CN101381774B - Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi - Google Patents

Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi Download PDF

Info

Publication number
CN101381774B
CN101381774B CN2008101579069A CN200810157906A CN101381774B CN 101381774 B CN101381774 B CN 101381774B CN 2008101579069 A CN2008101579069 A CN 2008101579069A CN 200810157906 A CN200810157906 A CN 200810157906A CN 101381774 B CN101381774 B CN 101381774B
Authority
CN
China
Prior art keywords
clostridium botulinum
isothermal amplification
mediated isothermal
loop
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2008101579069A
Other languages
Chinese (zh)
Other versions
CN101381774A (en
Inventor
雷质文
贺楠
祝素珍
贾俊涛
刘云国
张健
姜英辉
李正义
房保海
唐静
赵丽青
马维兴
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau
Original Assignee
Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau filed Critical Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau
Priority to CN2008101579069A priority Critical patent/CN101381774B/en
Publication of CN101381774A publication Critical patent/CN101381774A/en
Application granted granted Critical
Publication of CN101381774B publication Critical patent/CN101381774B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a rapid detection method for Clostridium botulinum by loop-mediated isothermal amplification. Reagents used by the method comprises a loop-mediated isothermal amplification reaction solution, a Bst DNA polymerase and a color development reagent, wherein the reaction solution contains reaction buffer, dNTP, magnesium sulfate, an upstream inner primer 5-GAGCCATAACCATTTCGCGTA-AGTTTGAATGTAAAAGCTTTGG-3, a downstream inner primer 5-GCCCAGATTTTACATTTGGTTTTGA-GTAGCAAATTTGCCTGCA-3, an upstream outer primer 5-AGTAATAATAGGACCCTCAGC-3, a downstream outer primer 5-TCATGTGCTAATGTTACTGC-3, and glycine betaine. The method for detection of A type Clostridium botulinum comprises the steps of DNA extraction of the Clostridium botulinum, loop-mediated isothermal amplification of the A type Clostridium botulinum, and chromogenic detection. The method has the advantages of rapidness, strong specificity, high sensitivity and low cost.

Description

Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi
Technical field
The present invention relates to a kind of method of utilizing ring mediated isothermal amplification (LAMP) technology to carry out the rapid detection of bacterium sample, specifically is a kind of A type loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi.
Background technology
Clostridium botulinum (Clostridium botulinum) belongs to the anaerobism genus clostridium, has the fundamental characteristics of this bacterium, promptly anaerobic rod bacterium, form the brood cell, the brood cell is wideer than propagulum, is the shuttle shape, gramstaining is positive, produces violent bacterial exotoxin, i.e. botulinus toxin.Botulinus toxin can cause the sausage poisoning of humans and animals, according to the antigenicity of botulinus toxin, and Clostridium botulinum existing so far A, B, C (1,2), D, E, seven types of F, G.Cause what the crowd poisoned, mainly contain A, B, E three types; C, D two type toxin mainly are the cause of diseases that poultry, poultry poison are poisoned; F, G type Clostridium botulinum seldom separate, and do not see that G type bacterium causes crowd's poisoning report.Clostridium botulinum extensively is present in nature, causes that the food of poisoning has sausage, ham, fish and fish product and tinned pre-etc.Take place to poison more in the U.S. with can, Japan is more with fish product, in China mainly based on leavened food, as bean curd with odor, broad bean paste, flour paste, fermented soya bean etc., other food that also causes poisoning also has: smoke the fish of internal organ, the eggplant that stuffs, oil immersion garlic, roast potato, sauteeing onions, bee product etc.Clostridium botulinum is one of the highest pathogenic agent of lethality, and infective dose is extremely low, everyone susceptible.The 18-36 hour sequela of ingesting is typical illness, but atypical can the grade to 8 days at 4 hours, symptom for weak, dizzy, follow vision Cheng Shuan, gradual speech impairment, breathing and dysphagia, finally cause paralysis, death.According to statistics, had 2305 people in the U.S. and poison to nineteen ninety in 1899, after testing, 303 people infect A type toxin, and 92 people infect the Type B poison, and 3 people infect E type toxin, and 2 people infect F type toxin, and it is to be caused by two kinds of toxin of A, B that 2 poisonings are arranged.And in China, the sausage poisoning incident that various places take place also mainly is A type and Type B.
The detection method of existing Clostridium botulinum and botulinus toxin has serology experiment, mice by intraperitoneal injection and neutralization test, ELISA to use double antibody sandwich method, PCR method etc. more, these methods respectively have superiority, but deficiency is also arranged, or required time is long or complex steps or cost are higher.And loop-mediated isothermal amplification method easily and fast, cost is low, is suitable for on-the-spot the detection, and good applicability is arranged, and has not yet to see the report that detects Clostridium botulinum with loop-mediated isothermal amplification method.
Summary of the invention
The purpose of this invention is to provide a kind of A type Clostridium botulinum ring mediated isothermal nucleic acid amplification method, overcoming the shortcoming of prior art, thereby provide the foundation and the directive function of science for aquaculture and food safety.
Cardinal principle of the present invention is: (1) particular design can be discerned six not homotactic two inner primers of target DNA (upstream inner primer and downstream inner primer) and two outer primers (upstream outer primer and downstream outer primer) for one group, and inner primer comprises the positive-sense strand and the antisense strand of target DNA; (2) one of them inner primer is at first hybridized with target DNA, strand displacement DNA subsequently synthesizes in the presence with the active archaeal dna polymerase of height strand displacement by an outer primer startup, discharge single stranded DNA, and, produce a primary stem circular DNA as an inner primer and the synthetic template of DNA that outer primer starts by the other end that hybridizes to target; (3) inner primer is done template with original stem circular DNA, starts the synthetic of strand displacement DNA, produces a primary stem circular DNA and the new stem circular DNA by twice stem length; (4) under isothermal condition, inner primer is a template with the stem circular DNA, forms a plurality of stem circular DNAs that contain the target DNA tumor-necrosis factor glycoproteins by strand displacement, and this circulating reaction can make target DNA be accumulated to 10 in one hour 9Copy can be observed amplification by fluorescence dye.
In the A type loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi that the present invention relates to, comprising reagent following (1)-(4):
(1) ring mediated isothermal amplification (LAMP) reaction solution:
Draw interior thing (FIP), 0.8-1.6 μ mol/L downstream inner primers (BIP), 0.2-0.3 μ mol/L upstream outer primer (F3), 0.2-0.3 μ mol/L downstream outer primer (B3) and 1-1.5mol/L trimethyl-glycine comprising 10 * Thermopol reaction buffer, 1.0-1.4mmol/L dNTP, 4-8mmol/L sal epsom (MgSO4), 0.8-1.6 μ mol/L upstreams;
The upstream inner primer:
5-GAGCCATAACCATTTCGCGTA-AGTTTGAATGTAAAAGCTTTGG-3、
The downstream inner primer:
5-GCCCAGATTTTACATTTGGTTTTGA-GTAGCAAATTTGCCTGCA-3、
Upstream outer primer: 5-AGTAATAATAGGACCCTCAGC-3,
Downstream outer primer: 5-TCATGTGCTAATGTTACTGC-3,
Wherein the mass ratio of four kinds of thymus nucleic acids in the mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.
Trihydroxy methyl aminomethane-the hydrochloric acid (Tris-HCl), 100mmol/L Repone K (KCl), 100mmol/L the ammonium sulfate ((NH that contain 200mmol pH8.8 in wherein said 10 * Thermopol reaction buffer 4) 2SO 4), 20mmol/L sal epsom (MgSO 4) and 1% Triton X-100 (Triton X-100);
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye SYBR GREEN I or DNAGreen.
Above the every pipe of described loop-mediated isothermal amplification liquid have 22 μ L, its best group becomes: 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L10 μ mol/L upstream inner primers (FIP), 4.0 μ L10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L10 μ mol/L downstream outer primer (B3), 2 μ L100mmol/L MgSO 4, 5 μ L5M trimethyl-glycines and 2.1 μ LddH 2O (sterilization distilled water).
Use mentioned reagent to detect the method for A type Clostridium botulinum, comprise the following steps successively (1)-(3):
(1) extraction of sample to be checked or DNA of bacteria:
Extract sample nucleic acid to be checked, wherein the sample DNA OD of Ti Quing 260/ OD 280In the 1.6-2.0 scope, concentration is in 10-100ng/ μ L scope;
(2) carry out the loop-mediated isothermal amplification of A type Clostridium botulinum:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 22 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 3-5min, place 1-3min on ice immediately for 95 ℃;
B. in reaction tubes, add 1 μ L Bst archaeal dna polymerase, and in water-bath 60-65 ℃ of amplified reaction 45-90min in the water bath with thermostatic control;
C. water-bath is transferred to 80-85 ℃ of termination reactions, is taken out to be checked behind 3-5min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked contains or is A type Clostridium botulinum.
The present invention be according to six sequences Design of A type Clostridium botulinum conserved regions two specificity inner primers and two specificity outer primers, this conservative gene sequence is that A type Clostridium botulinum is common, with the reliability of the A type Clostridium botulinum that guarantee to detect different sources.The present invention adopts loop-mediated isothermal amplification technique, this technology high specificity, with the PCR detection method identical highly sensitive is arranged, but do not need expensive PCR instrument, only need common water-bath get final product, and the result needn't observe with gel electrophoresis method, the use fluorescence dye is observed and is got final product, simple and quick, be specially adapted to basic medical unit.
Embodiment
The following example further specifies the present invention, but the restriction of the present invention of should not opposing.
Embodiment 1
Make the loop-mediated isothermal amplification liquid of A type Clostridium botulinum by following prescription:
(1) LAMP reaction solution:
Contain 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L10 μ mol/L upstream inner primers (FIP), 4.0 μ L10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L10 μ mol/L downstream outer primer (B3), 2 μ L100mmol/L MgSO 4, 5 μ L5M trimethyl-glycines and 2.1 μ LddH 2O (sterilization distilled water).
Wherein, described upstream inner primer:
5-GAGCCATAACCATTTCGCGTA-AGTTTGAATGTAAAAGCTTTGG-3、
The downstream inner primer:
5-GCCCAGATTTTACATTTGGTTTTGA-GTAGCAAATTTGCCTGCA-3、
Upstream outer primer: 5-AGTAATAATAGGACCCTCAGC-3,
Downstream outer primer: 5-TCATGTGCTAATGTTACTGC-3;
Wherein the mass ratio of four kinds of thymus nucleic acids in the mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye SYBR GREEN I.
Detect according to following (1)-(3) program:
(1) extraction of sample DNA
Detect bacterial classification A type Clostridium botulinum (Clostridium botulinum A), bacterial classification source Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL, numbering 62A.
Use the bacterial nucleic acid of sky, Beijing root bio-engineering corporation to extract test kit extraction sample DNA, DNA0D 260/ OD 280Can reach 1.8, concentration reaches 20ng/ μ L.
(2) carry out the loop-mediated isothermal amplification of A type Clostridium botulinum:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 22 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 5min, place 1min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ L Bst archaeal dna polymerase, and in water bath with thermostatic control 65 ℃ of amplified reactions 1 hour;
C. water-bath is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked is an A type Clostridium botulinum.
Embodiment 2
Make the loop-mediated isothermal amplification liquid of A type Clostridium botulinum by following prescription:
(1) LAMP reaction solution:
Contain 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L25mmol/L dNTP, 4.0 μ L10 μ mol/L upstream inner primers (FIP), 4.0 μ L10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L10 μ mol/L downstream outer primer (B3), 2 μ L100mmol/L MgSO 4, 5 μ L5mol/L trimethyl-glycines and 2.1 μ L ddH 2O (sterilization distilled water).
Wherein said upstream inner primer, downstream inner primer, upstream outer primer, downstream outer primer are the same.
The mass ratio of four kinds of thymus nucleic acids in the said mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye DNAGreen.
Detect according to following (1)-(3) program:
(1) acquisition of sample DNA
Detect bacterial classification A type Clostridium botulinum (Clostridium botulinum A), bacterial classification source Shandong Center for Disease Control ﹠ Prevention, numbering SDCDC9501.
Use the plant nucleic acid of Dalian Bao Bio-Engineering Company to extract test kit extraction sample DNA, DNA OD260/OD280 can reach 1.8, and concentration reaches 20ng/ μ L.
(2) carry out the loop-mediated isothermal amplification of A type Clostridium botulinum:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 22 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 5min, place 1min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ LBst archaeal dna polymerase, and in water bath with thermostatic control 65 ℃ of amplified reaction 1h;
C. water-bath is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, and sample then to be checked also is an A type Clostridium botulinum.
The nucleotides sequence tabulation
＜110〉Inspection and Quarantine Technology Center, Shandong Inspection and Quarantine
＜120〉loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi
<160>4
<210>1
<211>43
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(43)
<400>1
GAGCCATAACCATTTCGCGTA-AGTTTGAATGTAAAAGCTTTGG43
<210>2
<211>43
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(43)
<400>2
GCCCAGATTTTACATTTGGTTTTGA-GTAGCAAATTTGCCTGCA43
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(21)
<400>3
AGTAATAATAGGACCCTCAGC21
<210>4
<211>20
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(20)
<400>4
TCATGTGCTAATGTTACTGC20

Claims (1)

1. ring mediated isothermal amplification detects the reagent of Clostridium botulinum, it is characterized in that this reagent comprises (1)-(4):
(1) loop-mediated isothermal amplification liquid:
Comprise 10 * Thermopol reaction buffer, 1.0-1.4mmol/L dNTP, 4-8mmol/L sal epsom (MgSO4), 0.8-1.6 μ mol/L upstream inner primer (FIP), 0.8-1.6 μ mol/L downstream inner primer (BIP), 0.2-0.3 μ mol/L upstream outer primer (F3), 0.2-0.3 μ mol/L downstream outer primer (B3) and 1-1.5mol/L trimethyl-glycine; Wherein 10 * Thermopol reaction buffer contains trihydroxy methyl aminomethane-hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 of 200mmol/L pH8.8; Wherein, upstream inner primer:
5-GAGCCATAACCATTTCGCGTA-AGTTTGAATGTAAAAGCTTTGG-3；
The downstream inner primer:
5-GCCCAGATTTTACATTTGGTTTTGA-GTAGCAAATTTGCCTGCA-3；
Upstream outer primer: 5-AGTAATAATAGGACCCTCAGC-3;
Downstream outer primer: 5-TCATGTGCTAATGTTACTGC-3;
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye SYBR GREEN I or DNAGreen.
CN2008101579069A 2008-10-15 2008-10-15 Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi Expired - Fee Related CN101381774B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2008101579069A CN101381774B (en) 2008-10-15 2008-10-15 Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2008101579069A CN101381774B (en) 2008-10-15 2008-10-15 Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi

Publications (2)

Publication Number Publication Date
CN101381774A CN101381774A (en) 2009-03-11
CN101381774B true CN101381774B (en) 2011-01-26

Family

ID=40461825

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2008101579069A Expired - Fee Related CN101381774B (en) 2008-10-15 2008-10-15 Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi

Country Status (1)

Country Link
CN (1) CN101381774B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103497999B (en) * 2013-09-29 2015-03-04 杨波 Primer group and kit for loop-mediated isothermal amplification (LAMP) nucleic acid detection on clostridium botulinum
CN103740839B (en) * 2014-01-21 2015-08-05 北京亿森宝生物科技有限公司 The botulinal universal test kit of fluorescence quantitative PCR detection and nondiagnostic detection method
CN104561263A (en) * 2014-11-24 2015-04-29 河南师范大学 Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification
CN107435078A (en) * 2017-09-08 2017-12-05 银川安龙基因科技有限公司 A kind of method of clostridium botulinum viable bacteria in Visual retrieval food

Also Published As

Publication number Publication date
CN101381774A (en) 2009-03-11

Similar Documents

Publication Publication Date Title
CN101381775B (en) Loop-mediated isothermal amplification fast detection method of producing candida albicans fungi
CN101381774B (en) Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi
CN101255460A (en) Preparation and detection method of Bacterium typhosum rapid detection reagent kit
CN101381771B (en) Loop-mediated isothermal amplification fast detection method of producing ariatoxin fungi
Sweet et al. Assessment of the microbial communities associated with white syndrome and brown jelly syndrome in aquarium corals
CN101880709B (en) Salmonella enteritidis detection reagent kit and method based on loop-mediated isothermal amplification technology
CN101319249B (en) Fast detecting reagent kit for enterobacter sakazakii and detecting method thereof
CN104372099B (en) A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method
CN101386885A (en) Toxigenous commabacillus cholera vibrio ring mediated isothermal amplification rapid detection method
CN103276061B (en) Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof
CN101550445B (en) Preparation and test method of rapid test kit for roundup ready transgenic soybean and processed products thereof
Frias-Lopez et al. Identification of differential gene expression in bacteria associated with coral black band disease by using RNA-arbitrarily primed PCR
CN101020926A (en) Reagent kit and process for detecting cholera vibrio in circular mediated constant temperature amplification method
CN101875980A (en) Kit and method for detecting Macrobrachium rosenbergii Nodavirus
CN101200760A (en) Preparation and utilization method of yersinia genus rapid detection reagent kit
CN101307364A (en) Preparation of kit for rapidly detecting whit spot syndrome virus and detecting process
CN101255459A (en) Preparation and detection method of jejunum vibrio coli rapid detection reagent kit
CN105567864A (en) LAMP (loop-mediated isothermal amplification) detection primers and method of Listeria monocytogenes in food
CN101245375A (en) Method for producing and using trauma vibrio fast detection kit
Parnmen et al. Discrimination of lethal Russula subnigricans from wild edible and morphologically similar mushrooms in the genus Russula using SCAR markers
CN101381773B (en) Loop-mediated isothermal amplification fast detection method of producing potulin fungi
CN101200762B (en) Preparation and utilization method of staphylococcus glucose coccus rapid detection reagent kit
CN101200761B (en) Preparation and utilization method of clostridium perfringens rapid detection reagent kit
CN101403014A (en) Ring mediated isothermality amplification fast detecting method for norovirus
Zhang et al. Polymerase chain reaction-based methods for the rapid identification of Amanita exitialis

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20110126

Termination date: 20111015