CN107435078A - A kind of method of clostridium botulinum viable bacteria in Visual retrieval food - Google Patents
A kind of method of clostridium botulinum viable bacteria in Visual retrieval food Download PDFInfo
- Publication number
- CN107435078A CN107435078A CN201710802851.1A CN201710802851A CN107435078A CN 107435078 A CN107435078 A CN 107435078A CN 201710802851 A CN201710802851 A CN 201710802851A CN 107435078 A CN107435078 A CN 107435078A
- Authority
- CN
- China
- Prior art keywords
- clostridium botulinum
- viable bacteria
- primer
- lamp
- visual retrieval
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the invention discloses a kind of method of clostridium botulinum viable bacteria in Visual retrieval food, comprise the following steps that：According to the sequence that gene the preceding paragraphs of HA 70 of clostridium botulinum are highly conserved, LAMP primer, including a pair of inner primer FIP/BIP and a pair of outer primer F3/B3 are designed；1ml samples to be tested are added into PMA, the concentration for making PMA is 20 30 μM, is subsequently placed in dark place on ice and stands 6 10min, then with 650W halogen lamps in 15 20 centimeters, irradiation 5min；By the sample extraction DNA after processing, then using extract as template, LAMP amplifications are carried out；If white opacity precipitates, illustrate there is clostridium botulinum viable bacteria in sample.The present invention has the advantages that detection efficiency is high, risk control effect is good.
Description
Technical field
The present invention relates to field of gene detection, specifically in a kind of Visual retrieval food clostridium botulinum viable bacteria side
Method.
Background technology
Vahermengen in 1896 isolates clostridium botulinum (Clostridium botulinum) first, and confirms its energy
Grown in anaerobic environment, and exotoxin-botulinum toxin (Botulinum toxin) can be produced, clostridium botulinum specific features are
G+ bacteria, anaerobism, short and thick bacillus, its growth and breeding and production poison optimal temperature be 18~30 DEG C, 1910,
People are classified as seven types of A, B, C, D, E, F and G, wherein A, B, E, F according to the difference of clostridium botulinum and its Venom antigens
For people's poisoning type, C, D type are the poisoning type of animal and poultry.
Botulinum toxin intoxication is nervous system type poisoning, and people takes 0.1 μ g can be fatal, and the botulinum toxin 1mg of purifying can kill 200,000,000
Mouse, its pathogenesis of being poisoned are：The release that botulinum toxin can suppress nerve conduction medium-acetylcholine causes muscle numb
Numbness, severe person can also influence cranial nerve, and its symptom is mainly neurological symptom, using the symptom of symmetry cranial nerve lesion as spy
Sign, such as eye-blurred, ptosis, diplopia, mydriasis, aphasis, dysphagia, expiratory dyspnea, continuing development can be by
Cause respiratory failure and dead in paralysis of respiratory muscle, clostridium botulinum food poisoning is most serious in food posioning
It is a kind of.
Clostridium botulinum is distributed widely in soil, mud and animal wastes, and wherein soil is important pollution sources, and it can be by
Food, crops, fruit, marine product, insect, birds etc. travel to everywhere.Food is in processing, storage by clostridium botulinum
Pollute, and produce toxin, the food with toxin is not heated again before food or not heated fully, thus cause poisoning.In China
The botulinum toxin intoxication of generation and the eating habit of some areas have much relations, mainly it is edible preserve improperly meat products and
Beans cereal fermented food.
The detection method of present clostridium botulinum thalline is mainly PCR (PCR), but traditional PCR detections are not
Viable bacteria and dead bacterium can be distinguished, is unfavorable for prevention and control and risk assessment to pathogenic bacteria, experiment in addition needs thermal cycle, as a result
Also there are other detecting steps, operate more complicated.
The content of the invention
The technical problems to be solved by the invention are to overcome the pre- prevention and control of the prior art being unfavorable for pathogenic bacteria
System, unhandy defect, and the method that clostridium botulinum viable bacteria in a kind of Visual retrieval food is provided.
The present invention solves the technical scheme that above-mentioned technical problem provides：The invention discloses a kind of Visual retrieval food
The method of middle clostridium botulinum viable bacteria, is comprised the following steps that：
(1), according to the highly conserved sequence of HA-70 gene the preceding paragraphs of clostridium botulinum, LAMP primer, including a pair are designed
Inner primer FIP/BIP and a pair of outer primer F3/B3；
(2) 1ml samples to be tested, are added into PMA, the concentration for making PMA is 20-30 μM, is subsequently placed in dark place on ice and stands 6-
10min, then with 650W halogen lamps in 15-20 centimeters, irradiation 5min；
(3), by the sample extraction DNA after processing, then using extract as template, LAMP amplifications are carried out；
(4), if white opacity precipitates, illustrate there is clostridium botulinum viable bacteria in sample.
Preferably, in described step (1), designed using the online softwares of Primer Explorer version 4.0
LAMP primer.
Preferably, in described step (1), described inner primer FIP particular sequence is
CTGAGAAACACCACCAGACCATTATCGTATATTCTTGAGAGAAAAGTGTA,
Described inner primer BIP particular sequence is TGCTACCAGATGTATTTGTCTCAATGGCGATGGATATATGAG
AACAA,
Described outer primer F3 particular sequence is GCATCGTTAAGTCTTGCTTC,
Described outer primer B3 particular sequence is CAATACTTCCTTATCCTAATGGATT.
Preferably, in described step (3), sample extraction DNA method is：
Sample is added into 1ml cell pyrolysis liquids and 100mg/ml Proteinase Ks, 2 hours of 56 DEG C of water-baths, every half an hour
Shake up once, add 700 μ l mixed liquors, wherein phenol in mixed liquor：Chloroform：Isoamyl alcohol is 25：24：Under the conditions of 1,12000rpm,
15min is centrifuged, takes supernatant, then up the sodium acetate of clear interior 0.1 times of supernatant volume of addition and the absolute ethyl alcohol of 2 times of volumes ,-
Under conditions of 20 DEG C, 2 hours are stood, after there is precipitation, under the conditions of 12000rpm, 10min is centrifuged, abandons supernatant, add 70% second
Alcohol, mix, under the conditions of 7500rpm, 5min, then supernatant is abandoned, stand, after air-drying, add eluent to dissolve.
Preferably, in described step (3), LAMP reaction systems are 50 μ l：Bst strand displacement polymerases 8U (2 μ l), mould
Plate (4 μ l), 10 × Thermopol (5 μ l), MgSO4 10mM (3 μ l), dNTPs 1.5mM (7 μ l), F3/B3 (2 μ l/2 μ l),
FIP/BIP (2 μ l/2 μ l), MLV enzymes 10U (2 μ l), are finally mended to 50 μ l with DEPC water.
Preferably, in described step (3), the reaction condition of LAMP amplified reactions is：65 DEG C of incubations of water-bath or PCR instrument
1h, then 80 DEG C of heat inactivation 5min of Bst strand displacements polymerase.
Compared with prior art, the present invention has following advantageous benefits：
The present invention cardinal principle be：4 species-specific primers are designed for 6 regions of target gene, are polymerize in strand displacement DNA
In the presence of enzyme (Bst DNA polymerase), 60-65 DEG C of constant-temperature amplification, or so 30-60 minutes can be achieved 109~1010
The nucleic acid amplification of copy, have the characteristics that simple to operate, high specificity, product easily detect, when DNA is synthesized, from deoxyribose
Magnesium ion reaction in the pyrophosphate ion and reaction solution that are separated out in nucleic acid triphosphoric acid substrate (dNTPs), produces a large amount of burnt phosphorus
Sour magnesium precipitate, white is presented, therefore, can be using turbidity as the index reacted, the white opacity that only detects by an unaided eye precipitation, just
It can identify and whether expand, without cumbersome electrophoresis and ultraviolet visualization, the present invention uses fluorescent dye PMA simultaneously
(Propidium Monoazide), PMA are a kind of light reaction dyestuffs of DNA high-affinities, and dyestuff can be embedded in dead cell double-strand
D8NA, if covalent attachment can be formed under strong visible ray, chemical modification DNA is formed, prevents DNA from expanding
Reaction, so as to suppress LAMP amplifications, it can effectively distinguish dead bacterium and bacterium living.
In summary, the method for Visual retrieval clostridium botulinum viable bacteria of the present invention, simple to operate, high sensitivity,
Strong technical support is provided to detect pathogenic bacteria in food.
Brief description of the drawings
Fig. 1 is the experimental result picture in embodiment 1；
Fig. 2 is the electrophoresis detection result figure of LAMP amplified productions.
Embodiment
The invention discloses a kind of method of clostridium botulinum viable bacteria in Visual retrieval food, comprise the following steps that：
(1), according to the highly conserved sequence of HA-70 gene the preceding paragraphs of clostridium botulinum, LAMP primer, including a pair are designed
Inner primer FIP/BIP and a pair of outer primer F3/B3；
(2) 1ml samples to be tested, are added into PMA, the concentration for making PMA is 20-30 μM, is subsequently placed in dark place on ice and stands 6-
10min, then with 650W halogen lamps in 15-20 centimeters, irradiation 5min；
(3), by the sample extraction DNA after processing, then using extract as template, LAMP amplifications are carried out；
(4), if white opacity precipitates, illustrate there is clostridium botulinum viable bacteria in sample.
Preferably, in described step (1), designed using the online softwares of Primer Explorer version 4.0
LAMP primer.
Preferably, in described step (1), described inner primer FIP particular sequence is
CTGAGAAACACCACCAGACCATTATCGTATATTCTTGAGAGAAAAGTGTA,
Described inner primer BIP particular sequence is TGCTACCAGATGTATTTGTCTCAATGGCGATGGATATATGAG
AACAA,
Described outer primer F3 particular sequence is GCATCGTTAAGTCTTGCTTC,
Described outer primer B3 particular sequence is CAATACTTCCTTATCCTAATGGATT.
Preferably, in described step (3), sample extraction DNA method is：
Sample is added into 1ml cell pyrolysis liquids and 100mg/ml Proteinase Ks, 2 hours of 56 DEG C of water-baths, every half an hour
Shake up once, add 700 μ l mixed liquors, wherein phenol in mixed liquor：Chloroform：Isoamyl alcohol is 25：24：Under the conditions of 1,12000rpm,
15min is centrifuged, takes supernatant, then up the sodium acetate of clear interior 0.1 times of supernatant volume of addition and the absolute ethyl alcohol of 2 times of volumes ,-
Under conditions of 20 DEG C, 2 hours are stood, after there is precipitation, under the conditions of 12000rpm, 10min is centrifuged, abandons supernatant, add 70% second
Alcohol, mix, under the conditions of 7500rpm, 5min, then supernatant is abandoned, stand, after air-drying, add eluent to dissolve.
Preferably, in described step (3), LAMP reaction systems are 50 μ l：Bst strand displacement polymerases 8U (2 μ l), mould
Plate (4 μ l), 10 × Thermopol (5 μ l), MgSO4 10mM (3 μ l), dNTPs 1.5mM (7 μ l), F3/B3 (2 μ l/2 μ l),
FIP/BIP (2 μ l/2 μ l), MLV enzymes 10U (2 μ l), are finally mended to 50 μ l with DEPC water.
Preferably, in described step (3), the reaction condition of LAMP amplified reactions is：65 DEG C of incubations of water-bath or PCR instrument
1h, then 80 DEG C of heat inactivation 5min of Bst strand displacements polymerase.
The method that the present invention provides clostridium botulinum viable bacteria in a kind of quick detection food, not only solving existing PCR methods can not
Effective district is divided the problem of clostridium botulinum viable bacteria and dead bacterium, and experimentation does not need other special instruments, as a result can basis
Amplified reaction directly judges.Due to 4 species-specific primers that the present invention designs for 6 regions of target sequence, appoint in 6 regions
What, which is mismatched with primer at one, can not carry out nucleic acid amplification, therefore the accuracy of experimental result is higher than traditional PCR methods.
Embodiment 1
(1), according to the HA-70 gene (Genbank accession numbers of clostridium botulinum：AB037166.1) the preceding paragraph is highly conserved
Sequence, LAMP primer, including a pair of inner primer FIP/ are designed using the online softwares of Primer Explorer version 4.0
BIP and a pair of outer primer F3/B3, described inner primer FIP particular sequence are
CTGAGAAACACCACCAGACCATTATCGTATATTCTTGAGAGAAAAGTGTA,
Described inner primer BIP particular sequence is TGCTACCAGATGTATTTGTCTCAATGGCGATGGATATATGAG
AACAA,
Described outer primer F3 particular sequence is GCATCGTTAAGTCTTGCTTC,
Described outer primer B3 particular sequence is CAATACTTCCTTATCCTAATGGATT；
(2) 1ml samples to be tested, are added into PMA, the concentration for making PMA is 25 μM, is subsequently placed in dark place on ice and stands 6-
10min, then with 650W halogen lamps in 16 centimeters, irradiation 7min；
(3) sample after processing, is done into DNA extractions, then using extract as template, carries out LAMP amplifications；
Sample is added into 1ml cell pyrolysis liquids and 100mg/ml Proteinase Ks, 2 hours of 56 DEG C of water-baths, every half an hour
Shake up once, add 700 μ l mixed liquors, wherein phenol in mixed liquor：Chloroform：Isoamyl alcohol is 25：24：Under the conditions of 1,12000rpm,
15min is centrifuged, takes supernatant, then up the sodium acetate of clear interior 0.1 times of supernatant volume of addition and the absolute ethyl alcohol of 2 times of volumes ,-
Under conditions of 20 DEG C, 2 hours are stood, after there is precipitation, under the conditions of 12000rpm, 10min is centrifuged, abandons supernatant, add 70% second
Alcohol, mix, under the conditions of 7500rpm, 5min, then supernatant is abandoned, stand, after air-drying, add eluent to dissolve；
LAMP reaction systems are 50 μ l：Bst strand displacement polymerases 8U (2 μ l), template (4 μ l), 10 × Thermopol (5 μ
L), MgSO4 10mM (3 μ l), dNTPs 1.5mM (7 μ l), F3/B3 (2 μ l/2 μ l), FIP/BIP (2 μ l/2 μ l), MLV enzymes 10U
(2 μ l), finally mended with DEPC water to 50 μ l；
The reaction condition of LAMP amplified reactions is：65 DEG C of water-bath or PCR instrument are incubated 1h, then Bst strand displacements polymerase 80
DEG C heat inactivation 5min；
(4), result judges：If white opacity precipitates, illustrate there is clostridium botulinum viable bacteria in sample, experimental result is as schemed
Shown in 1, No. 1 pipe is negative control (template is purified water)；No. 2 pipes are the work bacterium without PMA processing；At No. 3 Guan Weijing PMA
The dead bacterium solution of reason；The living bacterial liquid of No. 4 Guan Weijing PMA processing；LAMP reactions do not occur for wherein No. 3 pipes, illustrate that PMA can suppress dead
The LAMP amplifications of bacterium；
(5), the electrophoresis detection of LAMP amplified productions
Above-mentioned 1-4 pipes are taken into 5 μ l LAMP amplified productions respectively, mixed with Loading buffer, point sample is dense in quality
Spend in the Ago-Gel for 2%, with 100V voltages in 1 × TAE electrophoretic buffers electrophoresis 30min, then in gel imaging
It is imaged in system, that is, completes detection.
As a result as shown in Fig. 2 M is DNA Marker, swimming lane 1 is negative control (template is purified water), swimming lane 2 be without
The work bacterium of PMA processing；Swimming lane 3 is the dead bacterium solution handled through PMA；Swimming lane 4 is the living bacterial liquid handled through PMA；As a result show
The swimming lane 2 and swimming lane 4 of clostridium botulinum viable bacteria have a band, and experimental result is consistent with step 4.
The above-described embodiments merely illustrate the principles and effects of the present invention, not for the limitation present invention.It is any ripe
Know the personage of this technology all can carry out modifications and changes under the spirit and scope without prejudice to the present invention to above-described embodiment.Cause
This, those of ordinary skill in the art is complete without departing from disclosed spirit and institute under technological thought such as
Into all equivalent modifications or change, should by the present invention claim be covered.
Claims (6)
1. a kind of method of clostridium botulinum viable bacteria in Visual retrieval food, it is characterised in that：Comprise the following steps that：
(1), according to the highly conserved sequence of HA-70 gene the preceding paragraphs of clostridium botulinum, design and draw in LAMP primer, including one pair
Thing FIP/BIP and a pair of outer primer F3/B3；
(2) 1ml samples to be tested, are added into PMA, the concentration for making PMA is 20-30 μM, is subsequently placed in dark place on ice and stands 6-
10min, then with 650W halogen lamps in 15-20 centimeters, irradiation 5min；
(3), by the sample extraction DNA after processing, then using extract as template, LAMP amplifications are carried out；
(4), if white opacity precipitates, illustrate there is clostridium botulinum viable bacteria in sample.
2. the method for clostridium botulinum viable bacteria in a kind of Visual retrieval food according to claim 1, it is characterised in that：Institute
In the step of stating (1), LAMP primer is designed using the online softwares of Primer Explorer version 4.0.
3. the method for clostridium botulinum viable bacteria in a kind of Visual retrieval food according to claim 1, it is characterised in that：Institute
In the step of stating (1), described inner primer FIP particular sequence is
CTGAGAAACACCACCAGACCATTATCGTATATTCTTGAGAGAAAAGTGTA,
Described inner primer BIP particular sequence is TGCTACCAGATGTATTTGTCTCAATGGCGATGGATATATGAGAACA
A,
Described outer primer F3 particular sequence is GCATCGTTAAGTCTTGCTTC,
Described outer primer B3 particular sequence is CAATACTTCCTTATCCTAATGGATT.
4. the method for clostridium botulinum viable bacteria in a kind of Visual retrieval food according to claim 1, it is characterised in that：Institute
In the step of stating (3), sample extraction DNA method is：
Sample is added into 1ml cell pyrolysis liquids and 100mg/ml Proteinase Ks, 2 hours of 56 DEG C of water-baths, shaken up every half an hour
Once, 700 μ l mixed liquors, wherein phenol in mixed liquor are added：Chloroform：Isoamyl alcohol is 25：24：Under the conditions of 1,12000rpm, centrifugation
15min, supernatant is taken, then up the sodium acetate of clear interior 0.1 times of supernatant volume of addition and the absolute ethyl alcohol of 2 times of volumes, at -20 DEG C
Under conditions of, 2 hours are stood, after there is precipitation, under the conditions of 12000rpm, 10min is centrifuged, abandons supernatant, add 70% ethanol, mix
It is even, under the conditions of 7500rpm, 5min, then supernatant is abandoned, stand, after air-drying, add eluent to dissolve.
5. the method for clostridium botulinum viable bacteria, its feature exist in a kind of Visual retrieval food according to claim 1 or 4
In：In described step (3), LAMP reaction systems are 50 μ l：Bst strand displacement polymerases 8U (2 μ l), template (4 μ l), 10 ×
Thermopol(5μl)、MgSO4 10mM(3μl)、dNTPs 1.5mM(7μl)、F3/B3(2μl/2μl)、FIP/BIP(2μl/2μ
L), MLV enzymes 10U (2 μ l), finally mended with DEPC water to 50 μ l.
6. the method for clostridium botulinum viable bacteria, its feature exist in a kind of Visual retrieval food according to claim 1 or 4
In：In described step (3), the reaction condition of LAMP amplified reactions is：65 DEG C of water-bath or PCR instrument are incubated 1h, and then Bst chains are put
Change 80 DEG C of heat inactivation 5min of polymerase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710802851.1A CN107435078A (en) | 2017-09-08 | 2017-09-08 | A kind of method of clostridium botulinum viable bacteria in Visual retrieval food |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710802851.1A CN107435078A (en) | 2017-09-08 | 2017-09-08 | A kind of method of clostridium botulinum viable bacteria in Visual retrieval food |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107435078A true CN107435078A (en) | 2017-12-05 |
Family
ID=60461539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710802851.1A Pending CN107435078A (en) | 2017-09-08 | 2017-09-08 | A kind of method of clostridium botulinum viable bacteria in Visual retrieval food |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107435078A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008140832A2 (en) * | 2007-01-11 | 2008-11-20 | Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Method for rapid detection of clostridium botulinum |
| CN101381774A (en) * | 2008-10-15 | 2009-03-11 | 山东出入境检验检疫局检验检疫技术中心 | Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi |
| CN103497999A (en) * | 2013-09-29 | 2014-01-08 | 杨波 | Primer group and kit for loop-mediated isothermal amplification (LAMP) nucleic acid detection on clostridium botulinum |
| US8790899B2 (en) * | 2009-09-01 | 2014-07-29 | Richard A. Robison | Real-time PCR assays for rapid detection and differentiation of the Clostridium botulinum toxin genes A, B, E, and F |
-
2017
- 2017-09-08 CN CN201710802851.1A patent/CN107435078A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008140832A2 (en) * | 2007-01-11 | 2008-11-20 | Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Method for rapid detection of clostridium botulinum |
| CN101381774A (en) * | 2008-10-15 | 2009-03-11 | 山东出入境检验检疫局检验检疫技术中心 | Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi |
| US8790899B2 (en) * | 2009-09-01 | 2014-07-29 | Richard A. Robison | Real-time PCR assays for rapid detection and differentiation of the Clostridium botulinum toxin genes A, B, E, and F |
| CN103497999A (en) * | 2013-09-29 | 2014-01-08 | 杨波 | Primer group and kit for loop-mediated isothermal amplification (LAMP) nucleic acid detection on clostridium botulinum |
Non-Patent Citations (3)
| Title |
|---|
| 吴莹莹: "实时可视化PMA-LAMP方法检测三种食源性微生物活菌方法研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
| 李冰冰 等: "《生化与分子生物学实验指导》", 31 August 2014, 中国矿业大学出版社 * |
| 谭贵良 等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014, 中山大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434891A (en) | Method for rapidly detecting Shigella at constant temperature, primers used for method and kit | |
| CN102154451B (en) | Loop-mediated isothermal amplification detection primer group, detection method and detection kit for enterobacter sakazakii | |
| CN103498000B (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| CN106367413A (en) | Nucleic acid amplification method and application | |
| CN106893787A (en) | Differentiate bifluorescence RT LAMP detection primers group, kit and its application of foot and mouth disease virus and vesicular stomatitis virus | |
| Grenda et al. | Clostridium botulinum spores in Polish honey samples | |
| CN112646904A (en) | Detection method of Burkholderia gladioli and acid-produced strain of Miermentaria, fluorescent PCR primer and probe for detection | |
| Ramazanzadeh et al. | Molecular characterization of Vibrio cholerae Isolated from clinical samples in Kurdistan province, Iran | |
| US8609375B2 (en) | Method for detecting viable cells in a sample by using a virus | |
| CN102242216B (en) | Fluorescent PCR (polymerase chain reaction) detection kit for vibrio cholerae and systematic identification method thereof | |
| Lee et al. | Lateral flow biosensor based on LAMP-CRISPR/Cas12a for sensitive and visualized detection of Salmonella spp. | |
| Milton et al. | Novel saltatory rolling circle amplification assay for rapid and visual detection of Campylobacter jejuni in chicken meat | |
| CN101768636B (en) | Composition and kit for detecting vibrio cholerae and detection method | |
| CN106367493A (en) | Method for rapidly detecting salmonella at constant temperature, primer and applications of primer | |
| CN106755462A (en) | A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN107435078A (en) | A kind of method of clostridium botulinum viable bacteria in Visual retrieval food | |
| CN103602727B (en) | Detection primer set, detection kit and detection method for rapidly detecting Ralstonia solanacearum | |
| CN103014156A (en) | Loop mediated isothermal amplification detection primer group, detection method and kit for enterococcus faecalis | |
| CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production | |
| CN116121408A (en) | Site visualization kit for detecting listeria monocytogenes based on CRISPR/Cas12a and application | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| CN104498487B (en) | One group of nucleotide sequence and the application in listeria ivanovii identification | |
| CN106367501A (en) | Method for rapidly detecting salmonella at constant temperature, primer and kit | |
| CN106434900A (en) | Method for conducting rapid constant-temperature detection on vibrio vulnificus and vibrio cholerae simultaneously, primer and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171205 |