CN106755462A - A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application - Google Patents
A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application Download PDFInfo
- Publication number
- CN106755462A CN106755462A CN201710017193.5A CN201710017193A CN106755462A CN 106755462 A CN106755462 A CN 106755462A CN 201710017193 A CN201710017193 A CN 201710017193A CN 106755462 A CN106755462 A CN 106755462A
- Authority
- CN
- China
- Prior art keywords
- pasteurella multocida
- primer
- detection
- isothermal amplification
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Ring mediated isothermal amplification detection primer composition, detection box and its application the present invention relates to a kind of ox pasteurella multocida, belong to Bacteria Detection technical field.A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, is made up of positive inner primer FIP, reverse inner primer BIP, forward direction outer primer F3 and reverse outer primer B3, wherein, the sequence of each primer is respectively：FIP：GCCACAAGCCAAATAAAAGACTACCAAATGGCATTATTTTATGGCTCG, BIP：AGCACAGTTTTGTTGGGCAGAAAATAACGTCCAATCAGTTGC, F3：CGCGAAATTGAGTTTTATGC, B3：CAAGGAAATATAAACCGGCAA.Detection method is quick, sensitive high, accuracy is good.
Description
Technical field
The present invention relates to Bacteria Detection technical field, and in particular to a kind of ring mediated isothermal of ox pasteurella multocida expands
Increase detection primer composition, detection box and its application.
Background technology
Ox pasteurella multocida（Pasteurella multocida）It is Pasteurella section Pasteurella member, leather
Lan Shi negative bacteriums, basis of microscopic observation is short and small shaft-like or spherical, two ends blunt circle, no flagellum, does not form gemma.It is biochemical
Characteristic is aerobic or amphimicrobian, the requirement to nutrition are higher；Decomposable asymmetric choice net mannose, glucose, sucrose and fructose, product acid are not produced
Gas.Encapsulated bacterial strain better resistance, is more common in the new isolated strains of clinical pathological material of disease.The bacterium easy infection monthly age less calf, draws
Play endemic newborn calf pneumonia, transporting hot or wean ox pneumonia；The generation of these diseases is generally adjoint in actual production
Various stress factors, such as unfavorable climatic effect, bad nutrition condition, long-distance transport.Especially the bacterium is in acute
Hueppe's disease can be shown as during infection, causes ill domestic animal dead rapidly.At present according to the pod membrane seroreaction of bacterium by the bacterium
A, B, D, E and F5 kind capsular serotypes can be divided into, wherein it is A, B and E type clinically to have to ox pathogenic.To 2006 annual reports
Since road separates A type bacterial strains, China other area such as Tianjin, Ningxia, the Inner Mongol, Xinjiang, Hubei, Jilin and Shandong ground also phase
A type bacterial strains are separated after report, has shown China from the north to middle part all in the presence of the prevalence of the disease.Because the disease is to the danger of cattle-raising
Evil is very big, therefore diagnosis to the disease is just particularly important.
Traditional ox pasteurella multocida detection method is mainly separation and the phase that bacterium is carried out by laboratory techniques
The biochemical identification of pass, serological Identification；Standard PCR identification, nested PCR identification and quantitative fluorescent PCR mirror were also occurred in that in recent years
It is fixed.These methods are often present needs the limitation of precision instrument and special experiment condition, constrains and now applies.Therefore, set up
A kind of strong detection technique of practical application in basic unit's popularization and application, with very strong clinical meaning.
Ring mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology is a kind of
Novel constant temperature nucleic acid amplification method, it is a kind of sensitive strand displacement technology, can be incited somebody to action under constant temperature and in the short time
Target dna is expanded to 10 from several copies9~1010Copy.The general principle of LAMP technology is directed to 6 regions of target sequence, if
4 specific primers of meter, using a kind of archaeal dna polymerase-Bst DNA polymerase with strand-displacement activity in isothermal bar
Reacted under part.One group of primer on same chain is sequentially annealed to target sequence, in the presence of strand displacement archaeal dna polymerase,
The primer of step annealing replaces the chain that above primer is formed afterwards.Displacement occurs on two chains, and the requirement to design of primers is
Cyclic structure can be formed.Reaction is carried out under constant temperature, and the denaturation of chain is produced by strand displacement.LAMP reacts and to form one and be
The DNA of row different length loop-stem structure judges whether to expand again by specific method.The method has fast and easy, operation letter
The features such as list, sensitiveness high, strong applicability, accurate result, and very low to the instrument requirements used by experiment, one common
Water-bath can just complete all experimentss reaction.
In order to realize quick, the accurate and simple checkout and diagnosis of ox pasteurella multocida, a kind of profit of necessary offer
The method that ox pasteurella multocida is detected with LAMP technology.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of ring mediated isothermal amplification inspection of ox pasteurella multocida
Survey method, quickly and accurately can detect to doubtful sample, with overcome existing method on Clinical practicability not
Foot.
In order to solve the above technical problems, the technical solution adopted in the present invention is：
A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, by positive inner primer FIP, reversely in
Primer BIP, forward direction outer primer F3 and reverse outer primer B3 are constituted, wherein, the sequence of each primer is respectively：
FIP：GCCACAAGCCAAATAAAAGACTACCAAATGGCATTATTTTATGGCTCG,
BIP：AGCACAGTTTTGTTGGGCAGAAAATAACGTCCAATCAGTTGC,
F3：CGCGAAATTGAGTTTTATGC,
B3：CAAGGAAATATAAACCGGCAA.
Ring mediated isothermal amplification detection primer composition the invention provides above-mentioned ox pasteurella multocida is in detection
Application in ox pasteurella multocida.
A kind of loop-mediated isothermal amplification detection kit of ox pasteurella multocida, comprising detection solution, every 24 μ L inspections
Surveying solution includes：
The μ L of 10 × Thermo Pol reaction buffers 2.5
1.0 μm of ol/L of positive inner primer FIP
1.0 μm of ol/L of reverse inner primer BIP
0.4 μm of ol/L of positive outer primer F3
0.4 μm of ol/L of reverse outer primer B3
MgSO4 1.0mmol/L
dNTP 1.6nmol/L
Bst archaeal dna polymerases 320000U/L
Colour reagent 3mmol/L
DEPC water complements to 24 μ L,
Wherein, the sequence of each primer is respectively：
FIP：GCCACAAGCCAAATAAAAGACTACCAAATGGCATTATTTTATGGCTCG,
BIP：AGCACAGTTTTGTTGGGCAGAAAATAACGTCCAATCAGTTGC,
F3：CGCGAAATTGAGTTTTATGC,
B3：CAAGGAAATATAAACCGGCAA.
Preferably, the colour reagent is hydroxynaphthol blue, is added before isothermal amplification reactions.
Loop-mediated isothermal amplification detection kit the invention provides above-mentioned ox pasteurella multocida is more in detection ox
Application in killing property Pasteurella.
Ox is detected the invention provides the loop-mediated isothermal amplification detection kit using above-mentioned ox pasteurella multocida
The method of pasteurella multocida, comprises the following steps：
Step S1：When original samples be liquid sample when, take the liquid sample 1mL under the conditions of 12000rpm/min from
Risen after heart 2min and discard supernatant, then be centrifuged with the resuspended precipitations of mL of PBS 1, under the conditions of 12000rpm/min after 2min again
Discard supernatant；Then precipitation is blown using 100 μ L PBSs after hanging, takes 1 μ L as sample template DNA；When original pathological material of disease
When sample is solid sample, the lesion of the solid sample and the tissue 0.5g of normal intersection are taken, add 10 times of PBS bufferings
Sterile gauze filtering after the aseptic grinding of liquid, freeze thawing 2 times, then at the method by the filtrate of acquisition using aforementioned liquids sample
Reason, obtains sample template DNA；
Step S2：Take the detection solution in the sample template DNA 24 μ L loop-mediated isothermal amplification detection kits of addition of 1 μ L, 62
DEG C isothermal reaction 1 hour；
Step S3：Observing response terminates the color change of rear solution, and positive findings is shown as sky blue, and negative findings is shown as purple
Color.
Preferably, the sample template DNA, is the infected animal tissue sample of suspected infection ox pasteurella multocida
Genome.
Compared with prior art, beneficial effects of the present invention are as follows：
4 primers designed using LAMP technology are directed to 6 different regions respectively, and any one mismatches reaction cannot just enter
OK.4 primers designed by the present invention：Positive inner primer FIP, reverse inner primer BIP, positive outer primer F3, reverse outer primer
B3, respectively for 6 isolated areas on target sequence.Wherein positive inner primer is FIP, including F1c sections（With target sequence
F1c sections are identical）, F2 sections（F2c sections with target sequence are identical）With TTTT connexons；Positive outer primer is
The F3c section complete complementaries of F3, the gene and target sequence；Reverse inner primer BIP, including B1c sections（With the B1c areas of target sequence
Section is identical）, B2 sections（B2c sections with target sequence are identical）With TTTT connexons；Reverse outer primer B3, with target sequence
B3c section complete complementaries on row.4 primers designed by the present invention are directed to 6 different regions on target sequence respectively, so that
Ensure the strong specificity of reaction.
The loop-mediated isothermal amplification detection method of ox pasteurella multocida of the present invention, including sample template DNA is extracted, profit
Ring mediated isothermal amplification is carried out with the loop-mediated isothermal amplification (LAMP) primer composition；Hydroxynaphthol blue (hydroxyl
Naphthol blue, HNB) belong to one kind of Metal ion indicator.HNB is Mg2+Titrant, its color is with pH value of solution
Change and change, therefore can be by monitoring Mg in loop-mediated isothermal amplification system2+Change and the pH value of solution of concentration and rise
To the effect of color indicator.HNB is added in reaction solution before reaction, reaction system is in purple, Mg in course of reaction2+With ring
The accessory substance P of mediated isothermal amplification2O7 4-Largely precipitated with reference to producing, Mg in solution2+Concentration reduction, pH changes, from
And the color of HNB is changed into sky blue from purple.Therefore, reaction judges ox after terminating by the color change of reaction system
The presence or absence of pasteurella multocida：Sky blue represents test positive, there is ox pasteurella multocida；Purple represents detection knot
Fruit is feminine gender, in the absence of ox pasteurella multocida.
1）Strong specificity：The present invention is using the loop-mediated isothermal amplification detection kit of ox pasteurella multocida to extracting
Ox pasteurella multocida, ox source staphylococcus aureus, ox source Streptococcusagalactiae and ox source genome of E.coli, while
Ring mediated isothermal amplification experiment is carried out, and negative control is set.Amplification shows with other bacteriums（Ox source Staphylococcus aureus
Bacterium, ox source Streptococcusagalactiae and ox source genome of E.coli）There is no positive amplification during as template.Ring mediated isothermal of the present invention
Augmentation detection Primer composition has specificity to ox pasteurella multocida.
2）Hypersensitivity：Using the loop-mediated isothermal amplification detection kit and Standard PCR pair of ox pasteurella multocida
The sample of doubling dilution is detected, as a result shown：The ring mediated isothermal amplification detection examination of ox pasteurella multocida of the present invention
Agent box can detect 10 CFU/mL, and the method for standard PCR amplification is only able to detect 1000 CFU/mL.As can be seen here, this hair
The loop-mediated isothermal amplification detection kit of the ox pasteurella multocida of bright offer has sensitiveness higher.
3）Rapidity：Reaction time and detection time of the relatively conventional PCR reaction up to a few hours, the present invention only need 1 small
When can complete whole reaction and result judgement.
4）Operability：Relatively conventional PCR, the ring mediated isothermal amplification detection reagent of ox pasteurella multocida of the present invention
Box does not need expensive PCR instrument, it is only necessary to which a simple thermostat water bath can complete reaction；And the detection of result can be straight
Connect naked eyes to judge, without using specific apparatus such as gel electrophoresises.Therefore kit of the present invention has stronger existing ground operability.
Detection method of the invention is quick, sensitive high, accuracy is good, easy to operate, and its remolding sensitivity Standard PCR is high by 100
Times, testing result can be observed directly by naked eyes, can be suspected infection as the specific detection of ox pasteurella multocida
The quick diagnosis of the infected animal tissue sample of ox pasteurella multocida provide a kind of new method, with reality very high
With value.
Brief description of the drawings
The present invention is described in further detail below in conjunction with the accompanying drawings.
Fig. 1 is the specific detection result of loop-mediated isothermal amplification（Gel detection figure）, wherein, 1：Negative control；
2：Ox pasteurella multocida；3：Ox source staphylococcus aureus；4：Ox source Streptococcusagalactiae；5：Ox source Escherichia coli；
Fig. 2 is the sensitivity Detection result of loop-mediated isothermal amplification（Directly visually observed after adding HNB）, wherein, 1：It is cloudy
Property control, amplified production is shown as purple；2：1 CFU/mL, amplified production is shown as purple；3：10 CFU/mL, amplified production
It is shown as sky blue；4：102CFU/mL, amplified production is shown as sky blue；5：103CFU/mL, amplified production is shown as sky blue
Color；6：104CFU/mL, amplified production is shown as sky blue；
Fig. 3 is the sensitivity Detection result of conventional PCR method（Gel detection figure）, wherein, 1：Negative control；2：1 CFU/mL；
3：10 CFU/mL；4：102CFU/mL；5：103CFU/mL；6：104 CFU/mL。
Specific embodiment
For a better understanding of the present invention, present disclosure, but this hair are further fairly set out with reference to embodiment
Bright protection content is not limited solely to the following examples.
1st, material prepares
Ox pasteurella multocida（Pasteurella multocida CVCC1667）, ox source staphylococcus aureus
（staphylococcus aureus CVCC3050）, ox source Streptococcusagalactiae（streptococcus agalactiae
CVCC1886）, ox source Escherichia coli（Escherichia coli CVCC1299）Purchased from Chinese veterinary microorganism culture presevation pipe
Reason center.Bst archaeal dna polymerases and 10 × Thermo Pol reaction buffers（Purchased from New England Biolabs companies）,
dNTP（Purchased from Clontech companies）、Mg2+（Purchased from Vazyme companies）.
2nd, design of primers and synthesis
With reference to the gene order of the ox pasteurella multocida delivered at present, for the gene KMT1 of ox pasteurella multocida
Conservative region, wherein, KMT1 gene orders as shown in sequence 1 in sequence table, using PrimerExplorer V4 online softwares
http://primerexplorer.jp/elamp4.0.0/index.html is designed for detecting ox pasteurella multocida
LAMP primer, wherein, LAMP primer includes：Positive inner primer FIP and reverse inner primer BIP, positive outer primer F3 are outer with reverse
Primer B3, primer sequence difference is as follows：
FIP： GCCACAAGCCAAATAAAAGACTACCAAATGGCATTATTTTATGGCTCG；
BIP：AGCACAGTTTTGTTGGGCAGAAAATAACGTCCAATCAGTTGC；
F3：CGCGAAATTGAGTTTTATGC；
B3：CAAGGAAATATAAACCGGCAA.
The primer for completing is designed by the deep fast biosynthesis in Suzhou.
The sequence of positive inner primer FIP is as shown in sequence 2 in sequence table；In the sequence of reverse inner primer BIP such as sequence table
Shown in sequence 3；The sequence of positive outer primer F3 is as shown in sequence 4 in sequence table；In the sequence of reverse outer primer B3 such as sequence table
Shown in sequence 5.
3rd, the extraction of sample gene group
When original samples are liquid sample, take the liquid sample 1mL and 2min is centrifuged under the conditions of 12000rpm/min
After rise and discard supernatant, then with the resuspended precipitations of mL of PBS 1, discarded again after 2min is centrifuged under the conditions of 12000 rpm/min
Supernatant；Then precipitation is blown using 100 μ L PBSs after hanging, takes 1 μ L as sample template DNA；
When original samples are solid sample, the lesion of the solid sample and the tissue 0.5g of normal intersection are taken, plus
Enter 10 times of the aseptic grinding of PBS, then the filtrate of acquisition is used aforementioned liquids by sterile gauze filtering after freeze thawing 2 times
The method of sample is processed, and obtains sample template DNA.
4th, the foundation of ox pasteurella multocida LAMP reaction systems
LAMP reaction systems, in terms of 25 μ L, including following component：
The μ L of 10 × Thermo Pol reaction buffers 2.5
1.0 μm of ol/L of positive inner primer FIP
1.0 μm of ol/L of reverse inner primer BIP
0.4 μm of ol/L of positive outer primer F3
0.4 μm of ol/L of reverse outer primer B3
MgSO4 1.0mmol/L
dNTP 1.6nmol/L
Bst archaeal dna polymerases 320000U/L
Hydroxynaphthol blue 3mmol/L
The μ L of sample template DNA 1
DEPC water complements to 25 μ L.
It is positioned over after said components are mixed in PCR instrument or 62 DEG C of constant temperature is acted on 1 hour in water-bath；After reaction terminates
Gel detection or Visual retrieval can be carried out, result is judged.
5th, the optimization of ox pasteurella multocida LAMP detection kit condition
5.1 primer concentrations optimize
With pair of primers as variable in the LAMP reaction systems of 25 μ L, other reaction substrate compositions are identical, successively to FIP with
BIP（0.4μmol/L、0.6μmol/L、0.8μmol/L、1.0μmol/L、1.2μmol/L、1.4μmol/L、1.6μmol/L、1.8
μmol/L、2.0μmol/L）, F3 and B3（0.05μmol/L、0.1μmol/L、0.2μmol/L、0.3μmol/L、0.4μmol/L、
0.5μmol/L、0.6μmol/L）These two pair primer carries out concentration gradient optimization, and each concentration is repeated 3 times, after reaction terminates,
Carry out 2% agarose gel electrophoresis detection.
5.2 proliferation times optimize
Configuration LAMP reaction systems, sample sets 3 repetitions under each time conditions, reacts 30 in thermostat water bath respectively
Taken out after min, 45 min, 60 min, 75 min, carry out 2% agarose gel electrophoresis detection.
The optimization of 5.3 amplification temperature
Configuration LAMP reaction systems, sample sets 3 repetitions under each temperature conditions, respectively 60 DEG C of different temperatures, 61 DEG C, 62
DEG C, 63 DEG C, 64 DEG C, 65 DEG C reaction 1 hour after take out, carry out 2% agarose gel electrophoresis detection.
5.4 Mg²+Concentration optimization
To Mg2+Concentration set gradient be 0.6 mmol/L, 0.8 mmol/L, 1.0 mmol/L, 1.2 mmol/L, 1.4
Mmol/L, sets 3 repetitions under each concentration gradient.After the reaction of all concentration gradients terminates, 2% Ago-Gel electricity is carried out
Swimming detection.
5.5 Bst archaeal dna polymerase concentration optimizations
Concentration to Bst archaeal dna polymerases is optimized, and its gradient is set to 160000 U/L, 320000 U/L, 480000 U/
L, 640 000U/L, 800000 U/L, each concentration gradient set 3 repetitions.After the reaction of all concentration gradients terminates, enter
The agarose gel electrophoresis of row 2% is detected.
The specific test of 5.6 LAMP reactions
With clinically common ox bacteriosis：Ox source staphylococcus aureus, ox source Streptococcusagalactiae and ox source large intestine bar
The genome of bacterium extracts the genome of above-mentioned three kinds of bacteriums as detection object, and carries out ring mediated isothermal expansion as template
Increase to verify the specificity of its reaction, it is as a result shown in Figure 1.
Result shows, when there is LAMP amplified reactions, produces substantial amounts of magnesium pyrophosphate white precipitate to cause reaction solution
Turbidity rises, by the way that shown in the chromogenic reaction result of HNB, the reaction tube of ox pasteurella multocida is in sky blue, and it is positive
As a result；And other ox source staphylococcus aureuses, ox source Streptococcusagalactiae, ox source Escherichia coli and negative control bacterium reaction tube are equal
It is negative findings in purple, it was demonstrated that designed LAMP specific primers have the specificity planted.This illustrates that the primer is combined
Thing can be used for the fast and reliable detection box identification of ox pasteurella multocida in samples in production practices.
The sensitivity tests of 5.7 LAMP reactions
The ox pasteurella multocida liquid of known CFU values is taken, is then diluted with PBS, make it be respectively equivalent to contain
There are 1 CFU/mL, 10CFU/mL, 100 CFU/mL, 1000 CFU/mL, 10000 CFU/mL, then extract above-mentioned five groups of oxen many
The genome of killing property Pasteurella, and it is divided into two parts, a part is detected with LAMP kit；Another part Standard PCR side
Method detects, both testing results is compared, to verify its sensitiveness reacted, as a result referring to shown in Fig. 2 ~ 3.
Refering to Fig. 2, LAMP kit testing result shows：The amplified production of negative control group is shown as purple；1 CFU/
The amplified production of mL is shown as purple；The amplified production of 10 CFU/mL is shown as sky blue；102The amplified production of CFU/mL shows
It is shown as sky blue；103The amplified production of CFU/mL is shown as sky blue；104The amplified production of CFU/mL is shown as sky blue.
Refering to Fig. 3, conventional PCR method testing result shows：Negative control group is without specific amplification products；1 CFU/mL without
Specific amplification products；10 CFU/mL are without specific amplification products；102 CFU/mL is without specific amplification products；103 CFU/mL
There are specific amplification products in 600bp or so；104 There are specific amplification products in 600bp or so in CFU/mL.
The testing result of above two method is compared：The detection threshold value of LAMP kit is 10CFU/mL, and normal
The detection threshold value for advising PCR is then 103CFU/mL；Show that LAMP detection method detection sensitivity is 100 times of Standard PCR, can
Pathological material of disease is more efficiently detected, the accuracy of clinical diagnosis is improved.
The accordance of 5.8 LAMP practical applications
63 Nasal swabs for suffering from respiratory tract infected cattle of clinical acquisitions.The genome of sample is extracted, the LAMP of foundation is utilized respectively
Detection method is detected with conventional PCR method.Compare by testing result in above method practical application, verify LAMP realities
The accordance of border application.
6th, the optimum results of ox pasteurella multocida LAMP method
6.1 optimization systems and condition
By the optimization of above-mentioned condition, the LAMP of the last optimization of the loop-mediated isothermal amplification kit of ox pasteurella multocida
System, in terms of 25 μ L, be：
The μ L of 10 × Thermo Pol reaction buffers 2.5
1.0 μm of ol/L of positive inner primer FIP
1.0 μm of ol/L of reverse inner primer BIP
0.4 μm of ol/L of positive outer primer F3
0.4 μm of ol/L of reverse outer primer B3
MgSO4 1.0mmol/L
dNTP 1.6nmol/L
Bst archaeal dna polymerases 320000U/L
Hydroxynaphthol blue 3mmol/L
The μ L of sample template DNA 1
DEPC water complements to 25 μ L.
Reaction condition is 62 DEG C and reacts 1 hour.
6.2 Ns of accordances of the loop-mediated isothermal amplification kit of pasteurella multocida
Loop-mediated isothermal amplification kit and conventional PCR method using ox pasteurella multocida enter to the 63 parts of samples for obtaining
Row detection, as a result finds the recall rate of the loop-mediated isothermal amplification kit of ox pasteurella multocida（23/63）It is significantly higher than
Conventional PCR method（13/63）, and the positive of conventional PCR method detection can be by the ring of ox pasteurella multocida Jie
Lead isothermal amplification kit detection.
Finally illustrate, the above embodiments are merely illustrative of the technical solutions of the present invention and it is unrestricted, this area is common
Other modifications or equivalent that technical staff is made to technical scheme, without departing from technical solution of the present invention
Spirit and scope, all should cover in the middle of scope of the presently claimed invention.
SEQUENCE LISTING
<110>Nanyang Normal College
<120>A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application
<130> 2017
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 431
<212> DNA
<213>Ox pasteurella multocida（Pasteurella multocida）
<400> 1
acccagtggg gcggtgcgaa tgaaccgatt gccgcgaaat tgagttttat gccacttgaa 60
atgggaaatg gcattatttt atggctcgtt gtgagtgggc ttgtcggtag tcttttattt 120
ggcttgtggc aaagaaaagc acagttttgt tgggcagagt ttggtgtgtt gagccaatct 180
gcttccttga caacggcgca actgattgga cgttatttat tactcagctt attgttattt 240
gccggtttat atttccttgt cagtctgatt tatcaatatt tccatgttga gttacgtttc 300
ttatggccat tattgaagcc ttaacggtag agcggtttaa tttatttatc gtgtattggt 360
tacctatttt ggtctttttc ttcgtgttca acggtttgat cgtgtcagtc caaatgaaac 420
aaaaagtggc g 431
<210> 2
<211> 48
<212> DNA
<213>Artificial sequence
<400> 2
gccacaagcc aaataaaaga ctaccaaatg gcattatttt atggctcg 48
<210> 3
<211> 42
<212> DNA
<213>Artificial sequence
<400> 3
agcacagttt tgttgggcag aaaataacgt ccaatcagtt gc 42
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
cgcgaaattg agttttatgc 20
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence
<400> 5
caaggaaata taaaccggca a 21
Claims (7)
1. the ring mediated isothermal amplification detection primer composition of a kind of ox pasteurella multocida, it is characterised in that：By just inside
Primers F IP, reverse inner primer BIP, forward direction outer primer F3 and reverse outer primer B3 composition, wherein, the sequence of each primer is respectively：
FIP：GCCACAAGCCAAATAAAAGACTACCAAATGGCATTATTTTATGGCTCG,
BIP：AGCACAGTTTTGTTGGGCAGAAAATAACGTCCAATCAGTTGC,
F3：CGCGAAATTGAGTTTTATGC,
B3：CAAGGAAATATAAACCGGCAA.
2. the ring mediated isothermal amplification detection primer composition of ox pasteurella multocida as claimed in claim 1 is in detection ox
Application in pasteurella multocida.
3. a kind of loop-mediated isothermal amplification detection kit of ox pasteurella multocida, it is characterised in that：Comprising detection solution,
Every 24 μ L detections solution includes：
The μ L of 10 × Thermo Pol reaction buffers 2.5
1.0 μm of ol/L of positive inner primer FIP
1.0 μm of ol/L of reverse inner primer BIP
0.4 μm of ol/L of positive outer primer F3
0.4 μm of ol/L of reverse outer primer B3
MgSO4 1.0mmol/L
dNTP 1.6nmol/L
Bst archaeal dna polymerases 320000U/L
Colour reagent 3mmol/L
DEPC water complements to 24 μ L,
Wherein, the sequence of each primer is respectively：
FIP：GCCACAAGCCAAATAAAAGACTACCAAATGGCATTATTTTATGGCTCG,
BIP：AGCACAGTTTTGTTGGGCAGAAAATAACGTCCAATCAGTTGC,
F3：CGCGAAATTGAGTTTTATGC,
B3：CAAGGAAATATAAACCGGCAA.
4. the loop-mediated isothermal amplification detection kit of ox pasteurella multocida as claimed in claim 3, it is characterised in that：
The colour reagent is hydroxynaphthol blue, is added before isothermal amplification reactions.
5. the loop-mediated isothermal amplification detection kit of the ox pasteurella multocida as described in claim 3 or 4 is in detection ox
Application in pasteurella multocida.
6. using the loop-mediated isothermal amplification detection kit detection of the ox pasteurella multocida as described in claim 3 or 4
The method of ox pasteurella multocida, it is characterised in that：Comprise the following steps：
Step S1：When original samples be liquid sample when, take the liquid sample 1mL under the conditions of 12000rpm/min from
Risen after heart 2min and discard supernatant, then be centrifuged with the resuspended precipitations of mL of PBS 1, under the conditions of 12000rpm/min after 2min again
Discard supernatant；Then precipitation is blown using 100 μ L PBSs after hanging, takes 1 μ L as sample template DNA；When original pathological material of disease
When sample is solid sample, the lesion of the solid sample and the tissue 0.5g of normal intersection are taken, add 10 times of PBS bufferings
Sterile gauze filtering after the aseptic grinding of liquid, freeze thawing 2 times, then at the method by the filtrate of acquisition using aforementioned liquids sample
Reason, obtains sample template DNA；
Step S2：The sample template DNA for taking 1 μ L adds the detection in loop-mediated isothermal amplification detection kit described in 24 μ L molten
Liquid, 62 DEG C of isothermal reactions 1 hour；
Step S3：Observing response terminates the color change of rear solution, and positive findings is shown as sky blue, and negative findings is shown as purple
Color.
7. the loop-mediated isothermal amplification detection kit detection ox using ox pasteurella multocida as claimed in claim 6 is more
The method of killing property Pasteurella, it is characterised in that：The sample template DNA, is the trouble of suspected infection ox pasteurella multocida
The genome of sick animal tissue's sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710017193.5A CN106755462A (en) | 2017-01-11 | 2017-01-11 | A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710017193.5A CN106755462A (en) | 2017-01-11 | 2017-01-11 | A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106755462A true CN106755462A (en) | 2017-05-31 |
Family
ID=58949091
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710017193.5A Pending CN106755462A (en) | 2017-01-11 | 2017-01-11 | A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755462A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660192A (en) * | 2018-05-31 | 2018-10-16 | 广西壮族自治区兽医研究所 | A kind of LAMP primer group of quick detection Mannheimia haemolytica and its application |
| CN109628622A (en) * | 2019-02-02 | 2019-04-16 | 广西壮族自治区兽医研究所 | A kind of real-time quantitative LAMP primer group and kit detecting pasteurella multocida |
| CN110218819A (en) * | 2019-06-14 | 2019-09-10 | 广西壮族自治区兽医研究所 | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease |
| CN110885892A (en) * | 2019-11-01 | 2020-03-17 | 拱北海关技术中心 | Method for detecting pasteurella multocida, primers and probe thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892175A (en) * | 2010-02-26 | 2010-11-24 | 中国农业科学院哈尔滨兽医研究所 | Bovine capsular serotype A Pasteurella mutocida, validation identification and application thereof |
| CN104073567A (en) * | 2014-07-18 | 2014-10-01 | 昆明滇龙生物医药科技有限公司 | Gene diagnosis kit and detection method for major cattle pathogenic bacteria-Pasteurella multocida |
-
2017
- 2017-01-11 CN CN201710017193.5A patent/CN106755462A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892175A (en) * | 2010-02-26 | 2010-11-24 | 中国农业科学院哈尔滨兽医研究所 | Bovine capsular serotype A Pasteurella mutocida, validation identification and application thereof |
| CN104073567A (en) * | 2014-07-18 | 2014-10-01 | 昆明滇龙生物医药科技有限公司 | Gene diagnosis kit and detection method for major cattle pathogenic bacteria-Pasteurella multocida |
Non-Patent Citations (2)
| Title |
|---|
| DONGBO SUN等: "Development of a novel LAMP diagnostic method for visible detection of swine Pasteurella multocida", 《VET RES COMMUN》 * |
| 于新友等: "牛多杀性巴氏杆菌和牛支原体双重PCR检测方法的建立及应用", 《中国奶牛》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660192A (en) * | 2018-05-31 | 2018-10-16 | 广西壮族自治区兽医研究所 | A kind of LAMP primer group of quick detection Mannheimia haemolytica and its application |
| CN109628622A (en) * | 2019-02-02 | 2019-04-16 | 广西壮族自治区兽医研究所 | A kind of real-time quantitative LAMP primer group and kit detecting pasteurella multocida |
| CN110218819A (en) * | 2019-06-14 | 2019-09-10 | 广西壮族自治区兽医研究所 | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease |
| CN110885892A (en) * | 2019-11-01 | 2020-03-17 | 拱北海关技术中心 | Method for detecting pasteurella multocida, primers and probe thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021164050A1 (en) | Multi-target double-dye isothermal amplification rapid detection method and kit | |
| CN106755462A (en) | A kind of ring mediated isothermal amplification detection primer composition of ox pasteurella multocida, detection box and its application | |
| CN102816847A (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN104212901A (en) | Composition for detecting drug resistance of staphylococcus aureus | |
| CN104830988B (en) | Salmonella typhimurium specificity LAMP primer group and LAMP detection method | |
| CN105219874A (en) | The PSR detection method of Pseudomonas aeruginosa and primer special thereof and test kit | |
| CN104263841B (en) | The real-time fluorescence LAMP detection method of black shank bacterium and test kit in potato | |
| CN101792794B (en) | Real-time fluorescence PCR ( Polymerase Chain Reaction) kit for detecting shigella and detection method thereof | |
| Gilling et al. | The identification and differentiation between Burkholderia mallei and Burkholderia pseudomallei using one gene pyrosequencing | |
| Song et al. | The establishment and application of a semi-nested PCR assay for the detection of Mycoplasma ovis | |
| CN108315451B (en) | Primer and probe for detecting clostridium perfringens and application thereof | |
| CN116377118A (en) | Multiplex PCR detection method for three pathogenic bacteria of Solanaceae and application thereof | |
| CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production | |
| CN104630328B (en) | Mycoplasma pneumoniae 23S rRNA 2064 site A:G mutation detection specific primer and probe | |
| CN104711351A (en) | Specific primer combination for detecting streptococcus pyogenes based on loop-mediated isothermal amplification method and application of specific primer combination | |
| CN108060244A (en) | A kind of nucleotide sequence and application for mycobacterium tuberculosis complex detection | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| CN104726568A (en) | Penicillium marneffei LAMP (loop-mediated isothermal amplification) kit and application thereof | |
| CN107326094A (en) | The kit and its detection method of chicken rhinitis type Klebsiella are detected based on ring mediated isothermal amplification | |
| CN103911434A (en) | Loop-mediated isothermal amplification (LAMP) detection primer group of aeromonas veronii, and kit | |
| CN108570510A (en) | LAMP primer, kit and detection method for detecting haemophilus parasuis | |
| CN100485044C (en) | Method of duplex fluorescence PCR - improved molecule beacon for detecting pathogenesis bacterium stemmed from eating source | |
| CN110157819B (en) | LAMP kit for rapidly detecting Salmonella indiana in livestock and poultry feces | |
| Clark et al. | The continuously expanding universe of Entamoeba |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |