CN101403014A - Ring mediated isothermality amplification fast detecting method for norovirus - Google Patents
Ring mediated isothermality amplification fast detecting method for norovirus Download PDFInfo
- Publication number
- CN101403014A CN101403014A CNA200810157904XA CN200810157904A CN101403014A CN 101403014 A CN101403014 A CN 101403014A CN A200810157904X A CNA200810157904X A CN A200810157904XA CN 200810157904 A CN200810157904 A CN 200810157904A CN 101403014 A CN101403014 A CN 101403014A
- Authority
- CN
- China
- Prior art keywords
- norovirus
- isothermal amplification
- mediated isothermal
- checked
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a rapid detection method of the loop-mediated isothermal amplification of a G II type norovirus. Reagents thereof comprise a reaction solution of the loop-mediated isothermal amplification, Bst DNA polymerase and a color development agent; wherein, the reaction solution comprises a reaction buffer solution, dNTP, bitter salt, an upstream inner primer 5-CGGGCTCCAGAGCCATAACCT-ACGCCAACCCATCTGATG-3, a downstream inner primer 5-GTGGCGGGCCAACAAAACGTA-CACTGTGAACTCTCCACCAG-3, an upstream outer primer 5-GTGAATGAAGATGGCGTCGA-3 and a downstream outer primer 5-CTGGAGCGTTTCTAGGGGA-3, and lycine. The detection method of the G II type norovirus includes the extraction of bacterial RNA, the loop-mediated isothermal amplification of the G II type norovirus, and color development detection. The method has the advantages of fast speed, strong specificity, high sensitivity and low cost.
Description
Technical field
The present invention relates to a kind of method of utilizing ring mediated isothermal amplification (LAMP) technology to carry out the rapid detection of bacterium sample, specifically is a kind of G II type norovirus loop-mediated isothermal amplification fast detection method.
Background technology
Norovirus (Norovirus, the virion that NV) be one group of plesiomorphism, antigenicity is slightly different.Norwalk virus is the prototype representative strains of this genus, be isolating cause of disease patient's ight soil of an acute diarrhea breaking out in U.S. C city from nineteen sixty-eight the earliest, after this, in gastro-enteritis patient ight soil, isolate variform all over the world successively similarly but the slightly different virus-like particle of antigenicity, all name with the location, as: HawaiiVirus (HV), Snow Mountain Virus (SMV), Mexico Virus (MxV) Southampton Virus (SOV) etc., August in 2002, the 8th ICNV's approved name was called norovirus.The main circulation way of norovirus is a fecal oral route, propagation such as water source that also can be by polluting, food, article, air.Because patient's vomitus and ight soil can form aerosol, can infect with contact patients.Inapparent infection person and healthy carrier all can be contagium, and patient's vomitus and ight soil are easy to cause and break out at occurring in nature polluted water or indirect pollution food.Its cardinal symptom for feel sick, vomiting, stomachache and diarrhoea, the child patient vomiting is general, adult patient diarrhoea is many, diarrhoea is 4～8 times in the 24h, ight soil be rare water just or watery stool, no mucus purulence blood, excrement is examined the white corpuscle feminine gender.In addition, have a headache, slightly generate heat, shiver and myalgia also is a common sympton, dehydration appears in severe patient.NV member is numerous and jumbled, its more than 100 strain isolateds is carried out gene sequencing at present.The homology analysis of nucleic acid shows, different areas, the world, different time popular NV gene RNA polymerase region sequence are conservative relatively, and the nucleotide amino acid sequence homology is higher than 60%, and what have reaches more than 90%.Therefore, according to the similarity of RNA polymerase region nucleotide sequence, NLV is divided into 5 genomes, wherein infected person comprise genome I, II and IV: genome I, with Norwalk virus (NV) is representative, comprises Southampton (SOV), Desert Shield virus (DSV) etc.; Genome II with Snow Mountain virus (SMV) representative, comprises Hawaii Virus (HV), Mexico Virus (MxV), Lordsdale virus (LV) etc.; The infection of China's norovirus is G II type basically, and G I type is more rare.
The detection method of existing norovirus mainly contains direct electron microscopy, immunoelectron microscopic method, radioimmunology, euzymelinked immunosorbent assay (ELISA) and RT-PCR etc., but directly electron microscopy sensitivity is lower; Immunoelectron microscopic method is highly sensitive, but cost is also very high; The radioimmunology required time is long, and needs labelled with radioisotope; The euzymelinked immunosorbent assay (ELISA) range of application is narrower; RT-PCR sensitivity, accurate, but the high problem of cost is also arranged.And loop-mediated isothermal amplification method can remedy these deficiencies preferably, has not yet to see the report that detects norovirus with loop-mediated isothermal amplification method.
Summary of the invention
The purpose of this invention is to provide a kind of G II type norovirus loop-mediated isothermal amplification fast detection method, overcoming the shortcoming of prior art, thereby provide the foundation and the directive function of science for aquaculture and food safety.
Cardinal principle of the present invention is: (1) particular design can be discerned six not homotactic two inner primers of target DNA (upstream inner primer and downstream inner primer) and two outer primers (upstream outer primer and downstream outer primer) for one group, and inner primer comprises the positive-sense strand and the antisense strand of target DNA; (2) one of them inner primer is at first hybridized with target DNA, strand displacement DNA subsequently synthesizes in the presence with the active archaeal dna polymerase of height strand displacement by an outer primer startup, discharge single stranded DNA, and, produce a primary stem circular DNA as an inner primer and the synthetic template of DNA that outer primer starts by the other end that hybridizes to target; (3) inner primer is done template with original stem circular DNA, starts the synthetic of strand displacement DNA, produces a primary stem circular DNA and the new stem circular DNA by twice stem length; (4) under isothermal condition, inner primer is a template with the stem circular DNA, forms a plurality of stem circular DNAs that contain the target DNA tumor-necrosis factor glycoproteins by strand displacement, and this circulating reaction can make target DNA be accumulated to 10 in one hour
9Copy can be observed amplification by fluorescence dye.
The G II type norovirus loop-mediated isothermal amplification fast detection method that the present invention relates to, comprising reagent following (1)-(5):
(1) ring mediated isothermal amplification (LAMP) reaction solution:
Draw interior thing (FIP), 0.8-1.6 μ mol/L downstream inner primer (BIP), 0.2-0.3 μ mol/L upstream outer primer (F3), 0.2-0.3 μ mol/L downstream outer primer (B3) and 1-1.5mol/L trimethyl-glycine comprising 10 * Thermopol reaction buffer, 1.0-1.4mmol/L dNTP, 4-8mmol/L sal epsom (MgSO4), 0.8-1.6 μ mol/L upstream;
The upstream inner primer:
5-CGGGCTCCAGAGCCATAACCT-ACGCCAACCCATCTGATG-3、
The downstream inner primer:
5-GTGGCGGGCCAACAAAACGTA-CACTGTGAACTCTCCACCAG-3、
Upstream outer primer: 5-GTGAATGAAGATGGCGTCGA-3,
Downstream outer primer: 5-CTGGAGCGTTTCTAGGGGA-3,
Wherein the mass ratio of four kinds of thymus nucleic acids in the mixture dNTP is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1.
Trihydroxy methyl aminomethane-the hydrochloric acid (Tris-HCl), 100mmol/L Repone K (KCl), 100mmol/L the ammonium sulfate ((NH that contain 200mmol pH8.8 in wherein said 10 * Thermopol reaction buffer
4)
2SO
4), 20mmol/L sal epsom (MgSO
4) and 1% triton x-100 (Triton X-100);
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4)ReverTra?Ace：100U/μL；
(5) developer: be 10% fluorescence dye SYBR GREEN I or DNAGreen.
Above the every pipe of described ring mediated isothermal amplification (LAMP) reaction solution have 21 μ L, its best group becomes: 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L 25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L, 10 μ mol/L upstream inner primers (FIP), 4.0 μ L, 10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L, 10 μ mol/L downstream outer primers (B3), 1.5 μ L 100mmol/LMgSO
4, 5 μ L 5M trimethyl-glycines and 1.6 μ L ddH
2O (sterilization distilled water).
Use aforesaid method to detect GII type norovirus, comprise the following steps successively (1)-(3):
(1) extraction of sample to be checked or viral RNA:
Extract sample nucleic acid to be checked, wherein the sample RNA OD of Ti Quing
260/ OD
280In the 1.6-2.0 scope, concentration is in 10-100ng/ μ L scope.
(2) carry out the loop-mediated isothermal amplification of GII type norovirus:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 21 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 3-5min, place 1-3min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ L Bst archaeal dna polymerase and 1 μ L ReverTra Ace, and in water-bath 60-65 ℃ of amplified reaction 45-90min in the water bath with thermostatic control;
C. water-bath is transferred to 80-85 ℃ of termination reaction, is taken out to be checked behind the 3-5min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked contains or is GII type norovirus.
The present invention is that the RNA polymerase region sequence according to GII type norovirus has designed two specificity inner primers and two specificity outer primers, this conservative gene sequence is that GII type norovirus is common, detects the reliability of the GII type norovirus of different sources with assurance.The present invention adopts ring mediated isothermal amplification (LAMP) technology, this technology high specificity, with the PCR detection method identical highly sensitive is arranged, but do not need expensive PCR instrument, only need common water-bath get final product, and the result needn't observe with gel electrophoresis method, the use fluorescence dye is observed and is got final product, simple and quick, be specially adapted to basic medical unit.
Embodiment
The following example further specifies the present invention, but the restriction of the present invention of should not opposing.
Embodiment 1
Make the loop-mediated isothermal amplification liquid of GII type norovirus by following prescription:
(1) LAMP reaction solution:
Contain 2.5 μ L, 10 * Thermopol reaction buffer, 1.4 μ L 25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L, 10 μ mol/L upstream inner primers (FIP), 4.0 μ L, 10 μ mol/L downstream inner primers (BIP), 0.5 μ L, 10 μ mol/L upstream outer primers (F3), 0.5 μ L, 10 μ mol/L downstream outer primers (B3), 1.5 μ L 100mmol/L MgSO
4, 5 μ L 5M trimethyl-glycines and 1.6 μ L ddH
2O (sterilization distilled water).
Wherein said upstream inner primer:
5-CGGGCTCCAGAGCCATAACCT-ACGCCAACCCATCTGATG-3、
The downstream inner primer:
5-GTGGCGGGCCAACAAAACGTA-CACTGTGAACTCTCCACCAG-3、
Upstream outer primer: 5-GTGAATGAAGATGGCGTCGA-3,
Downstream outer primer: 5-CTGGAGCGTTTCTAGGGGA-3
Wherein the mass ratio of four kinds of thymus nucleic acids in the mixture dNTP is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1.
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4)ReverTra?Ace：100U/μL；
(5) developer: be 10% fluorescence dye SYBR GREEN I.
Detect according to following (1)-(3) program:
(1) extraction of sample DNA:
(NV, GII), CDC virus precaution control institute in strain source numbers NLVSCHN4300 to detect strain GII type norovirus.
Use TIANamp virus genom DNA/RNA of sky, Beijing root bio-engineering corporation to extract test kit extraction sample RNA, RNA OD
260/ OD
280Can reach 1.8, concentration reaches 20ng/ μ L.
(2) carry out the loop-mediated isothermal amplification of G II type norovirus:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 21 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 5min, place 1min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ L Bst archaeal dna polymerase and 1 μ L ReverTra Ace, and in water bath with thermostatic control 65 ℃ of amplified reactions 1 hour;
C. water-bath is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3min;
(3) color developing detection:
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked is a GII type norovirus.
Embodiment 2
Make the loop-mediated isothermal amplification liquid of GII type norovirus by following prescription:
(1) LAMP reaction solution:
Contain 2.5 μ L, 10 * Thermopol reaction buffer, 1.4 μ L 25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L, 10 μ mol/L upstream inner primers (FIP), 4.0 μ L, 10 μ mol/L downstream inner primers (BIP), 0.5 μ L, 10 μ mol/L upstream outer primers (F3), 0.5 μ L, 10 μ mol/L downstream outer primers (B3), 1.5 μ L 100mmol/L MgSO
4, 5 μ L 5M trimethyl-glycines and 1.6 μ L ddH
2O (sterilization distilled water).
Wherein said upstream inner primer, downstream inner primer, upstream outer primer, downstream outer primer are the same.
The mass ratio of four kinds of thymus nucleic acids in the said mixture dNTP is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1.
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4)ReverTra?Ace：100U/μL；
(5) developer: be 10% fluorescence dye DNAGreen.
Detect according to following (1)-(3) program:
(1) extraction of sample DNA:
(NV, GII), strain source Japanese national transmissible disease institute numbers NV-GII to detect strain GII type norovirus.
Use a small amount of viral DNA/RNA of Dalian Bao Bio-Engineering Company to extract test kit extraction sample RNA, RNAOD
260/ OD
280Can reach 1.8, concentration reaches 20ng/ μ L.
(2) carry out the loop-mediated isothermal amplification of GII type norovirus:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 21 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 5min, place 1min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ L Bst archaeal dna polymerase and 1 μ L ReverTra Ace, and in water bath with thermostatic control 65 ℃ of amplified reaction 1h;
C. water-bath is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3min;
(3) color developing detection;
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, and sample then to be checked also is a GII type norovirus.
The nucleotides sequence tabulation
＜110〉Inspection and Quarantine Technology Center, Shandong Inspection and Quarantine
＜120〉norovirus loop-mediated isothermal amplification fast detection method
<160>4
<210>1
<211>39
<212>RNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(39)
<400>1
CGGGCTCCAGAGCCATAACCT-ACGCCAACCCATCTGATG 39
<210>2
<211>41
<212>RNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(41)
<400>2
GTGGCGGGCCAACAAAACGTA-CACTGTGAACTCTCCACCAG 41
<210>3
<211>20
<212>RNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(20)
<400>3
GTGAATGAAGATGGCGTCGA 20
<210>4
<211>19
<212>RNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(19)
<400>4
CTGGAGCGTTTCTAGGGGA 19
Claims (3)
1. ring mediated isothermal amplification detects the reagent of norovirus, it is characterized in that this reagent comprises (1)-(5):
(1) loop-mediated isothermal amplification liquid:
Comprise that 10 * Thermopol reaction buffer, 1.0-1.4mmol/L dNTP, 4-8mmol/L sal epsom, 0.8-1.6 μ mol/L upstream draw interior thing, 0.8-1.6 μ mol/L downstream inner primer, 0.2-0.3 μ mol/L upstream outer primer, 0.2-0.3 μ mol/L downstream outer primer and 1-1.5mol/L trimethyl-glycine; Wherein 10 * Thermopol reaction buffer contains trihydroxy methyl aminomethane-hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 of 200mmol/L pH8.8;
Wherein, upstream inner primer:
5-CGGGCTCCAGAGCCATAACCT-ACGCCAACCCATCTGATG-3；
The downstream inner primer:
5-GTGGCGGGCCAACAAAACGTA-CACTGTGAACTCTCCACCAG-3；
Upstream outer primer: 5-GTGAATGAAGATGGCGTCGA-3;
Downstream outer primer: 5-CTGGAGCGTTTCTAGGGGA-3;
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4)ReverTra?Ace：100U/μL；
(5) developer: be 10% fluorescence dye SYBR GREEN I or DNAGreen.
2. ring mediated isothermal amplification detects the reagent of norovirus, it is characterized in that the mass ratio of four kinds of thymus nucleic acids in the above-mentioned dNTP is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1.
3, utilize the reagent described in the claim 1 to carry out the method for isothermal rapid detection norovirus, it is characterized in that comprising successively (1)-(3) the following step:
(1) extraction of sample to be checked or viral RNA:
Extract sample nucleic acid to be checked, wherein the sample RNA OD of Ti Quing
260/ OD
280In the 1.6-2.0 scope, concentration is in 10-100ng/ μ L scope;
(2) carry out the loop-mediated isothermal amplification of G II type norovirus:
A. the UNG enzyme that adds 2 μ L sample template DNA to be checked and 0.5 μ L in the reaction tubes that 21 μ L LAMP reaction solutions are housed is placed 3-5min for 95 ℃ in constant temperature, places 1-3min on ice immediately;
B. in reaction tubes, add 1 μ L Bst archaeal dna polymerase and 1 μ LeverTra Ace again, and in 65 ℃ of amplified reaction 45-90min of constant temperature;
C. temperature is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3-5min;
(3) color developing detection:
In each reaction tubes, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked contains or is G II type norovirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200810157904XA CN101403014A (en) | 2008-10-15 | 2008-10-15 | Ring mediated isothermality amplification fast detecting method for norovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA200810157904XA CN101403014A (en) | 2008-10-15 | 2008-10-15 | Ring mediated isothermality amplification fast detecting method for norovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101403014A true CN101403014A (en) | 2009-04-08 |
Family
ID=40537173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA200810157904XA Pending CN101403014A (en) | 2008-10-15 | 2008-10-15 | Ring mediated isothermality amplification fast detecting method for norovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101403014A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899530B (en) * | 2009-11-05 | 2013-02-06 | 中国农业科学院烟草研究所 | Loop-mediated isothermal amplification detection method of tobacco mosaic viruses |
| CN103642943A (en) * | 2013-12-16 | 2014-03-19 | 广东省微生物研究所 | Detection primer group, detection method and kit for loop-mediated isothermal amplification of GI type Norovirus |
| CN106702027A (en) * | 2017-01-16 | 2017-05-24 | 山东省农业科学院家禽研究所 | Isothermal amplification detection method for RHDV recombinant polymerase |
-
2008
- 2008-10-15 CN CNA200810157904XA patent/CN101403014A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899530B (en) * | 2009-11-05 | 2013-02-06 | 中国农业科学院烟草研究所 | Loop-mediated isothermal amplification detection method of tobacco mosaic viruses |
| CN103642943A (en) * | 2013-12-16 | 2014-03-19 | 广东省微生物研究所 | Detection primer group, detection method and kit for loop-mediated isothermal amplification of GI type Norovirus |
| CN103642943B (en) * | 2013-12-16 | 2016-08-17 | 广东省微生物研究所 | Ring mediated isothermal amplification detection primer group, detection method and the test kit of G I type norovirus |
| CN106702027A (en) * | 2017-01-16 | 2017-05-24 | 山东省农业科学院家禽研究所 | Isothermal amplification detection method for RHDV recombinant polymerase |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Savini et al. | Novel putative Bluetongue virus in healthy goats from Sardinia, Italy | |
| CN108330210B (en) | Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof | |
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN106755571B (en) | Kit for detecting Zika virus, dengue fever virus and chikungunya virus | |
| CN111534637B (en) | Universal primer, probe and kit for enterovirus nucleic acid detection | |
| CN110724769A (en) | PCR primer group, kit and detection method for detecting African swine fever virus MGF360-505R gene | |
| CN104328222A (en) | Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit | |
| CN112941237A (en) | CRISPR nucleic acid detection kit for specifically detecting H7N9 avian influenza A virus | |
| CN101386885B (en) | Toxigenous commabacillus cholera vibrio ring mediated isothermal amplification rapid detection method | |
| CN103173568B (en) | Primer group, kit and method for rapidly identifying 1 type dengue fever virus | |
| CN110923361A (en) | Primer, probe and kit for blood source screening based on digital PCR | |
| CN101403014A (en) | Ring mediated isothermality amplification fast detecting method for norovirus | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN101487064B (en) | Method and special reagent kit for detecting five zoonosis virus | |
| CN101381771A (en) | Loop-mediated isothermal amplification fast detection method of producing ariatoxin fungi | |
| CN112831609A (en) | PCR primer, kit and method for detecting African swine fever virus MGF-505-1R gene | |
| CN101020926A (en) | Reagent kit and process for detecting cholera vibrio in circular mediated constant temperature amplification method | |
| CN112458201A (en) | Fluorescent RT-RPA primer, probe and detection method for detecting novel coronavirus | |
| CN113046476A (en) | Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus | |
| CN111534636A (en) | Primer pair, probe, kit and detection method for detecting 2019-nCoV and application thereof | |
| CN106939357A (en) | H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application | |
| CN113637795A (en) | Detection method and kit for influenza A/B virus and novel coronavirus | |
| CN116479189A (en) | Whole-gene capturing method, primer combination and kit for syncytial virus subtype B | |
| CN111518954A (en) | Primer group, kit and method for double nano PCR detection of H5 and N8 subtype avian influenza virus | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20090408 |