CN106939357A - H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application - Google Patents

H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application Download PDF

Info

Publication number
CN106939357A
CN106939357A CN201710307098.9A CN201710307098A CN106939357A CN 106939357 A CN106939357 A CN 106939357A CN 201710307098 A CN201710307098 A CN 201710307098A CN 106939357 A CN106939357 A CN 106939357A
Authority
CN
China
Prior art keywords
hypotypes
aiv
primer
pcr
primers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710307098.9A
Other languages
Chinese (zh)
Inventor
李旭勇
郭晶
李玉保
刘文强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Liaocheng University
Original Assignee
Liaocheng University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Liaocheng University filed Critical Liaocheng University
Priority to CN201710307098.9A priority Critical patent/CN106939357A/en
Publication of CN106939357A publication Critical patent/CN106939357A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Abstract

H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV triple RT PCR primer combinations, including 3 pairs of specificity amplification primers, respectively primer pair H4 F and H4 R, primer pair H6 F and H6 R, primer pair H9 F and H9 R are identified simultaneously the invention discloses quick.Also disclose the kit comprising triple RT PCR primer combinations and identify H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV application and method simultaneously using triple RT PCR primer combinations come quick.The features such as present invention has short simple to operate, detection time, high specificity, high accuracy rate, provides with its effective diagnosis detection scheme, the prevention and control, monitoring to low pathogenicity AIV are significant for low pathogenicity AIV inspection and quarantine, diseases monitoring.

Description

H4 hypotypes, H6 hypotypes and the combination of H9 hypotypes AIV triple RT-PCR primers, kit and It is applied
Technical field
The invention belongs to animal virology diagnostic techniques field, in particular it relates to which quick identify H4 hypotypes and/or H6 simultaneously Hypotype and/or the combination of H9 hypotypes AIV triple RT-PCR primers, further relate to include the kit of triple RT-PCR primer combinations And H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV side are identified simultaneously come quick using triple RT-PCR primer combinations Method.
Background technology
It is well known that during poultry farming, AIV is very big to its harmfulness, according to the difference to chicken pathogenic Can be highly pathogenic (highly pathogenic avian influenza virus, HPAIV) and low pathogenicity by AIV points Avian influenza virus (low pathogenic avian influenza virus, LPAIV).Wherein LPAIV includes H4, H6 and H9 Hypotype etc., LPAIV can occur throughout the year, be likely to occur without obvious symptom or atypical symptom, have after infection poultry When be showed only as laying rate and be slightly decreased, therefore monitoring and prevention and control of the domestic aquaculture to LPAIV realize weak.However, with China scientist goed deep into AIV researchs in recent years, was found that while that LPAIV will not cause a large amount of poultry dead as HPAIV, still LPAIV can provide related gene for HPAIV, promote HPAIV constantly to make a variation, or even HPAIV is obtained across species barrier Ability, can infect the mammal even mankind, so as to cause serious economic loss, endanger mankind's public safety.
The domestic research gradually paid attention to LPAIV, the especially research to H4, H6 and H9 hypotype AIV in the last few years.It is sub- to H4 Type AIV research shows that several features are presented in the virus.First, H4 hypotypes AIV separation rate more and more highers in China poultry, According to state's poultry influenza reference laboratory statistics, H4 hypotypes AIV is in south China province AIV detection in increased state year by year Gesture.Secondly, seasonal feature is presented in H4 hypotypes AIV distribution, from the individual separation rates of LPAIVs and separation of group rate experiment statisticses From the point of view of, it is 0.00% that minimum separation rate is reached in January and July, and 6 and September part separation rate 2.00% or so, The separation rate of H4 hypotypes AIV in family duck is significantly larger than the separation rate of chicken and family goose.
H6 hypotypes AIV is initially isolated from the turkey in the U.S. in nineteen sixty-five, is then separated in succession in wild bird, aquatic bird and terrestrial bird Arrive.The epidemiological surveillance in Europe and the U.S. shows that H6 hypotypes AIV is one of higher hypotype of separation rate, same phase in monitoring There is wider array of host range for the AIV of other hypotypes.Multiple research displays, some H6 hypotypes AIV can be with infecting mouse and snow Ermine, and cause morbidity.Have been reported that the case that a people infects H6N1 occurs in Taiwan Province of China in 2013.It is reported that China in recent years The H6 hypotypes AIV of southern area separation has been provided with the horizontal transmission ability on cavy, shows that the hypotype is pacified to public health Full threat increasingly increases.
H9N2 hypotypes AIV is a kind of important infectious disease for endangering aviculture, while being also with very big to public health One of infectious disease of threat.The inside base of Hong Kong H5N1 avian influenza virus of 1997 and the H7N9 of 2013 and H10N8 virus Because coming from H9N2 hypotype AIV, thus H9N2AIV served in the generation of new avian influenza virus it is vital.Though People so there is no to infect H9N2 AIV death incidents at present, but the virus of the hypotype is popular very wide in China, infects mammal Event also occasionally have a generation, and in fowl group constantly heredity and variation occurs for virus, it is possible to which the public of the mankind is defended Raw safety produces threat.
Therefore, to LPAIV, in particular for H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes LPAIV triple RT-PCR The foundation of detection scheme is very necessary.
However, at present both at home and abroad for H4 hypotypes and/or H6 hypotypes and/or H9 hypotype AIV detection methods seldom, using compared with Many authentication methods are the conventional methods such as separation sequencing, hemagglutination-inhibition test, the neuraminic acid enzyme test of virus, though these are tested Right accuracy rate is high, but time-consuming, costly, it is impossible to meet requirement that is quick to epidemic disease, diagnosing in time when epidemic disease is broken out；And These detection methods can not determine that the virus is H4, H6 or H9 hypotype AIV simultaneously.Therefore, epidemiology survey and epidemic disease scene It can fast and accurately differentiate H4, H6 or/and H9 hypotype AIV detection method in the urgent need to a kind of in diagnosis.
The detection scheme of the present invention can be assured that the virus is H4, H6 or H9 hypotype AIV with one-time detection, and tool The characteristics of having high easy, quick, accuracy rate, high specificity.
The content of the invention
The technical problem to be solved in the present invention is quick while identifying H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV.
For above-mentioned technical problem, the present invention provides following technical scheme to solve：
One of technical scheme is to provide quick while identifying H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV The combination of triple RT-PCT primers, including 3 pairs of specificity amplification primers, respectively primer pair H4-F and H4-R, primer pair H6-F Sequence with H6-R, primer pair H9-F and H9-R or its complementary series or with its at least more than 90% uniformity, primer pair H4-F Nucleotide sequence with H4-R, primer pair H6-F and H6-R, primer pair H9-F and H9-R is as follows：
H4 primers H4-F：CCAAGRGGACATTACAA(SEQ ID NO：1)；
H4 primers H4-R：CYTCAACATACTTCTCCAG(SEQ ID NO：2)；
H6 primers H6-F：AACAAYTCRACAACACAAGTG(SEQ ID NO：3)；
H6 primers H6-R：TCATKCTTTCAGTYCCCATTCT(SEQ ID NO：4)；
H9 primers H9-F：AGGGCCAAGGCCHCTTGTCAA(SEQ ID NO：5)；
H9 primers H9-R：GGATGTTATTTTGTCAATTGCGTT(SEQ ID NO：6).
Another technical scheme of the present invention is to provide quick while identifying H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV kit, the kit is combined comprising above-mentioned primer.
Further, mentioned reagent box is also included：Buffer solution, dNTP, archaeal dna polymerase, deionized water.
Preferably, above-mentioned archaeal dna polymerase is Pfu archaeal dna polymerases and Taq archaeal dna polymerases, and above-mentioned dNTP is dATP、dTTP、dCTP、dGTP、dUTP。
Another technical scheme of the present invention is to provide above-mentioned primer combination or kit quick while identifying that H4 is sub- Applied in type and/or H6 hypotypes and/or H9 hypotypes AIV.
Preferably, the field of above-mentioned application is birds or mammal.
Another technical scheme of the present invention is to provide a kind of quick while identifying H4 hypotypes and/or H6 hypotypes and/or H9 Hypotype AIV triple RT-PCR analysis methods, comprise the following steps：
(1) viral RNA is extracted from sample；
(2) using the RNA in above-mentioned steps as template, cDNA is gone out using universal primer reverse transcription；
(3) using the cDNA in above-mentioned steps as template, PCR amplifications are carried out using the primer combination described in claim 1；
(4) using electrophoresis analysis after expanding, the viral type is determined.
Preferably, above-mentioned universal primer is influenza virus reverse transcription universal primer (unit 12), and above-mentioned electrophoresis is agar Sugared gel electrophoresis.
Preferably, the reaction system of above-mentioned PCR amplifications is 20 μ l：The μ l of 5 × buffer solution 4；2.5mM dNTP 1μl；Polymerase 0.5 1 μ l of μ l, cDNA；H4-F, concentration is 20pM and H4-R, and concentration is 20pM, each 0.1-1 μ l；H6-F, concentration is 20pM, and H6-R, concentration is 20pM, each 0.1-1 μ l；H9-F, concentration is 20pM and H9-R, and concentration is 20pM, each 0.1-1 μ l；Deionization Water, is mended to 20 μ l.
Preferably, H4-F and H4-R, each 0.4 μ l；H6-F and H6-R, each 0.5 μ l；Each 0.4 μ l of H9-F and H9-R.
Preferably, the response procedures of above-mentioned PCR amplifications are：A.98 DEG C pre-degeneration, 30s；B.98 DEG C denaturation, 10s；c.55- 65 DEG C of annealing, 30s；D.72 DEG C extension, 15s；E.72 DEG C extension eventually, 3min, wherein, step b to step d is circulated 30 times.
Preferably, annealing temperature is 62 DEG C.
Specific definition：
" archaeal dna polymerase (DNA polymerase) ", archaeal dna polymerase is cellular replication DNA important function enzyme.DNA gathers Synthase, using DNA or cDNA as template is replicated, since the enzyme that DNA is copied to 3' ends by 5' end points.Archaeal dna polymerase it is main Activity is the synthesis (in the case where possessing template, primer, dNTP etc.) of catalytic dna and its mutually auxiliary activity.For the present invention The example of archaeal dna polymerase have Q5 high-fidelity DNA polymerases, Phusin high-fidelity DNA polymerases, Taq DNA polymerase, however, Those skilled in the art according to actual conditions, can select suitable archaeal dna polymerase, these enzymes also invention protection domain it It is interior.
" complementary series (Complementary sequence) ", complementary series is the root using a nucleotide chain as template The complementary strand formed according to base complementrity rule, complementary series is also within protection scope of the present invention.
" reverse transcription (Reverse Transcription) ", reverse transcription is, using RNA as template, to pass through reverse transcriptase, synthesis DNA process, is a kind of particular form of DNA biosynthesis.
" dNTP (deoxy-ribonucleoside triphosphate) ", the abbreviation of deoxyribonucleoside triphosphate.It is General designation including including dATP, dGTP, dTTP, dCTP etc., N refers to nitrogenous base, represents variable and refers in A, T, G, C, U etc. It is a kind of.Play raw material in biological DNA synthesis, and in various PCR (RT-PCR, real-time PCR).
" electrophoresis (electrophoresis, EP) ", charged particle is under electric field action, towards the electricity electrically opposite with it Ghandler motion is moved, referred to as electrophoresis.Using charged particle, translational speed is different and reach the technology referred to as electrophoretic techniques of separation in the electric field. Electrophoresis method for DNA has agarose gel electrophoresis, polyacrylamide gel electrophoresis etc..Those skilled in the art are according to reality Situation, can select suitable electrophoresis method, these methods are also within the protection domain of invention.
" uniformity (identity) ", sequence identity refers to many on each position of two or more homologous sequences Count the sequence of existing nucleotides or amino acid composition.Those skilled in the art are on the basis of primer sequence disclosed by the invention On, sequence slight changes can still be obtained with the technique effect of primer of the present invention, these slight changes and with the present invention's Primer has the primer sequence of high consistency also within protection scope of the present invention.
" PCR expands (Polymerase Chain Reaction) ", PCR abbreviation PCR.PCR is external A kind of method of enzyme' s catalysis specific DNA fragment, one is constituted by the reaction such as high-temperature denatured, process annealing (renaturation) and thermophilic extension Individual cycle, circulation is carried out, and target DNA is expanded rapidly, with the spy such as high specificity, sensitivity is high, easy to operate, time saving Point.It cannot be only used for the basic research such as Gene Isolation, clone and nucleic acid sequence analysis, it may also be used for the diagnosis of disease is any There are DNA, RNA place.
The beneficial effects of the invention are as follows：
(1) the HA gene orders for H4, H6 and H9 hypotype AIV that the present invention was separated in recent years according to laboratory, with reference to The conserved sequence of HA genes that Genbank is announced designs 3 pairs of specific primers, the characteristics of with high specificity, can be simultaneously H4 hypotypes and/or H6 hypotypes and/or H9 hypotype AIV are detected, other subtype influenza virus H2, H8, H10 etc. is feminine gender, newly City epidemic disease poison, ILTV, infectious bronchitis virus etc. are also feminine gender；
(2) present invention detection method is deeply optimized, with sensitivity it is high the characteristics of, by sample doubling dilution Carry out sensitivity technique and show that the least concentration of detection is 100EID50/100μl；
(3) the characteristics of having reproducible, same sample is under same reaction condition in triplicate as in same batch Repeat to test, different samples are repeated once under same reaction condition as repeating to test between different batches, and result of the test is identical；
(4) present invention compensate for the technical deficiency of existing avian influenza virus identification and diagnosis, and existing detection method is only Whether energy infected by influenza is that H4, H6 or H9 hypotype AIV detect one by one, investigated.The present invention sets up a kind of quick mirror simultaneously Determine H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV triple RT-PCR analysis methods, reach that one-time detection is assured that The virus is H4, H6 or H9 hypotype AIV purpose.Compared with traditional detection method, the present invention is realized to same sample simultaneously Carry out the detection of a variety of different target gene；
(5) inventive samples consumption is few, simple to operate, and the time is short, low cost, it is necessary to detecting instrument it is easy, completely may be used To be promoted the use of in laboratories.
Brief description of the drawings
With reference to detailed description of the accompanying drawing to the specific embodiment of the invention, those skilled in the art will become more apparent that the present invention Above-mentioned and other purposes, advantages and features.
Fig. 1 is the specific detection electrophoretogram of triple RT-PCR detection methods；
Fig. 2 is H4 hypotypes AIV sensitivity technique electrophoretogram；
Fig. 3 is H6 hypotypes AIV sensitivity technique electrophoretogram；
Fig. 4 is H9 hypotypes AIV sensitivity technique electrophoretogram；
Fig. 5 is that triple RT-PCR detection methods detect electrophoretogram to clinical sample.
Embodiment
Raw materials used and equipment is those skilled in the art and known in embodiment, and be in the market can buy or It is readily available or is made.
Embodiment 1：PCR primer is to design
H4, H6 and H9 hypotype AIV separated in recent years according to laboratory HA gene orders, are announced with reference to Genbank The conserved sequence of the HA genes of H4, H6 and H9 hypotype, designs 3 pairs of specific primers, respectively primer pair H4-F and H4-R, draw Thing is to H6-F and H6-R, primer pair H9-F and H9-R, and its nucleotide sequence is as follows：
Embodiment 2：The foundation of triple RT-PCR detection methods and condition optimizing
First, virus total RNA is extracted
H4N6, H6N1, H9N2 hypotype AIV that laboratory is preserved are chosen, virus total RNA is extracted respectively.
1st, the μ l of virus liquid 250 are taken, 750 μ l Trizol are added, mixes, is stored at room temperature 5min；
2nd, 200 μ l chloroforms are added, overturns and mixes, be stored at room temperature 5min；
3rd, in 12000 turns/min at 4 DEG C, 15min is centrifuged；
4th, supernatant is drawn in new centrifuge tube, adds 500 μ l isopropanols, overturned and mix, -20 DEG C of standing 20min；
5th, in 12000 turns/min at 4 DEG C, 20min is centrifuged；
6th, supernatant is abandoned, is washed once with the μ l of 75% ethanol 1000；
7th, in 12000 turns/min at 4 DEG C, 10min is centrifuged；
8th, supernatant is abandoned, 20 μ l are added after drying naturally without RNase water, viral RNA is dissolved.
2nd, RNA reverse transcriptions are cDNA
Reaction system is that 20 μ l RNA add 2 μ l Unit12 primers, in after 70 DEG C of water-bath 5min, ice-water bath 5min, plus Enter 5 × buffer solution, 8 μ l, dNTP mixture 4 μ l, the μ l of RNase inhibitor 1, the μ l of reverse transcriptase 1, add without RNase H2O is settled to 40 μ l, 1h is reacted in 42 DEG C.
3rd, add specificity amplification primer and enter performing PCR detection
1st, triple RT-PCR reaction system optimizations
Triple RT-PCR reaction systems are 20 μ l, 5 × buffer solution, 4 μ l, 2.5mM dNTP 1 μ l, archaeal dna polymerase (Phu Archaeal dna polymerase) 0.5 μ l, cDNA 1 μ l, H4-F (concentration is 20pM) and each 0.1 μ l of H4-R (concentration is 20pM), 0.2 μ l, 0.3 μ L, 0.4 μ l, 0.5 μ l, 0.6 μ l, 0.7 μ l, 0.8 μ l, 0.9 μ l or 1 μ l, H6-F (concentration is 20pM) and H6-R (concentration is 20pM) Each 0.1 μ l, 0.2 μ l, 0.3 μ l, 0.4 μ l, 0.5 μ l, 0.6 μ l, 0.7 μ l, 0.8 μ l, 0.9 μ l or 1 μ l, H9-F (concentration is 20pM) With each 0.1 μ l of H9-R (concentration is 20pM), 0.2 μ l, 0.3 μ l, 0.4 μ l, 0.5 μ l, 0.6 μ l, 0.7 μ l, 0.8 μ l, 0.9 μ l or 1 μ L, is mended with deionized water to 20 μ l.
2nd, triple RT-PCR response procedures optimizations
Triple RT-PCR response procedures are：98 DEG C of pre-degeneration 30s；98 DEG C of denaturation 10s；55-65 DEG C (55 DEG C of gradient of setting, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C or 65 DEG C) annealing 30s；72 DEG C extend 15s, totally 30 Circulation；Last 72 DEG C extend 3min eventually.
3rd, take PCR primer to carry out 1% agarose gel electrophoresis, and take pictures under ultraviolet light, analysis record result.
4th, result judgement method and analysis
Result judgement method：The amplified production size of H4 hypotype AIV specificity amplification primers is 406bp, if measuring samples In the DNA fragmentation containing 400bp or so, then the primer and annealing temperature of this concentration can expand H4 hypotypes AIV HA, otherwise then The primer and annealing temperature of this concentration can not expand H4 hypotypes AIV HA；The amplified production of H6 hypotype AIV specificity amplification primers Size is 600bp, if the DNA fragmentation containing 600bp or so in measuring samples, the primer and annealing temperature of this concentration can expand Increase H6 hypotypes AIV HA, on the contrary then the primer and annealing temperature of this concentration can not expand H6 hypotypes AIV HA；H9 hypotypes AIV is special The amplified production size of specific amplification primers is 490bp, if the DNA fragmentation containing 500bp or so in measuring samples, this concentration Primer and annealing temperature can expand H9 hypotypes AIV HA, otherwise then the primer and annealing temperature of this concentration can not expand H9 Hypotype AIV HA.
As a result show, the primer pair H4 in embodiment 1 can be used for identification H4 hypotype AIV, primer pair H6 can be used for mirror Determine H6 hypotype AIV, primer pair H9 can be used for identification H9 hypotypes AIV.Optimal reaction system (20 μ l)：The μ l of 5 × buffer solution 4, The μ l of 2.5mM dNTP 1, enzyme 0.5 μ l, cDNA 1 μ l, H4-F (concentration is 20pM) and H4-R (concentration is 20pM) each 0.4 μ l, H6- F (concentration is 20pM) and H6-R (concentration is 20pM) each 0.5 μ l, H9-F (concentration is 20pM) and H9-R (concentration is 20pM) are each 0.4 μ l, are mended with deionized water to 20 μ l.Triple RT-PCR optimum responses programs are：98 DEG C of pre-degeneration 30s；98 DEG C of denaturation 10s； 62 DEG C of annealing 30s；72 DEG C of extension 15s, totally 30 circulations；Last 72 DEG C extend 3min eventually.
Embodiment 3：The specific detection of RT-PCR detection method
First, Total RNAs extraction
Choose H2N3, H4N6, H6N1, H8N4, H9N2, H10N3 hypotype AIV, NDV, infection of laboratory preservation Property laryngotracheitis virus, infectious bronchitis virus, extract virus total RNA respectively.Method be the same as Example 2.
2nd, RNA reverse transcriptions are cDNA
Method be the same as Example 2.
3rd, triple RT-PCR detections
1st, the composition of template
By H4N6, H6N1 and H9N2 hypotype AIV cDNA solution, (volume ratio is 1:1:1) mixed solution 1 is constituted, by H4N6 (volume ratio is 1 with H6N1 hypotypes AIV cDNA solution:1) composition mixed solution 2, molten by H4N6 and H9N2 hypotypes AIV cDNA (volume ratio is 1 to liquid:1) mixed solution 3 is constituted, (volume ratio is 1 by H6N1 and H9N2 hypotypes AIV cDNA solution:1) constitute mixed Conjunction solution 4, H4N6 hypotypes AIV cDNA solution are referred to as solution 5, H6N1 hypotypes AIV cDNA solution and are referred to as solution 6, H9N2 Asias Type AIV cDNA solution is referred to as solution 7, H2N3 hypotypes AIV cDNA solution and is referred to as solution 8, H8N4 hypotypes AIV cDNA solution Referred to as solution 9, H10N3 hypotypes AIV cDNA solution are referred to as solution 10, NDV cDNA solution and are referred to as solution 11, infection Property laryngotracheitis virus cDNA solution is referred to as solution 12, infectious bursa of Fabricius virus cDNA solution and is referred to as solution 13, deionized water Referred to as solution 14.
2nd, add specificity amplification primer and enter performing PCR detection
RT-PCR reaction systems and reaction condition after optimization in method be the same as Example 2.
4th, electrophoresis
PCR primer is taken to carry out 1% agarose gel electrophoresis, as a result as shown in Figure 1.It is analyzed as follows, swimming lane 1 is mixed solution 1, swimming lane 2 is mixed solution 2, and swimming lane 3 is mixed solution 3, and swimming lane 4 is mixed solution 4, and swimming lane 5 is that solution 5, swimming lane 6 are solution 6th, swimming lane 7 is that solution 7, swimming lane 8 are that solution 8, swimming lane 9 are that solution 9, swimming lane 10 are that solution 10, swimming lane 11 are solution 11, swimming lane 12 It is that solution 13, swimming lane 14 are solution 14 for solution 12, swimming lane 13.After purpose fragment is cut, sequencing company sequencing is delivered to.
As a result show, all samples containing H4, H6 and/or H9 hypotype AIV templates can amplify corresponding 406bp, 600bp and/or 490bp purpose band, and other templates in same position without any band.Purpose fragment is sequenced, to sequence Row interpretation of result shows completely the same with the gene homologous segment of design of primers template.This result shows that of the invention is triple RT-PCR method detection H4, H6 and/or H9 hypotype AIV has strong specificity.
Embodiment 4：The sensitivity technique of RT-PCR detection method
First, sensitivity technique of the RT-PCR detection method to H4N6 hypotypes AIV
1st, the preparation of the various dilutions of H4N6 hypotypes AIV
H4N6 hypotypes AIV is taken to determine viral level EID50, it is 10 by viral dilution6EID50/ 100 μ l, enter on this basis 10 times of doubling dilutions of row, the viral level for making each dilution is respectively 105EID50/100μl、104EID50/100μl、103EID50/ 100μl、102EID50/100μl、101EID50/100μl、100EID50/100μl、10-1EID50/100μl.Selection 104EID50/ 100μl-10-1EID50The sensitivity of/100 μ l intervals detection RT-PCR detection method.
2nd, Total RNAs extraction
Take 104EID50/100μl-10-1EID50/ 100 μ l totally 6 interval sample diluting liquids, extract total serum IgE, method respectively Be the same as Example 2.
3rd, RNA reverse transcriptions are cDNA
Method be the same as Example 2.
4th, add specificity amplification primer and enter performing PCR detection
Used specificity amplification primer is to H4-R and H4-F.The RT-PCR after optimization in method be the same as Example 2 is anti- Answer system and reaction condition.
5th, electrophoresis
PCR primer is taken to carry out 1% agarose gel electrophoresis, as a result as shown in Figure 2.Through analysis, H4N6 hypotype AIV samples are dilute Release to 101EID50/ 100 μ l and above viral dilution liquid are observed that two sizes respectively in 400bp or so band.As a result Show, detection method of the invention can reach 10 to H4N6 hypotypes AIV detection sensitivity1EID50/100μl。
2nd, sensitivity technique of the RT-PCR detection method to H6N1 hypotypes AIV
1st, the preparation of the various dilutions of H6N1 hypotypes AIV
H6N1 hypotypes AIV dilution process is with 1 in step one.
2nd, Total RNAs extraction
Take 104EID50/100μl-10-1EID50/ 100 μ l totally 6 interval sample diluting liquids, extract total serum IgE, method respectively Be the same as Example 2.
3rd, RNA reverse transcriptions are cDNA
Method be the same as Example 2.
4th, add specificity amplification primer and enter performing PCR detection
Used specific primer is to being H6-R and H6-F.RT-PCR reactions after optimization in method be the same as Example 2 System and reaction condition.
5th, electrophoresis
PCR primer is taken to carry out 1% agarose gel electrophoresis, as a result as shown in Figure 3.Through analysis, H6N1 hypotypes AIV sample It is diluted to 100EID50/ 100 μ l and above viral dilution liquid are observed that two sizes respectively in 600bp or so band.Knot Fruit shows that detection method can reach 10 to H6N1 hypotypes AIV detection sensitivity0EID50/100μl。
3rd, sensitivity technique of the RT-PCR detection method to H9N2 hypotypes AIV
1st, the preparation of the various dilutions of H9N2 hypotypes AIV
H9N2 hypotypes AIV dilution process is with 1 in step one.
2nd, Total RNAs extraction
Take 104EID50/100μl-10-1EID50/ 100 μ l totally 6 interval sample diluting liquids, extract total serum IgE respectively, side Method be the same as Example 2.
3rd, RNA reverse transcriptions are cDNA
Method be the same as Example 2.
4th, add specificity amplification primer and enter performing PCR detection
Used specificity amplification primer is to for H9-R and H9-F.The RT-PCR after optimization in method be the same as Example 2 Reaction system and reaction condition.
5th, electrophoresis
PCR primer is taken to carry out 1% agarose gel electrophoresis, as a result as shown in Figure 4.Through analysis, H9N2 hypotypes AIV sample It is diluted to 100EID50/ 100 μ l and above viral dilution liquid are observed that two sizes respectively in 500bp or so band.Knot Fruit shows that detection method can reach 10 to H9N2 hypotypes AIV detection sensitivity0EID50/100μl。
Embodiment 5：Triple RT-PCR detections of pathological material of disease (throat swab and cloacal swab of sick fowl) to be checked
1st, the preparation of sample
The throat swab and cloacal swab of the sick fowl of collection amount to 100 parts, and respectively marked as Y1-Y100, swab infiltration is arrived In PBS, fully mix on the oscillator, supernatant is transferred in sterile centrifuge tube by centrifugation, is numbered standby.
2nd, Total RNAs extraction
250 μ l supernatants are taken, 750 μ l Trizol are added, virus total RNA, method be the same as Example 2 is extracted.
3rd, RNA reverse transcriptions are cDNA
Method be the same as Example 2.
4th, add amplimer and enter performing PCR detection
Used specific primer is to for H4, H6 and H9.RT-PCR reactants after optimization in method be the same as Example 2 System and reaction condition.
5th, electrophoresis
PCR primer is taken to carry out 1% agarose gel electrophoresis, 2 parts of samples are H4, H6 and H9 hypotype AIV positive, 4 parts of samples Positive for H4 and H9 hypotypes AIV, 5 parts of samples are H6 and H9 hypotypes AIV positive, and 2 parts of samples are H4 and H6 hypotypes AIV positive, 6 parts Sample is H4 hypotypes AIV positive, and 7 parts of samples are H6 hypotypes AIV positive, and 12 parts of samples are H9 hypotypes AIV positive.This experiment knot Fruit is consistent with the Serological in laboratory.Meanwhile, the purpose fragment of amplification is sent to sequencing company and is sequenced, sequencing result It is consistent with RT-PCR results.
Agarose gel electrophoresis qualification result such as Fig. 5, M are label, and swimming lane 1-20 is numbering Y21-Y40 sample, swimming Road 21 is deionized water.Swimming lane 2 and 3 (numbering Y22 and Y23) amplifies the band that a size is 406bp respectively, is H4 hypotypes AIV；Swimming lane 5 (numbering Y25) amplifies the band that a size is 490bp, is H9 hypotypes AIV；Swimming lane 6 (numbering Y26) is expanded Go out the band that a size is 600bp, be H6 hypotypes AIV；Swimming lane 7 (numbering Y27) amplifies three sizes for 600,490 and 406bp band, is H4, H6 and H9 hypotype AIV mixed infections；Swimming lane 9 (numbering Y29) amplifies two sizes for 490 Hes 406bp band, is H4 and H9 hypotype AIV mixed infections；Swimming lane 10 (numbering Y30) amplifies two sizes for 600 and 490bp Band, be H6 and H9 hypotype AIV mixed infections；Swimming lane 14 and 15 (numbering Y34 and Y35) amplifies two sizes for 600 Hes 406bp band, is H4 and H6 hypotype AIV mixed infections；Remaining sample and negative control are feminine gender.
As a result show, can be with the AIV of precise Identification H4, H6 and/or H9 hypotype using triple RT-PCR of the present invention.
The above is only the specific embodiment of the present invention, not does any formal limitation to the present invention, though So the present invention is disclosed above with specific embodiment, but is not limited to the present invention, any to be familiar with this professional technology people Member, in the range of technical solution of the present invention is not departed from, when the technology contents using the disclosure above make a little change or repair The Equivalent embodiments for equivalent variations are adornd, as long as being the content without departing from technical solution of the present invention, the technology according to the present invention is real Any simple modification, equivalent variations and modification that confrontation above example is made, still fall within the scope of technical solution of the present invention It is interior.
Sequence table
<110>Liaocheng University
<120>H4 hypotypes, H6 hypotypes and the triple RT-PCR primer combinations of H9 hypotypes AIV, kit and its application
<130>
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<221>Misc_ features
<222> (6)..(6)
<223>R is a or g
<400> 1
ccaagrggac attacaa 17
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<221>Misc_ features
<222> (2)..(2)
<223>Y is c or t
<400> 2
cytcaacata cttctccag 19
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<221>Misc_ features
<222> (6)..(6)
<223>Y is c or t
<220>
<221>Misc_ features
<222> (9)..(9)
<223>R is a or g
<400> 3
aacaaytcra caacacaagt g 21
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<221>Misc_ features
<222> (5)..(5)
<223>K is g or t
<220>
<221>Misc_ features
<222> (14)..(14)
<223>R is a or g
<400> 4
tcatkctttc agtycccatt ct 22
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<221>Misc_ features
<222> (13)..(13)
<223>H is a, t or c
<400> 5
agggccaagg cchcttgtca a 21
<210> 6
<211> 24
<212> DNA
<213>Artificial sequence
<400> 6
ggatgttatt ttgtcaattg cgtt 24

Claims (10)

1. quick identify H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV triple RT-PCT primers combination, including 3 pairs simultaneously Specificity amplification primer, respectively primer pair H4-F and H4-R, primer pair H6-F and H6-R, primer pair H9-F and H9-R or its is mutual Complementary series or the sequence with its at least more than 90% uniformity, primer pair H4-F and H4-R, primer pair H6-F and H6-R, primer pair H9-F and H9-R nucleotide sequence is as follows：
H4 primers H4-F：CCAAGRGGACATTACAA(SEQ ID NO：1)；
H4 primers H4-R：CYTCAACATACTTCTCCAG(SEQ ID NO：2)；
H6 primers H6-F：AACAAYTCRACAACACAAGTG(SEQ ID NO：3)；
H6 primers H6-R：TCATKCTTTCAGTYCCCATTCT(SEQ ID NO：4)；
H9 primers H9-F：AGGGCCAAGGCCHCTTGTCAA(SEQ ID NO：5)；
H9 primers H9-R：GGATGTTATTTTGTCAATTGCGTT(SEQ ID NO：6).
2. quick identify H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV kit simultaneously, the kit includes right It is required that the primer combination described in 1.
3. the kit described in claim 2, it is further included：Buffer solution, dNTP, archaeal dna polymerase, deionized water.
4. the kit described in claim 3, wherein, described archaeal dna polymerase is that Pfu archaeal dna polymerases and Taq DNA polymerize Enzyme, described dNTP is dATP, dTTP, dCTP, dGTP, dUTP.
5. the kit any one of primer combination or claim 2-3 described in claim 1 is identified simultaneously quick Applied in H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV.
6. the application described in claim 5, the field of the application is birds or mammal.
7. a kind of quick identification H4 hypotypes and/or H6 hypotypes and/or H9 hypotypes AIV triple RT-PCR analysis methods simultaneously, bag Include following steps：
(1) viral RNA is extracted from sample；
(2) using the RNA in above-mentioned steps as template, cDNA is gone out using universal primer reverse transcription；
(3) using the cDNA in above-mentioned steps as template, PCR amplifications are carried out using the primer combination described in claim 1；
(4) using electrophoresis analysis after expanding, the viral type is determined.
8. the method described in claim 7, it is characterised in that：The universal primer is influenza virus reverse transcription universal primer, institute Electrophoresis is stated for agarose gel electrophoresis method.
9. method according to claim 8, it is characterised in that：The reaction system of the PCR amplifications is 20 μ l：5 × buffering The μ l of liquid 4；2.5mM dNTP 1μl；The 1 μ l of μ l, cDNA of archaeal dna polymerase 0.5；H4-F, concentration is 20pM and H4-R, and concentration is 20pM, each 0.1-1 μ l；H6-F, concentration is 20pM, and H6-R, and concentration is 20pM, each 0.1-1 μ l；H9-F, concentration be 20pM and H9-R, concentration is 20pM, each 0.1-1 μ l；Deionized water, is mended to 20 μ l, it is preferable that H4-F and H4-R, each 0.4 μ l；H6-F and H6-R, each 0.5 μ l；Each 0.4 μ l of H9-F and H9-R.
10. method according to claim 8, it is characterised in that：The response procedures of PCR amplification are：A.98 DEG C pre- change Property, 30s；B.98 DEG C denaturation, 10s；C.55-65 DEG C annealing, 30s；D.72 DEG C extension, 15s；E.72 DEG C extension eventually, 3min, its In, step b to step d is circulated 30 times, wherein it is preferred to, annealing temperature is 62 DEG C.
CN201710307098.9A 2017-05-04 2017-05-04 H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application Pending CN106939357A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710307098.9A CN106939357A (en) 2017-05-04 2017-05-04 H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710307098.9A CN106939357A (en) 2017-05-04 2017-05-04 H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application

Publications (1)

Publication Number Publication Date
CN106939357A true CN106939357A (en) 2017-07-11

Family

ID=59463359

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710307098.9A Pending CN106939357A (en) 2017-05-04 2017-05-04 H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application

Country Status (1)

Country Link
CN (1) CN106939357A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107326103A (en) * 2017-08-28 2017-11-07 聊城大学 A kind of triple RT PCR specificity amplification primers groups and the RT PCR detection methods of triple identifications
CN109628639A (en) * 2018-12-26 2019-04-16 武汉科前生物股份有限公司 The primer and kit of the triple RT-PCR detections of avian influenza virus H5, H7, H9 hypotype
CN110669872A (en) * 2019-10-31 2020-01-10 广西壮族自治区兽医研究所 Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070092871A1 (en) * 2005-10-20 2007-04-26 Combimatrix Corporation Microarray for pathogen identification
CN101058833A (en) * 2007-02-08 2007-10-24 中国检验检疫科学研究院动植物检疫研究所 Primer system and method for detecting and analyzing avian influenza virus
CN101460632A (en) * 2006-04-28 2009-06-17 西门子医疗保健诊断公司 Nucleic acid primers and probes for detecting human and avian influenza viruses
CN102191339A (en) * 2011-03-30 2011-09-21 珠海出入境检验检疫局检验检疫技术中心 Preparation method and detection method for gene chip
CN103103291A (en) * 2013-01-30 2013-05-15 山东省农业科学院家禽研究所 Multiple identification and detection method of H4 and H9 subtypes of avian influenza virus

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070092871A1 (en) * 2005-10-20 2007-04-26 Combimatrix Corporation Microarray for pathogen identification
CN101460632A (en) * 2006-04-28 2009-06-17 西门子医疗保健诊断公司 Nucleic acid primers and probes for detecting human and avian influenza viruses
CN101058833A (en) * 2007-02-08 2007-10-24 中国检验检疫科学研究院动植物检疫研究所 Primer system and method for detecting and analyzing avian influenza virus
CN102191339A (en) * 2011-03-30 2011-09-21 珠海出入境检验检疫局检验检疫技术中心 Preparation method and detection method for gene chip
CN103103291A (en) * 2013-01-30 2013-05-15 山东省农业科学院家禽研究所 Multiple identification and detection method of H4 and H9 subtypes of avian influenza virus

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
华文君等: ""应用多重引物RT-PCR快速诊断禽流感亚型"", 《家禽科学》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107326103A (en) * 2017-08-28 2017-11-07 聊城大学 A kind of triple RT PCR specificity amplification primers groups and the RT PCR detection methods of triple identifications
CN109628639A (en) * 2018-12-26 2019-04-16 武汉科前生物股份有限公司 The primer and kit of the triple RT-PCR detections of avian influenza virus H5, H7, H9 hypotype
CN109628639B (en) * 2018-12-26 2022-04-01 武汉科前生物股份有限公司 Primer and kit for triple RT-PCR detection of avian influenza virus H5, H7 and H9 subtypes
CN110669872A (en) * 2019-10-31 2020-01-10 广西壮族自治区兽医研究所 Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses

Similar Documents

Publication Publication Date Title
CN105567877B (en) A kind of the primer combination and its application of identification chicken parvovirus and Avianreovirus
CN106811551A (en) The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method
CN106636472B (en) Complete set of reagent and method for detecting avian influenza virus and chicken parvovirus
De Battisti et al. Rapid pathotyping of Newcastle Disease Virus by pyrosequencing
CN106399585A (en) Universal PCR primers and method for detecting group I aviadenovirus and detection kit
CN106939357A (en) H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application
CN105441586A (en) A-type H5N6 subtype avian influenza virus dual-channel real-time fluorescence PCR (polymerase chain reaction) detection kit and detection method
CN105886667A (en) Detection kit for porcine epidemic diarrhea virus and detection method thereof
CN107828914A (en) Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent
CN104498629A (en) Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV)
Li et al. An improved reverse transcription loop-mediated isothermal amplification assay for sensitive and specific detection of Newcastle disease virus
CN105463136B (en) Kit for the detection of avian infectious bronchitis virus RT-PCR partings
CN102321769B (en) Primer pair for identifying newcastle disease virus and multi-subtype avian influenza virus and application thereof
CN111926113B (en) Primer group, probe, kit and method for rapidly detecting avian reovirus
CN106636473B (en) Complete set of reagents and method for detecting H5 subtype avian influenza virus and chicken parvovirus
CN102329891B (en) RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primer group for detecting H9 subtype avian influenza virus as well as detection method and application thereof
CN107287352A (en) The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection
CN107190103A (en) Multiple PCR primer group, kit and the method for three kinds of fishes virus are detected simultaneously
CN104561383A (en) Influenza A virus and B virus joint detection primer, probe, kit and application
CN104531899B (en) The GeXP rapid detection kit of avian influenza virus and its H6 hypotypes and N1 hypotypes
CN110669872A (en) Triple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group, kit and method for H9 and H10 subtype avian influenza viruses
CN102304591B (en) PCR (polymerase chain reaction) primer pair for identifying H3 subtype avian influenza virus and application thereof
CN105525038A (en) Newcastle disease virus strong/weak virulent one-step real-time fluorescence RT-PCR detection kit
CN104946796A (en) Kit and detection method for detecting tomato spotted wilf virus by RT-LAMP method
CN109487011A (en) For detecting the primer combination and its application of H5, H7 and H9 and 9 NA hypotype AIV

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination