CN101402958A - Genetic engineering uses of rice phosphate transfer protein gene OsPht1;6 - Google Patents

Abstract

The invention discloses an engineering application of an oryza sativa phosphate transport protein gene OsPht1; 6, belonging to the genetic engineering field. The engineering application comprises an application of the gene in the aspect of improving the effective phosphorus utilization in soil, the registry number of the nucleotide sequence is AF536966, and the amino acid sequence of the expressed oryza sativa phosphate transport protein gene OsPht1; 6 is SEQ ID NO.2. The OsPht1; 6 gene protein is responsible for absorbing the phosphate in soil and upward transporting the phosphate in oryza sativa; a knock-out mutant of the gene leads to the decrease of the absorption of the phosphate by the oryza sativa by 24.1 percent and causes obvious symptoms of phosphorus deficiency. Transgenic experiments show that the over-expression of the gene can improve the total phosphorus absorption amount by nearly two times. The OsPht1; 6 can be used as a target gene for being introduced to plants, improving the tolerance ability to low phosphorus of the plants and providing a guarantee for fostering oryza sativa new kinds which are applicable to soil with phosphorus deficiency.

Description

Rice phosphate transfer protein gene OsPht 1; 6 genetically engineered is used

Technical field

The invention discloses rice phosphate transfer protein gene OsPht 1; 6 genetically engineered is used, the platymiscium gene engineering technology field.Be specifically related to a kind of gene OsPht1 that controls paddy rice phosphorus absorption and transport; 6 function and application.

Background technology

Phosphorus is one of growth and development of plants necessary three big nutritive elements.It not only relates to the synthetic of microbial film and nucleic acid, plays the part of important role simultaneously in the regulation and control of energy metabolism and enzyme.Because phosphorus element (PO ₄ ^3-, HPO ₄ ^2-, H ₂PO ₄ ^-) strong fixed action in acid and alkaline soil, make content very low (less than 10 μ the M) (Bieleski of titanium pigment in the saturated soil solution, R.L.Phosphatepools, phosphate transport and phosphate availability.Annu.Rev.Plant Physiol.1973,24,225-252), do not satisfy the growth needs of plant far away, make it become a big restriction sex factor of plant-growth.So can plant efficiently utilize, and a spot of titanium pigment has fundamental influence to plant-growth in the soil.

The plant modification genotype is to improve the effective approach that plant absorbing is utilized phosphorus efficient.The absorption and transport of plant phosphorus is the active transport process of contrary concentration, will be by the root cells film by plain transport protein regulation/control (the Smith FW of a plurality of phosphorus of same or different families, Rae AL, Hawkesford MJ.Molecular mechanisms of phosphate and sulphate transportin plants.Biochim BiophysActa, 2000,1465:236-245).Height according to available phosphorus concentration in the medium, the plain translocator of phosphorus is divided into low-affinity and high-affinity two big class (Rausch C, Bucher M.Molecular mechanisms of phosphate transport in plants.Planta, 2002,216:23-37), wherein high affinity phosphate cotransporter albumen is being undertaken root system suction phosphorus important task under the scarce phosphorus condition, therefore people receive much attention to the research of high affinity phosphate cotransporter albumen, at Arabidopis thaliana, report (Stephen R.Mudge in a variety of plants such as barley in succession, Anne L. Rae, Eugene Diatloff and Frank W. Smith.Expression analysis suggests novel roles for members of the Pht1family ofphosphate transporters in Arabidopsis.The Plant Journal, 2002,31:341-351; Anne L.Rae, DaisyH.Cybinski, Janine M.Characterization of two phosphate transporters from barley; Evidence for diversefunction and kinetic properties among members of the Pht1 family.Plant Molecular Biology, 2003,53:27-36).

The high affinity phosphate cotransporter albumen of paddy rice has 13 (Goff S.A., Ricke D., Lan T.H.et al.A draft sequence ofthe rice genome (Oryza sativa L. ssp.japonica) .Science 2002,286,92-100), OsPht1 wherein; The 6th, an important member in the high affine phosphorus transporter albumen.OsPht1; 6 pairs of absorbing of phosphorus of raising have vital role, utilize the rice varieties of phosphorus element to provide safeguard for cultivating efficient absorption.

Summary of the invention

Technical problem

The object of the present invention is to provide rice phosphate transfer protein gene OsPht 1; 6 genetically engineered is used, and this gene overexpression in paddy rice can improve phosphorus absorption total amount under the low-phosphorous condition greatly, and tiller number also increases substantially compared with the control.

Technical scheme

The invention provides rice phosphate transfer protein gene OsPht 1; 6 genetically engineered is used, and its nucleotide sequence accession number is AF536966.This gene expression product rice phosphate translocator OsPht1; 6 application, its aminoacid sequence are SEQ ID NO.2, totally 543 amino acid.

Rice phosphate transfer protein gene OsPht 1; The special primer sequence of 6 coding regions amplification is:

OsPT6-F：5’ATAA CCTAGGATGGGCGGCGGCGGCGGGGAG?3’

OsPT6-R：5’AATT CTCGAGCTACAGTACAGTTTGCAGGGGC?3’

Said gene OsPht1; 6 genetically engineered is used, and is meant the application aspect the available phosphorus utilising efficiency in improving soil.

Beneficial effect

1, a kind of rice phosphate transfer protein gene OsPht 1 is disclosed first; 6 genetically engineered is used.Transgenic experiments proves that the overexpression of this gene has improved paddy rice greatly and resisted low-phosphorous ability.

2, the present invention provides paddy gene OsPht1 first; The proteic engineering of 6 phosphate cotransporter is used.OsPht1; The protein of 6 coded by said gene imports plant with it as goal gene to the phosphorus high affinity, is expected to be applied to monocotyledonous genetic improvement.

3, the present invention provides rice Os Pht1 first; 6 proteic phosphate absorption and transport functions belong to reported first.The mRNA expression analysis shows OsPht1 under low-phosphorous condition; 6 genes still are that the expression amount of underground part has all improved about 7.5 times at the overground part of rice seedling.RNAi gene interference material shows, this gene underground part expression amount has reduced by 14.7% than wild-type, overground part has reduced by 26.1%, through incubation growth three all post analysis under low-phosphorous (10 μ M) condition of this material are found that the suction phosphorus total amount of this material is 75.9% of a wild-type, also promptly the mutant of this gene knockout causes paddy rice that phosphatic absorption is reduced 24.1%.Heterologous expression system studies show that OsPht1; 6 is high affine phosphate cotransporter albumen.

4, OsPht1 provided by the invention; 6 genes have the optimizing codon that monocotyledonss such as being suitable for paddy rice is expressed from paddy rice, and its genetically engineered recipient plant is except dicotyledons, as being more suitable for monocotyledonss such as paddy rice, corn, wheat outside soybean, cotton, the tobacco etc.

5, utilize OsPht1 provided by the invention; 6 genes make up plant expression vector as goal gene, wherein available any promotor is cauliflower mosaic virus (CAMV) 35S promoter, corn Ubiquitin promotor or other promotor for example, can comprise enhanser in case of necessity in this expression vector, no matter be transcriptional enhancer or translational enhancer.Can use selected marker for the evaluation of simplifying transformant and comprise enzyme antibiotics resistance, also can utilize the enzyme of the compound that colour-change (for example β-glucose sugar neuraminidase GUS) or luminous (for example luciferase) discern, also available unmarked selection.Used expression vector can use Ti-plasmids, Ri plasmid, plant viral vector etc.Method for transformation can be used through agrobacterium-mediated transformation, particle bombardment, pollen tube passage method or other method and transform plant.

Description of drawings

Fig. 1: rice phosphate transporter gene overexpression vector structural representation

Wherein 1:Ubiquitin promoter is the corn ubiquitin promoter; OsPht1; 6ORF is the coding region of phosphate cotransporter protein gene; Adh1 intron is an intron in the corn, is used to improve OsPht1; 6 expression intensity; NOS ter is the gene terminator

Fig. 2: OsPht1 under two kinds of phosphorus treatment condition; 6 at paddy rice different sites (root, blade) expression characteristic

Fig. 3: phosphorate and two kinds of phosphorus treatment condition of scarce phosphorus under, the commentaries on classics OsPht1 that grew 21 days; The different sites that β in 6 gene vaccines-glucose neuraminidase GUS expresses:

A, e: be respectively to phosphorate and scarce phosphorus paddy rice root tip; B, f: be respectively to phosphorate and scarce phosphorus paddy rice lateral root district; C, g: be respectively to phosphorate and scarce phosphorus paddy rice rhizome combining site; D, h: be respectively to phosphorate and the leaf of scarce phosphorus paddy rice; I: be the section that lacks the phosphorus tip of a root; J: be the section that lacks phosphorus paddy rice lateral root district; K: be the section that lacks the phosphorus blade.

Fig. 4: yeast heterogenous expression OsPht1; Functional verification behind 6 albumen

A: acid phosphatase intensity detection OsPht1; 6 gene pairss lack the complementation of the plain absorptive function of the proteic yeast mutants MB192 of the affine phosphorus transporter of endogenous height phosphorus; B: yeast transformant upgrowth situation under the condition of different pH; C: measure yeast Yp112-OsPht1 with isotropic substance 32P; 6 pairs of plain speed (pH 6.0) that absorb of phosphorus.Wherein solid and hollow dots is represented Yp112-OsPht1 respectively; 6 and express the yeast cell Yp112A1NE of empty carrier.

Fig. 5: OsPht1; The expression of 6 genes in the root system of RNAi mutant strain system and wild-type (WT), and ³²The radioautograph that P absorbs.Three strain systems of OsPT6 silent mutation body are respectively r6-1, r6-2 and r6-3

Embodiment

One, the acquisition of gene order

1, OsPht1; The acquisition of 6 genes encoding region sequences

The applicant goes up input OsPT6 at NCBI website (www.ncbi.nlm.nih.gov) and obtains the dna sequence dna that sequence number is one section high affine phosphorus transporter protein gene of coding paddy rice of AF536966.According to the international plant gene nomenclature of the molecular biology of plants council, Commission for Plant Gene Nomenclature of the International Society for Plant MolecularBiology) requirement, we are with this dna sequence dna called after OsPht1; 6.(be open reading frame, ORF) be 1605bp to this full length gene coding region of analysis revealed, 534 amino acid of encoding.This gene does not have intron.

2, OsPht1; The acquisition of 6 gene promoter sequences

According to existing rice Os Pht1; Its promoter region sequence (SEQ ID NO.1) is searched and obtained to 6 coding region sequences (AF536966) on NCBI website (www.ncbi.nlm.nih.gov), design has the pcr amplification reaction primer of AscI and PacI restriction enzyme site and protection base:

P1?5′CCGC TTAATTAACACCACATTGGAAGGCTAGGAACGA?3′

P2?5′TATA GGCGCGCCGCCAGCTTAATTGCTTGCTTTGTGA?3′

Get the about 50ng of the total DNA of 1 μ L and in 20 μ L systems, carry out the amplification of aim sequence.Amplification condition is: 94 ℃ of pre-sex change 4min, and then with 94 ℃ of sex change 45s, 55 ℃ of renaturation 45s, 72 ℃ are extended 2.5min, carry out 30 circulations, and last 72 ℃ are extended 10min.Reclaim amplified fragments by the Agrose gel electrophoresis, order-checking (2860bp, SEQ ID NO.1) is connected with the pUC18T carrier, and transformed into escherichia coli competent cell DH5 α is containing screening acquisition recombinant clone on the LB flat board of IPTG, X gal and penbritin.

Two, OsPht1; The spatial and temporal expression spectrum of 6 genes

1. make up the expression vector of promotor

More than be cloned in the OsPht1 on the pUC18T carrier; 6 promoter fragments are with rare restriction enzyme A scI and PacI double digestion.After electrophoresis reclaims, with same with AscI and PacI double digestion pS1aG-3 carrier (containing gus reporter gene) (Sch ü nmann, P.H.D., Richardson, A.E., Smith, F.W.and Delhaize, E.Characterization of promoter expression patterns derivedfrom the Pht1 phosphate transporter genes of barley (Hordeum vulgare L.) .J.Exp.Bot.2004,55,855-865) connect.Be converted into Agrobacterium EHA105 (Xu M then, Zhu L, Shou H, Wu P.A PIN1 family gene, OsPIN1, involved in auxin-dependent adventitious root emergence and tillering in rice.Plant Cell Physiol.2005,46:1674-81) in.

2. change OsPht1; Acquisition and the detection of 6 gene promoters (containing GUS) plant

The Agrobacterium that the commentaries on classics of step 1 acquisition is had expression vector, further be converted into paddy rice, the transfer-gen plant that obtains is carried out PCR to be detected, after the checking, carry out different phosphate concentration and handle experiment, detect β-glucose sugar neuraminidase (β-lucuronidase, position (the Jefferson of reporter gene expression of β-GUS), R.D., Kavanagh, T.A.and Bevan, M.W. GUS fusions:b-glucuronidase as a sensitiveand versatile gene fusion marker in highter plants.EMBO is J.19876,3901-3907), OsPht1 is determined in analysis report expression of gene position; 6 spatial and temporal expression spectrum.Find OsPht1; 6 under low-phosphorous (10 μ M) or scarce phosphorus condition epidermis and the endodermis cell at the tip of a root and lateral root place expression (Fig. 3) is all arranged, this and RT-PCR result match (Fig. 2).

Three, yeast heterogenous expression OsPht1; 6 albumen

1. make up yeast heterogenous expression carrier

Yeast mutants bacterial strain MB192, Yeast expression carrier p112A1NE (all see bright phoenix etc. the clone of rice phosphate transporter gene, expression and functional analysis. Chinese science C collects, and 2006,36:385-389385).EcoRI and NotI double digestion phosphorus transporter protein gene OsPht1; 6 cDNA clone is (available from Japanese National Agriculture bio-source Inst, National Institute of AgribiologicalSciences), condition of contact with reference to TaRaKa pMD19-T vector System carries out even reaction of enzyme, makes up yeast expression recombinant vectors p112A1NE-OsPht1; 6.The p112A1NE carrier comprises the amino acid selective marker.

2. zymic transforms

Picking yeast mutants MB192 mono-clonal in the YEPD liquid nutrient medium, under 30 ℃, when 250r/min is cultured to OD600 and is about 1.0-1.3, the collecting cell precipitation, the sterilized water of equivalent volumes precooling suspends again, centrifugal; The sterilized water suspended centrifugal of the precooling of 1/2 volume; Be suspended at last in the sorbyl alcohol of 1mol/L of precooling of 1/25 volume.For the changing effect that obtains, the dithiothreitol (DTT) that adds 25mmol/L is at room temperature handled 10min, and the sorbyl alcohol with an amount of 1mol/L washs yeast cell again, finally is suspended in the Sorbitol Solution USP of precooling of 1/200 volume.Get 5 μ L plasmid DNA and join in the 50 μ L competence yeast suspensions, mixing is transferred to electricity rapidly and transforms in the cup, and with 1.5kV, 200 Ω, 25 μ F carry out electricity and transform.Add 1mLYEPD liquid nutrient medium incubation 1h, the sorbyl alcohol with 1mol/L suspends again, is tiled on the YNB flat board, and the yeast after the conversion is called yeast transformant Yp112-OsPht1; 6; The positive control that contains the PH084 gene be wild-type yeast (see bright phoenix etc. the clone of rice phosphate transporter gene, expression and functional analysis. Chinese science C collects, 2006,36:385-389385); Negative control is for changeing two kinds of empty carrier Yp112A1NE and mutant strain MB192.

3. yeast complementation experiment

With positive control wild-type yeast, yeast transformant Yp112-OsPht1; 6 and negative control phosphorus transporter protein gene mutant MB192 be incubated on the YNB solid medium (not phosphorous element), not in the YNB substratum of phosphorous element, make its OD600 is 1.0 to picking list colony inoculation in liquid.Getting the 2ml culture is inoculated in respectively in the YNB substratum that contains the plain concentration of different phosphate (20 μ M, 60 μ M, 100 μ M) (test tube) after the washing of 3% glucose solution, cultivating in 30 ℃ of thermostat containers and making its OD600 is 1.0, add 2 purpurum bromocresoliss then as indicator, change in color in the cultivation of observation different phosphate concentration, the indicator change in color can reaction culture medium acidizing degree, show with this whether the zymic growth conditions is good, the result shows that mutant MB192 cell only at Pi concentration 100 μ M well-growns, has acid-reaction; And significantly be subjected to press down no acidic reaction at 20 μ M and the growth of 60 μ M cells.And contain p112-OsPht1; 6 cell can be on the substratum of 60 μ M Pi well-grown, and have acid-reaction (Fig. 4).According to function complementation experiment, reaching a conclusion is the coded protein mediated phosphate cotransporter of yeast cell film of OsPT6.

4. phosphorus transporter albumen OsPht1; 6 (SEQ ID NO.2) work under the meta-alkalescence condition equally

Be determined under the condition of different pH yeast to the absorbing state of phosphorus element.Experimental result shows OsPht1; The 6 best pH that grow in yeast are 6-7 (phosphorus transporter albumen OsPht1; 6 work under the meta-alkalescence condition equally), and its best PH＜5 (Fig. 4) of positive control wild-type yeast.This illustrates OsPht1; 6 phosphorus transporter albumen are that the proton gradient that depends on inside and outside the yeast cell film is carried out work for the absorption of phosphorus element, in this result and the plant materials phosphorus transporter albumen be one with proton mutually the conclusion of link coupled translocator be corresponding to.

5. the mensuration of phosphorus absorbed dose in the yeast growth process

Adopt isotope-labeled method to measure the uptake rate experiment of yeast strain to the phosphorus element, method is with reference to P.Martinez andPersson (Martinez P, Persson B L.Identification, cloning and characterization of aderepressible Na ⁺-coupled phosphate transporter in Saccharomyces cerevisiae.Mol Gen Genet, 1998,258:628-638).And calculate to find that by SigmaPlot10.0 the proteic Km of this phosphorus transporter is 97 μ M, maximum absorption speed is 0.41noml Pi (mg yeast cellsmin) ^-1(Fig. 4).

Four, OsPht1; Knocking out of 6 genes

1.RNAi the structure of expression vector

According to the high affine phosphate transfer protein gene OsPht 1 of paddy rice; The amplification of 6cDNA sequence (AF536966) design special primer is used for RNA interferential dna fragmentation, long 258bp (SEQ ID NO.5) for one section.And on the upstream and downstream primer, introduce restriction endonuclease sites KpnI, SpeI and BamHI, SacI respectively.Primer sequence is:

5’GGTC GGTACCACTAGTTACCATTTCACGGCCATC?3’

5’ATTA GGATCCGAGCTCGAGGGTGATGCCATAGACG?3’

Cloning with the cDNA that buys is template, carries out PCR, the PCR program with F and this a pair of primer of R earlier: 94 ℃ of pre-sex change 4min, and 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 20s, and after 30 circulations, 72 ℃ of 7min run glue and detect.The size of PCR product is 258bp, the PCR product is cut glue after agarose electrophoresis is separated reclaim, reclaim the back and carry out double digestion with SacI and SpeI, use SacI and SpeI double digestion pTCK303 plasmid (Wang Z simultaneously, Chen CHB, Xu YY, Jiang RX, Han Y, Xu ZHH, Chong K.A practical vector for efficient knockdown of gene expression in rice.Plant Molecular Biology Reporter.200422:409-417), reclaim fragment and carrier then respectively, the recovery back connects under 4 degree by T4 ligase enzyme (Promega company) spends the night, and is converted into 37 ℃ of overnight incubation in the DH5 α intestinal bacteria, select positive colony, order-checking; With BamHI and KpnI the PCR product that reclaims is carried out double digestion again, use the positive colony of the BamHI and the KpnI double digestion the first step simultaneously, the recovery back connects under 4 degree by T4 ligase enzyme (Promega company) spends the night, heat shock is converted into 37 ℃ of overnight incubation in the DH5 α intestinal bacteria, select positive colony, order-checking.OsPht1 like this; One section distinguished sequence of 6 is cloned into binary expression vector pTCK303 (Wang Z by two pairs of corresponding restriction enzyme sites respectively, Chen CHB, Xu YY, Jiang RX, Han Y, Xu ZHH, Chong K.A practical vector for efficientknockdown of gene expression in rice.Plant Molecular Biology Reporter.200422:409-417), order-checking correct after be converted in the EHA105 Agrobacterium.

2.RNAi the acquisition of transfer-gen plant

The commentaries on classics that obtains there is the Agrobacterium of expression vector, further is converted into paddy rice, the OsPht1 that obtains; The 6-RNAi transfer-gen plant carries out PCR and detects, and analyzes OsPht1 with RT-PCR; The OsPht1 of 6-RNAi rice seedling and wild-type rice seedling root; 6 genetic expressions found that: 3 OsPht1; The expression amount of 6-RNAi transgenic line is compared obvious decline with wild-type, this illustrates that we disturb (RNAi) technology to obtain three OsPht1 by RNA; The mutant of 6 gene knockouts, called after r6-1, r6-2 and r6-3 (Fig. 5).

Find through RNAi being knocked out material incubation growth three all post analysis under low-phosphorous (10 μ M) condition, the suction phosphorus total amount of this material only is 75.9% of a wild-type, simultaneously to the plant dry weight, system general length, the root system surface-area, root system volume, the morphological index of roots such as tip of a root number is studied, and has all found significantly reduced phenomenon.While and isotropic substance ³²The result of P absorption experiment conform to (Fig. 5).As seen OsPht1; The silence of 6 genes can significantly reduce the suction phosphorus total amount of rice plant under low-phosphorous (10 μ M) stress conditions, influences the phenotype of root simultaneously, has proved OsPht1; The significant role that 6 genes absorb and transport phosphorus nutrition in paddy rice.

Five, OsPht1; The overexpression plant of 6 genes

1, the structure of overexpression carrier

The coding region is OsPht1; 6 coding region (that is: OsPht1; 6 open reading frame);

Promotor is corn ubiquitin promoter (ubiquitin promoter) (Wang M-B, Li Z-Y, Matthews PR, Upadhyaya NM, Waterhouse PM.Improved vectors for Agrobacterium tumefaciens-mediated transformation of monocotplants.Acta Horticulturae.1998,461,401-405);

Binary expression vector is pS 1a-4 (Sch ü nmann, P.H.D., Richardson, A.E., Smith, F.W.and Delhaize, E.Characterization of promoter expression patterns derived from the Pht1 phosphate transporter genes ofbarley (Hordeum vulgare L.) .J.Exp.Bot.2004,55,855-865).

According to the high affine phosphoric acid salt transport protein gene OsPht1 of paddy rice; 6 cDNA sequence (AF536966), design primer amplification OsPht1; 6 open reading frame, and on the upstream and downstream primer, introduce restriction endonuclease sites AvrII respectively, and XhoI, primer sequence is:

OsPT6-F：5’ATAA CCTAGGATGGGCGGCGGCGGCGGGGAG?3’

OsPT6-R：5’AATT CTCGAGCTACAGTACAGTTTGCAGGGGC?3’

With the cDNA clone is that template is carried out PCR, and program is: 94 ℃ of pre-sex change 4 minutes, and 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 2min.After 30 circulations, 72 ℃ of 7min run glue and detect OsPht1; 6 PCR product size is 1605bp, the PCR product cloning is to pMD-19 carrier (Takara company), the correct back of order-checking imports transformed binary expression vector pS1a-4 (promotor that replaces original carrier to carry with ubiquitin promoter) by corresponding restriction enzyme site, is converted into then among the Agrobacterium EHA105.

2, the acquisition of overexpression transfer-gen plant

The commentaries on classics that step 1 is obtained has the Agrobacterium of expression vector, further is converted into paddy rice, and the transfer-gen plant that obtains is detected.PRELIMINARY RESULTS shows that this material its suction phosphorus total amount of incubation growth three all backs under low-phosphorous (10 μ M) condition is the nearly twice of wild-type, has improved the utilising efficiency of phosphorus element greatly.

In sum, the OsPht1 that provides of the inventor; 6 engineering is applied as reported first in the paddy rice.This gene protein not only is responsible for absorbing from soil and upwards transporting phosphoric acid salt in paddy rice, and is all playing an important role aspect phosphorus absorption, assimilation and the transhipment of rice paddy seed.Transgenic experiments proves that the overexpression of this gene has improved paddy rice greatly and resisted low-phosphorous ability.OsPht1; 6 can be used as goal gene imports plant, improves the plant tolerant to low-phosphorus ability, is applicable to that for cultivation the new rice variety of phosphorus lean soil provides guarantee.

SEQUENCE?LISTING

＜110〉Agricultural University Of Nanjing

＜120〉rice phosphate transfer protein gene OsPht 1; 6 genetically engineered is used

＜130〉specification sheets

<140>00

<141>2008-11-17

<160>9

<170>PatentIn?version?3.1

<210>1

<211>2860

<212>DNA

＜213〉Otyza sativa (paddy rice)

<220>

＜221〉rice phosphate transfer protein gene OsPht 1; 6 promotors

<222>(1)..(2860)

<223>

<400>1

ttctttgttc?ttcctccagg?ctttcttctc?ctgatctgat?ttcttggaga?ttaattacag 60

gatctccaga?caaatcataa?ccactattat?gctccaatat?tcatcaagag?gattccattt 120

tagtgacatt?ttactatcat?ccatgtccat?aataatttca?tactacatta?ttttagtgtt 180

tttccataat?ttgtgggtat?gccggtgcat?acccgacacc?cccggtccgc?tcctggttat 240

taataatact?gtattattca?tatttagcta?tgtgtaaatt?taggtttgaa?attttacgag 300

acggtaaaac?tgtgccatta?attaaatctt?tattatttcc?gtaaatatct?cattgggaat 360

taaggaagca?gaagccccct?gggcatacgt?gacacagcaa?ggggaaagta?aagcggagag 420

acttctgagg?ttaattagtt?gagaaaaaat?ggaggtgaag?tgggcgcggc?gctcaatcat 480

atcatgcatc?actgcatctg?cgtgcaccac?attggaaggc?taggaacgaa?agcatctcca 540

atctctcatt?gctgacctct?ttaaattaac?ccccttaatt?tgaccaccct?acgtaccagc 600

tttcatttct?taatttaatt?ctctggcttc?tgtattatat?tgacagtgct?cctatatata 660

tgtactttag?cgtggttagt?tatatattat?aacagcacgt?aatcactgct?cagcatgtac 720

ttaatttgtc?ccttggtaga?atgatcagcc?gatgcttttg?cacgatcagt?tcactgtgcc 780

atataggggc?tcccatgcat?catgaacaaa?ttaacatgac?cttcggtaag?gcggtactct 840

cgaaagtcgc?tattggggtt?gcacaaggga?tgagttcatc?ttcttctctc?ttattcctcc 900

tcctcatcaa?cctgtttcta?taggatgact?aggagtttgt?gggtggctag?tagcttgcag 960

ttatggtagg?acagagtgtc?tatgtcccgc?tgtagagctg?tggtgacagg?ccacacataa 1020

cagtgatagg?ctcggcgtta?gttcttttct?caagttggtg?gttgggagtc?gttagtttca 1080

tgctggtgag?tttttctttt?ctttcctaat?tgtagcctcc?tagagttgta?atattgtata 1140

ttttttcatg?ctatattaat?atgaagcctc?gcagctatct?catgtggttt?gttcaaaaaa 1200

aataacatga?tcaattgttg?tttgttgtgt?agtggtctct?ccggtgtcac?tatcggtgat 1260

ttgacaaaga?cactcccaat?gttgaatggt?gtaaagatag?tcatgtctcc?agtctttgca 1320

catatatata?atacatagag?tcaaagttta?agatcaaagg?taaccttaat?aagcgattga 1380

atgctctatg?tgatggaaat?gtgcatgacg?tctatagtcc?tttctaagac?tctaagagtg 1440

agttacaaac?cgcctttgct?acctgtacgt?tgattgagtt?ttagaaaaat?cgtagttgat 1500

tgatcaatca?tcaatctgtt?gttgatctaa?gggctatagc?tctatcttgt?acctcgagcc 1560

aagagggaga?catgataagg?agagggatat?gtcagagagg?actcgcgaca?acgtcctggt 1620

ggagatgggc?gggcggtggg?tgggggtgag?atcatgtggt?taggttgcaa?gggtgataga 1680

tctagcagcg?tgagccaccc?cgagatgaag?gagaaaacac?atatggattt?gttgatgaag 1740

agggtgatgg?cagtgatgtg?gagggaaaga?ggacagggat?aggaaaggct?tgtccagcct 1800

cgccggtgtc?agcgctggca?gtgcaaagag?gaatgccatc?acacgcgagt?caaagttggg 1860

acttagaacg?ttggtggcac?aagagacggg?atcaggagag?ggggaggcta?tgttaaaatt 1920

agattgttac?acaaataaca?atgtaatctg?agctatttaa?taaactatat?ataaaacatc 1980

aggcaactaa?tgaatggtca?agccgttatc?aattattctg?gatggtaact?ccctgccttc 2040

gatgcaggac?ggagtgtagc?gggggcccct?gtccgaccat?cccttgcgat?aagagttttt 2100

ttctttctca?gtaacttata?tttcctgtat?ttgtgttttt?tgtttctttt?ttttccttga 2160

cccctagcaa?cggccctctg?accgtttgcg?ttgtgtaacc?aaactctgtt?gtcttcttct 2220

aatatattga?cgtgcaatca?tttagcgcgt?tcgcgagaaa?aaaatggttt?ggatggttaa 2280

atcttactag?aaaccagaac?aagataggct?acgcaattag?caatggatgg?ttggcattag 2340

gtcatctaag?gtcaaaccga?cggagataca?tttgctgcat?aaatagcaac?tagcgtaata 2400

tgtgatgtga?tgtacttcct?acgtcttata?ataagtttat?tttttagcta?cttatatttg 2460

tctagaaata?agttaatttt?tagaataatt?atttgtatcg?gagtttatga?aagtaaaaag 2520

taattgtatt?tggagtacat?aaagtgagga?agtattgaga?tttgataaag?tagaggtatt 2580

ttagtttttt?tttattggta?cgtatgagat?tagtgaaaaa?taaatttatt?tgggaaggga 2640

tgtagtacct?agctactctt?gtaccagcta?gattaagtat?aaaccaaaaa?caacgggagt 2700

agtagtagta?agaatgtaaa?acggttccaa?cataacgcaa?caacggaacg?gttggatatt 2760

cggttgggag?gagaagggag?attccgtttg?agtaggttat?aaatagcaag?gaatacatac 2820

gtacgttcca?aatcatcaca?aagcaagcaa?ttaagctggc 2860

<210>2

<211>534

<212>PRT

＜213〉Oryza sativa (paddy rice)

<220>

＜221〉rice phosphate translocator OsPht1; 6

<222>(1)..(534)

<223>

<400>2

Met?Gly?Gly?Gly?Gly?Gly?Glu?Gln?Gln?Gln?Leu?Glu?Val?Leu?His?Ala

1 5 10 15

Leu?Asp?Val?Ala?Lys?Thr?Gln?Trp?Tyr?His?Phe?Thr?Ala?Ile?Val?Val

20 25 30

Ala?Gly?Met?Gly?Phe?Phe?Thr?Asp?Ala?Tyr?Asp?Leu?Phe?Cys?Ile?Ser

35 40 45

Leu?Val?Thr?Lys?Leu?Leu?Gly?Arg?Ile?Tyr?Tyr?Arg?Val?Asp?Gly?Ser

50 55 60

Pro?Ser?Pro?Gly?Thr?Leu?Pro?Pro?His?Val?Ser?Ala?Ser?Val?Asn?Gly

65 70 75 80

Val?Ala?Phe?Val?Gly?Thr?Leu?Ser?Gly?Gln?Leu?Phe?Phe?Gly?Typ?Leu

85 90 95

Gly?Asp?Lys?Leu?Gly?Arg?Lys?Arg?Val?Tyr?Gly?Ile?Thr?Leu?Met?Leu

100 105 110

Met?Val?Leu?Cys?Ser?Leu?Ala?Ser?Ala?Leu?Ser?Phe?Gly?His?Thr?Pro

115 120 125

Thr?Ser?Val?Met?Ala?Thr?Leu?Cys?Phe?Phe?Arg?Phe?Trp?Leu?Gly?Phe

130 135 140

Gly?Ile?Gly?Gly?Asp?Tyr?Pro?Leu?Ser?Ala?Thr?Ile?Met?Ser?Glu?Tyr

145 150 155 160

Ala?Asn?Lys?Lys?Thr?Arg?Gly?Ala?Phe?Ile?Ala?Ala?Val?Phe?Ala?Met

165 170 175

Gln?Gly?Phe?Gly?Ile?Ile?Thr?Gly?Gly?Leu?Val?Ala?Ile?Leu?Val?Ser

180 185 190

Ala?Ser?Phe?Arg?Ala?Ala?Phe?Pro?Ala?Pro?Pro?Ttr?Gly?Glu?Asp?Pro

195 200 205

Val?Ala?Ser?Thr?Pro?Pro?Gln?Ala?Asp?Phe?Val?Trp?Arg?Ile?Ile?Leu

210 215 220

Met?Leu?Gly?Ala?Leu?Pro?Ala?Ala?Leu?Thr?Tyr?Tyr?Trp?Arg?Thr?Lys

225 230 235 240

Met?Pro?Glu?Thr?Ala?Ayr?Tyr?Thr?Ala?Leu?Val?Ala?Asn?Asn?Ala?Lys

245 250 255

Gln?Ala?Ala?Ala?Asp?Met?Ser?Lys?Val?Leu?Gln?Val?Val?Glu?Met?Arg

260 265 270

Asn?Ile?Gly?Asn?Asn?Gly?Gly?Ser?Arg?Arg?Pro?Phe?Gly?Leu?Phe?Ser

275 280 285

Gly?Glu?Phe?Val?Arg?Arg?His?Gly?Leu?His?Leu?Val?Gly?Thr?Ser?Ala

290 295 300

Thr?Trp?Leu?Leu?Leu?Asp?Ile?Ala?Phe?Tyr?Ser?Gln?Asn?Leu?Phe?Gln

305 310 315 320

Lys?Asp?Ile?Phe?Ser?Ala?Val?Gly?Try?Ile?Pro?Lys?Ala?Ala?Thr?Met

325 330 335

Ser?Ala?Leu?Glu?Glu?Leu?Phe?Arg?Ile?Ala?Arg?Ala?Gln?Thr?Leu?Ile

340 345 350

Ala?Leu?Cys?Gly?Thr?Val?Pro?Gly?Tyr?Trp?Phe?Thr?Val?Ala?Leu?Ile

355 360 365

Asp?Val?Val?Gly?Arg?Phe?Lys?Ile?Gln?Ala?Val?Gly?Phe?Phe?Met?Met

370 375 380

Thr?Leu?Phe?Met?Leu?Thr?Leu?Ala?Leu?Pro?Tyr?His?His?Trp?Thr?Ala

385 390 395 400

Pro?Gly?Lys?Asn?His?Val?Gly?Phe?Leu?Leu?Leu?Tyr?Gly?Leu?Thr?Phe

405 410 415

Phe?Phe?Ala?Asn?Phe?Gly?Pro?Asn?Ser?Thr?Thr?Phe?Ile?Val?Pro?Ala

420 425 430

Glu?Ile?Phe?Pro?Ala?Arg?Leu?Arg?Ala?Thr?Cys?His?Gly?Ile?Ser?Ala

435 440 445

Ala?Ser?Gly?Lys?Leu?Gly?Ala?Ile?Val?Gly?Ser?Phe?Gly?Phe?Leu?Tyr

450 455 460

Leu?Ala?Gln?Ser?Pro?Asp?Arg?Ser?Lys?Thr?Glu?His?Gly?Tyr?Pro?Pro

465 470 475 480

Gly?Ile?Gly?Val?Arg?Asn?Ser?Leu?Phe?Leu?Leu?Ala?Ala?Cys?Asn?Leu

485 490 495

Leu?Gly?Leu?Leu?Phe?Thr?Phe?Leu?Val?Pro?Glu?Ser?Lys?Gly?Lys?Ser

500 505 510

Leu?Glu?Glu?Met?Ser?Gly?Asp?Ala?Glu?Ala?Gln?Glu?Glu?Ala?Pro?Pro

515 520 525

Pro?Leu?Gln?Thr?Val?Leu

530

<210>3

<211>31

<212>DNA

＜213〉synthetic

<220>

＜221〉primer OsPT6-F

<222>(1)..(31)

<223>

<400>3

ataacctagg?atgggcggcg?gcggcgggga?g 31

<210>4

<211>32

<212>DNA

＜213〉synthetic

<220>

<221>OsPT6-R

<222>(1)..(32)

<223>

<400>4

aattctcgag?ctacagtaca?gtttgcaggg?gc 32

<210>5

<211>258

<212>DNA

＜213〉Oryza sativa (paddy rice)

<220>

＜221〉be used for RNA interferential dna fragmentation

<222>(1)..(258)

<223>

<400>5

taccatttca?cggccatcgt?ggtggccgga?atggggttct?tcaccgacgc?ctatgacctc 60

ttctgcatct?ccctcgtcac?caagctgctg?ggccgcatct?actaccgcgt?cgacgggtcc 120

ccgtcccccg?gcacgctccc?cccgcacgtc?tccgcctccg?tcaacggcgt?ggccttcgtg 180

ggcacgctct?cagggcaact?cttctttggc?tggctgggcg?acaagctcgg?ccgtaagcgc 240

gtctatggca?tcaccctc 258

<210>6

<211>37

<212>DNA

＜213〉synthetic

<220>

＜221〉a promoter sequence primer left side

<222>(1)..(37)

<223>

<220>

＜221〉promoter sequence primer P1

<222>(1)..(37)

<223>

<400>6

ccgcttaatt?aacaccacat?tggaaggcta?ggaacga 37

<210>7

<211>37

<212>DNA

＜213〉synthetic

<220>

＜221〉promoter sequence primer P2

<222>(1)..(37)

<223>

<400>7

tataggcgcg?ccgccagctt?aattgcttgc?tttgtga 37

<210>8

<211>34

<212>DNA

＜213〉synthetic

<220>

＜221〉be used for RNA interferential dna fragmentation primer left end

<222>(1)..(34)

<223>

<400>8

ggtcggtacc?actagttacc?atttcacggc?catc 34

<210>9

<211>35

<212>DNA

＜213〉synthetic

<220>

＜221〉be used for RNA interferential dna fragmentation primer right-hand member

<222>(1)..(35)

<223>

<400>9

attaggatcc?gagctcgagg?gtgatgccat?agacg 35

Claims (4)

1, rice phosphate transfer protein gene OsPht 1; 6 engineering is used, and the nucleotide sequence accession number of this gene is AF536966.

2, the rice phosphate translocator OsPht1 of the described genetic expression of claim 1; 6 application, this proteic aminoacid sequence are SEQ ID NO.2.

3, the described rice phosphate transfer protein gene OsPht 1 of claim 1; The special primer sequence of 6 coding regions amplification is:

OsPT6-F：5’ATAA CCTAGGATGGGCGGCGGCGGCGGGGAG?3’

OsPT6-R：5’AATTCTCGAGCTACAGTACAGTTTGCAGGGGC?3’

4, the described gene OsPht1 of claim 1; 6 genetically engineered is used, and it is characterized in that the application aspect the available phosphorus utilising efficiency in improving soil of this gene.

Images