CN103087167B - Protein derived from diatom and related to plant nitrogen use and growth as well as coding gene and application thereof - Google Patents

Abstract

The invention discloses a protein derived from diatom and related to plant growth as well as a coding gene and application thereof. The protein is named as AMT of a) or b) as follows: a) a protein of amino acid sequence described as SEQ ID No.2; and b) a protein, which is of replacing and/or deleting and/or adding one or a plurality of amino acid residues in SEQ ID No.2, related to usage of plant nitrogen and derived by a). The experiment proves that plant height, tiller number and kernel weight per plant of trans-AMT gene rice are obviously higher than receptor rice for lack of nitrogen, which proves that AMT gene is capable of obviously improving utilization efficiency of transgenic rice to nitrogen. Therefore, the gene plays an important role in plant nitrogen absorption area and breeding work of anti-low nitrogen plant varieties and the application prospect is wide.

Description

What derive from diatom utilizes with plant nitrogen and protein and encoding gene and the application of growth correlation

Technical field

The present invention relates to derive from utilizing with plant nitrogen and protein and encoding gene and the application of growth correlation of diatom.

Background technology

For a long time, rice breeding as main breeding objective, in pursuing high yield, causes increasing considerably of amount of application of nitrogen fertilizer mainly with high yield, fertilizer resistance anti-lodging.China has consumed the nitrogenous fertilizer in the world 30% to account for the arable land in the world 10%.Wherein, paddy rice is again that consumption amount of nitrogenous fertilizer is maximum, accounts for 24% left and right of the total amount of nitrogen in the whole nation.By 3,000 ten thousand hectares of calculating of the long-term cultivated area of rice in China, every year to 1,800,000 tons, less waste nitrogenous fertilizer, the cost of investment that this has not only improved peasant's Rice Cropping, causes that Higher output is not accompanied by a higher income, but also has seriously polluted environment.According to statistics, the dissolved inorganic nitrogen of the annual output of the Changjiang river, the Yellow River and the Zhujiang River reaches 97.5 ten thousand tons, and wherein 90% from agricultural, and fertilizer nitrogen has accounted for 50%.The pollution that this causes soil, water source, physical environment, has arrived extremely severe stage.If be cloned into the gene that can promote paddy growth under low nitrogen condition, will establish basic substance for solving the excessive problems such as causing body eutrophication, serious environment pollution, waste social resources of using of nitrogenous fertilizer in Rice Production.

Summary of the invention

Technical problem to be solved by this invention be to provide one with protein and encoding gene and the application of the utilization of plant nitrogen and/or growth correlation.

Protein provided by the present invention, name is called AMT, derives from cylindrotheca clostetium (Cylindrothecafusiformis), is following protein a) or b):

A) protein of aminoacid sequence as shown in SEQ ID No.2;

B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and utilize with plant nitrogen and/or growth correlation by a) derivative protein.

Wherein, SEQ ID No.2 is made up of 513 amino-acid residues.

Albumen in above-mentioned in order to make (a) is convenient to purifying, and N-terminal that can the protein that the aminoacid sequence shown in sequence 2 forms in by sequence table or C-terminal connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6(is generally 5)	RRRRR
Poly-His	2-10(is generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tagII	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

AMT in above-mentioned (b) can first synthesize its encoding gene, then carries out biological expression and obtain.The encoding gene of AMT in above-mentioned (b) can be by lacking the codon of one or several amino-acid residue in the DNA sequence dna shown in the 7-1548 position Nucleotide of SEQ ID No.1, and/or carry out the missense mutation of one or several base pair, and/or the encoding sequence that connects the label shown in table 1 at its 5 ' end and/or 3 ' end obtains.

The nucleic acid molecule of coding AMT also belongs to protection scope of the present invention.

Wherein, described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.

Described nucleic acid molecule specifically can be following 1)-5) in the gene shown in arbitrary:

1) DNA molecular of coding AMT;

2) its encoding sequence is the DNA molecular of position, the 7-1548 position Nucleotide of SEQ ID No.1;

3) under stringent condition with 1) DNA molecule hybridize limiting and the DNA molecular of coding AMT;

4) with 1) DNA molecular that limits has more than 90% homology and the DNA molecular of coding AMT;

5) with 1) to 4) in the DNA molecular of arbitrary described DNA molecular reverse complemental.

Above-mentioned stringent condition can be with 6 × SSC, the solution of 0.5%SDS, and at 65 DEG C, hybridization, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively washes film once.

Wherein, SEQ ID No.1 is made up of 1557 Nucleotide, and its encoding sequence is 7-1548 position, the protein shown in coding SEQID No.2.

Following 1)-4) in any biomaterial also belong to protection scope of the present invention:

1) expression cassette of the nucleic acid molecule that contains the AMT that encodes;

2) recombinant vectors of the nucleic acid molecule that contains the AMT that encodes;

3) recombinant microorganism of the nucleic acid molecule that contains the AMT that encodes;

4) transgenic cell line of the nucleic acid molecule that contains the AMT that encodes.

In above-mentioned biomaterial, 1) expression cassette of the described nucleic acid molecule that contains the AMT that encode, refers to the DNA that can express AMT in host cell, and this DNA not only can comprise the promotor that starts AMT genetic transcription, also can comprise the terminator that termination AMT transcribes.Further, described expression cassette also can comprise enhancer sequence.2) recombinant expression vector of the expression AMT that the multiple clone site insertion AMT encoding gene that the recombinant vectors of the described nucleic acid molecule that contains the AMT that encodes specifically can be at carrier pUT3301 obtains.3) described recombinant microorganism specifically can be bacterium, yeast, algae and fungi.Wherein, bacterium can be from Escherichia (Escherichia), Erwinia (Erwinia), agrobacterium tumefaciens belongs to (Agrobacterium), Flavobacterium (Flavobacterium), Alcaligenes (Alcaligenes), Rhodopseudomonas (Pseudomonas), Bacillus (Bacillus) etc.4) described transgenic cell line does not comprise the reproductive material of plant.

The present invention also protects the nucleic acid molecule of coding AMT, nucleic acid molecule or the application of above-mentioned any biomaterial in regulating plant nitrogen utilizes and/or grows of coding AMT.

In above-mentioned application, described plant can be monocotyledons or dicotyledons.

In above-mentioned application, described regulating plant growth is at least one in A to C:

The individual plant seed weight of A, adjusting and controlling rice;

The tiller number of B, adjusting and controlling rice;

The plant height of C, adjusting and controlling rice.

In above-mentioned application, described regulating plant growth is regulating plant growth under nitrogen stress condition.Described nitrogen stress is to instigate acceptor paddy rice to occur the nitrogen form of nitrogen stress symptom.

The present invention also provides the method for utilizing AMT gene to cultivate transgenic paddy rice.

The method of cultivation transgenic paddy rice provided by the present invention, comprises in acceptor paddy rice and imports AMT gene, obtains the tolerance of nitrogen stress higher than described acceptor paddy rice and/or growth higher than the transgenic paddy rice of described acceptor paddy rice;

Described growth has following 1 higher than the transgenic paddy rice of described acceptor paddy rice)-3) in the transgenic paddy rice of arbitrary proterties: 1) individual plant seed is great in described acceptor paddy rice; 2) tiller number is greater than described acceptor paddy rice; 3) plant height is greater than described acceptor paddy rice.

In the method for above-mentioned cultivation transgenic paddy rice, described transgenic paddy rice and described acceptor paddy rice be growth under normal operation before from sowing to 41 heart stages of leaf, all under nitrogen stress condition, grows from 41 heart stages of leaf to ripe whole period.

Described nitrogen stress is to instigate acceptor paddy rice to occur the nitrogen form of nitrogen stress symptom.

Wherein said AMT gene can first be modified as follows, then imports in recipient plant, to reach better expression effect:

1) modify according to actual needs and optimize, so that gene efficient expression; For example, the codon that can have a preference for according to recipient plant changes its codon to meet plant-preference in the aminoacid sequence that keeps AMT gene of the present invention; In optimizing process, preferably can make to keep certain GC content in the encoding sequence after optimizing, to realize best the high level expression of quiding gene in plant, wherein GC content can be 35%, more than 45%, more than 50% or more than approximately 60%;

2) modify the gene order of contiguous initial methionine, so that translate effectively initial; For example, utilize known effective sequence in plant to modify;

3) be connected with the promotor of various expression of plants, be beneficial to its expression in plant; Described promotor can comprise that composing type, induction type, sequential regulate, grow adjusting, Chemical Regulation, tissue preferably and tissue-specific promoter; The selection of promotor will be along with expression time and space requirement and is changed, and depends on target species; The for example specific expressing promoter of tissue or organ, acceptor in what period of growing is determined as required; Although it is operational having proved to derive from many promotors of dicotyledons in monocotyledons, vice versa, but ideally, select the expression of dicotyledons promotor for dicotyledons, monocotyledonous promotor is for the expression of monocotyledons;

4), with applicable Transcription Termination sub-connection, also can improve the expression efficiency of gene of the present invention; For example derive from the tml of CaMV, derive from the E9 of rbcS; Any known available terminator working in plant can be connected with gene of the present invention;

5) introduce enhancer sequence, for example, for example, as intron sequences (deriving from Adhl and bronzel) and virus leader sequence (deriving from TMV, MCMV and AMV).

Described AMT gene can import object plant by AMT expression casette or the AMT that contains described AMT expression casette expression vector.

The expression casette of AMT described in the present invention all can contain described AMT gene and start the promotor of described AMT genetic transcription.The expression casette of AMT described in the present invention all refers in host cell, to express the DNA of the AMT shown in SEQ ID No.2, and this DNA not only can comprise the promotor that starts described AMT genetic transcription, also can comprise the terminator that stops described AMT genetic transcription.Further, described AMT expression casette also can comprise enhancer sequence.Can be used for promotor of the present invention includes but not limited to: constitutive promoter, the promotor that tissue, organ and growth are special, and inducible promoter.The example of promotor includes but not limited to: the constitutive promoter 35S of cauliflower mosaic virus; From the wound-induced type promotor of tomato, leucine aminopeptidase (" LAP ", the people such as Chao (1999) Plant Physiol120:979-992); From chemical inducible promoter of tobacco, pathogeny 1 (PR1) (by Whitfield's ointment and BTH (diazosulfide-7-carbothioic acid carbothiolic acid S-methyl esters) induction) that be correlated with; Tomato proteinase inhibitor II promotor (PIN2) or LAP promotor (all available jasmonic acid Yue ester inductions); Heat-shocked promotor (United States Patent (USP) 5,187,267); Tsiklomitsin inducible promoter (United States Patent (USP) 5,057,422); Seed specific promoters, as Millet Seed specificity promoter pF128(CN101063139B (Chinese patent 200710099169.7)), the special promotor of seed storage protein matter (for example, phaseollin, napin, the promotor (people (1985) EMBOJ.4:3047-3053 such as Beachy) of oleosin and soybean betaconglycin).All reference cited herein all quote in full.Suitable transcription terminator includes but not limited to: Agrobacterium rouge alkali synthetase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator, tml terminator, pea rbcSE9 terminator and nopaline and octopine synthase terminator (referring to, for example: the people (I such as Odell ⁹⁸⁵) Nature313:810; The people such as Rosenberg (1987) Gene, 56:125; The people such as Guerineau (1991) Mol.Gen.Genet, 262:141; Proudfoot (1991) Cell, 64:671; The people Genes Dev. such as Sanfacon, 5:141; The people such as Mogen (1990) PlantCell2:1261; The people such as Munroe (1990) Gene91:151; The people such as Ballad (1989) Nucleic Acids Res.17:7891; The people such as Joshi (1987) Nucleic Acid Res., 15:9627).In an embodiment of the present invention, the promotor that starts described AMT genetic transcription in described AMT expression casette is Ubiquitin promotor, and the terminator that stops described AMT genetic transcription is NOS terminator.

Wherein, the nucleotide sequence of Ubiquitin promotor can be the 7-1992 position of SEQ ID No.3 or SEQ ID No.3.SEQ ID No.3 is made up of 1998 Nucleotide, and 1-6 position is enzyme recognition site, and 7-1992 position is Ubiquitin promotor, and 1993-1998 position is enzyme recognition site.The nucleotide sequence of NOS terminator (T-NOS) can be the 7-759 position of SEQID No.4 or SEQ ID No.4.SEQ ID No.4 is made up of 765 Nucleotide, and 1-6 position is enzyme recognition site, and 7-759 position is T-NOS, and 760-765 position is enzyme recognition site.

The recombinant expression vector that available existing plant expression vector construction contains described AMT expression casette.Described plant expression vector comprises double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.As pROKII, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb(CAMBIA company) etc.Described plant expression vector also can comprise 3 ' end untranslated region of foreign gene, comprises the DNA fragmentation of polyadenylic acid signal and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor, as Agrobacterium crown-gall nodule induction (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean storage protein gene) 3 ' holds the non-translational region of transcribing all to have similar functions.While using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can synthesize.Translation initiation region can be from transcription initiation region or structure gene.For the ease of transgenic plant cells or plant are identified and are screened, can process plant expression vector used, the coding that can express in plant as added can produce the enzyme of colour-change or the gene (gus gene of luminophor, luciferase genes etc.), antibiotic marker gene (as is given the nptII gene to kantlex and associated antibiotic resistance, give the bar gene to weedicide phosphinothricin resistance, give the hph gene to microbiotic hygromycin resistance, with the dhfr gene of giving methatrexate resistance, give the EPSPS gene to glyphosate resistance) or anti-chemical reagent marker gene etc. (as anti-weedkiller gene), the mannose-6-phosphate isomerase gene of metabolism seminose ability is provided.

In an embodiment of the present invention, described AMT gene imports object plant by the AMT expression vector that contains described AMT expression casette.Described AMT expression vector is the recombinant expression vector pAMT3301 that inserts the expression AMT that AMT encoding gene expression cassette obtains in the multiple clone site of carrier pCAMBIA3301.

Described AMT expression vector can be by using Ti-plasmids; plant virus carrying agent; directly delivered DNA; microinjection, the conventional biotechnological means such as electroporation imports vegetable cell (Weissbach, 1998; Method for Plant Molecular Biology VIII; Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

Described method also comprises the plant of the described encoding gene of screening expression from the plant of the encoding gene of the AMT shown in importing SEQ ID No.2, obtains the step of described transgenic plant.

Described transgenic plant are interpreted as and not only comprise the first-generation transgenic plant that described gene transformation object plant is obtained, also comprise its filial generation.For transgenic plant, can in these species, breed this gene, also can this transgenosis be entered with traditional breeding method to other kind of same species, in commercial variety.Described transgenic plant comprise seed, callus, whole plant and cell.

Experiment showed, under the condition of nitrogen stress, the plant height, tiller number and the individual plant seed that turn AMT trans-genetic hybrid rice are heavily significantly higher than acceptor paddy rice.Illustrate that AMT gene can significantly improve the utilising efficiency of transgenic paddy rice to nitrogen, this gene, by playing a significant role in the breeding process of plant nitrogen fertilizer absorption field and breeding low nitrogen resisting plant variety, has a extensive future.

Brief description of the drawings

Fig. 1 is Hind III and the BamHI double digestion electrophoretogram of pU3301.

1 is λ DNA/EcoRI+HindIII Marker; 2 is Hind III and the BamHI double digestion product of pU3301; Arrow shows Ubiquitin promoter fragment.

Fig. 2 is BamHI and the EcoRI double digestion electrophoretogram of pUT3301.

1 is Quick-load1KD λ DNA ladder; 2 is BamHI and the EcoRI double digestion product of pUT3301; Arrow shows T-NOS fragment.

Fig. 3 is the pcr amplification product electrophoretogram of AMT gene.

1 is Quick-load1KD λ DNA ladder, and 2 for not adding the contrast of template, and 3 is the pcr amplification product of AMT gene.Arrow shows the PCR product of AMT gene.

Fig. 4 is the BamHI single endonuclease digestion electrophoretogram of pMD19-AMT.

1: λ DNALadder; The BamHI single endonuclease digestion result of 2:pMD19-AMT.Arrow shows AMT gene fragment.

Fig. 5 is the restriction enzyme digestion and electrophoresis collection of illustrative plates of pAMT3301.

1 is λ DNA molecular amount standard; 2: be SacI single endonuclease digestion; 3 is BamHI single endonuclease digestion.

Fig. 6 is the T-DNA part-structure schematic diagram of pAMT3301.

Fig. 7 is that the PCR that turns the Basta resistant rice plant of pAMT3301 detects electrophoretogram.

1: λ DNAMarker; 2 to 7: the Basta resistant rice plant pcr amplification that turns pAMT3301; 8: negative control; 9: positive control, 10: acceptor paddy rice (not transgenosis) pcr amplification.

Fig. 8 is that the GUS that turns the positive transfer-gen plant of AMT of pAMT3301 detects.

A, c, e: the positive transfer-gen plant of AMT that turns pAMT3301; B, d, f: Japan is fine.

Fig. 9 is that the RT-PCR that turns pAMT3301 paddy rice T1 generation detects.

1: λ DNA/EcoRI+HindIII Marker; In 2:T1 generation, turns pAMT3301 paddy rice S21-2; In 3:T1 generation, turns pAMT3301 paddy rice S25-1; In 4:T1 generation, turns pAMT3301 paddy rice S49-1; 5: acceptor paddy rice (not transgenosis).

Figure 10 is that T1 is for the fine rice field Basta resistance screening picture of AMT gene masculine transgenosis Japan.

Embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.

PUT3301 in following embodiment builds as follows:

1, build pU3301

With Hind III and BamHI enzyme cut SEQ ID No.3 Ubiquitin promoter fragment insert pCAMBIA3301(Beijing Baeyer enlightening Bioisystech Co., Ltd) Hind III and BamHI site obtain recombinant vectors pU3301.SEQID No.3 is made up of 1998 Nucleotide, and 1-6 position is enzyme recognition site, and 7-1992 position is Ubiquitin promotor, and 1993-1998 position is enzyme recognition site.

PU3301 obtains the Ubiquitin promoter fragment (Fig. 1) of about 2000bp through Hind III and BamHI double digestion, illustrate that pU3301 is that Ubiquitin promotor and Ω enhanser fragment are inserted the Hind III of pCAMBIA3301 and the recombinant vectors that BamHI site obtains.

2, build pUT3301

Cut the T-NOS fragment of SEQ ID No.4 with BamHI and EcoRI enzyme, BamHI and the EcoRI site of T-NOS fragment being inserted to pU3301 obtain recombinant vectors pUT3301.SEQ ID No.4 is made up of 765 Nucleotide, and 1-6 position is enzyme recognition site, and 7-759 position is T-NOS, and 760-765 position is enzyme recognition site.

PUT3301 obtains the T-NOS fragment (Fig. 2) of 765bp through BamHI and EcoRI double digestion, illustrate that pUT3301 is that T-NOS fragment is inserted the BamHI of pU3301 and the recombinant vectors that EcoRI site obtains.

The clone of embodiment 1, AMT gene and functional verification

One, the clone of AMT gene

1. extract total RNA of diatom

Use the TRIZOL of Invitrogen company ^rreagent test kit, reference reagent box specification sheets extracts total RNA of cylindrotheca clostetium (Cylindrothecafusiformis), and concrete grammar comprises the following steps:

1) get 50-100mg cylindrotheca clostetium (Cylindrothecafusiformis), be placed in liquid nitrogen grind into powder, proceed in 1.5mL centrifuge tube.

2) add 1mL TRIZOL Reagent fully to mix, room temperature is placed 5min.

3) add 200 μ l chloroforms, vibration 15s, room temperature is placed 2-3min, 4 DEG C, the centrifugal 10min of 12000g.

4) get supernatant, add 500 μ l Virahols, room temperature is placed 10min, and 4 DEG C, the centrifugal 5min of 12000g, in the RNA precipitation of the visible white plates in centrifuge tube bottom.

5) abandon supernatant, carefully add 1mL70% ethanol, do not destroy RNA flaky precipitate, after 5s with sample injector by whole liquid sucking-offs.

6) room temperature is placed 5-10min and is made ethanol volatilization (do not allow it completely dry, otherwise affect solvability), adds 20 μ lDEPC water dissolution precipitations, obtains the total RNA of diatom.

2. the synthetic cDNA of reverse transcription

The total RNA of diatom obtaining taking step 1 is template, and with the GeneRacer test kit of Invitrogen company, the reverse transcription of reference reagent box specification sheets becomes its cDNA, and concrete steps are as follows:

1) get the total RNA10 μ l of cylindrotheca clostetium (Cylindrothecafusiformis), add 1 μ l Gene Racer Oligo dT Primer, 1 μ l dNTPs, 1 μ l sterile distilled water.

2) 65 DEG C of temperature are bathed 5min to remove RNA secondary structure, and ice bath 5min is of short duration centrifugal.

3) add successively 4 μ l5 × the first chain damping fluids, 1 μ l0.1M DTT, 1 μ l RNaseOut ^tM, 1 μ lSuperScript ^tMiII RT damping fluid to cumulative volume is 20 μ l, mixes with pipettor.

4) of short duration centrifugal after, 50 DEG C temperature bathe 50min.

5) 70 DEG C of temperature are bathed 15min, place 2min stopped reaction on ice, of short duration centrifugal.

6) add 1 μ l RnaseH, 37 DEG C of temperature are bathed 20min, of short duration centrifugal, obtain the cDNA of diatom, can be immediately for pcr amplification or-20 DEG C of preservations.

3. the pcr amplification of goal gene

The cDNA obtaining taking step 2 is template, PA5:5 '-GGATCCATGGCTGAGTTTGATAAC-3 ' and PA3:5 '-GGATCCTTACTAGGCGGTGTCCTC-3 ' (primer PA5 and PA3 design according to AMT1) are for primer carries out pcr amplification, and PCR reaction conditions is: 95 DEG C of 5min; 94 DEG C of 30s, 65 DEG C of 90s, 72 DEG C of 2min, after 30 circulations, 72 DEG C are extended 10min.After reaction finishes, PCR product is carried out to 1% agarose gel electrophoresis detection, detected result as shown in Figure 3, has an obvious amplified band at 1557bp place.

Gel reclaims test kit purified pcr product, carries out the cloning and sequencing of object fragment with carrier pMD19-Tsimple test kit.Sequencing result is shown to the recombinant vectors called after pMD19-AMT of the DNA molecular (PCR product) that contains SEQ ID No.1.The nucleotide sequence of the cDNA gene of AMT is as shown in SEQ ID No.1, and its encoding sequence is 7-1548 position Nucleotide, the a-protein MT of its encoding amino acid sequence as shown in SEQ ID No.2 in sequence table.

The BamHI single endonuclease digestion electrophoretogram of pMD19-AMT as shown in Figure 4, shows that pMD19-AMT obtains the AMT gene fragment of 1557bp and the carrier segments of 2692bp through BamHI single endonuclease digestion.

Two build the plant expression vector of AMT gene

PMD19-AMT BamHI single endonuclease digestion, the AMT gene fragment of recovery 1557bp, pUT3301 uses BamHI single endonuclease digestion equally, reclaims carrier segments and is connected with AMT gene fragment.Verify with BamHI single endonuclease digestion whether AMT gene is connected into, the direction of inserting with SacI checking gene, if cut out the band of 1360bp, illustrates that AMT gene is that forward inserts.The recombinant vectors called after pAMT3301 that AMT gene forward is inserted.The enzyme of pAMT3301 is cut the result as shown in Figure 5, and pAMT3301, through BamHI single endonuclease digestion, obtains the fragment of 1557bp, obtains the fragment of 1360bp through SacI single endonuclease digestion.As shown in Figure 6, the promotor that starts AMT genetic transcription in AMT expression casette is Ubiquitin promotor to the T-DNA part of pAMT3301, and the terminator that stops described AMT genetic transcription is NOS terminator.

Three, the genetic transformation of paddy rice

1, the conversion agrobacterium tumefaciens AGLI of plant expression vector pAMT3301

Adopt electric shock conversion method, be 18KV/cm in strength of electric field, electric capacity 25F, under the condition of resistance 200 Ω, pAMT3301 plant expression vector is imported to agrobacterium tumefaciens AGLI(general as spit of fland biotechnology (Beijing) company limited) in competent cell, bacterium liquid is coated on the YEB solid medium that contains kantlex (Kan) and Rifampin (Rif), the dark 2-3d that cultivates at 28 DEG C of temperature, picking list bacterium colony carries out PCR detection.Obtain the restructuring Agrobacterium AGLI/pAMT3301 that contains pAMT3301.The restructuring Agrobacterium AGLI/pUT3301 that preparation contains pUT3301 according to the method described above simultaneously.

2, the induction of Rice Callus

The ripe fine seed of paddy rice Japan shells, in 70% ethanol, soak 1min, then 20min sterilizes in 1% clorox, afterwards again with 1% clorox sterilization 15min, sterile water wash 4-5 time, finally sucks the moisture on seed surface with aseptic filter paper, after dry, be inoculated in (MS+2 on inducing culture, 4-D4mg/L, pH5.8), 28 DEG C of dark 30d that cultivate.Get uniform particles, the tissue that meets flushing proceeds to subculture medium (MS+2,4-D2mg/L, pH5.8), secretly cultivates one week.

3, the cultivation of restructuring Agrobacterium

By restructuring Agrobacterium AGLI/pAMT3301 bacterium liquid or restructuring Agrobacterium AGLI/pUT3301 all be coated in YEB solid medium (Kan50mg/L+Rif50mg/L), 28 DEG C of cultivation 2d secretly.The restructuring Agrobacterium growing is scraped to (AAM+AS100 μ mol/L, pH5.2) in suspension medium, and 2-3h is cultivated in 28 DEG C of concussions, and regulating bacterial concentration is a certain OD between 0.12-0.15 ₆₀₀value, in order to the use of conversion.

4, infecting together of Rice Callus cultivated

By in the callus access 100ml triangular flask after subculture, add the restructuring Agrobacterium bacterium liquid modulating, soak 20min, constantly rock during this time triangular flask.After infecting, outwell bacterium liquid, callus is placed on aseptic filter paper, blot surperficial bacterium liquid, be linked into subsequently (N in the common culture medium that is covered with aseptic filter paper ₆+ 6BA2mg/L+AS100 μ mol/L, pH5.8), 26 DEG C of dark cultivations three days.

Callus after cultivating altogether is first used aseptic water washing 3-5 time, then is dipped in the sterilized water containing cephamycin (250mg/L) and soaks 30min, then callus is blotted with aseptic filter paper, must make callus complete drying.The callus being dried is inoculated in to the upper (N of screening culture medium S1 ₆+ 6BA2mg/L+Cef200mg/L+Basta50mg/L, pH5.8), 28 DEG C of dark cultivations two weeks.The callus growing fine of the upper survival of picking S1 is placed in S2 substratum (N ₆+ 6BA2mg/L+Cef100mg/L+Basta50mg/L, pH5.8), continue secretly to cultivate, to growing newborn kanamycin-resistant callus tissue, about approximately two weeks.

5, pre-differentiation and differentiation

The newborn resistant calli growing on S2 is placed in to pre-division culture medium (N ₆+ 6BA2mg/L+NAA1mg/L+ABA5mg/L+Cef50mg/L, pH5.8), 28 DEG C of dark cultivations one week, are inoculated in (N on division culture medium subsequently ₆+ 6BA2mg/L+NAA1mg/L, pH5.8), first dark cultivation one day, then cultivates under light (illumination 12h/d), two weeks subcultures once, until grow resistance seedling.

6, the acquisition of transgenic paddy rice seedling

The resistance seedling growing in differentiation culture process is placed in to root media (1/2MS ₀+ Basta50mg/L, pH5.8), under 28 DEG C of light, cultivate (illumination 12h/d), the PCR that carries out goal gene after blade is grown up detects and GUS detection.

Four, turn the detection of base AMT trans-genetic hybrid rice

1, the PCR of transgenic paddy rice detects

Obtain altogether the Basta resistant plant that 52 strains turn pAMT3301, for whether checking is incorporated into target gene in the genome of acceptor material, extracted the genomic dna of transgenic paddy rice blade.Utilize PCR to detect it is carried out to Preliminary detection, result shows that having 17 strain transgenic paddy rices is the PCR positive (Fig. 7), obtains the AMT gene fragment of 1312bp, and this 17 strain transgenic paddy rice is AMT gene masculine plant, and transformation efficiency reaches 32.7%.In the time carrying out the design of AMT gene primer, detect for the ease of design of primers and PCR, in the indoor design of AMT gene two checking primers (pAM5:AGGCTATCAACACCTTCTC, pAM3:GCACTGGTCATGTCGTAGG), the sequence length between primer is 1312bp.

2, the GUS of transgenic paddy rice detects

Because the T-DNA of plant expression vector pAMT3301 is upper with reporter gene GUS, in the time that T-DAN is incorporated in the appropriate site of plant chromosome and can correction, β-glucose neuraminidase (β-Glucuronidase) of gus gene coding can be by the chloro-3-indoles-β-D-of bromo-substrate 5-4-glucuronide (5-bromo-4-chlono-3-indoly-β-D-glucuronide, X-Gluc) decompose the colourless indole derivatives producing, there is the effect of oxidative dimerization body and produce blue precipitation in the latter, this kinds of oxidation reaction can greatly be promoted under the effect of the Tripotassium iron hexacyanide/yellow prussiate of potash, whether there is blue appearance by making plant material, determine the success or not transforming.Concrete steps are as follows:

1) rice leaf to be measured is cut into pieces, be placed in 1.5mL centrifuge tube, add appropriate GUS staining fluid (not having blade), 37 DEG C of lucifuge overnight incubation.

2) take out GUS staining fluid, add stationary liquid FAA(formaldehyde, 95% alcohol, Glacial acetic acid by the preparation of 10:85:4 volume), sucking-off stationary liquid after fixing 15min.

3) dehydrated alcohol decolouring, takes off to leaf green, is white.

4) visual inspection, is blue part and is GUS expression sites under white background.

17 obtained strain AMT gene masculine plant are carried out to GUS detection, and rotaring gene plant blade all has blue spot to generate, and the fine blade of non-transgenic plant Japan is without any color, and both have obvious difference (Fig. 8).

3, the RT-PCR of transgenic paddy rice detects

Gather in the crops the seed of 17 strain AMT gene masculine plant, plant, get rice leaf grind into powder in liquid nitrogen that T1 generation turns pAMT3301 plant, getting about 100mg organizes powder to being put in the 1.5ml centrifuge tube of precooling, add 1ml Trizol reagent, vibration mixes, and adds 200ul chloroform, and vibration mixes.12000rmp, 4 ° of C, centrifugal 15min.The careful supernatant (about 600ul) of drawing, is put in another 1.5ml centrifuge tube without RNA enzyme, adds 500ul Virahol, mixes, and room temperature is placed 10min.12000rmp, 4 ° of C, centrifugal 10min.Abandoning supernatant, the ethanol with 75% cleans RNA once.Absorb residual ethanol, dry in the air when without ethanol taste, add the appropriate water dissolution RNA without RNase for subsequent use.Utilize GeneRacer test kit synthetic its cDNA of reference reagent box specification sheets reverse transcription of Invitrogen company, with PAR5, PAR3(PAR5:TCATGTTGGACGCTTGTCGTG, PAR3:GTGAGATGGCATACTTGCAGC) be primer, carry out RT-PCR augmentation detection.RT-PCR reaction conditions is: 94 DEG C of 30s, 56 DEG C of 1min, 72 DEG C of 1min, 30 rear 72 DEG C of extension 10min of circulation.Can amplify the band of 500bp, stripe size is consistent with expection, and this explanation AMT gene has been incorporated in the genome of paddy rice, and transcriptional expression (Fig. 9).Result obtains altogether the genomic T1 generation that 14 AMT genes have been incorporated into paddy rice and turns pAMT3301 strain, and strain numbering is respectively S21-1, S21-2, S21-3, S21-4, S21-5, S21-6, S21-7, S25-1, S49-1, S2, S3, S4, S5, S6.

4, T1 is for AMT transgenic paddy rice land for growing field crops Basta resistance screening.

The T1 that step 3 is obtained is genomic 14 the Basta resistance screenings that turn pAMT3301 strain and carry out large Tanaka to paddy rice for AMT gene integration.Be three leaf one heart stage spray 500ppm Basta at paddy rice seedling age, after one week, spray again 500ppm Basta one time.Result shows that genomic 14 to paddy rice turn pAMT3301 strain Basta is had to good resistance (Figure 10) for AMT gene integration for the T1 that obtains.The T1 that results have a resistance to Basta turns pAMT3301 strain S21-1, S21-2, S21-3 for AMT gene integration to genomic 8 of paddy rice, S21-4, S21-5, S21-6, S21-7, the seed (T2 generation turns pAMT3301 strain) of S25-1 carries out the functional verification of following step 5.

In addition, according to the method described above, pUT3301 is imported to Japan fine, obtain the seed (T2 generation turns pUT3301 strain) that T2 generation turns the fine paddy rice of pUT3301 Japan, the functional verification of following step 5.

Five, the functional verification of AMT gene

T2 transgenic paddy rice is carried out to nitrogen stress experiment, the function of checking AMT gene.Select a dried rhizome of rehmannia, remove the mellow soil of the arable layer of top layer 30cm, then add sand, the thickness of sand is 30cm.Deep ploughing 40cm left and right, after mixing lower floor's immature soil, as experimental plot with sand.Two plot are established in experimental plot altogether, and two plot are at a distance of 10 meters.

Fine acceptor paddy rice Japan, 8 T2 generation are turned to pAMT3301 strain (S21-1-3, S21-2-2, S21-3-4, S21-4-6, S21-5-3, S21-6-1, S21-7-5, S25-1-2), 1 T2 generation to be turned pUT3301 strain and all carries out under normal operation seedling well-fed large Tanaka, for ensureing that all T2 are transgenic seedlings for transgenic paddy rice seedling, at three leaf one heart stage spray 500ppm Basta, after one week, spraying a 500ppm Basta screens again, obtain Basta resistant plant and plant, be transplanted into experimental plot to 41 heart stages of leaf.

Test adopts randomized block design, establish altogether three iterons, She12Ge community, each iteron, acceptor paddy rice is established 2 communities altogether, in T2 generation, turns pUT3301 strain and establishes altogether 2 communities, in 8 T2 generations, turn each 1 community of pAMT3301 rice strain, and it is adjacent for turning pUT3301 strain community with 1 T2 with 1 acceptor paddy rice community that every 4 T2 generation turns pAMT3301 rice strain community.Plantation 3 row in each community, every row 10 strains.The not experimental plot of nitrogen fertilizer application and the experimental plot of normal nitrogen fertilizer application will be moved into respectively in the rice seedling of 41 heart stages of leaf.The not experimental plot of nitrogen fertilizer application, between rice maturity, except nitrogen fertilizer application not, other cultivation management condition is normal (phosphate fertilizer, potash fertilizer are all normally used, and water management is normal) all.The experimental plot of normal nitrogen fertilizer application, between rice maturity, nitrogenous fertilizer, phosphate fertilizer, potash fertilizer are all normally used, and water management is normal, and other cultivation management condition is also normal.After paddy rice maturation, investigate its plant height, tiller number, individual plant seed weight, the data that obtain are carried out to T check analysis.

Result shows, the average plant height, the mean tillering number and the average individual plant seed weight average that in the experimental plot of normal nitrogen fertilizer application, turn pAMT3301 paddy rice, turn pUT3301 paddy rice and acceptor paddy rice are without significant difference (table 2).From 41 heart stages of leaf to ripe, transgenic paddy rice and acceptor paddy growth are normal, all do not occur nitrogen stress symptom.

Plant height, tiller number and the individual plant seed weight of paddy rice in the experimental plot of the normal nitrogen fertilizer application of table 2.

, in the experimental plot of nitrogen fertilizer application, from 41 heart stages of leaf to ripe, transgenic paddy rice does not show nitrogen stress symptom, and leaf dark green is tillered normal.Non-transgenic acceptor paddy rice shows obvious nitrogen stress disease, tillering phase blade start flavescence, start yellow from the tip of blade, tiller number reduce, heading stage (florescence), spike of rice was shorter, seed is little, and whole rice growing season shorten, ripen in advance.Not in the experimental plot of nitrogen fertilizer application, turn plant height, tiller number and the individual plant seed of pAMT3301 paddy rice heavy with contrast all extremely significantly (table 3) of Japanese fine variance analysis, plant height, tiller number and the individual plant seed that turns pAMT3301 paddy rice be heavily significantly higher than contrast Japanese fine.The plant height, tiller number and the individual plant seed that turn pUT3301 paddy rice and acceptor paddy rice are heavy without significant difference.Illustrate that AMT gene can significantly improve the utilising efficiency of transgenic paddy rice to nitrogen, this gene, by playing a significant role in the breeding process of plant nitrogen fertilizer absorption field and breeding low nitrogen resisting plant variety, has a extensive future.

Table 3, not plant height, tiller number and the individual plant seed weight of paddy rice in the experimental plot of nitrogen fertilizer application

In table 1 and table 2, the T1 that Basta is had to a resistance that S21-1-3, S21-2-2, S21-3-4, S21-4-6, S21-5-3, S21-6-1, S21-7-5, S25-1-2 derive from respectively step 4 is the genomic pAMT3301 of the turning strain S21-1 to paddy rice for AMT gene integration, S21-2, S21-3, S21-4, S21-5, S21-6, S21-7, S25-1.

Claims (8)

1. an albumen is the protein of aminoacid sequence as shown in SEQ ID No.2.

2. the nucleic acid molecule of albumen described in coding claim 1.

3. nucleic acid molecule according to claim 2, is characterized in that: described nucleic acid molecule is that encoding sequence is the DNA molecular of the 7-1548 position Nucleotide of SEQ ID No.1.

4. any biomaterial following 1)-4):

1) expression cassette that contains nucleic acid molecule described in claim 2 or 3;

2) recombinant vectors that contains nucleic acid molecule described in claim 2 or 3;

3) recombinant microorganism that contains nucleic acid molecule described in claim 2 or 3;

4) transgenic cell line that contains nucleic acid molecule described in claim 2 or 3.

5. the nucleic acid molecule described in protein claimed in claim 1, claim 2 or 3, the biomaterial claimed in claim 4 application in utilization and/or the regulating plant growth to nitrogen at regulating plant; Described plant is paddy rice.

6. application according to claim 5, is characterized in that: described regulating plant growth is at least one in A to C:

The individual plant seed weight of A, adjusting and controlling rice;

The tiller number of B, adjusting and controlling rice;

The plant height of C, adjusting and controlling rice.

7. cultivate the method for transgenic paddy rice, comprise in acceptor paddy rice and import nucleic acid molecule claimed in claim 3, obtain to the tolerance of nitrogen stress the transgenic paddy rice higher than described acceptor paddy rice higher than described acceptor paddy rice and/or growth;

Described growth has following 1 higher than the transgenic paddy rice of described acceptor paddy rice)-3) in the transgenic paddy rice of arbitrary proterties: 1) individual plant seed is great in described acceptor paddy rice; 2) tiller number is greater than described acceptor paddy rice; 3) plant height is greater than described acceptor paddy rice.

8. the primer pair of the nucleic acid molecule total length described in amplification claim 2 or 3.