CN102242144A

CN102242144A - Application of rice gene ORYsa;Pht1;8 to genetic engineering

Info

Publication number: CN102242144A
Application number: CN 201110099787
Authority: CN
Inventors: 徐国华; 孙淑斌; 贾宏昉; 顾冕
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2011-04-20
Filing date: 2011-04-20
Publication date: 2011-11-16

Abstract

The invention belongs to the field of genetic engineering, and discloses application of a rice gene ORYsa;Pht1;8 to the genetic engineering for the first time. Transgenic experiments prove that the phosphorus absorption capacity of rice is greatly improved by over-expressing the gene, and the effective phosphorus content of an overground part and an underground part of a transgenic positive seedling is more than 2 times that of a wild seedling; experiments on potted plants with different phosphorus using amount prove that the total phosphorus content of the transgenic positive seedling in rice husks is 2 to 3 times that of the wild seedling; and the gene provides guarantee for cultivating a new rice variety with high phosphorus absorption efficiency and high in-vivo phosphorus redistribution efficiency. The invention provides application of phosphate translocator ORYsa;Pht1;8 coded by the rice gene ORYsa;Pht1;8 to the genetic engineering for the first time. The phosphate translocator has high affinity to the phosphorus, and is expected to be applied to the genetic improvement of monocotyledons when taken as a target gene to be transferred to a plant.

Description

Paddy gene ORYsa; Pht1; 8 genetically engineered is used

Technical field

The invention belongs to the plant gene engineering technology field, disclose paddy gene ORYsa; Pht1; 8 genetically engineered is used, and is specifically related to a kind of gene ORYsa that participates in the rice phosphate absorption and transport to organ of multiplication from vegetative organ; Pht1; 8 function and application.

Background technology

Phosphorus is the necessary second largest nutritive element of growth and development of plants, and its content is only second to nitrogen in plant materials, and generally the content of phosphorus accounts for 0.05～0.5% (Vance et al., 2003) of plant dry weight.It not only relates to the synthetic of microbial film and nucleic acid, plays the part of important role simultaneously in the regulation and control of energy metabolism and enzyme.Because phosphorus element (PO ₄ ^3-, HPO ₄ ^2-, H ₂PO ₄ ^-) strong fixed action in acid and alkaline soil, make content very low (less than 10 μ the M) (Bieleski of titanium pigment in the saturated soil solution, R.L.Phosphate pools, phosphate transport and phosphate availability.Annu.Rev.Plant Physiol.1973,24,225-252), do not satisfy the growth needs of plant far away, make it become a big restriction sex factor of plant-growth.So can plant efficiently utilize, and a spot of titanium pigment has fundamental influence to plant-growth in the soil.

In order to improve crop yield, people use phosphate fertilizer in a large number, have increased agricultural cost and peasant's burden so greatly.The plant modification genotype is to improve the effective approach that plant absorbing is utilized phosphorus efficient.The absorption and transport of plant phosphorus is the active transport process of contrary concentration, will be by the root cells film by plain transport protein regulation/control (the Smith FW of a plurality of phosphorus of same or different families, Rae AL, Hawkesford MJ.Molecular mechanisms of phosphate and sulphate transportin plants.BiochimBiophys Acta, 2000,1465:236-245).Height according to available phosphorus concentration in the medium, the plain translocator of phosphorus is divided into low-affinity and high-affinity two big class (Rausch C, Bucher M.Molecular mechanisms of phosphate transport in plants.Planta, 2002,216:23-37), wherein high affinity phosphate cotransporter albumen is being undertaken root system suction phosphorus important task under the scarce phosphorus condition, therefore people receive much attention to the research of high affinity phosphate cotransporter albumen, at Arabidopis thaliana, report (Stephen R.Mudge in a variety of plants such as barley in succession, Anne L.Rae, Eugene Diatloff and Frank W.Smith.Expression analysis suggestsnovel roles for members of the Pht1 family of phosphate transporters in Arabidopsis.The PlantJournal, 2002,31:341-351; Anne L.Rae, Daisy H.Cybinski, Janine M.Characterization of twophosphate transporters from barley; Evidence for diverse function and kinetic properties amongmembers of the Pht1 family.Plant Molecular Biology, 2003,53:27-36).

Paddy rice is one of main food crop of China, and phosphoric is significant to the paddy rice good quality and high output.Paddy growth a large amount of phosphorus of accumulation in blade in early stage, the grouting of growth later stage is shifted in the fringe (Marschner, 1995).Up to the present, also not relevant for participating in phosphorus in the paddy rice from the relevant report of vegetative organ to the phosphorus transporter protein gene of organ of multiplication transhipment.We discover ORYsa; Pht1; 8 can improve the plain assimilated efficiency of phosphorus more than 2 times, and play an important role to the transport process of organ of multiplication from vegetative organ at phosphorus.

Summary of the invention

The purpose of this invention is to provide paddy gene ORYsa; Pht1; 8 engineering is used.

Another object of the present invention provides paddy gene ORYsa; Pht1; 8 application aspect the available phosphorus utilising efficiency in improving soil.

Another purpose of the present invention provides paddy gene ORYsa; Pht1; 8 at phosphorus from vegetative organ to the application aspect the transhipment of organ of multiplication.

Purpose of the present invention can be achieved through the following technical solutions:

Paddy gene ORYsa; Pht1; 8 genetically engineered is used, and its nucleotide sequence accession number is AF536968, and the proteic aminoacid sequence of the phosphate cotransporter of this genes encoding is SEQ ID NO.2, totally 541 amino acid.

Described paddy gene ORYsa; Pht1; The special upstream and downstream primer sequence of 8 promoter regions amplification is respectively:

P1：5’GCCGTTAATTAAGAGCTAGAGCACAGCCAGT?3’(SEQ?ID?NO.5)

P2：5’ATTAGGCGCGCCGGCTGAACGACTCTGCTC?3’(SEQ?ID?NO.6)

Described paddy gene ORYsa; Pht1; The special upstream and downstream primer sequence of 8 coding regions amplification is respectively:

OsPT8-F：5’AATTGAGCTCATGGCGCGGCAGGAGCAGC?3’(SEQ?ID?NO.3)

OsPT8-R：5’AATTACTAGTCTACGCCGTCTGCGGCCG?3’(SEQ?ID?NO.4)

Utilize ORYsa provided by the invention; Pht1; 8 genes make up plant expression vector as goal gene, wherein available any promotor is cauliflower mosaic virus (CAMV) 35S promoter, corn Ubiquitin promotor or other promotor for example, can comprise enhanser in case of necessity in this expression vector, no matter be transcriptional enhancer or translational enhancer.Can use selected marker for the evaluation of simplifying transformant and comprise enzyme antibiotics resistance, also can utilize the enzyme of the compound that colour-change (for example β-glucose sugar neuraminidase GUS) or luminous (for example luciferase) discern, also available unmarked selection.Used expression vector can use Ti-plasmids, Ri plasmid, plant viral vector etc.Method for transformation can be used through agrobacterium-mediated transformation, particle bombardment, pollen tube passage method or other method and transform plant.

Rice phosphate translocator ORYsa; Pht1; 8 engineering is used, this phosphate cotransporter albumen ORYsa; Pht1; 8 aminoacid sequence is SEQ ID NO.2.

Paddy gene ORYsa; Pht1; 8 application in the available phosphorus utilization ratio in improving soil.

Rice phosphate translocator ORYsa; Pht1; 8 application in the available phosphorus utilization ratio in improving soil.

Paddy gene ORYsa; Pht1; 8 at phosphorus from vegetative organ to the application aspect the transhipment of organ of multiplication.

Rice phosphate translocator ORYsa; Pht1; 8 at phosphorus from vegetative organ to the application aspect the transhipment of organ of multiplication.

Beneficial effect:

1, the present invention discloses a kind of paddy gene ORYsa first; Pht1; 8 genetically engineered is used.Transgenic experiments proves that the overexpression of this gene has significantly improved the plain receptivity of paddy rice phosphorus, and the overground part of transgenic positive seedling and underground part available phosphorus content have all reached about 2 times of wild-type; The different outer potted plant experiments of executing the phosphate fertilizer consumption show that the content of tatal phosphorus of transgenic positive seedling in husk is 2-3 times of wild-type.Reallocation efficient new rice variety improves guarantee to this gene in the plain body of high phosphorus element assimilated efficiency and high phosphorus in order to cultivate.

2, the present invention provides paddy gene ORYsa first; Pht1; The phosphate cotransporter albumen ORYsa of 8 codings; Pht1; 8 engineering is used.ORYsa; Pht1; The protein ORYsa of 8 coded by said gene; Pht1; 8 pairs of phosphorus high affinities import plant with it as goal gene, are expected to be applied to monocotyledonous genetic improvement.

3, the present invention discloses rice phosphate translocator ORYsa first; Pht1; 8 at phosphoric acid salt from the transport function of vegetative organ, for rice genetic breeding or seed selection phosphorus efficiency absorption-type kind provide new thinking to organ of multiplication.

Description of drawings

Fig. 1: paddy gene ORYsa; Pht1; 8 express signal (RT-PCR) under normal phosphorus supply and low-phosphorous condition.

Wherein :+P represents normal phosphorus supply (300 μ mol/L) processing, and-P represents low-phosphorous (15 μ mol/L) handles, and OsActin is an internal control gene.

Fig. 2: ORYsa under two kinds of phosphorus treatment condition; Pht1; 8 expression characteristics at paddy rice different sites (root, stem, blade).A, E: be respectively normal phosphorus supply and scarce phosphorus paddy rice root tip; B, F: be respectively normal phosphorus supply and scarce phosphorus paddy rice lateral root district; C, G: be respectively normal phosphorus supply and scarce phosphorus paddy rice rhizome combining site; D, H: the leaf that is normal phosphorus supply and scarce phosphorus paddy rice respectively;

Wherein :+P represents normal phosphorus supply (300 μ mol/L) processing, and-P represents low-phosphorous (15 μ mol/L) handles.

Fig. 3 acid phosphatase intensity detection ORYsa; Pht1; 8 gene pairss lack the complementation of the plain absorptive function of the proteic yeast mutants MB192 of the affine phosphorus transporter of endogenous height phosphorus.

Fig. 4 isotropic substance ³³P measures yeast Yp112-ORYsa; Pht1; 8 pairs of plain speed (pH 6.5) that absorb of phosphorus.

Fig. 5 under normal phosphorus supply condition, the ORYsa that grew 21 days; Pht1; Available phosphorus content in the root of 8 gene silencing plant, stem, Lao Ye and the young leaves.

Wherein, WT represents the wild-type paddy rice, and Ri1 and Ri2 represent two strain ORYsa respectively; Pht1; 8 gene silencing strains system.

Fig. 6 ORYsa; Pht1; 8 gene silencing strains tie up to blade and the content of tatal phosphorus in the husk and the thousand seed weight in growth later stage.

A, gene silencing strain system and the wild-type paddy rice content of tatal phosphorus in normal phosphate fertilizer supply condition lower blade and husk.

B, gene silencing strain system and the wild-type paddy rice thousand seed weight under normal phosphate fertilizer supply condition.

Wherein, WT represents the wild-type paddy rice, and Ri1 and Ri2 represent two strain ORYsa respectively; Pht1; 8 reticent strains are.

Fig. 7 under normal phosphorus supply condition, the ORYsa that grew 21 days; Pht1; Available phosphorus content in root, stem, Lao Ye and the young leaves of the positive seedling of 8 overexpressions.

Wherein, WT represents the wild-type paddy rice, and Oe1 and Oe2 represent two strain ORYsa respectively; Pht1; 8 overexpression strains system.

Fig. 8: ORYsa; Pht1; 8 gene overexpression transgenic seedlings at later stages blade and the content of tatal phosphorus in the husk.

A, overexpression strain system and wild-type paddy rice are executed phosphorus consumption (0mg/kg, 40mg/kg, 80mg/kg, 160mg/kg) content of tatal phosphorus in the condition lower blade outside four.

B, overexpression strain system and wild-type paddy rice are executed phosphorus consumption (0mg/kg, 40mg/kg, 80mg/kg, 160mg/kg) content of tatal phosphorus in the husk under the condition outside four.

Wherein, WT represents wild-type, and OsPT8-Oe represents ORYsa; Pht1; 8 overexpression transfer-gen plant ORYsa; Pht1; 8-Oe.

Fig. 9 expression vector p112A1NE plasmid map.

Figure 10 binary expression vector pS1aG-3 plasmid map.

Figure 11 binary expression vector pTCK303 plasmid map.

Embodiment

Embodiment 1.ORYsa; Pht1; The acquisition of 8 genes encoding region sequences

The applicant goes up input OsPT8 at NCBI website (www.ncbi.nlm.nih.gov) and obtains the dna sequence dna that sequence number is one section high affine phosphorus transporter protein gene of coding paddy rice of AF536968.According to the international plant gene nomenclature of the molecular biology of plants council, Commission for Plant Gene Nomenclature of the International Society for Plant MolecularBiology) requirement, we are with this dna sequence dna called after ORYsa; Pht1; 8.(be open reading frame, ORF) be 1626bp to this full length gene coding region of analysis revealed, 541 amino acid of encoding.This gene does not have intron.

Embodiment 2. utilizes RT-PCR to identify paddy rice ORYsa; Pht1; The spatial and temporal expression pattern of 8 genes

1, the extraction of total RNA and transcribe synthetic cDNA first chain

Select rice varieties " Japan fine " for use, treat that rice seedling grows to 10 days after, carry out normal phosphorus supply (300 μ M KH respectively ₂PO ₄) and low-phosphorous (10 μ M KH ₂PO ₄) handle, gather blade and root after 3 weeks, adopt TriZol reagent extracted total RNA respectively, identify total RNA quality with the denaturing formaldehyde gel electrophoresis, on spectrophotometer, measure rna content then.Total RNA with acquisition is a masterplate, obtains rice cDNA first chain through reverse transcription, uses for follow-up experiment.The synthesis step of cDNA first chain: with the eppendorf pipe (1.5mL) of DEPC water treatment, add total RNA 5 μ g, oligodT 2 μ L (25ng/ μ L), dNTP (10mmoL/L) 2 μ L, 70 ℃ of water-bath 5min place cooled on ice rapidly, add 5 * reaction buffer, 4 μ L, M-MLV reversed transcriptive enzyme (200U/ μ L) 1 μ L, RNase inhibitor 0.5 μ L, DEPC water to cumulative volume are 20 μ L (above all in operation on ice).Centrifugally slightly be placed on 42 ℃ of water-bath 1h.Products therefrom is cDNAs, places-20 ℃ of preservations.

2, ORYsa; Pht1; The spatial and temporal expression pattern of 8 genes is identified

" Japan the is fine " cDNA that obtains with step 1 is a template, according to paddy rice ORYsa; Pht1; The encoding sequence of 8 genes designs following ORYsa; Pht1; 8 gene specific primer P3, P4 amplification length are that 683bp sheet degree is identified ORYsa; Pht1; The spatial and temporal expression pattern of 8 genes.

P3?GCAGATGGTGACCCGGAACAGC(SEQ?ID?NO.7)

P4?CGAGGAACGTGCAGATGAACCC(SEQ?ID?NO.8)

The RT-PCR concrete steps are: the cDNA that obtains with step 1 is that template is carried out the RT-PCR amplification, and the PCR reaction system is 25 μ l:PCR Buffer, 2.5 μ l, dNTP Mix 2 μ l, each 1 μ l of forward and reverse primer (P3, P4), template 1 μ l, archaeal dna polymerase 0.5 μ l, distilled water 17 μ l; The PCR program is as follows: 94 ℃ of pre-sex change 4 minutes, and 94 ℃ of sex change 30s, 56 ℃ of renaturation 1min, 72 ℃ are extended 1.5min, after 33 circulations, 72 ℃ of 5min.PCR product gel electrophoresis is identified ORYsa; Pht1; The spatial and temporal expression pattern of 8 genes the results are shown in Figure 1.Entrust Shanghai to give birth to the order-checking of worker company and determine that sequence is ORYsa; Pht1; 8 fragments.

As seen from Figure 1, ORYsa; Pht1; 8 genes are under low-phosphorous and normal phosphorus supply treatment condition, and root and overground part are all expressed strongly, and root significantly raises by low-phosphorous abduction delivering, and overground part difference is not remarkable.

Embodiment 3. utilizes ORYsa; Pht1; 8 promotors+GUS transgenic rice plant research ORYsa; Pht1; 8 function

1, makes up the expression vector of promotor

Selecting rice varieties " Japan is fine " for use, grows under normal phosphorus supply condition in the back of germinateing, and the total DNA of 3 weeks back extracting is used for ORYsa; Pht1; The clone of 8 gene promoter sequences.Design has the pcr amplification reaction primer of AscI and PacI restriction enzyme site and protection base:

P1?5′GCCG?TTAATTAAGAGCTAGAGCACAGCCAGT?3′(SEQ?ID?NO.5)

P2?5′ATTAGGCGCGCCGGCTGAACGACTCTGCTC?3′(SEQ?ID?NO.6)

Get the total about 50ng of DNA of 1 μ l " Japan is fine " and in 20 μ L systems, carry out the amplification of aim sequence.The PCR reaction system is 25 μ l:PCR Buffer, 2.5 μ l, dNTP Mix 2 μ l, each 1 μ l of forward and reverse primer (SEQ ID NO.5 and SEQ ID NO.6), template 1 μ l, archaeal dna polymerase 0.5 μ l, distilled water 17 μ l; Amplification condition is: 94 ℃ of pre-sex change 4min, and then with 94 ℃ of sex change 45s, 55 ℃ of renaturation 45s, 72 ℃ are extended 2.5min, carry out 30 circulations, and last 72 ℃ are extended 10min.Reclaim amplified fragments by the Agrose gel electrophoresis, order-checking (2184bp, SEQ ID NO.1), be connected with the pUC18T carrier, (bio tech ltd is contained in east, Guangdong to transformed into escherichia coli competent cell DH5 α, containing screening acquisition recombinant clone on the LB flat board of IPTG, X gal and penbritin down together).

More than be cloned in the ORYsa on the pUC18T carrier; Pht1; 8 promoter fragments are with rare restriction enzyme A scI and PacI double digestion.After electrophoresis reclaims, (contain gus reporter gene with same with AscI and PacI double digestion pS1aG-3 carrier, plasmid map is seen Figure 10) (Sch ü nmann, P.H.D., Richardson, A.E., Smith, F.W.and Delhaize, E.Characterization of promoter expression patterns derived from the Pht1 phosphate transporter genesof barley (Hordeum vulgare L.) .J.Exp.Bot.2004,55,855-865) connect, obtain changing over to ORYsa; Pht1; The recombinant expression vector of 8 promoter fragments.Then this is gone into ORYsa; Pht1; The recombinant expression vector of 8 promoter fragments is converted among the Agrobacterium EHA105 (day bounties Gene Tech. Company Limited).

2, change ORYsa; Pht1; Acquisition and the detection of 8 gene promoters (containing GUS) plant

The commentaries on classics that step 1 is obtained has the Agrobacterium of recombinant expression vector, further is converted into paddy rice (adopting Agrobacterium tumefaciens mediated method to change the expression vector that makes up over to paddy rice Japan fine kind), inducing paddy rice mature embryo callus.Choose to a certain size rice callus tissue long, putting into to change has the Agrobacterium EHA105 suspension of recombinant expression vector to infect 5 minutes (the callus amount there was not 50ml centrifuge tube taper position to get final product, and that does not stop shakes); Callus is taken out, place to drain on the aseptic filter paper 30-40 minute; Callus places on the common substratum, 28 ℃ of dark cultivations 2.5 days.Callus changes the enterprising row filter of selection substratum that contains 250mg/L Pyocianil (Car) and 50mg/L Totomycin over to then.The kanamycin-resistant callus tissue of picking color cadmium yellow moves into the culture dish that division culture medium is housed or breaks up in the jar (substratum is normal phosphorus supply), puts into constant temperature culture chamber seedling differentiation.Put into root media one to two week of strong sprout again.

The transfer-gen plant that obtains is carried out GUS dyeing to be detected: painted tissue is put into the 1.5ml centrifuge tube that contains the GUS dye liquor, and 37 ℃ are spent the night, and manifest the blue positive plant of sample, and what do not have color is the false positive seedling.With wild-type paddy rice and the positive transgenic seedling that obtains incubation growth after 21 days under (10uM/L) condition under normal phosphorus supply (300 μ M/L) and the low-phosphorous condition, get root respectively, stem, rhizome junction and blade detect β-glucose sugar neuraminidase (β-lucuronidase, expression (the Jefferson of reporter gene of β-GUS), R.D., Kavanagh, TA.and Bevan, M.W.GUS fusions:b-glucuronidase as asensitive and versatile gene fusion marker in highter plants.EMBO J.19876,3901-3907), ORYsa is determined in analysis report expression of gene position; Pht1; 8 spatial and temporal expression spectrum.Find ORYsa; Pht1; 8 under low-phosphorous and normal phosphorus supply condition all sites strong expression all, but root is subjected to low-phosphorous abduction delivering obviously to strengthen (Fig. 2), this and RT-PCR result match (Fig. 1).

Embodiment 4. yeast allos systems identify paddy rice ORYsa; Pht1; 8 functions

1, makes up yeast heterogenous expression carrier

Yeast mutants bacterial strain MB192, Yeast expression carrier p112A1NE (all see bright phoenix etc. the clone of rice phosphate transporter gene, expression and functional analysis. Chinese science C collects, and 2006,36:385-389)." Japan is fine, and " normal phosphorus supply root cDNA is template (embodiment 2), and (upstream primer F1 sequence is SEQ ID NO.9 to contain EcoR I restriction enzyme site primer with paddy rice; Downstream primer R1 sequence is SEQ ID NO.10) amplification ORYsa; Pht1; Behind 8 coding regions, be connected, make up yeast expression recombinant vectors p112A1NE-ORYsa with expression vector p112A1NE (Fig. 9); Pht1; 8.The p112A1NE carrier comprises the amino acid selective marker.

2, zymic transforms

Picking yeast phosphorus transporter protein gene mutant MB192 mono-clonal is in the YEPD liquid nutrient medium, and under 30 ℃, 250r/min is cultured to OD ₆₀₀When being about 1.0-1.3, collecting cell precipitation, the sterilized water of equivalent volumes precooling suspends again, centrifugal; The sterilized water suspended centrifugal of the precooling of 1/2 volume; Be suspended at last in the sorbyl alcohol of 1mol/L of precooling of 1/25 volume.For the changing effect that obtains, the dithiothreitol (DTT) that adds 25mmol/L is at room temperature handled 10min, and the sorbyl alcohol with an amount of 1mol/L washs yeast cell again, finally is suspended in the Sorbitol Solution USP of precooling of 1/200 volume.Get 5 μ L yeast recombinant expression vector p112A1NE-ORYsa; Pht1; 8 join in the 50 μ L competence yeast suspensions, and mixing is transferred to electricity rapidly and transforms in the cup, and with 1.5kV, 200 Ω, 25 μ F carry out electricity and transform.Add 1mLYEPD liquid nutrient medium incubation 1h, the sorbyl alcohol with 1mol/L suspends again, is tiled on the YNB flat board, and the yeast after the conversion is called yeast transformant Yp112-ORYsa; Pht1; 8; Positive control be the wild-type yeast that contains the PH084 gene (see bright phoenix etc. the clone of rice phosphate transporter gene, expression and functional analysis. Chinese science C collects, 2006,36:385-389); Negative control is yeast mutants MB192.

3, yeast complementation experiment

With positive control wild-type yeast, yeast transformant Yp112-ORYsa; Pht1; 8 and negative control yeast phosphorus transporter protein gene mutant MB192 be incubated on the YNB solid medium (not phosphorous element), not in the YNB substratum of phosphorous element, make its OD600 is 1.0 to picking list colony inoculation in liquid.Getting the 2ml culture is inoculated in respectively in the YNB substratum that contains the plain concentration of different phosphate (20 μ M, 60 μ M, 100 μ M) (test tube) after the washing of 3% glucose solution, cultivating in 30 ℃ of thermostat containers and making its OD600 is 1.0, add 2 purpurum bromocresoliss then as indicator, change in color in the cultivation of observation different phosphate concentration, the indicator change in color can reaction culture medium acidizing degree, color is the yellow normal growth that is, color dark more (red or black) shows that the zymic growth conditions is bad.The result shows that mutant MB192 cell only at Pi concentration 100 μ M well-growns, has acid-reaction; And significantly be subjected to press down no acidic reaction at 20 μ M and the growth of 60 μ M cells.And contain Yp112-ORYsa; Pht1; 8 cell can be a well-grown on 60 μ M and the above substratum at Pi, and has acid-reaction (Fig. 3).According to function complementation experiment, reaching a conclusion is ORYsa; Pht1; The 8 coded protein mediated phosphate cotransporters of yeast cell film.

4, the mensuration of phosphorus absorbed dose in the yeast growth process

Adopt isotope-labeled method to measure yeast transformant Yp112-ORYsa; Pht1; 8 and mutant strain MB192 to the experiment of the uptake rate of phosphorus element, method is with reference to P.Martinez and Persson (Martinez P, Persson B L.Identification, cloning andcharacterization of a derepressible Na ⁺-coupled phosphate transporter in Saccharomyces cerevisiae.Mol Gen Genet, 1998,258:628-638).And by SigmaPlot10.0 calculating discovery phosphorus transporter albumen ORYsa; Pht1; 8 Km is 63 μ M, and maximum absorption speed is 0.73noml Pi (mg yeast cellsmin) ^-1(Fig. 4).We think ORYsa thus; Pht1; 8 is parents and phosphorus transporter proteoplast, and this qualification result (Fig. 2) with reporter gene GUS is consistent.

Embodiment 5. utilizes Ubi promotor+RNAi fragment+GUS transgenic rice plant research ORYsa; Pht1; 8 function

1, the structure of RNAi expression vector

According to paddy gene ORYsa; Pht1; 8cDNA sequence (AF536968) design special primer F2 and R2 (SEQ IDNO.11 and SEQ ID NO.12) amplification are used for RNA interferential dna fragmentation (SEQ ID NO.14) for one section, length is 260bp, thereby this fragment is by forming the purpose that hairpin structure arrives gene silencing.Wherein introduce restriction endonuclease sites KpnI respectively on the upstream and downstream primer, SpeI and BamHI, SacI, primer sequence is as follows:

Upstream primer F2:5 ' AGAGGGTACCACTAGTGCCGCATCTACTACACCG 3 ' (SEQ ID NO.11)

Downstream primer R2:5 ' ATATGGATCCGAGCTCAAGAAGCAGAGCGTCGCCA 3 ' (SEQ ID NO.12)

(embodiment 2 step 1) are template with normal phosphorus supply root cDNA clone, earlier carry out PCR with F2 and this a pair of primer of R2, the PCR reaction system is 25 μ l:PCR Buffer, 2.5 μ l, dNTP Mix 2 μ l, each 1 μ l of forward and reverse primer (SEQ IDNO.11 and SEQ ID NO.12), template 1 μ l, archaeal dna polymerase 0.5 μ l, distilled water 17 μ l; The PCR program: 94 ℃ of pre-sex change 4min, 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 20s, and after 30 circulations, 72 ℃ of 7min run glue and detect.The size of PCR product is 260bp, the PCR product is cut glue after agarose electrophoresis is separated reclaim, reclaim the back and carry out double digestion with SacI and SpeI, use SacI and SpeI double digestion pTCK303 plasmid (Wang Z simultaneously, Chen CHB, Xu YY, Jiang RX, Han Y, Xu ZHH, Chong K.A practical vector for efficient knockdown of geneexpression in rice.Plant Molecular Biology Reporter.2004 22:409-417 Figure 11), reclaim purpose fragment and carrier then respectively, reclaim the back and spend the night, be converted into 37 ℃ of overnight incubation in the DH5 α intestinal bacteria by T4 ligase enzyme (Promega company) connection under 4 ℃, select positive colony, order-checking is identified; With BamHI and KpnI the PCR product that reclaims is carried out double digestion again, use the positive colony of the BamHI and the KpnI double digestion the first step simultaneously, reclaiming the back spends the night by T4 ligase enzyme (Promega company) connection under 4 ℃, heat shock is converted into 37 ℃ of overnight incubation in the DH5 α intestinal bacteria, select positive colony, order-checking.The correct positive colony of order-checking is converted in EHA105 (day bounties Gene Tech. Company Limited) Agrobacterium.

2, the acquisition of RNAi transfer-gen plant and Function Identification

The commentaries on classics that step 1 is obtained has the Agrobacterium of expression vector, further is converted into paddy rice (adopting Agrobacterium tumefaciens mediated method to change the expression vector that makes up over to paddy rice Japan fine kind).Inducing paddy rice mature embryo callus.Choose to a certain size rice callus tissue long, put into agrobacterium suspension and infect 5 minutes (the callus amount there was not 50ml centrifuge tube taper position to get final product, and that does not stop shakes); Callus is taken out, place to drain on the aseptic filter paper 30-40 minute; Callus places on the common substratum, 28 ℃ of dark cultivations 2.5 days.Callus changes the enterprising row filter of selection substratum that contains 250mg/L Pyocianil (Car) and 50mg/L Totomycin over to then.The kanamycin-resistant callus tissue of picking color cadmium yellow moves in the culture dish or differentiation jar that division culture medium is housed, and puts into constant temperature culture chamber seedling differentiation.Put into root media one to two week of strong sprout again.

To the ORYsa that obtains; Pht1; The 8-RNAi transfer-gen plant carries out GUS dyeing and detects: painted tissue is put into the 1.5ml centrifuge tube that contains the GUS dye liquor, and 37 ℃ are spent the night, and manifest the blue positive plant (ORYsa of sample; Pht1; 8 gene silencing plant), do not have color for the false positive seedling.

With wild-type paddy rice and two ORYsa; Pht1; 8 gene silencing strains are that Ri1, Ri2 incubation growth under normal phosphorus supply (300 μ M) condition was got each 0.5g of root, stem, Lao Ye and young leaves respectively, the available phosphorus content of working sample after 21 days.Operation steps is as follows: (1) gets 0.5 gram bright sample liquid nitrogen grinding powdered, and to the sample freeze thawing, perchloric acid (PCA) grinding that adds 1ml10% (w/v) is even in 4 ℃ of placement (on ice or refrigerator).(2) homogenate dilutes 10 times with the perchloric acid (PCA) of 5% (w/v), in placing 30 minutes on ice.(3) in 4 ℃, centrifugal 10 minutes of 10000g, supernatant liquor are used for the mensuration (molybdenum blue method) of available phosphorus content.(4) get the 2ml working solution and mix, in 40 ℃ of incubations 20 minutes with 1ml sample supernatant liquor.(5) reaction solution is measured absorption value down in the 820nm visible wavelength after cooled on ice.Too high as sample concentration, should suitably dilute, its OD value is dropped in the linearity range of graticule.Calculate the available phosphorus content that obtains each position.

Experimental result shows this ORYsa; Pht1; The phosphate absorption speed ratio wild-type of 8 gene silencing strains system has reduced by 30.5%, the stem of over-ground part, and available phosphorus content significantly is lower than wild-type (Fig. 5) in Lao Ye and the young leaves, has shown ORYsa; Pht1; 8 genes paddy rice phosphorus nutrition is absorbed and transport process in play an important role, uptake rate and the transport efficacy of paddy rice have been improved significantly, aspect the raising soil phosphorus utilising efficiency very big potentiality are being arranged, for the new rice variety of cultivating the nutrition efficient absorption provides foundation.

To the ORYsa that obtains; Pht1; 8 gene silencing strains are that Ri1 and Ri2 carry out the potted plant experiment in land for growing field crops, and soil phosphate fertilizer consumption is 80mgKH ₂PO ₄/ every kilogram of soil.Through 110 days growth period duration of rice, get blade and husk sample.105 ℃ of 30min that complete, baking is two days in 70 ℃ of baking ovens, grinds.Take by weighing about 0.1g plant dry sample, use dense H ₂SO ₄-H ₂O ₂Mixing disappears boils.Behind the cooling constant volume, use molybdenum antimony resistance colorimetric method,, obtain plant sample content of tatal phosphorus in 722 ultraviolet-visible spectrophotometer 700nm place's colorimetric estimations (Bao Shidan, 2000).Add up the thousand seed weight of wild-type and two transgene silencing strain systems simultaneously.

Content of tatal phosphorus in the blade of two strains systems of experimental result demonstration transfer-gen plant Ri1 and Ri2 is at normal phosphorus supply condition (80mgKH ₂PO ₄/ every kilogram of soil) be significantly higher than wild-type (Fig. 6 A) under, and the content of tatal phosphorus in the husk is only by 70% (Fig. 6 A) of wild-type in the transfer-gen plant, transgenic line thousand seed weight significantly is lower than wild-type (Fig. 6 B).Prove this gene phosphorus from vegetative organ to aspect the transhipment of organ of multiplication very important effect.

Embodiment 6. utilizes Ubi promotor+coding region+GUS transgenic rice plant research ORYsa; Pht1; 8 application prospect

1, the structure of overexpression carrier

The coding region is ORYsa; Pht1; 8 coding region (being SEQ ID NO.13);

According to the high affine phosphoric acid salt transport protein gene ORYsa of paddy rice; Pht1; 8 cDNA sequence (AF536968), design primer amplification ORYsa; Pht1; 8 coding region, and on the upstream and downstream primer, introduce restriction endonuclease sites SacI and SpeI respectively, primer sequence is:

OsPT8-F：5’AATTGAGCTCATGGCGCGGCAGGAGCAGC?3’(SEQ?ID?NO.3)

OsPT8-R：5’AATTACTAGTCTACGCCGTCTGCGGCCG?3’(SEQ?ID?NO.4)

(embodiment 2 step 1) are that template is carried out PCR, and the PCR reaction system is 25 μ l:PCR Buffer, 2.5 μ l, dNTP Mix 2 μ l with the cDNA clone, each 1 μ l of forward and reverse primer (SEQ ID NO.5 and SEQ ID NO.6), template 1 μ l, archaeal dna polymerase 0.5 μ l, distilled water 17 μ l; Program is: 94 ℃ of pre-sex change 4 minutes, and 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 2min.After 30 circulations, 72 ℃ of 7min run glue and detect ORYsa; Pht1; 8 PCR product size is 1626bp, the PCR product cloning is to pUC18T carrier (Takara company), the correct back of order-checking imports binary expression vector pTCK303 by corresponding SacI and SpeI restriction enzyme site, (Wang Z, Chen CHB, Xu YY, Jiang RX, Han Y, Xu ZHH, Chong K.A practical vector forefficient knockdown of gene expression in rice.Plant Molecular Biology Reporter.2004 22:409-417 Figure 11), be converted into then among the Agrobacterium EHA105 (day bounties Gene Tech. Company Limited).

2, the acquisition of overexpression transfer-gen plant and Function Identification

The commentaries on classics that step 1 is obtained has the Agrobacterium of expression vector, further is converted into paddy rice (adopting Agrobacterium tumefaciens mediated method to change the expression vector that makes up over to paddy rice Japan fine kind).Inducing paddy rice mature embryo callus.Choose to a certain size rice callus tissue long, put into agrobacterium suspension and infect 5 minutes (the callus amount there was not 50ml centrifuge tube taper position to get final product, and that does not stop shakes); Callus is taken out, place to drain on the aseptic filter paper 30-40 minute; Callus places on the common substratum, 28 ℃ of dark cultivations 2.5 days.Callus changes the enterprising row filter of selection substratum that contains 250mg/L Pyocianil (Car) and 50mg/L Totomycin over to then.The kanamycin-resistant callus tissue of picking color cadmium yellow moves in the culture dish or differentiation jar that division culture medium is housed, and puts into constant temperature culture chamber seedling differentiation.Put into root media one to two week of strong sprout again, promptly obtain transfer-gen plant.

The transfer-gen plant that obtains is carried out GUS dyeing to be detected: painted tissue is put into the 1.5ml centrifuge tube that contains the GUS dye liquor, and 37 ℃ are spent the night, and manifest the blue positive plant of sample, (are ORYsa; Pht1; 8 overexpression transfer-gen plant ORYsa; Pht1; 8-Oe), do not have color for the false positive seedling.Get ORYsa; Pht1; 8 overexpression transfer-gen plant ORYsa; Pht1; 8-Oe incubation growth under normal phosphorus supply (300 μ M) condition is got each 0.5g of root, stem, Lao Ye and young leaves respectively, the available phosphorus content of working sample after three weeks.Operation steps is as follows: (1) gets 0.5 gram bright sample liquid nitrogen grinding powdered, and to the sample freeze thawing, perchloric acid (PCA) grinding that adds 1ml 10% (w/v) is even in 4 ℃ of placement (on ice or refrigerator).(2) homogenate dilutes 10 times with the perchloric acid (PCA) of 5% (w/v), in placing 30 minutes on ice.(3) in 4 ℃, centrifugal 10 minutes of 10000g, supernatant liquor are used for the mensuration (molybdenum blue method) of available phosphorus content.(4) get the 2ml working solution and mix, in 40 ℃ of incubations 20 minutes with 1ml sample supernatant liquor.(5) reaction solution is measured absorption value down in the 820nm visible wavelength after cooled on ice.Too high as sample concentration, should suitably dilute, its OD value is dropped in the linearity range of graticule.Calculate the available phosphorus content that obtains each position.Experimental result shows that root phosphate absorption speed is 2 times of wild-type, and the 1.5-2 that efficient content has also reached the wild-type position in over-ground part stem, Lao Ye and the young leaves has doubly significantly improved the utilising efficiency (Fig. 7) of phosphorus element.

To the transfer-gen plant ORYsa that obtains; Pht1; 8-Oe carries out the potted plant experiment in land for growing field crops, and soil phosphate fertilizer consumption is four, is respectively 0mgKH ₂PO ₄/ every kilogram of soil, 40mgKH ₂PO ₄/ every kilogram of soil, 80mg KH ₂PO ₄/ every kilogram of soil, 160mgKH ₂PO ₄/ every kilogram of soil.Through 110 days growth period duration of rice, get blade and husk sample, measure phosphorus content in the plant sample (handling the same) with molybdenum antimony resistance colorimetric method.105 ℃ of 30min that complete, baking is two days in 70 ℃ of baking ovens, grinds.Take by weighing about 0.1g plant dry sample, use dense H ₂SO ₄-H ₂O ₂Mixing disappears boils.Behind the cooling constant volume, use molybdenum antimony resistance colorimetric method, in 722 ultraviolet-visible spectrophotometer 700nm place's colorimetric estimations (Bao Shidan, 2000).Obtain plant sample content of tatal phosphorus.

The different outer earth culture experimental results of executing the phosphate fertilizer consumption show transfer-gen plant ORYsa; Pht1; Content of tatal phosphorus in the 8-Oe blade is at low-phosphorous condition (0mgKH ₂PO ₄/ every kilogram of soil) significantly descend down, have only 70% (Fig. 8 A) of wild-type, and transfer-gen plant ORYsa; Pht1; Content of tatal phosphorus in the 8-Oe husk is the 2-3 doubly (Fig. 8 B) of wild-type, prove this gene phosphorus from vegetative organ to aspect the transhipment of organ of multiplication very important effect.

In sum, the ORYsa that provides of the inventor; Pht1; 8 engineering is applied as reported first in the paddy rice.ORYsa; Pht1; 8 can be used as goal gene importing plant, improve plain utilising efficiency of plant phosphorus and the phosphorus element transport efficacy to organ of multiplication, for the new rice variety of cultivating the plain efficient reallocation of phosphorus in plain absorption of high phosphorus and the body thereof provides guarantee.

For simplicity, ORYsa among the present invention; Pht1; 8 are labeled as OsPT8 sometimes.

Claims

1. paddy gene ORYsa; Pht1; 8 engineering is used, and the nucleotide sequence accession number of this gene is AF536968.

2. paddy gene ORYsa according to claim 1; Pht1; 8 engineering is used, and it is characterized in that the phosphate cotransporter albumen ORYsa of this genes encoding; Pht1; 8 aminoacid sequence is SEQ ID NO.2.

3. paddy gene ORYsa according to claim 1; Pht1; 8 engineering is used, and it is characterized in that amplifying rice gene ORYsa; Pht1; The special upstream primer of 8 encoder block is OsPT8-F:SEQ ID NO.3, and downstream primer is OsPT8-R:SEQID NO.4.

4. rice phosphate translocator ORYsa; Pht1; 8 engineering is used, this phosphate cotransporter albumen ORYsa; Pht1; 8 aminoacid sequence is SEQ ID NO.2.

5. paddy gene ORYsa; Pht1; 8 application in the available phosphorus utilization ratio in improving soil.

6. rice phosphate translocator ORYsa; Pht1; 8 application in the available phosphorus utilization ratio in improving soil.

7. paddy gene ORYsa; Pht1; 8 at phosphorus from vegetative organ to the application aspect the transhipment of organ of multiplication.

8. rice phosphate translocator ORYsa; Pht1; 8 at phosphorus from vegetative organ to the application aspect the transhipment of organ of multiplication.