CN114672493A - Method for cultivating drought-resistant plant by using ZmPHT1, 7 protein or coding gene thereof - Google Patents

Abstract

The invention discloses a method for preparing a medical dressing by using ZmPHT1;7 protein or its coding gene. The invention provides a method for cultivating drought-resistant transgenic plants, which is used for culturing ZmPET 1 in target plants; 7 gene editing to terminate the protein translation in advance to obtain transgenic plant with drought resistance higher than that of the target plant; in the embodiment of the invention, the CRISPR-Cas9 gene editing technology is adopted to obtain drought-sensitive plants, compared with the traditional breeding mode, the time is short, the purpose is strong, gene resources are provided for cultivating and improving new varieties of drought-resistant plants, and theoretical basis is provided for clarifying the molecular mechanism of WRKY transcription factors in plant drought stress signal response.

Description

A method of treating diabetes with ZmPHT1; method for cultivating drought-resistant plant by 7 protein or coding gene thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a biological enzyme inhibitor prepared from ZmPHT1;7 protein or its coding gene.

Background

Drought is one of the most serious abiotic stresses in the world, plant growth and development are hindered due to drought stress, plant plants are short and small, crop yield and quality are reduced, serious harm is brought to agricultural production, and the global problem that the agricultural production is influenced is solved. Therefore, the genes involved in plant drought response are searched, and the genes are mutated by using technologies such as transgenic overexpression or gene editing, so that candidate gene resources can be provided for molecular breeding and germplasm improvement and improvement of crop stress resistance. Particularly, the rapidly developed CRISPR/Cas9 technology in recent years provides an efficient, convenient and accurate gene editing mode, and the advanced technology is used for breeding new stress-resistant varieties, so that the breeding efficiency can be improved, the hybridization and screening time can be shortened, and the breeding direction is determined, so that the method is one of effective methods for improving the crop traits.

Phosphorus is one of important macronutrient elements necessary for plant growth and development, plant phosphorus transporters are important proteins in plant phosphorus nutrition, and members of the family are mainly responsible for absorption and transportation of phosphorus nutrition in plant root systems. The research on the high-efficiency utilization of the phosphorus element has important theoretical value and practical significance for increasing the yield of crops. Although the research on phosphorus transporters has been rapidly advanced and has achieved a great deal of success in nutrient absorption, research on stress resistance has yet to be conducted. The high-efficiency utilization of phosphorus nutrition and the stress resistance are combined, the coordination and unification of the growth and development of plants and the stress resistance are realized, and the method has important significance for realizing the high yield, stable yield and yield preservation of crops.

Corn (Zea mays) is one of three major food crops, and is also an important forage crop, belonging to the Zea genus of the family gramineae. With the completion of genome sequencing of maize inbred lines such as B73 and Mo17, the genetic background of maize is clearer. At the same time, inbred lines that are amenable to genetic transformation are continually sequenced and developed, greatly increasing the efficiency of transgenic overexpression and gene editing techniques, such as the B73 inbred line. The transformation efficiency of the inbred line is higher than that of most of the inbred lines known at present, transgenic over-expression or gene editing plants can be obtained easily through transformation, technical support is provided for genetic character improvement by utilizing molecular breeding, and the inbred line has application value for reducing corn yield reduction caused by abiotic stress such as drought.

At present, some researches about the participation of phosphorus transporters in plant nutrition high efficiency exist in plants, but the drought resistance related functions of the phosphorus transporters in monocotyledonous crop maize are not reported.

Disclosure of Invention

An object of the present invention is to provide a method for cultivating a drought-resistant transgenic plant.

The method provided by the invention is 1) or 2) or 3) as follows:

1) the method comprises the following steps: reducing the activity or content of DNA molecule coding protein in a target plant to obtain a transgenic plant with drought resistance higher than that of the target plant;

2) the method comprises the following steps: inhibiting the expression of the DNA molecule in the target plant to obtain a transgenic plant with drought resistance higher than that of the target plant;

3) the method comprises the following steps: and (3) carrying out gene editing on the DNA molecules in the target plant, so that the translation of the protein is terminated in advance, and obtaining a transgenic plant with drought resistance higher than that of the target plant.

The DNA molecule is the following DNA molecule (b1), or (b2), or (b3), or (b 4):

(b1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

(b2) the coding region is a DNA molecule shown as a sequence 3 in a sequence table;

(b3) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (b1) or (b2) and encodes the protein;

(b4) A DNA molecule derived from maize and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in (b1) or (b2) and encoding said protein.

In the above method, the reducing the activity or content of a protein encoded by a DNA molecule in a target plant, the inhibiting the expression of the above DNA molecule in a target plant, or the performing gene editing on the above DNA molecule in a target plant is performed by: introducing the CRISPR/Cas9 system into the target plant.

The CRISPR/Cas9 system comprising the following 1) or 2):

1) a sgRNA that is sgRNA1 and/or sgRNA 2;

the target point of the sgRNA1 is 809 th 830 th bit of the sequence 1;

the sgRNA2 targets at position 904-925 of the sequence 1;

2) a CRISPR/Cas9 vector expressing the sgRNA.

In the above, the plant is a monocotyledon or dicotyledon.

Another object of the present invention is to provide a DNA molecule.

The DNA molecule provided by the invention is ZmPHT 1; 7 gene which is a DNA molecule of (b1) or (b2) or (b3) or (b4) as follows:

(b1) The coding region is a DNA molecule shown as a sequence 1 in a sequence table;

(b2) the coding region is a DNA molecule shown as a sequence 3 in a sequence table;

(b3) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (b1) or (b2) and encodes the protein;

(b4) a DNA molecule derived from maize and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in (b1) or (b2) and encoding said protein.

The protein encoded by the DNA molecule is also within the scope of the present invention.

The protein is (a1), (a2), (a3) or (a 4):

(a1) protein shown in a sequence 2 in a sequence table;

(a2) the protein shown in the sequence 2 in the sequence table is subjected to substitution and/or deletion and/or addition of one or more amino acid residues, and is related to plant drought resistance and derived from the protein;

(a3) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);

(a4) a protein derived from corn, having 98% or more identity to (a1), and having a relationship with plant drought resistance.

The labels are specifically shown in table 1.

Table 1 shows the sequence of the tags

Label (R)	Residue(s) of	Sequence of
			Poly-Arg	5-6 (generally 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL
HA	9	YPYDVPDYA

The maize zmpth 1; the 7 gene consists of 2904 bases (sequence 1), the reading frame of the T01 transcript is shown as sequence 3, and the encoded protein is shown as sequence 2. The transcript consists of 2 exons, 2 of which are encoded, with bases from position 1 to 783 in reading frame, bases from position 1018 to 1620, and the remainder as intron sequences. The gene is from B73 corn, because the same DNA segment sequence of corn can produce different transcripts to translate different proteins, the different transcripts produced by the DNA segment sequence and the translated different proteins with drought-resistant function are all in the protection scope of the invention.

Recombinant vectors, expression cassettes or recombinant bacteria comprising the above DNA molecules are also within the scope of the present invention.

The application of the DNA molecule or the protein in the regulation of the drought resistance of the plant is also within the protection scope of the invention.

The application of the substance for reducing the activity or the content of the protein in improving the drought resistance of plants or cultivating drought-resistant plants is also within the protection scope of the invention.

Or, the application of the substance for inhibiting the expression of the DNA molecule in improving the drought resistance of plants or cultivating drought-resistant plants is also within the protection scope of the invention.

In the application, the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

1) a sgRNA that is sgRNA1 and/or sgRNA 2;

the target point of the sgRNA1 is 809 th 830 th bit of the sequence 1;

the sgRNA2 targets at position 904-925 of the sequence 1;

2) a CRISPR/Cas9 vector expressing the sgRNA.

ZmPHT 1; the nucleotide sequence of the 7 gene is shown as a sequence 1, and one or more nucleotides are replaced, deleted and/or added by a CRISPR/Cas9 gene editing technology according to the nucleotide sequence disclosed by the invention to obtain an influence ZmPHT 1; 7 protein function. Specifically, the technical scheme of the invention comprises the following steps: ZmPHT1 using website design; 7, designing a primer according to the target, constructing a CRISPR/Cas9 vector through a series of processes such as PCR, enzyme digestion, connection and the like, transferring the vector into agrobacterium, infecting corn immature embryos with the agrobacterium to obtain transformed seedlings, identifying and screening positive plants by using a herbicide and PCR, extracting mutant plant DNA, and sequencing to obtain a mutant with a mutation site. The mutants were subjected to selfing and breeding and then to drought treatment experiments. Zmpth 1; 7 gene can be edited by more than one target, and the edited mutant gene can generate one or more nucleotide additions or deletions, thereby leading to partial deletion or premature termination of the protein, wherein some mutations can influence the biological function of the protein. Mutant plants expressing non-functional proteins that may develop a phenotype responsive to drought stress are within the scope of the claimed invention. After obtaining the mutants, zmpth 1 was tested; phenotype of mutant under drought treatment.

ZmPHT1 provided by the invention; after 7 gene mutation, the mutant growth under drought treatment condition is obviously stronger than wild type, which shows that the gene is a negative regulatory factor of drought stress response, and the drought resistance of plants can be obviously enhanced after mutation. In the embodiment of the invention, the drought-resistant ZmPET 1 is obtained by using a CRISPR/Cas9 technology; the mutant 7 has stronger genetic stability after the Cas9 background is removed by selfing, can be stably inherited in different generations, provides gene resources for cultivating and improving new drought-resistant varieties, and provides theoretical basis for clarifying the molecular mechanism of plant drought stress signal response.

The invention has the beneficial effects that:

(1) zmpth 1 in the present invention; the 7 gene mutation plant has obvious drought-resistant phenotype, has better growth condition under drought conditions, has obviously lower leaf wilting degree than that of an un-mutated wild plant, and can exploit the drought-resistant performance of the plant by utilizing the negative regulation and control action of the gene.

(2) Compared with the traditional breeding mode, the method for breeding the drought-resistant plant has the advantages of short breeding time, strong purposiveness and the like, obviously shortens the breeding period and improves the efficiency of drought-response breeding.

Drawings

FIG. 1 is wild type maize (control) and ZmPHT 1; photograph of growth of plants after drought treatment of 7CRISPR-Cas9 mutant line.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples are intended to illustrate the invention without limiting its scope.

The transcript used in the following examples is T01, as an example only, and does not limit the editing sites in the application. Examples were carried out according to the usual experimental conditions or product specifications, unless otherwise specified.

Maize ecotype B73, described in the following documents: schnable, P.S.et al.the B73 mail genome: complex, diversity, and dynamics.science 326, 1112-

The agrobacterium strain is EHA 105.

CRISPR/Cas9 vector pBUE411, described in: xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ BMC Plant biol.2014Nov 29; 14(1) 327; a CRISPR/Cas9 toolkit for multiplex genome editing in plants.

The main reagents comprise: restriction enzymes, DNA polymerases, T4 ligases, etc. from biological companies such as NEB and Toyobo; reverse transcription kit from Thermo corporation; RNA extraction kit from magenta; quantitative PCR reagents of Takara corporation; the plasmid extraction kit and the DNA recovery kit are purchased from Tiangen corporation; MS culture medium, agar powder, agarose, ampicillin, kanamycin, gentamicin sulfate, rifampicin and other antibiotics are purchased from sigma; various other chemical reagents used in the examples are imported or domestic analytical reagents; primer synthesis and sequencing was done by invitro.

Example 1, zmpth 1; 7 gene acquisition and construction and detection of CRISPR/Cas9 gene editing vector

One, zmpth 1; 7 Gene acquisition

To study the molecular mechanism of PHT family proteins in plant drought resistance, ZmPHT1 was directionally mutated from the maize (Zea mays L.) B73 genome by using CRISPR/Cas9 technology; 7 gene.

Corn zmpth 1; the 7 gene consists of 2904 bases (sequence 1), the reading frame of the T01 transcript is sequence 3, and the encoded protein is shown as sequence 2. The transcript is composed of 3 exons, wherein the reading frame comprises 584 th to 2136 th bases, 2755 th to 2895 th bases, 3978 th to 4924 th bases and the rest is an intron sequence. The gene is from B73 corn, because the same DNA segment sequence of corn can produce different transcripts to translate different proteins, the different transcripts produced by the DNA segment sequence and the translated different proteins with drought-resistant function are all in the protection scope of the invention.

II, ZmPHT1 used for gene editing; constructing a CRISPR/Cas9 gene editing vector of the 7 gene and selecting ZmPHT 1; ACGTCGCGGCGGCGGTCAACGG (809 st 830 th site of the sequence 1) and GTGTACGGGATGACGCTCATGG (904 st 925 th site of the sequence 1) in the 7 gene are used as two targets of the gene, and primers containing information of the two targets are designed:

Respectively synthesizing single-stranded oligonucleotides according to sequences designed by the target points, wherein the synthesis method comprises the following steps:

MT1T2-F:AATAATGGTCTCAGGCGACGTCGCGGCGGCGGTCAA

MT1T2-F0:GACGTCGCGGCGGCGGTCAAGTTTTAGAGCTAGAAATAGC

MT1T2-R0:TGAGCGTCATCCCGTACACCGCTTCTTGGTGCC

MT1T2-R:ATTATTGGTCTCTAAACTGAGCGTCATCCCGTACAC

(1) and (3) PCR amplification: four-primer PCR amplification was performed using 100-fold diluted pCBC-MT1T2 (described in Xing, HL., Dong, L., Wang, ZP. et al. A CRISPR/Cas9 toolkit for multiplex genome amplification in plants. BMC Plant Biol 14,327 (2014.) as a template. MT1T2-F/-R is the normal primer concentration; MT1T2-F0/-R0 diluted 20-fold.

Obtaining a PCR product; and carrying out enzyme digestion on the PCR product to obtain a product after enzyme digestion.

(2) The pBUE411 vector (which contains a 3 XFLAG-NLS-zCas 9-NLS expression system and a gRNA bracket for inserting a target sequence) is subjected to enzyme digestion by BsaI (NEB) to obtain pBUE411 after enzyme digestion;

table 2 shows the digestion system

(3) Connection system

Connecting the product obtained in the step (1) with the pBUE411 obtained in the step (2) to obtain a connection product, namely the recombinant CRISPR vector pBCXUN-ZmPHT 1; 7CRISPR-Cas9, wherein the vector expresses sgRNA1 and sgRNA2, the coding sequence of the recognition region of the sgRNA1 is 809-830 th bit of the sequence 1, and the coding sequence of the recognition region of the sgRNA2 is 904-925 th bit of the sequence 1.

The above-described linkage system is shown in table 3:

table 3 shows the connection system

(4) Identification

Taking 5 mu l of the ligation product obtained in the step (3), and transforming the Escherichia coli competence. Screening was performed on LB plates containing 50. mu.g/mL kanamycin.

Colony PCR identification is carried out by adopting OsU3-FD3 and TaU3-RD, and 831bp is obtained as positive bacteria.

Sequencing was confirmed using OsU3-FD3 and TaU3-FD 2.

OsU3-FD3:GACAGGCGTCTTCTACTGGTGCTAC

TaU3-RD:CTCACAAATTATCAGCACGCTAGTC

TaU3-FD2:TTGACTAGCGTGCTGATAATTTGTG

Sequencing results show that the plasmid of the positive clone is a recombinant CRISPR vector pBCXUN-ZmPHT 1; 7CRISPR-Cas9, wherein the vector expresses sgRNA1 and sgRNA2, the coding sequence of a recognition region of the sgRNA1 is 809-830 th bit of a sequence 1, and the coding sequence of a recognition region of the sgRNA2 is 904-925 th bit of the sequence 1.

Example 2, zmpth 1; construction and identification of 7-gene CRISPR-Cas9 plant

1. Preparation of recombinant bacterium

The CRISPR/Cas9 gene editing vector pBCXUN-ZmPHT1 constructed in example 1; the 7CRISPR-Cas9 mutant plasmid is transformed into a competent Agrobacterium EHA105 strain by a heat shock method, and a positive clone is identified by colony PCR and is named as EHA105/pBCXUN-ZmPHT 1; 7CRISPR-Cas 9.

2. Zmpth 1; construction of 7-gene CRISPR-Cas9 plant

The correct Agrobacterium EHA105/pBCXUN-ZmPHT1 will be identified; inoculating 7CRISPR-Cas9 single colony in 2-3 mL liquid culture medium containing 100. mu.g/mL kanamycin and 50. mu.g/mL rifampicin, shake culturing at 28 deg.C overnight, inoculating to liquid culture medium containing large amount of antibiotics the next day, shake culturing, collecting thallus after several times of inoculation, and resuspending to OD ₆₀₀Between 0.8 and 1.0.

The recombinant strain EHA105/pBCXUN-ZmPHT 1; 7CRISPR-Cas9 is transferred into a hard stalk inbred line B73 by adopting an agrobacterium-mediated method and is also called as wild corn below), the immature embryo of B73 is infected by agrobacterium tumefaciens EHA105, the immature embryo which is invaded by the agrobacterium tumefaciens EHA105 is placed on a selective culture medium for multiple times of screening to obtain a resistant callus, and the resistant callus is regenerated into seedlings to obtain T0 generation transformed seedlings. The construction method refers to: plant Journal,93(6): 1032-1044, 2018.

3. Detection of

DNA of T0 transformed seedlings was extracted as template for PCR amplification and sequencing, using B73 maize as control.

PCR amplification was performed using OsU3-FD3 and TaU3-RD to obtain a positive of 831 bp.

Sequencing was confirmed using OsU3-FD3 and TaU3-FD 2.

OsU3-FD3:GACAGGCGTCTTCTACTGGTGCTAC

TaU3-RD:CTCACAAATTATCAGCACGCTAGTC

TaU3-FD2:TTGACTAGCGTGCTGATAATTTGTG

Sequencing primers: OsU3-FD 3: GACAGGCGTCTTCTACTGGTGCTAC

Sequencing results show that ZmPHT1 of T0 generation transformed seedlings is compared with wild type corn B73; large fragment deletion mutation (95bp, corresponding to position 825-919 in the sequence 1) in the 7 gene causes frame shift, so that the protein sequence is changed, translation is stopped, and the protein function is damaged.

The transformed plantlet containing the mutant form was named positive T0 generation CRISPR-Cas9 mutant maize.

Breeding positive T0 generation CRISPR-Cas9 mutant corn to obtain T2 generation CRISPR-Cas9 mutant corn.

Example 3, zmpth 1; 7-gene CRISPR-Cas9 mutant maize drought treatment phenotype detection

1. Sowing T2-generation CRISPR-Cas9 mutant corn strain zmptht 1 in a small pot filled with nutrient soil; 7-1 seed, T2 generation CRISPR-Cas9 mutant maize line zmptht 1; 7-2 seeds and wild type maize B73 seeds, covering 50cm²Dumping the residual water in the tray after the soil is fully absorbed with water, and growing seedlings after 7 days to obtain T2 generation CRISPR-Cas9 mutant corn zmpth 1; 7-1 seedling, T2 generation CRISPR-Cas9 mutant maize zmptht 1; 7-2 seedlings and wild type corn seedlings;

2. the growing and full-bodied T2 generation CRISPR-Cas9 mutant maize zmptht 1; 7-1 seedling, T2 generation CRISPR-Cas9 mutant maize zmpht 1; seedlings 7-2 and wild type maize B73 were transplanted into new pots containing nutrient soil, 3 plants per pot, watered normally and cultured for 7 days. Three replicates were set up, each line being replicated 3 pots each time.

3. After completion of step 2, no watering was continued for 14 days (drought treatment), and the phenotype was recorded by photographing.

The results are shown in fig. 1, and it can be seen that the growth conditions of the control plants (WT, wild type maize B73) were weaker than zmpth 1 after 14 days without watering; 7CRISPR-Cas9 mutant plants (zmpth 1; 7-1 and zmpth 1; 7-2) with higher leaf wilting control (WT) than mutant plants (zmpth 1; 7-1& zmpth 1; 7-2) which were more drought tolerant than the non-mutated control plants.

Thus, zmpth 1 was inhibited; 7 protein expression or knock-out of zmpth 1;7 genes can improve drought tolerance of corn.

SEQUENCE LISTING

<110> university of agriculture in China

<120> a method for cultivating drought-resistant plants using ZmPHT1, 7 protein or its coding gene

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 2904

<212> DNA

<213> Zea mays L.

<400> 1

ctaacccgtg ccgtgcttcg ggctacccgt taggcccgac ccgtttggac atgtatattc 60

gcacctcaca ctcgtcgcgt ccctgtcagc agccaagttt ctccgaaatg gcggcaagag 120

gcggaccgcg gacccgatgc tccccggtca tgacgaaacg gaacctgcca aggcgggcgg 180

aaaaatggcg aaaagataag tggtccgtta gatgacgtca cgaacggaca gagtgaactc 240

aatctcttgg gtgatgatcc cccctcgcct ccccctgttt caatttcgat tccgacgaga 300

ggaatcgacg taaataaaac aaaaccaaaa tacttgcttg actacttgag caagcgcgtg 360

cgcgtcttcg gtcatcgcag tcgtcgccgg gcgccagcgg ccagccgcaa cccacaagca 420

gagcaaaata ttccgccaag gatccgtgga ccgagcagca tctggcactg agctacatat 480

acccgttgtt cagccaccac cactgtcccc aagcatcaag ctaggcaggc ctggtcccga 540

agaacaccct tctctggtcg tcgcatcgca gggcagctag ctaggtagct aacatccgcc 600

atggcgcgcg ggggagacgg cctgcaggtg ctgagcgcgc tggacgcggc gaagacgcag 660

tggtaccact tcacggccat catcgtcgcc ggcatgggct tcttcacgga cgcctacgac 720

ctcttctgca tctccctcgt caccaagctg ctgggccgca tctactacac ggacaccagc 780

aaggacagcc ccgggtcgct gccgcccaac gtcgcggcgg cggtcaacgg cgtggccttc 840

tgcggcacgc tggcggggca gctcttcttc ggctggctgg gcgacaagct ggggcgcaag 900

agcgtgtacg ggatgacgct catggtcatg gtcatctgct ccgtcgcgtc gggcctctcg 960

ttcggccaca cccccacggg ggtcatggcc acgctctgct tcttccgctt ctggctcggc 1020

ttcggcatcg gcggcgacta cccgctgtcg gccaccatca tgtccgagta cgccaacaag 1080

aggacccgcg gcgccttcat cgccgccgtc ttcgccatgc agggcttcgg catcctcgcc 1140

ggcggcatcg tcacgctcgt catctccgcc gccttccgcg cggcgtaccc gtccccggcg 1200

tacagggacg accacttcac ctccaccgtg ccgcaggccg acatcgtgtg gcgggtcatc 1260

gtcatgctcg gcgccgcgcc ggcgctgctc acctactact ggcggatgaa gatgcccgag 1320

acggcgcggt acacggcgct ggtggccaag aacgccaagc aggccgccgc cgacatgtcc 1380

aaggtgctgc acacggagat cgtggacgag caggagaagc tggacgccgc cgagggcgcc 1440

aacagcttcg gcctcttctc cagggagttc gcgcgccgcc acggcctcca cctcgtcggc 1500

accgccacca cctggttcct gctcgacatc gccttctaca gccagaacct gttccagaag 1560

gacatcttca ccagcatcaa ctggatcccc aaggccaaca ccatgagcgc gctggaggag 1620

gtgtaccgca tctcccgcgc gcagaccctc atcgcgctct gcggcacagt cccgggctac 1680

tggttcaccg tcgcgctcat cgacgtcgtc ggccgcttcg ccatacagct gctgggcttc 1740

ttcatgatga ccgtcttcat gctcggcctc gccatcccct accaccactg gaccacgccg 1800

ggcaaccaca tcggcttcgt cgtcatgtac gccttcacct tcttcttcgc caacttcggg 1860

cccaacagca ccaccttcat cgtgcccgcc gagatcttcc cggcgcgcct gcgctccacc 1920

tgccacggca tctccgccgc ctcggggaag gccggggcca tcatcggcgc gttcggcttc 1980

ctgtacgcgg cgcagaacca ggacaggagc aagacggacg ccggctaccc cgcgggcatc 2040

ggcgtgcgca actcgctctt cgtcctcgcc gccagcaaca tgctcggctt cgtcctcacg 2100

ttcctcgtgc cggagtccaa gggcaagtcg ctcgaggaga tgtccggtga ggctgaagac 2160

tcagaggagg agcccgtcgg cgcccgtgcg gtgcggccgt cggagaccca gatggtgtag 2220

agaatcgatc gatcgacgcg tgttccttcc tgcactgcac atggtgggct atcatgtcct 2280

caattgtttt tttccacgtt aaagtcaacc ctggctgtgt tttgatgtgc acaagtcgtt 2340

cgcatacgta gtacgtgtgt gatagtctgg tagagcaggt gaatcgcatc gcatgtggca 2400

gtctggtaga ggtccacgtg tgataataaa taggcgggaa agtagctagg tgaactttac 2460

actcgtatat ccaaccatat ataatcggtt acgcgcgttt agcaactcca ctactccagc 2520

aaataatcta aatcctaact cactagttta aattcaattc ttaatttagt tctagaagac 2580

atgatccatt attgcaacat ctagtccaca aatatacaac atatcgatgt aggttgtgcc 2640

ctcattgtgt acatgtagcc atagctcaca gaatggagtc atgcctacat gggctgccca 2700

ttgacccaca ccctatacat tatttacttg ctacatgtgc tcacgctaca ggatacgaga 2760

tcatttttcc gtcacagaag ctgacgaaaa taagctatat tttataaaaa taatttattt 2820

tcggcgacat gtggcctatg gcacgttatc agtattggcc tgccaacaaa taacttgcta 2880

aaagagttca agcttgacaa tagc 2904

<210> 2

<211> 461

<212> PRT

<213> Zea mays L.

<400> 2

Met Ala Arg Gly Gly Asp Gly Leu Gln Val Leu Ser Ala Leu Asp Ala

1 5 10 15

Ala Lys Thr Gln Trp Tyr His Phe Thr Ala Ile Ile Val Ala Gly Met

20 25 30

Gly Phe Phe Thr Asp Ala Tyr Asp Leu Phe Cys Ile Ser Leu Val Thr

35 40 45

Lys Leu Leu Gly Arg Ile Tyr Tyr Thr Asp Thr Ser Lys Asp Ser Pro

50 55 60

Gly Ser Leu Pro Pro Asn Val Ala Ala Ala Val Asn Gly Val Ala Phe

65 70 75 80

Cys Gly Thr Leu Ala Gly Gln Leu Phe Phe Gly Trp Leu Gly Asp Lys

85 90 95

Leu Gly Arg Lys Ser Val Tyr Gly Met Thr Leu Met Val Met Val Ile

100 105 110

Cys Ser Val Ala Ser Gly Leu Ser Phe Gly His Thr Pro Thr Gly Val

115 120 125

Met Ala Thr Leu Cys Phe Phe Arg Phe Trp Leu Gly Phe Gly Ile Gly

130 135 140

Gly Asp Tyr Pro Leu Ser Ala Thr Ile Met Ser Glu Tyr Ala Asn Lys

145 150 155 160

Arg Thr Arg Gly Ala Phe Ile Ala Ala Val Phe Ala Met Gln Gly Phe

165 170 175

Gly Ile Leu Ala Gly Gly Ile Val Thr Leu Val Ile Ser Ala Ala Phe

180 185 190

Arg Ala Ala Tyr Pro Ser Pro Ala Tyr Arg Asp Asp His Phe Thr Ser

195 200 205

Thr Val Pro Gln Ala Asp Ile Val Trp Arg Val Ile Val Met Leu Gly

210 215 220

Ala Ala Pro Ala Leu Leu Thr Tyr Tyr Trp Arg Met Lys Met Pro Glu

225 230 235 240

Thr Ala Arg Tyr Thr Ala Leu Val Ala Lys Asn Ala Lys Gln Ala Ala

245 250 255

Ala Asp Met Ser Lys Glu Val Tyr Arg Ile Ser Arg Ala Gln Thr Leu

260 265 270

Ile Ala Leu Cys Gly Thr Val Pro Gly Tyr Trp Phe Thr Val Ala Leu

275 280 285

Ile Asp Val Val Gly Arg Phe Ala Ile Gln Leu Leu Gly Phe Phe Met

290 295 300

Met Thr Val Phe Met Leu Gly Leu Ala Ile Pro Tyr His His Trp Thr

305 310 315 320

Thr Pro Gly Asn His Ile Gly Phe Val Val Met Tyr Ala Phe Thr Phe

325 330 335

Phe Phe Ala Asn Phe Gly Pro Asn Ser Thr Thr Phe Ile Val Pro Ala

340 345 350

Glu Ile Phe Pro Ala Arg Leu Arg Ser Thr Cys His Gly Ile Ser Ala

355 360 365

Ala Ser Gly Lys Ala Gly Ala Ile Ile Gly Ala Phe Gly Phe Leu Tyr

370 375 380

Ala Ala Gln Asn Gln Asp Arg Ser Lys Thr Asp Ala Gly Tyr Pro Ala

385 390 395 400

Gly Ile Gly Val Arg Asn Ser Leu Phe Val Leu Ala Ala Ser Asn Met

405 410 415

Leu Gly Phe Val Leu Thr Phe Leu Val Pro Glu Ser Lys Gly Lys Ser

420 425 430

Leu Glu Glu Met Ser Gly Glu Ala Glu Asp Ser Glu Glu Glu Pro Val

435 440 445

Gly Ala Arg Ala Val Arg Pro Ser Glu Thr Gln Met Val

450 455 460

<210> 3

<211> 1386

<212> DNA

<213> Zea mays L.

<400> 3

atggcgcgcg ggggagacgg cctgcaggtg ctgagcgcgc tggacgcggc gaagacgcag 60

tggtaccact tcacggccat catcgtcgcc ggcatgggct tcttcacgga cgcctacgac 120

ctcttctgca tctccctcgt caccaagctg ctgggccgca tctactacac ggacaccagc 180

aaggacagcc ccgggtcgct gccgcccaac gtcgcggcgg cggtcaacgg cgtggccttc 240

tgcggcacgc tggcggggca gctcttcttc ggctggctgg gcgacaagct ggggcgcaag 300

agcgtgtacg ggatgacgct catggtcatg gtcatctgct ccgtcgcgtc gggcctctcg 360

ttcggccaca cccccacggg ggtcatggcc acgctctgct tcttccgctt ctggctcggc 420

ttcggcatcg gcggcgacta cccgctgtcg gccaccatca tgtccgagta cgccaacaag 480

aggacccgcg gcgccttcat cgccgccgtc ttcgccatgc agggcttcgg catcctcgcc 540

ggcggcatcg tcacgctcgt catctccgcc gccttccgcg cggcgtaccc gtccccggcg 600

tacagggacg accacttcac ctccaccgtg ccgcaggccg acatcgtgtg gcgggtcatc 660

gtcatgctcg gcgccgcgcc ggcgctgctc acctactact ggcggatgaa gatgcccgag 720

acggcgcggt acacggcgct ggtggccaag aacgccaagc aggccgccgc cgacatgtcc 780

aaggaggtgt accgcatctc ccgcgcgcag accctcatcg cgctctgcgg cacagtcccg 840

ggctactggt tcaccgtcgc gctcatcgac gtcgtcggcc gcttcgccat acagctgctg 900

ggcttcttca tgatgaccgt cttcatgctc ggcctcgcca tcccctacca ccactggacc 960

acgccgggca accacatcgg cttcgtcgtc atgtacgcct tcaccttctt cttcgccaac 1020

ttcgggccca acagcaccac cttcatcgtg cccgccgaga tcttcccggc gcgcctgcgc 1080

tccacctgcc acggcatctc cgccgcctcg gggaaggccg gggccatcat cggcgcgttc 1140

ggcttcctgt acgcggcgca gaaccaggac aggagcaaga cggacgccgg ctaccccgcg 1200

ggcatcggcg tgcgcaactc gctcttcgtc ctcgccgcca gcaacatgct cggcttcgtc 1260

ctcacgttcc tcgtgccgga gtccaagggc aagtcgctcg aggagatgtc cggtgaggct 1320

gaagactcag aggaggagcc cgtcggcgcc cgtgcggtgc ggccgtcgga gacccagatg 1380

gtgtag 1386

Claims (10)

1. A method for cultivating drought-resistant transgenic plants comprises the following steps 1) or 2) or 3):

1) comprises the following steps: reducing the activity or content of DNA molecule coding protein in a target plant to obtain a transgenic plant with drought resistance higher than that of the target plant;

2) comprises the following steps: inhibiting the expression of the DNA molecules in the target plant to obtain a transgenic plant with drought resistance higher than that of the target plant;

3) comprises the following steps: carrying out gene editing on the DNA molecules in the target plant to terminate the translation of the protein in advance so as to obtain a transgenic plant with drought resistance higher than that of the target plant;

the DNA molecule is the following DNA molecule (b1), or (b2), or (b3), or (b 4):

(b1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

(b2) the coding region is a DNA molecule shown as a sequence 3 in a sequence table;

(b3) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (b1) or (b2) and encodes the protein;

(b4) a DNA molecule derived from maize and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in (b1) or (b2) and encoding said protein.

2. The method of claim 1, wherein:

the reduction of the activity or content of a protein encoded by a DNA molecule in a plant of interest, the inhibition of the expression of said DNA molecule in a plant of interest, or the gene editing of said DNA molecule in a plant of interest is effected by: introducing the CRISPR/Cas9 system into the plant of interest;

the CRISPR/Cas9 system comprising the following 1) or 2):

1) a sgRNA that is sgRNA1 and/or sgRNA 2;

the target point of the sgRNA1 is 809 th 830 th bit of the sequence 1;

the sgRNA2 targets at position 904-925 of the sequence 1;

2) a CRISPR/Cas9 vector expressing the sgRNA.

3. A DNA molecule which is the following (b1) or (b2) or (b3) or (b 4):

(b1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

(b2) the coding region is a DNA molecule shown as a sequence 3 in a sequence table;

(b3) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (b1) or (b2) and encodes the protein;

(b4) a DNA molecule derived from maize and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in (b1) or (b2) and encoding said protein.

4. A protein encoded by the DNA molecule of claim 3.

5. The protein of claim 4 which is (a1) or (a2) or (a3) or (a4) as follows:

(a1) protein shown in a sequence 2 in a sequence table;

(a2) the protein shown in the sequence 2 in the sequence table is subjected to substitution and/or deletion and/or addition of one or more amino acid residues, and is related to plant drought resistance and derived from the protein;

(a3) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);

(a4) a protein derived from corn, having 98% or more identity to (a1), and associated with plant drought resistance.

6. A recombinant vector, expression cassette or recombinant bacterium comprising the DNA molecule of claim 3.

7. Use of a DNA molecule according to claim 3 or a protein according to claim 4 or 5 for modulating drought resistance in a plant.

8. Use of a substance that reduces the activity or content of a protein according to claim 4 or 5 for increasing drought resistance in plants or for growing drought-resistant plants;

or, use of a substance that inhibits the expression of the DNA molecule of claim 3 to increase drought resistance in plants or to cultivate drought resistant plants.

9. Use according to claim 8, characterized in that: the substance is a CRISPR/Cas9 system;

The CRISPR/Cas9 system includes the following 1) or 2):

1) a sgRNA that is sgRNA1 and/or sgRNA 2;

the target point of the sgRNA1 is 809 th 830 th bit of the sequence 1;

the sgRNA2 targets at position 904-925 of the sequence 1;

2) a CRISPR/Cas9 vector expressing the sgRNA.

10. A CRISPR/Cas9 system comprising the following 1) or 2):

1) a sgRNA that is sgRNA1 and/or sgRNA 2;

the target point of the sgRNA1 is 809 th 830 th bit of the sequence 1;

the sgRNA2 targets at position 904-925 of the sequence 1;

2) a CRISPR/Cas9 vector expressing the sgRNA.

Images