CN101392260A - Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene - Google Patents
Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene Download PDFInfo
- Publication number
- CN101392260A CN101392260A CNA2008102335235A CN200810233523A CN101392260A CN 101392260 A CN101392260 A CN 101392260A CN A2008102335235 A CNA2008102335235 A CN A2008102335235A CN 200810233523 A CN200810233523 A CN 200810233523A CN 101392260 A CN101392260 A CN 101392260A
- Authority
- CN
- China
- Prior art keywords
- leaf
- stem
- hongkong pavetta
- days
- pavetta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a method for creating a cut flower cultivar of Gypsophila paniculata which can resist against Liriomyza sativae, which obtains a tissue culture plantlet of genetically modified Gypsophila paniculata which can resist against Liriomyza sativae by constructing a high efficient genetic transformation system of Gypsophila paniculata, sieving the background of Gypsophila paniculata antibiotics, utilizing Bt genes to carry out genetic transformation to the G33 cultivar of Gypsophila paniculata, sieving the antibiotics of transformed plants, carrying out Pcr identification to the transformed plants and the rooting and propagation of the transformed plants. The method effectively improves the capability of Gypsophila paniculata in resisting against Liriomyza sativae; compared with the control plants inoculated in the same period, the morbidity degree of Liriomyza sativae is obviously lowered, thereby indicating that the genetically modified plants can effectively lower the harm of Liriomyza sativae done to Gypsophila paniculata, reduce cost for the culture management of Gypsophila paniculata and have practical meaning to practical planting production.
Description
Technical field
The present invention relates to a kind of breeding method of disease resistance flower plant, specifically is a kind of cut-flower Stem and leaf of Hongkong Pavetta gene breeding method of liriomyza sativae insect pest, belongs to biological technical field.
Background technology
Stem and leaf of Hongkong Pavetta (Gypsophila panicuta), another name silk China pink, rosy clouds grass belong to Caryophyllaceae Carnation Dan Niansheng or perennial herb flowers, originate in Europe, inferior northern.The plant branches and leaves of Stem and leaf of Hongkong Pavetta are careful, spend pure whitely, and polyphyll reaches more than thousand, so the name of Stem and leaf of Hongkong Pavetta is arranged.Suitable flower bed, flower footpath, rock garden configuration, the indispensable setoff of various especially cut-flower goods done.Yunnan is the main cultivation area of Stem and leaf of Hongkong Pavetta, and the whole province's cultivated area reaches 1550 mu, and annual turnover is 200-230 ten thousand strains, and the annual sales volume can reach more than 5,000 ten thousand yuans, is one of Yunnan flower planting main source of earning foreign exchange.
Americal rice leaf miner belongs to Diptera, Agromyzidae insect, is the main insect pest that takes place in the Stem and leaf of Hongkong Pavetta cultivation process.Along with the expansion of Yunnan Province's Stem and leaf of Hongkong Pavetta cultivated area, the damaging range of this insect pest is also increasing, and is on the rise.Because Americal rice leaf miner grows all the year round, and the generation overlap phenomenon is comparatively general, therefore have a strong impact on the anniversary cut-flower output of the regional Stem and leaf of Hongkong Pavetta of plantation in the geographic booth of plantation.Existing eliminating pest means mainly by spraying a large amount of chemical pesticides such as Avrmectin, take place in the hope of the big area of control Americal rice leaf miner in Stem and leaf of Hongkong Pavetta cultivation process.But because chemical pesticide contaminate environment and cost height, effect is limited, can not satisfy the requirement of the production of flowers and plants.The developing into it new solution route be provided of transgenic breeding technology.Therefore, utilize genetic engineering means to create Stem and leaf of Hongkong Pavetta liriomyza sativae insect pest new variety the production problem that solves its fungal disease and cause is had main practical application meaning.
1987, Vaeck etc. successfully imported tobacco to the toxoprotein gene of bacillus thuringiensis first, and transgene tobacco reaches more than 95% the poisoning rate of maduca sexta.The Bt gene is from the isolated Bacillus thuringiensis desinsection of microorganism Bacillus thuringiensis kind crystalline protein (insecticidal crystal protein, ICP) gene.The ICP gene exists with parent toxin (protoxin) situation usually, behind insect's food-taking ICP gene, in the digestive tube of insect, parent toxin is activated, and makes the transition to be the toxic polypeptide molecule, after specific proteins above the insect gut epithelial cell combines, the ICP gene is all or part of to be embedded in the cytolemma, makes cytolemma produce some ducts, thereby causes cell to break owing to osmotic equilibrium is destroyed, insect larvae will stop feed, and will be final dead.Therefore, utilize Stem and leaf of Hongkong Pavetta new variety that genetic engineering means creates the liriomyza sativae insect pest that the production problem that solves its insect pest and cause is had main practical application meaning.
Summary of the invention
The object of the present invention is to provide a kind of cut-flower Stem and leaf of Hongkong Pavetta gene breeding method of liriomyza sativae insect pest, it utilizes foreign gene that seedling of open herding is carried out genetic transformation, make the seedling after the conversion can effectively resist the Americal rice leaf miner insect pest, do not influence its ornamental value simultaneously again.
The present invention serves as the examination material with commercially available Stem and leaf of Hongkong Pavetta kind G33, utilize Bt gene pairs Stem and leaf of Hongkong Pavetta kind G33 to carry out gene transformation, according to the transgenic technology requirement, relevant group training research, agriculture bacillus mediated Bt gene transformation and the insect-resistance research of transfer-gen plant have been carried out, Stem and leaf of Hongkong Pavetta high-efficiency regeneration system, genetic conversion system and microbiotic threshold concentration screening system have been set up, obtain transfer-gen plant, obtained the transgenosis Stem and leaf of Hongkong Pavetta tissue cultured seedling of liriomyza sativae insect pest again by tissue culture fast-propagation.
Concrete technical scheme of the present invention is: a kind of transgenosis is created the method for cut-flower Stem and leaf of Hongkong Pavetta liriomyza sativae kind, and G33 is a material with the Stem and leaf of Hongkong Pavetta kind, comprises the following steps:
A, the foundation of the efficient transformation tissue culture system of Stem and leaf of Hongkong Pavetta: the Stem and leaf of Hongkong Pavetta individual plant of selecting healthy growth under the isolated culture condition, under aseptic condition, get vanelets as material, at division culture medium promptly: cultivated 14-21 days on the Ms+BA 0.5-2.0mg/L+NAA 0.1-0.5mg/L, wherein, culture temperature is 24~25 ℃, and intensity of illumination is 2000~2500LX, dissolves budlet from the base section of Stem and leaf of Hongkong Pavetta;
B, the conversion of Bt gene pairs Stem and leaf of Hongkong Pavetta:
With the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404, place the LB substratum of the Rif of the Km that contains 50mg/L and 5mg/L to shake overnight incubation, take out bacterium liquid, place LB liquid to cultivate base, concussion was cultivated 4-5 hour, and the Stem and leaf of Hongkong Pavetta blade to the A step infects afterwards, time of infection is 6~10min, change in the Ms substratum, dark cultivation down 2 days gets Stem and leaf of Hongkong Pavetta and infects blade;
C, the screening of transfer-gen plant: with the Stem and leaf of Hongkong Pavetta of B step infect blade forward to cultivate 2~3 days on the MS minimum medium after, forward to again contain Pyocianil Cb division culture medium promptly: cultivate on the Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L+Cb 400-500mg/L after 12~16 days, select the normal Stem and leaf of Hongkong Pavetta of differentiation to transform seedling, change over to contain Km division culture medium promptly: carry out 2~3 weeks of screening and culturing once more among the Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L+Km 50mg/L, tie up to division culture medium through the normal Stem and leaf of Hongkong Pavetta strain of the growth after the screening and culturing: carry out on the Ms+BA0.5-2.0mg/L+NAA 0.05-0.2mg/L tissue culture expand numerous after, transfer-gen plant;
D, take root, hardening and transplanting:
With C step gained transfer-gen plant through division culture medium: Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L expand numerous after, transfer to root media: on the Ms+NAA 0.2-0.4mg/L+IAA 0.1-0.3mg/ml, at 24~26 ℃, cultivated 14-21 days under intensity of illumination 2000~2500Lx condition, after treating that tissue cultured seedling plant bottom grows callus lines, be transplanted in the perlite, shading screen transition 25-35 days next time, the root system stalwartness, the seedling leaf is green when healthy and strong, be transplanted to laterite: the secondary transition is 25-40 days in the soil of leaf-humidified soil=3:1, be transplanted to afterwards and carry out the field planting cultivation in the booth, get the Stem and leaf of Hongkong Pavetta cut-flower seedling of liriomyza sativae insect pest.
The single bacterium colony of the agrobacterium tumefaciens pBI-Bt/LBA4404 of described B step obtains by following art methods:
(1) preparation of Agrobacterium competent cell
Agrobacterium LBA4404 is inoculated in the LB liquid nutrient medium, contains the kantlex Km of 50mg/L and the Rifampin Rif of 5mg/L in this substratum, in 28 ℃, 200rpm overnight incubation; Getting culture, to continue to be cultured to OD600 in the LB liquid nutrient medium that contains 50mg/L Km and 5mg/L Rif be 0.5, with culture ice bath 30min, behind 4 ℃, the centrifugal 5min of 5000rpm, abandons supernatant, is the CaCl of 20mmol/L with concentration
2Suspend, add concentration after the packing and be 15% glycerine, promptly get the Agrobacterium competent cell, freezing-70 ℃ of preservations in back in the liquid nitrogen;
(2) contain the conversion of Bt gene plasmid in Agrobacterium
Add in the competent cell in B step (1) and contain Bt gene plasmid DNA, after placing 30min on ice, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 3-5min are to melting fully, 2min adds LB liquid on ice, recovers to cultivate 3-5h in 28 ℃ of following 200rpm, the centrifugal 3-5min of 5000rpm collects thalline, is the CaCl of 20mmol/L again with concentration
2Repeat to suspend, be coated with the LB flat board, this flat board contains the Km of 50mg/L and the Rif of 5mg/L, cultivates 2 days for 28 ℃, obtains the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404.
The present invention has following advantage and effect:
1, setting up with Stem and leaf of Hongkong Pavetta kind G33 is the Stem and leaf of Hongkong Pavetta highly efficient regeneration transformation system of representative, shows that through Pcr, Southern hybridization detected result transformation efficiency reaches 6%.
2, Stem and leaf of Hongkong Pavetta kind G33 has been carried out the conversion of Bt gene, effectively improve the ability of its liriomyza sativae insect pest, system compares with the inoculation contrast strain same period, the Americal rice leaf miner occurring degree obviously reduces, show that transgenic line is highly resistant to the Stem and leaf of Hongkong Pavetta insect pest that is caused by Americal rice leaf miner, reduced the cost in the Stem and leaf of Hongkong Pavetta cultivation management, plantation is produced and is of practical significance to reality.
Embodiment
For flesh and blood of the present invention is described better, provide embodiments of the invention below, but content of the present invention is not limited in these.
Embodiment 1
A, the foundation of the efficient transformation tissue culture system of Stem and leaf of Hongkong Pavetta: the Stem and leaf of Hongkong Pavetta individual plant of selecting healthy growth under the isolated culture condition, under aseptic condition, get vanelets as material, at division culture medium promptly: cultivated 18 days on the Ms+BA 1.0mg/L+NAA 0.3mg/L, wherein, culture temperature is 25 ℃, and intensity of illumination is 2000lx, dissolves budlet from the base section of Stem and leaf of Hongkong Pavetta;
B, the conversion of Bt gene pairs Stem and leaf of Hongkong Pavetta:
(1) preparation of Agrobacterium competent cell
Agrobacterium LBA4404 is inoculated in 5ml contains in the LB liquid nutrient medium of Rif of the Km of 50mg/L and 5mg/L 28 ℃, 200rpm overnight incubation; Get the 2ml culture and in 50ml contains the LB liquid nutrient medium of Rif of the Km of 50mg/L and 5mg/L, continue to cultivate, to OD600 be 0.5, with culture ice bath 30min, 4 ℃, the centrifugal 5min of 5000rpm abandon supernatant, are the CaCl of 20mmol/L with the cold concentration of 1ml
2Suspend, be distributed into 50 μ l/ pipe, add concentration and be 15% glycerine, promptly get the Agrobacterium competent cell, freezing-70 ℃ of preservations afterwards in the liquid nitrogen;
(2) contain the conversion of plasmid in Agrobacterium of Bt gene
Add 1ug in the competent cell in B step (1) and contain Bt gene plasmid DNA, place 30min on ice after, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 4min are to melting fully, 2min on ice adds the liquid LB of 600ul, and 28 ℃ of following 200rpm recover to cultivate 4h, the centrifugal 4min of 5000rpm collects thalline, stay 100ul resuspended, be coated with the LB flat board, promptly contain the Km of 50mg/L and the Rif of 5mg/L, cultivated 2 days for 28 ℃, obtain the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404;
(3) Agrobacterium infecting to the Stem and leaf of Hongkong Pavetta blade
Get the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404 in the B step (2), place the LB substratum of the Rif of the Km that contains 50mg/L and 5mg/L to shake overnight incubation, take out bacterium liquid 1ml, place 100mlLB liquid to cultivate base, concussion was cultivated 4 hours, after bacterium liquid is activated, Stem and leaf of Hongkong Pavetta blade to the A step infects, time of infection is 8min, changes in the Ms substratum, dark cultivation down 2 days;
C, the antibiotic-screening of transformed plant: with the Stem and leaf of Hongkong Pavetta of B step (3) infect blade forward to cultivate 2 days on the MS minimum medium after, forward to again contain Cb division culture medium promptly: cultivate on the Ms+BA 1.0mg/L+NAA 0.1mg/L+Cb 500mg/L after 14 days, select the normal Stem and leaf of Hongkong Pavetta of differentiation to transform seedling, change over to contain Km division culture medium promptly: carry out screening and culturing among the Ms+BA 1.0mg/L+NAA 0.1mg/L+Km50mg/L once more? my god, after screening the growth normal Stem and leaf of Hongkong Pavetta strain tie up to division culture medium: expand on the Ms+BA 1.0mg/L+NAA 0.1mg/L numerous, transgenosis Stem and leaf of Hongkong Pavetta plant;
D, take root, hardening and transplanting:
Transgenosis Stem and leaf of Hongkong Pavetta plant with the C step, through division culture medium: Ms+BA 1.0mg/L+NAA 0.1mg/L expand numerous after, transfer to root media: on the Ms+NAA 0.3mg/L+IAA 0.2mg/ml, 24 ℃, 2000lx cultivated 18 days, after treating that tissue cultured seedling plant bottom grows callus lines, be transplanted in the perlite, shading screen transition next time 30 days, treat the root system stalwartness, the seedling leaf is green when healthy and strong, be transplanted to laterite: carry out the secondary transition in the nutrient bag of leaf-humidified soil=3:1, be transplanted to after 30 days and carry out the field planting cultivation in the booth, get the Stem and leaf of Hongkong Pavetta cut-flower seedling of liriomyza sativae insect pest.
Set forth the present invention with detailed process of the test of the present invention and result below.
The material that test is selected for use is:
(1) bacterial classification and plasmid: plant expression vector pBI-Bt plasmid, Agrobacterium LBA4404 bacterial strain are the laboratory and preserve;
(2) vegetable material: Stem and leaf of Hongkong Pavetta kind G33
(3) for examination worm kind: the Americal rice leaf miner adult
(4) main chemical reagent: chloroform, primary isoamyl alcohol, Virahol, ethanol, Km (kantlex), Amp (penbritin), Cb (Pyocianil), Rif (Rifampin), Pcr amplimer, Taq enzyme and buffer, dNTP, DL2000Marker, restriction enzyme and Buffer thereof, Klenow fragment and Buffer thereof etc.
Concrete experimentation and result:
A, the foundation of the efficient genetic conversion system of Stem and leaf of Hongkong Pavetta kind G33
Select the Stem and leaf of Hongkong Pavetta plant of healthy growth under the isolated culture condition, along the cane vanelets of tearing, after cultivating 14 days on the division culture medium Ms+BA of different hormonal readinesses 0.5~2.0mg/L+NAA 0.1~0.5mg/L, the differentiation situation that compares the petiole base bud, select differentiation bud number more substratum, this process culture temperature is 25 ℃, and intensity of illumination is 2000lx; Observe through comparative test result, being suitable for the substratum that the differentiation of Stem and leaf of Hongkong Pavetta petiole sprouts most is Ms+BA 1.0mg/L+NAA 0.1mg/L, and under this culture condition, differentiation rate can reach more than 90%;
B, the experiment of African chrysanthemum microbiotic background
According to the structure component characteristic of expression vector pBI121, selecting kantlex is the screening microbiotic of this Stem and leaf of Hongkong Pavetta converting material.In division culture medium Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L, add 50 respectively, 90,130,180, the Km of 210mg/L implants the Stem and leaf of Hongkong Pavetta individual plant again in the substratum, observe after 14 days, albefaction seedling phenomenon appears in the material major part in the substratum of the Km of interpolation 180mg/L, and compared with the control, growth potential is obviously weakened.With this antibiotic-screening concentration as the Stem and leaf of Hongkong Pavetta transformation plant.Result such as following table:
Experiment showed, that African chrysanthemum ' red cap ' is very responsive to kantlex, the concentration of 25mg/L can produce restraining effect to its normal growth.In not containing antibiotic control medium, plant energy normal growth, and differentiate a large amount of buds of normally growing thickly; Along with the increase of Km concentration, the growth of plant on substratum obviously is affected, and mortality ratio and antibiotic concentration are proportional.When Km concentration reaches 25mg/L, cultivate after 1 month, 8% plant survival is only arranged, dormant situation appears in most of plant, and the bud of growing thickly that newly differentiates mostly is the albefaction seedling greatly, along with the increase of incubation time, most of plant death, and no longer continue the new bud of growing thickly of differentiation, therefore, the Km that defines 25mg/L is the screening threshold concentration of African chrysanthemum ' red cap '.
C, the conversion of Bt gene pairs Stem and leaf of Hongkong Pavetta:
(1) preparation of Agrobacterium competent cell
Agrobacterium LBA4404 is inoculated in 5ml contains in the LB liquid nutrient medium of Rif of the Km of 50mg/L and 5mg/L 28 ℃, 200rpm overnight incubation; Get the 2ml culture and in 50ml contains the LB liquid nutrient medium of Rif of the Km of 50mg/L and 5mg/L, continue to cultivate, to OD600 be 0.5, with culture ice bath 30min, 4 ℃, the centrifugal 5min of 5000rpm abandon supernatant, with the cold CaCl of 1ml
2(20mmol/l) suspend, be distributed into 50 μ l/ pipe, add 15% glycerine, promptly get the Agrobacterium competent cell, freezing-70 ℃ of preservations in back in the liquid nitrogen;
(2) contain the conversion of plasmid in Agrobacterium of Bt gene
Add 1ug in the competent cell in C step (1) and contain Bt gene plasmid DNA, place 30min on ice after, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 5min are to melting fully, 2min on ice adds the liquid LB of 600ul, and 28 ℃ of following 200rpm recover to cultivate 5h, the centrifugal 5min of 5000rpm collects thalline, stay 50ul resuspended, be coated with the LB flat board, promptly contain the Km of 50mg/L and the Rif of 5mg/L, cultivated 2 days for 28 ℃, obtain the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404;
(3) Agrobacterium infecting to the Stem and leaf of Hongkong Pavetta blade
Get the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404 in the C step (2), place the LB substratum of the Rif of the Km that contains 50mg/L and 5mg/L to shake overnight incubation, take out bacterium liquid 1ml, place 100mlLB liquid to cultivate base, concussion was cultivated 4-5 hour, and bacterium liquid is activated, infect the Stem and leaf of Hongkong Pavetta blade of A step the back, time of infection is 8min, changes in the Ms substratum, dark cultivation down 2 days;
D, the screening of transfer-gen plant: with the Stem and leaf of Hongkong Pavetta of C step (3) infect blade forward to cultivate 2 days on the MS minimum medium after, forward to again contain Cb division culture medium promptly: cultivate on the Ms+BA 1.0mg/L+NAA 0.1mg/L after 14 days, select the normal Stem and leaf of Hongkong Pavetta of differentiation to transform seedling, change over to contain Km division culture medium promptly: carry out screening and culturing among the Ms+BA 1.0mg/L+NAA 0.1mg/L once more, the normal Stem and leaf of Hongkong Pavetta strain of growth ties up to division culture medium after screening: carry out on the Ms+BA 1.0mg/L+NAA 0.1mg/L tissue culture expand numerous after, transgenosis Stem and leaf of Hongkong Pavetta plant.
E, the Pcr of transgenosis Stem and leaf of Hongkong Pavetta plant detects:
The extraction of plasmid DNA: Type B small pieces plasmid extraction kit extracts;
The extraction of the total DNA of plant: under aseptic condition, get in the D step blade of the unconverted materials of Stem and leaf of Hongkong Pavetta through transforming and contrast, in centrifuge tube, under the liquid nitrogen condition, grind, add the DNA extraction damping fluid immediately promptly: 100mMNaCl, 50mM EDTA, 0.5%SDS, 50mM Tris, PH 7.4 mixings, 60 ℃ of water-bath 1h, add isopyknic chloroform-primary isoamyl alcohol (volume ratio is 24:1), put upside down mixing, the centrifugal 4min of 10000rpm repeats extracting 3 times; Get the liquid aqueous phase layer, add the freezing Virahol of 2 times of volumes, abundant mixing ,-20 ℃ of placements;
The Pcr amplification of total DNA: with the total DNA of the plant of extracting in the converting material is template, serves as according to the design primer with the Bt gene order, carries out the Pcr amplification:
Amplimer is: P
1: 5 ' GAATGAGGCTTTGTAAATTCAC 3 '
P
2:5’CGTTAATTTCCAAAAGACCTCTGGT?3’
The Pcr reactive system:
Add in the aseptic Pcr pipe:
10×Pcrbuffer 2ul
4×dNTP(2mM) 2ul
Primer1(10pmol/ul) 2ul
Primer2(10pmol/ul) 2ul
Taq enzyme (1ug/ul) 1ul
Template DNA (about 25ng) 2ul
D
2H
2O 9ul
Cumulative volume 20ul
Last envelope paraffin oil, increase by following program:
94 ℃ of pre-sex change 4min; 94 ℃ of 30s, 62 ℃ of 30s, 72 ℃ of 3min, 35 circulations; 72 ℃ are extended 10min.
Reaction is got the Pcr product and carry out electrophoresis detection on 1.0% sepharose after finishing, and contrasts the negative contrast of Pcr product of strain DNA with the Stem and leaf of Hongkong Pavetta G33 of unconverted.
F, take root, hardening and transplanting:
Stem and leaf of Hongkong Pavetta plant with E step Pcr tests positive, through division culture medium: Ms+BA 1.0mg/L+NAA0.1mg/L expand numerous after, transfer to root media: on the Ms+NAA 0.2mg/L+IAA 0.1mg/ml, 24 ℃, 2000lx cultivated 20 days, after treating that tissue cultured seedling plant bottom grows callus lines, be transplanted in the perlite, shading screen transition next time 35 days, treat that root system stalwartness, seedling leaf are green when healthy and strong, be transplanted to laterite: carry out the secondary transition in the nutrient bag of leaf-humidified soil=3:1, be transplanted to after 35 days and carry out the field planting cultivation in the booth;
G, the insect-resistance of transgenosis Stem and leaf of Hongkong Pavetta plant detects:
(1) worm is cultivated: gather the blade that fresh mine is arranged from Stem and leaf of Hongkong Pavetta insect pest morbidity strain, place breeding in the husky mesh bag of making of 100-120 order nylon, and standby;
(2) material plantation: the expert evidence that seedling age is identical is planted in the soil of bacterium that went out, each strain system plantation 10 basin, and contrast plantation 10 basins are placed in the greenhouse and plant, and temperature treats promptly to put into after plant strain growth is stablized the adult of breeding between 25 ℃;
(4) state of an illness investigation: put in the greenhouse and institute an inquiry insect pest behind the worm 10d a situation arises, with gallery number on the every leaf and killed area classification.0 grade: full leaf does not have gallery; 1 grade: little thin narrow white is dived and is eaten the trace road, and the gallery area is below 1/5 of blade; 2 grades: gallery is few, and the gallery area is 2/5 of a blade; 3 grades: gallery is many, and its gallery area is 3/5 of a blade; Its gallery area is more than 4/5 of blade.Every the 4d investigation once, investigate 9 times record morbidity progression altogether.Select 2 transgenic positive strain systems as follows with contrast Stem and leaf of Hongkong Pavetta morbidity strain insect pest test result:
Claims (2)
1, a kind of transgenosis is created the method for cut-flower Stem and leaf of Hongkong Pavetta liriomyza sativae kind, it is characterized in that comprising the following steps:
A, the foundation of the efficient transformation tissue culture system of Stem and leaf of Hongkong Pavetta: the Stem and leaf of Hongkong Pavetta individual plant of selecting healthy growth under the isolated culture condition, under aseptic condition, get vanelets as material, at division culture medium promptly: cultivated 14-21 days on the Ms+BA 0.5-2.0mg/L+NAA 0.1-0.5mg/L, wherein, culture temperature is 24~25 ℃, and intensity of illumination is 2000~2500LX;
B, the conversion of Bt gene pairs Stem and leaf of Hongkong Pavetta:
With the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404, place the LB substratum of the Rif of the Km that contains 50mg/L and 5mg/L to shake overnight incubation, take out bacterium liquid, place LB liquid to cultivate base, concussion was cultivated 4-5 hour, and the Stem and leaf of Hongkong Pavetta blade to the A step infects afterwards, time of infection is 6~10min, change in the Ms substratum, dark cultivation down 2 days gets Stem and leaf of Hongkong Pavetta and infects blade;
C, the screening of transfer-gen plant: with the Stem and leaf of Hongkong Pavetta of B step infect blade forward to cultivate 2~3 days on the MS minimum medium after, forward to again contain Pyocianil Cb division culture medium promptly: cultivate on the Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L+Cb 400-500mg/L after 12~16 days, select the normal Stem and leaf of Hongkong Pavetta of differentiation to transform seedling, change over to contain Km division culture medium promptly: carry out 2~3 weeks of screening and culturing once more among the Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L+Km 50mg/L, the normal Stem and leaf of Hongkong Pavetta strain of growth ties up to division culture medium after screening: carry out on the Ms+BA0.5-2.0mg/L+NAA 0.05-0.2mg/L tissue culture expand numerous after, transfer-gen plant;
D, take root, hardening and transplanting:
With C step gained transfer-gen plant through division culture medium: Ms+BA 0.5-2.0mg/L+NAA 0.05-0.2mg/L expand numerous after, transfer to root media: on the Ms+NAA 0.2-0.4mg/L+IAA 0.1-0.3mg/ml, at 24~26 ℃, cultivated 14-21 days under intensity of illumination 2000~2500Lx condition, after treating that tissue cultured seedling plant bottom grows callus lines, be transplanted in the perlite, shading screen transition 25-35 days next time, the root system stalwartness, the seedling leaf is green when healthy and strong, be transplanted to laterite: the secondary transition is 25-40 days in the soil of leaf-humidified soil=3:1, be transplanted to afterwards and carry out the field planting cultivation in the booth, get the Stem and leaf of Hongkong Pavetta cut-flower seedling of liriomyza sativae insect pest.
2, transgenosis according to claim 1 is created the method for cut-flower Stem and leaf of Hongkong Pavetta liriomyza sativae kind, it is characterized in that the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404 of described B step obtains by following method:
(1) preparation of Agrobacterium competent cell
Agrobacterium LBA4404 is inoculated in the LB liquid nutrient medium, contains the kantlex Km of 50mg/L and the Rifampin Rif of 5mg/L in this substratum, in 28 ℃, 200rpm overnight incubation; Getting culture, to continue to be cultured to OD600 in the LB liquid nutrient medium that contains 50mg/L Km and 5mg/L Rif be 0.5, with culture ice bath 30min, behind 4 ℃, the centrifugal 5min of 5000rpm, abandons supernatant, is the CaCl of 20mmol/L with concentration
2Suspend, add concentration after the packing and be 15% glycerine, promptly get the Agrobacterium competent cell, freezing-70 ℃ of preservations in back in the liquid nitrogen;
(2) contain the conversion of Bt gene plasmid in Agrobacterium
Add in the competent cell in B step (1) and contain Bt gene plasmid DNA, after placing 30min on ice, liquid nitrogen flash freezer 5min, 37 ℃ of water-bath 3-5min are to melting fully, 2min adds LB liquid on ice, recovers to cultivate 3-5h in 28 ℃ of following 200rpm, the centrifugal 3-5min of 5000rpm collects thalline, is the CaCl of 20mmol/L again with concentration
2Repeat to suspend, be coated with the LB flat board, this flat board contains the Km of 50mg/L and the Rif of 5mg/L, cultivates 2 days for 28 ℃, obtains the single bacterium colony of agrobacterium tumefaciens pBI-Bt/LBA4404.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2008102335235A CN101392260B (en) | 2008-11-03 | 2008-11-03 | Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2008102335235A CN101392260B (en) | 2008-11-03 | 2008-11-03 | Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101392260A true CN101392260A (en) | 2009-03-25 |
CN101392260B CN101392260B (en) | 2011-06-15 |
Family
ID=40492771
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2008102335235A Expired - Fee Related CN101392260B (en) | 2008-11-03 | 2008-11-03 | Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101392260B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113142048A (en) * | 2021-04-02 | 2021-07-23 | 云南省农业科学院花卉研究所 | Effective method for screening double-petal mutants of cone stone flower |
CN114698554A (en) * | 2022-05-17 | 2022-07-05 | 云南省农业科学院花卉研究所 | Construction method of genetic transformation system of gypsophila paniculata |
-
2008
- 2008-11-03 CN CN2008102335235A patent/CN101392260B/en not_active Expired - Fee Related
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113142048A (en) * | 2021-04-02 | 2021-07-23 | 云南省农业科学院花卉研究所 | Effective method for screening double-petal mutants of cone stone flower |
CN114698554A (en) * | 2022-05-17 | 2022-07-05 | 云南省农业科学院花卉研究所 | Construction method of genetic transformation system of gypsophila paniculata |
CN114698554B (en) * | 2022-05-17 | 2023-11-17 | 云南省农业科学院花卉研究所 | Construction method of genetic transformation system of starfish |
Also Published As
Publication number | Publication date |
---|---|
CN101392260B (en) | 2011-06-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Liu et al. | Artificial cultivation of true morels: current state, issues and perspectives | |
CN105349555B (en) | A kind of artificial synthesized Bt anti insect genes FLIa and its preparation method and application | |
CN101999295B (en) | Halimasch (XL-A0704) as well as preparation method and application thereof | |
CN103266132B (en) | Tribactur cry1Ah/cry1Ie bivalent gene expression vector and application thereof | |
Kimiti et al. | Integrated soil fertility management enhances population and effectiveness of indigenous cowpea rhizobia in semi-arid eastern Kenya | |
CN103891618A (en) | Method for breeding two-season seed potato | |
CN105331620A (en) | Artificially synthesized BT insect-resistant gene FLAc and application thereof | |
CN101186926B (en) | Modified method for transforming gramineous crop by agrobacterium mediated flower-dipping method | |
CN101006768B (en) | Agrobacterium-mediated Sophora japonica transgene and tissue-culturing rapid propagation method | |
Huang HongWen et al. | History of cultivation and trends in China. | |
CN104770294B (en) | A kind of protocorm based on the sprouting of iris seed is the breeding method of acceptor | |
CN101392260B (en) | Method for creating cut flower gypsophila paniculata liriomyza sativae blandchard variety by transgene | |
CN104046639B (en) | Wheat methionine sulfoxide reductase gene TaMsrB3.1 and application thereof | |
CN102061263B (en) | Gastrodia elata seed Germination bacterium (XL-M0701), and preparation method and application thereof | |
CN101926365B (en) | Use of bacillus thuringiensis cry1Ai in pest control, modified mcry1Ai gene and use of modified mcry1Ai gene | |
CN101289670A (en) | Process for obtaining antimycosis cut flower flameray gerbera by transgene | |
CN102618561A (en) | Genes related to stress resistance and application to improving stress resistance of plant to environment | |
CN101463393A (en) | Method for screening transgenic plate with safety marker gene | |
Tarte et al. | Potential role and utilization of Piriformospora indica: fungal endophytes in commercial plant tissue culture | |
CN104450736A (en) | Cucumber AG-like gene CsMADS24 overexpression carrier and application thereof | |
CN102978238A (en) | Purpose of eremosparton songoricum EsDREB gene | |
Ahmad et al. | Response of groundnut genotypes against root rot disease in district Mianwali | |
CN114164228B (en) | Method for improving disease resistance of rice through gene editing and application thereof | |
CN104059939A (en) | Method for culturing transgenic wheat with aphid resistance | |
Ficko | Development Of Shrub And Lichen-Dominated Biocrust Propagation And Establishment Techniques For Reclamation In Northern Environments |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110615 Termination date: 20171103 |