CN114164228B - Method for improving disease resistance of rice through gene editing and application thereof - Google Patents

Abstract

The invention discloses a method for cultivating rice blast resistant rice varieties, which comprises the following steps: the OsWRKY70 gene function in rice plants is inactivated by a genetic engineering method, so that the rice material with improved rice blast resistance is obtained. The method can be used for carrying out genetic improvement on the resistance of rice blast, but does not influence the normal growth and development of rice.

Description

Method for improving disease resistance of rice through gene editing and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a method for improving disease resistance of rice by gene editing and application thereof.

Background

The rice blast is one of the most harmful rice diseases in various rice areas in the world, seriously affects the quality and yield of rice, threatens the safety of grains in the world, and is one of the most main factors for preventing the quality, the high yield, the stable yield and the harvest of rice. The rice blast is caused by the filamentous ascomycete rice blast fungus, has the characteristics of extremely high epidemic speed and the like, and frequently occurs in each rice area and is mainly harmful to leaves, stems and spikes. The yield loss caused by rice blast is generally 10% -20%, 40% -50% can be achieved when serious disease occurs, and even no granule is received. In 2014, the damage area of the rice blast in China reaches 513.6 ten thousand hectares, and the yield is reduced by 55.8 ten thousand tons. Because of the genetic complexity and variability of rice blast fungus minispecies, the cultivation of good varieties combining disease resistance with high yield and high quality is a long-term and difficult problem in rice breeding. At present, the rice blast is controlled mainly by chemical pesticides, but the method has high cost, time and labor consumption and serious harm to ecological environment and human health. Practice proves that the cultivation and planting of disease-resistant varieties is the most economical, safe and effective method for controlling rice blast. The traditional breeding has long time consumption and large workload, is difficult to directionally improve the target character, and is an effective way for efficiently, accurately and quickly cultivating new disease-resistant varieties by combining the conventional disease-resistant breeding and biotechnology along with the continuous deep research of functional genomics and molecular aided design breeding technologies.

The CRISPR-Cas9 technology is to design a section of sgRNA-mediated Cas9 nuclease to specifically identify and target and cut target sites, and introduce mutation by using an intracellular error-prone repair mechanism. The technology has the advantages of simple operation, high mutation efficiency, short period and low cost, can obtain germplasm resources without marker genes, and has great significance for germplasm resource innovation and gene function research. At present, the technology can accurately modify the genome of crops such as rice, corn, wheat, sorghum, tomato, potato and the like at specific sites, can rapidly, accurately and effectively directionally improve variety traits, is successfully applied to improving the characteristics such as specific gene expression, metabolic regulation and control, disease and pest resistance, stress response, nutrition utilization, yield, quality and the like of the crops, and provides a new idea for improving the variety of the crops.

Many WRKY transcription factors are involved in the immune response of rice in the rice genome, such as WRKY45 positively regulates the resistance of rice to rice blast and bacterial blight, and WRKY62 and WRKY76 negatively regulate the immune response of rice. Studies have shown that the expression of OsWRKY70 is induced by mechanical injury and insect pest feeding of Chilo suppressalis and brown planthopper feeding, and is a key node in an insect pest induction defense network. OsWRKY70 positively regulates synthesis of jasmonic acid and trypsin inhibitor and resistance of rice to chilo suppressalis, and negatively regulates synthesis of gibberellin, salicylic acid and hydrogen peroxide and resistance of rice to brown planthopper.

Disclosure of Invention

We have paid attention to Nippon RiceOsWRKY70Editing genes, performing DNA sequencing analysis on the gene-edited rice lines, andOsWRKY70gene sequences were compared and found in the Gene editing lines CRS6,8 and 9OsWRKY70Insertion of a A at position 347 of the coding region and a T at position 347 of the CRS7 line (FIG. 2), which resulted in the shifting of the OsWRKY70 protein at position 116 and premature termination of the egg at amino acid 177 in the gene editing lineWhite coding resulted in the loss of function of OsWRKY70 protein in these rice lines (FIG. 3). The method is characterized in that the gene editing rice field is observed for the agronomic characters in the whole growth period, and the gene editing is found to not influence the normal growth and development and agronomic characters of the rice; disease resistance analysis is carried out on the gene editing rice materials CRS7 and CRS9, two-leaf and one-heart-period spraying inoculation of rice blast fungus minispecies R01-1, and the number of lesions on leaves of the rice blast fungus minispecies is found to be obviously smaller than that of lesions on wild leaves, so that the OsWRKY70 gene editing can improve the resistance of rice to rice blast.

The technical scheme provided by the invention is as follows: a method for cultivating rice variety with rice blast resistance includes such steps as gene engineering to deactivate OsWRKY70 gene in rice plant to obtain rice material with high resistance to rice blast.

The method is characterized in that the genetic engineering method is selected from physical or chemical mutagenesis, homologous recombination and gene editing.

The method described above, wherein the gene editing is a CRISPR-Cas9 gene editing method.

In the method, the nucleotide sequence of the OsWRKY70 gene is shown as SEQ ID NO. 1.

The method comprises the steps of enabling plants to be in plants through a gene editing methodOsWRKY70The 347 th position of the coding region is followed by insertion of the base A or T.

Meanwhile, the invention also provides application of the OsWRKY70 gene in creating plants with improved rice blast resistance.

The nucleotide sequence of the OsWRKY70 gene is shown as SEQ ID NO. 1.

In the application, the OsWRKY70 gene function in the rice plant is inactivated by a genetic engineering method, so that the rice material with improved resistance to rice blast is obtained.

The above application, the genetic engineering method is selected from physical or chemical mutagenesis, homologous recombination and gene editing.

The gene editing is a CRISPR-Cas9 gene editing method.

The invention has the following beneficial effects: the research of the invention discovers that OsWRKY70 plays an important role in improving rice blast resistance of rice. The resistance of the OsWRKY70 gene mutated rice gene edited rice to rice blast is enhanced by a gene editing technology, so that the rice blast resistant gene edited plant variety is cultivated. Experiments show that a section of sgRNA mediated Cas9 nuclease is designed for specific recognition and targeted cutting of target sites through a CRISPR-Cas9 technology according to a specific target DNA sequence (GGACGAGCAGCAACAGTACT) of OsWRKY70, and mutation is introduced by using an intracellular error-prone repair mechanism, so that the OsWRKY70 gene mutation in gene-edited rice is caused, and the resistance of the gene-edited rice to rice blast can be improved. The gene shows that the resistance of rice blast can be genetically improved by utilizing the OsWRKY70 gene through a gene editing technology.

Drawings

FIG. 1, schematic diagram of the gene editing vector pHUN4c 12;

FIG. 2, DNA mutation identification of gene-edited rice OsWRKY70, WRKY70-6,7,8,9 represent different gene-edited strains, WRKR70 represents the DNA sequence of LOC4339092 in the database, the underlined part represents the PAM sequence of the gene editing of WRKY70, and 347 represents the base insertion position;

FIG. 3, osWRKY70 protein sequence analysis of gene editing rice, wherein WRKY70-CRS represents protein sequence of gene editing strain, WRKR70 represents protein sequence of LOC4339092 in database, gene editing material generates frame shift mutation after 166 amino acids, and frame shift gene editing at 177 amino acids leads to early termination of protein translation;

FIG. 4, osWRKY70 gene editing the rice mature stage field phenotype; the wild type Japanese sunny on the left and the gene editing strain CRS7 of OsWRKY70 on the right, and the wild type and the gene editing rice which normally grow in the field have no difference in the agricultural characters of plant type, mature period, spike and the like;

FIG. 5 shows that OsWRKY70 gene-edited rice has improved resistance to rice blast,OsWRKY70gene-edited rice has enhanced disease resistance against Pyricularia oryzae (R01-1), NIP is wild type Japanese sunny (transformed recipient material), and CRS7 and CRS9 represent two OsWRKY70 gene-edited lines.

Detailed Description

The invention is further illustrated by the following detailed description of specific embodiments, which is not intended to be limiting, but is made merely by way of example.

Example 1OsWRKY70Construction of Gene editing vector

The inventor creates by agrobacterium infection methodOsWRKY70And (5) gene editing rice.

Designing a segment of sgRNA (namely PAM sequence, GGACGAGCAGCAACAGTACT) PAM by utilizing a DNA sequence with a nucleotide sequence shown as SEQ ID NO:1 (OsWRKY 70) coding region specificity, synthesizing two oligo DNA sequences, and cloning to pHUN4c12 (figure 1) to construct a gene editing vector pHUN4c12-PAM; the pHUN4c12-PAM is converted into rice Nippon through a transgenic technology, sgRNA is used for mediating Cas9 nuclease to specifically identify and target-cut target sites, and an intracellular error-prone repair mechanism is used for introducing mutation, so that the OsWRKY70 gene mutated gene editing rice material is finally obtained.

The method for constructing the gene editing vector comprises the following steps: first, a PAM sequence (namely, a PAM sequence, GGACGAGCAGCAACAGTACT) is designed by utilizing CRISPR Primer Designer v1.1.2 aiming at an OsWRKY70 gene, and two oligo DNA primers (LP: TGGCGGGACGAGCAGCAACAGTACT, RP: AAACAGTACTGTTGCTGCTCGTCCC) are synthesized; the two synthetic primers were annealed and ligated to pHUN4c12 vector digested with BsaI to give gene editing vector pHUN4c12-PAM of OsWRKY70, which was introduced into Agrobacterium tumefaciens EHA 105.

Example two OsWRKY70 Gene editing creation of Rice Material

The method for creating OsWRKY70 gene edited rice by using agrobacterium infection method comprises the following steps:

1) Induction and subculture of rice embryo callus: shelling Japanese eyes of rice seeds, soaking in 75% ethanol for 1min, soaking in sodium hypochlorite solution for 30min, washing with sterile water, repeatedly soaking in sodium hypochlorite for 15min, and washing with sterile water. And (3) airing the sterilized rice seeds on sterilized filter paper, and planting the sterilized rice seeds in an induction culture medium. Dark culture at 28℃for 2 weeks. The isolated calli were transferred to induction medium for 3 subcultures at 28 ℃. Picking the soft yellow and loose callus particles, and culturing at 28deg.C for 3 days.

2) Activating and propagating strains: agrobacteria containing the gene editing vector pHUN4c12-PAM were streaked onto YEB solid medium at 28℃for 2 days, respectively.

3) Co-culture of agrobacterium with callus: and (3) suspending a proper amount of thalli in a 100 mu M AS+AA liquid culture medium, and when the OD value of the bacterial liquid reaches 0.3, immersing the callus into the bacterial liquid, and slightly shaking for 20 minutes. Removing bacterial liquid, taking out the callus, filtering out excessive bacterial liquid, and transferring to NB solid culture medium for dark culture at 22 ℃ for 3 days.

4) Screening for resistant calli: co-cultured callus is selected, rinsed with sterile water, dried and spread on a screening culture medium, and is subjected to dark culture at 28 ℃ for 2 weeks for next generation.

5) Pre-differentiation and differentiation: transferring the callus which grows vigorously and takes the shape of milky white to a pre-differentiation culture medium, culturing in dark at 28 ℃ for 1 week, culturing in light at 28 ℃ for 2 weeks, further subculturing for 4 weeks, and differentiating into seedlings.

6) Rooting and strengthening seedlings: and (5) transferring the seedlings with better growth vigor to a rooting culture medium, culturing for 2 weeks, and transplanting.

7) Transplanting transgenic seedlings growing normally into a greenhouse for cultivation until seeds are harvested.

8) The seedlings of the obtained transgenic positive plants are subjected to generation adding to obtain T1 and high generation seeds.

Example DNA sequence mutation analysis of OsWRKY70 in three Gene editing Material

Extracting DNA of OsWRKY70 gene editing rice material by CTAB method:

1.2% CTAB extract preparation: sodium chloride 81.82 g and CTAB 20 g are weighed and dissolved in ddH2O, tris-HCl (pH 8.0) 100mL,0.5M EDTA 40 mL with the concentration of 1M is added, the volume is fixed to 1L, and the mixture is preserved at room temperature for standby.

2. About 0.1g of rice material is taken and placed in a 2.0 mL pipe filled with clean stainless steel beads, and is quickly placed in liquid nitrogen for freeze-drying, and then the material is crushed into powder by a plant tissue crusher;

3. adding 700 μl of 2% CTAB extract, mixing thoroughly, water-bathing at 65deg.C for 30min, gently inverting and mixing 1-2 times;

centrifuge at 4.12000 rpm for 10 minutes, transfer the liquid to a 1.5mL centrifuge tube, add 300 μl chloroform/isoamyl alcohol (V/v=24:1), mix gently;

5. centrifuging at 12000rpm at room temperature for 10 min, transferring the supernatant to a 1.5mL tube, adding pre-cooled isopropanol with the same volume as the supernatant, gently mixing, and precipitating at-20deg.C for 30 min;

6.12000 Centrifuging at rpm for 10 minutes, discarding the supernatant, washing the precipitate once with 1 ml of 75% ethanol;

7.12000 Centrifuging at 4 ℃ for 5 minutes at a high speed, discarding the supernatant, standing at room temperature, and airing the precipitate;

8. 200. Mu.L of sterile RNase water was added to dissolve the precipitate, and the precipitate was put into a 37℃oven for digestion for 30 minutes;

PCR amplification and sequence analysis of genomic DNA of Gene-edited Rice

The primer OsWRKY70 (OsWRKY 70F: CGATCCTGGCATCCTACTCT; osWRKY70R: CCCAATGGAGCCATTAGCAT) is synthesized, DNA of different lines of gene editing is used as a template for PCR amplification, the PCR product with the size of 630bp is subjected to DNA sequencing, and DNA sequence comparison analysis of the PCR product with the OsWRKR70 (LOC 4339092) in NCBI genome database shows that the gene editing lines of the OsWRKY70-6,7,8 and 9 have one base insertion at 347 bases of the gene coding region, and the streaked part represents PAM sequence (figure 2) of the gene editing of the OsWRKY70, which indicates that the gene editing rice material with the gene mutation is obtained due to gene frame shifting caused by the gene editing.

Example four protein sequence mutation analysis of OsWRKY70 in Gene editing Material

The corresponding protein sequence was aligned based on the mutated DNA sequence, and it was found that the insertion mutation of one base at position 347 resulted in the initiation of the frame shift mutation after the 166 th amino acid and the premature termination of the protein translation at position 177 amino acid due to the frame shift. WRKY70-CRS represents the protein sequence of the gene editing line, WRKR70 represents the protein sequence of LOC4339092 in NCBI database (fig. 3). Indicating that the gene editing results in the loss of the protein function of the gene in rice.

Example fiveOsWRKY70Gene editing does not affect agronomic traits in rice fields

The present inventors have found thatOsWRKY70The investigation of the agronomic characters of the whole growth period in the field is carried out on the gene-edited rice, and the fact that the growth and development of the gene-edited rice are not obviously different from that of the wild rice is found, and the mature period shows similar agronomic characters in the aspects of plant height, plant type, spike type, grain type, mature period and the like (figure 4), which shows that the gene editing does not influence the normal growth and development of the rice.

Example sixOsWRKY70Gene editing to raise rice resistance to rice blast

Rice blast fungus minispecies: r01-1 (from China national institute of agricultural science plant protection institute)

Rice material: japanese sunny OsWRKY70 gene editing material (CRS 7 and CRS 9)

The test operation comprises the steps of culturing and collecting rice blast spores, culturing rice materials, spraying and inoculating living bodies, observing and photographing and the like. Wild type strain CRS7 and CRS9 strain of Japanese sunny and OsWRKY70 gene were planted in soil of a nutrition pot after germination, and grown normally outdoors for about 3 weeks (two leaves and one core) at a concentration of 5x10 ⁵ The individual spores/mL of the rice blast spore suspension was added to Tween 20 at two parts per million concentration and shaken well for spray inoculation. Placing the plants inoculated with the seeds into a bag and spraying spore suspension again; the bag is tied up to keep moist, after 24 hours of dark culture at 25 degrees, the plants are moved into the growth chamber and the humidity is ensured to be kept above 80%; and then observing plants every day, wherein symptoms appear about 3 days, observing the time of necrotic lesions, the number of lesions and the size of lesions of different materials, taking the lesions as the basis of disease resistance, and taking pictures after 5-6 days of inoculation. The rice blast spore culture and rice blast fungus spray inoculation and disease resistance analysis method comprises the following steps:

collecting rice blast spores

1. Separating filter paper sheets from rice blast, inoculating on oat agar medium (30 g oat/L), and culturing in darkness at 28deg.C for 5 days;

( Preparing an oat culture medium, heating 800ml of water in a microwave oven and adding 50g of oat; after thorough mixing, grinding with a stirrer; the insufficiently ground oat is filtered off by a sieve, and then transferred to a 500ml bottle, 7.5-8g of agar is added to 500ml of liquid, and the medium is autoclaved for 25min. )

2. Moving the culture dish with the rice blast bacteria under light (continuous illumination to induce spores), and culturing at 28 ℃ for 5-7 days;

3. adding distilled water to scrape off fungi;

4. the mycelium was filtered with gauze in order to collect spores only from rice blast medium;

5. spore concentration was checked with a hemocytometer and then adjusted to a concentration of 5x10 ⁵ Individual spores/mL (20-30 spores in approximately 16 squares);

6. adding Tween 20 (20 mu L/100 mL) with two parts per million concentration into the spore suspension, and shaking uniformly;

7. the suspension is used for spraying or punching inoculation.

Spray inoculation rice blast germ and disease resistance analysis

1. Preparing an inoculation box and placing the inoculation box into a plastic bag;

2. pouring water to maintain humidity on the plastic bag and supplying water to plants;

3. spraying spore suspension on the plants until the leaves become wet completely;

4. placing the plants inoculated with the seeds into a bag and spraying spore suspension again;

5. the tie-down bag is kept moist, and the box is covered to make the interior dark;

6. placing the plants in a dark condition at 25-26 ℃ for 24 hours, and then moving the plants into a growth chamber;

7. plants were checked daily until symptoms appeared around 3 days. Humidity is one of the important factors affecting the development of symptoms. Therefore, the humidity is kept at 80% or higher. Photographing after 5-6 days of inoculation. The time of occurrence of necrotic lesions, the number of lesions and the size of lesions of different materials are observed, and these phenotypes are used as the basis for disease resistance.

The test results show that:OsWRKY70gene-edited rice has enhanced disease resistance against Pyricularia oryzae (R01-1), NIP is wild type Japanese sunny (transformed recipient material), and CRS7 and CRS9 represent two OsWRKY70 gene-edited lines (FIG. 5). After 5 days of inoculation of the germs,the number of necrotic lesions of the two gene-editing lines CRS7 and CRS9 was significantly smaller than that of the wild type, and the lesion area was also significantly smaller than that of the wild type. The disease resistance analysis of the rice blast shows that the resistance of the gene editing rice material to the rice blast is obviously improved, which indicates that the OsWRKY70 gene editing can improve the resistance of the rice to the rice blast.

<110> institute of biotechnology of national academy of agricultural sciences; hunan university of agriculture

<120> method for improving disease resistance of rice by gene editing and application thereof

<160> 2

<210> 1

<211>1719

<212> DNA

<400> 1

ATGACCGCCGCGCCGGGGAGCCTCCCGCTGGTGAACTCGAGGCCCGTCTCCCTCTCCTTGGCGGCGAGCAGGTCGTCCTTCTCCAGCCTGCTCAGTGGCGGCGCCGGCTCGTCGTTGAACCTCATGACGCCGCCGTCTTCTCTCCCGCCGTCGTCGCCGTCGTCCTACTTCGGCGGCGTCTCGTCCTCCGGGTTTCTCGACTCGCCGATCCTCCTCACGCCCAGTTTATTCCCATCGCCGACGACGACGGGCGCATTGTTCAGCTGGATTACGACGGCGACGGCGACGGCGGCGATAGCGCCGGAGAGCCAGGTGCAAGGAGGGGTCAAGGACGAGCAGCAACAGTACTCGGACTTCACGTTCCTGCCGACGGCGTCCACGGCGCCGGCGACGACGATGGCCGGAGCCACCGCGACGACGTCCAACTCCTTCATGCAGGACTCCATGCTAATGGCTCCATTGGGAGGGGACCCGTACAATGGCGAGCAGCAGCAGCCATGGAGCTACCAAGAACCGACCATGGACGCTGACACTAGGCCAGCGGAATTCACCTCGTCGGCGGCGGCGGGTGACGTGGCCGGGAACGGCAGCTACAGCCAGGTGGCGGCGCCGGCGGCGGCCGGCGGCTTCCGTCAGCAGAGCCGGCGGTCGTCGGACGACGGCTACAACTGGCGCAAGTACGGGCAGAAGCAGATGAAGGGGAGCGAGAACCCGCGCAGCTACTACAAGTGCACCTTCCCTGGCTGCCCGACCAAGAAGAAGGTGGAGCAGTCGCCGGACGGCCAGGTCACCGAGATCGTCTACAAGGGCGCGCACAGCCACCCCAAGCCGCCGCAGAACGGCCGCGGCCGCGGCGGCTCCGGCTACGCGCTGCATGGCGGCGCCGCCAGCGACGCATACTCCTCCGCCGACGCGCTCTCCGGCACGCCGGTGGCGACGCCCGAGAACTCGTCGGCGTCGTTCGGGGACGACGAGGCGGTCAACGGCGTCAGCTCGTCGCTGCGGGTCGCCTCTAGCGTCGGCGGCGGCGAGGATCTCGACGACGACGAGCCTGATTCCAAGAGGTGGAGGAGAGACGGCGGCGACGGCGAGGGCGTCTCGCTGGTGGCCGGCAACCGGACGGTGCGTGAGCCGAGGGTGGTTGTGCAGACGATGAGCGACATCGACATCCTCGACGACGGCTACCGGTGGCGCAAGTACGGGCAGAAGGTGGTCAAGGGCAACCCAAACCCAAGGAGCTACTACAAGTGCACGACGGCCGGGTGCCCCGTGCGGAAGCACGTGGAGCGCGCGTCCAACGACCTGCGCGCGGTGATCACCACGTACGAGGGCAAGCACAACCACGACGTGCCCGCGGCGCGCGGGAGCGCCGCCGCCGCGCTCTACCGCGCCACGCCGCCGCCGCAGGCGAGCAACGCCGGCATGATGCCCACCACGGCGCAGCCCTCGAGCTACCTGCAGGGCGGCGGCGGCGTCCTTCCGGCCGGCGGGTACGGCGCGTCGTACGGCGGCGCGCCGACGACGACGCAGCCCGCGAACGGCGGTGGCTTCGCCGCCCTGTCCGGCCGGTTCGACGACGACGCGACGGGAGCGTCTTACTCTTACACGAGCCAGCAGCAGCAGCAGCCGAACGACGCGGTGTACTACGCGTCGAGAGCCAAGGATGAGCCGAGAGACGACGGCATCATGTCGTTCTTTGAGCAGCCGCTGCTGTTTTGA

<210> 2

<211> 572

<212> amino acid

<400> 2

MTAAPGSLPLVNSRPVSLSLAASRSSFSSLLSGGAGSSLNLMTPPSSLPPSSPSSYFGGVSSSGFLDSPILLTPSLFPSPTTTGALFSWITTATATAAIAPESQVQGGVKDEQQQYSDFTFLPTASTAPATTMAGATATTSNSFMQDSMLMAPLGGDPYNGEQQQPWSYQEPTMDADTRPAEFTSSAAAGDVAGNGSYSQVAAPAAAGGFRQQSRRSSDDGYNWRKYGQKQMKGSENPRSYYKCTFPGCPTKKKVEQSPDGQVTEIVYKGAHSHPKPPQNGRGRGGSGYALHGGAASDAYSSADALSGTPVATPENSSASFGDDEAVNGVSSSLRVASSVGGGEDLDDDEPDSKRWRRDGGDGEGVSLVAGNRTVREPRVVVQTMSDIDILDDGYRWRKYGQKVVKGNPNPRSYYKCTTAGCPVRKHVERASNDLRAVITTYEGKHNHDVPAARGSAAAALYRATPPPQASNAGMMPTTAQPSSYLQGGGGVLPAGGYGASYGGAPTTTQPANGGGFAALSGRFDDDATGASYSYTSQQQQQPNDAVYYASRAKDEPRDDGIMSFFEQPLLF

Claims (7)

1. A method for cultivating rice variety with rice blast resistance comprises inactivating OsWRKY70 gene function in rice plant by genetic engineering method to obtain rice material with improved rice blast resistance; the nucleotide sequence of the OsWRKY70 gene is shown as SEQ ID NO. 1.

2. The method of claim 1, wherein the genetic engineering method is selected from the group consisting of homologous recombination, gene editing.

3. The method of claim 2, wherein the gene editing is a CRISPR-Cas9 gene editing method.

4. As claimed inThe method according to claim 3, wherein the plant is subjected to a gene editing methodOsWRKY70The 347 th position of the coding region is followed by insertion of the base A or T.

5. The application of the OsWRKY70 gene in the establishment of plants with improved rice blast resistance is characterized in that the nucleotide sequence of the OsWRKY70 gene is shown as SEQ ID NO. 1, and the OsWRKY70 gene function in the rice plants is inactivated by a genetic engineering method so as to obtain rice materials with improved rice blast resistance.

6. The use according to claim 5, wherein the genetic engineering method is selected from the group consisting of homologous recombination and gene editing.

7. The use of claim 6, wherein the gene editing is a CRISPR-Cas9 gene editing method.