CN101376887A - Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide - Google Patents
Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide Download PDFInfo
- Publication number
- CN101376887A CN101376887A CNA2008101557252A CN200810155725A CN101376887A CN 101376887 A CN101376887 A CN 101376887A CN A2008101557252 A CNA2008101557252 A CN A2008101557252A CN 200810155725 A CN200810155725 A CN 200810155725A CN 101376887 A CN101376887 A CN 101376887A
- Authority
- CN
- China
- Prior art keywords
- mouth disease
- composite peptide
- recombinant immune
- immune composite
- swine foot
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a method for constructing porcine fmd recombinant immune complex peptide and an application thereof, which belongs to the technical field of biological engineering. The immune multi-peptide adjuvant is fused with aphthovirus novel auxiliary T cell epiposition (I-S-I-S-E-I-K-G-V-I-V-H-K-I-E-T-I-L-F) and Bursin mimic peptide (T-P-N-L-K-H-G) by a flexible Linker. A fusion gene is inserted into an expression carrier to be converted into colon bacillus, gene engineering strains which express the porcine fmd recombinant immune complex peptide with high efficiency are obtained, and the fusion protein of the porcine fmd recombinant immune complex peptide is obtained after liquid culture and purification; the thioredoxin in the fusion protein is removed by enterokinase with His label on the N end, and the single porcine fmd recombinant immune complex peptide can be obtained after affinity chromatography purification with very high sample purity. The recombinant immune complex peptide can serve as the novel immune multi-peptide adjuvant of the foot-and-mouth disease vaccine. Animal immune experiments prove that the method has high safety but no toxicity and side effect, and can effectively enhance the immunity of organisms and cells and the immunity level of body fluid.
Description
Technical field
The present invention relates to the preparation method and the application of swine foot-and-mouth disease recombinant immune composite peptide, belong to the technical field that the genetically engineered in the biological-pharmacy is produced immunological adjuvant.
Background technology
(foot-and-mouth disease is that (foot-and-mouth disease virus, the deadly infectious disease that FMDV) causes mainly infects artiodactylous animals by foot and mouth disease virus FMD) to foot and mouth disease.Except that animal dead caused direct economic loss, animal stopped to cause this area even livestock product foreign trade that should country to stop in the production of meat and milk during one's sickness, also causes enormous economic loss.Therefore, countries in the world all take much count of the anti-system of this disease.
FMDV infects body and produces the participation that neutrality antibody needs B cell and T cell, both there had been T cell dependency IgG1 and IgG2 in the mice serum of infection FMDV, also have non-T cell dependency IgG3, show the T cell the antigen of FMDV constitute and immunne response in play an important role.Have in the VP1 G-H ring of FMDV and induce the site that generates the B cell, also have to excite the site that produces the Th cell.Test is found to have 11 different t cell epitopes at least on 41～209 amino-acid residue positions of VP1.The polypeptide that contains t cell epitope can strengthen the Th cell activity, and the co-induction body produces antiviral antibody simultaneously.Contain the B cell of Asia I type FMDV and the fusion rotein of t cell epitope and can cause the cavy immune response, this fusion epi-position provides selection for anti-Asia I type FMDV.
Vaccine is the effective measure of control FMD, conventional vaccines such as FMD attenuated vaccine and inactivated vaccine all have good immunogenicity, in the process of prevention and control FMD, bringing into play important effect, but in the production of inactivated vaccine, use the danger of bringing out FMD is arranged, this impels recombinant vaccine to become the focus of FMD vaccine research gradually.But also there are some parts not fully up to expectations in recombinant vaccine aspect the organism immune response inducing, and therefore, the investigator attempts to strengthen from many aspects the immune effect of FMD vaccine.The fabricius bursa (bursa of Fabricus, BF) be the important central immune organ of bird, contain many biologically active substances in the fabricius bursa ultrafiltration thing (1KD is following), particularly some little peptides have immunoloregulation function to bird, can promote the differentiation and development of bird, mammalian cell, promote the maturation of immune organ.The plain tripeptides of capsule wherein (K-H-G) not only has immunoloregulation function to bird as the important component part of activeconstituents in the BF tissue, and Mammals and people's quasi-lymphocyte are also had tangible immunology and physiologically active.Because natural BS can only extract from the fabricius bursa tissue of chicken, the source is very restricted, and other foreign protein content height, and the purifying difficulty is big, and its actual effect also is subjected to influencing significantly.The BS cost height of chemosynthesis is not suitable for the field and promotes.Therefore utilize genetic engineering technique, external great expression BS bioactive peptide may make BS obtain using the most widely as a kind of effective immunostimulant.
The present invention provides feasible technical route for the Schweineseuche immune composite peptide of preparation reorganization, and the swine foot-and-mouth disease recombinant immune composite peptide for preparing by present method can be used as the novel genetic engineering polypeptide vaccine adjuvant of foot and mouth disease vaccine.
Summary of the invention
Technical problem the objective of the invention is to develop the gene engineering polypeptide with good immune effect, and preventing and treating for Schweineseuche clinically provides a suitable immunological adjuvant.Providing a kind of simultaneously is the preparation method of host's genetically engineered immune peptide with intestinal bacteria.The invention still further relates to the application of genetically engineered Schweineseuche immune composite peptide in the Schweineseuche control.
Technical scheme
1) one of the technology of the present invention main points provide a kind of genetically engineered Schweineseuche immune composite peptide and gene thereof
The swine foot-and-mouth disease recombinant immune composite peptide gene is characterized in that intending the peptide gene by the capsule prime modulus of Schweineseuche helper T cell epitope gene and two copies is in series by flexible Linker (G-G-G-S) gene and is connected, and holds 5 ' and to be added with enteropeptidase recognition site gene order.The amino acid polypeptide that this tandem gene is derived is a swine foot-and-mouth disease recombinant immune composite peptide.This swine foot-and-mouth disease recombinant immune composite peptide is characterized in that t cell epitope polypeptide and the plain simulating peptide of capsule are in series.On the one hand, the t cell epitope polypeptide can strengthen the Th1 cell activity, and the co-induction body produces foot-and-mouth disease virus resistant antibody simultaneously.Simultaneously, the capsule prime modulus is intended the differentiation and maturation that Toplink promotes the B cell, induces antibody to generate.The two connects by flexible amino acid, can effectively bring into play biological function separately when keeping space structure independently.5 ' end is added with enteropeptidase recognition site sequence, can obtain to keep the swine foot-and-mouth disease recombinant immune composite peptide of natural N end under the effect of this enzyme.
2) two of the technology of the present invention main points provide a kind of construction process that can efficiently express the genetic engineering bacterium of swine foot-and-mouth disease recombinant immune composite peptide
Be the low swine foot-and-mouth disease recombinant immune composite peptide of production cost, must make up a kind of swine foot-and-mouth disease recombinant immune composite peptide that efficiently expresses, can produce the genetic engineering bacterium of swine foot-and-mouth disease recombinant immune composite peptide, genetic engineering bacterium of the present invention is the e. coli bl21 (DE3) that carries recombinant vectors, and recombinant vectors is the pET32a carrier that contains the swine foot-and-mouth disease recombinant immune composite peptide gene.
3) three of the technology of the present invention main points genetically engineered Schweineseuche immune composite peptide preparation methods that a kind of solubility is provided
The present invention selects escherichia expression system for use, and the pET32a carrier is with the T7 promotor, and inducing at IPTG down can efficiently expressing exogenous gene.The swine foot-and-mouth disease recombinant immune composite peptide gene is inserted Trx (TRX) gene C end, utilize the effect of Trx molecular chaperones, obtained the genetically engineered Schweineseuche immune composite peptide fusion rotein of solubility.This fusion rotein at first behind Ni post affinitive layer purification, holds the enteropeptidase enzyme that has the His label to cut except that Trx by N again, can obtain to keep the swine foot-and-mouth disease recombinant immune composite peptide of natural N end.Carry out affinity chromatography once more, collect and to penetrate the peak, lyophilize obtains the swine foot-and-mouth disease recombinant immune composite peptide of based on very high purity.
4) four of the technology of the present invention main points application that genetically engineered Schweineseuche immune composite peptide is provided
The present invention utilizes mouse model, cooperates the Schweineseuche inactivated vaccine to use the Schweineseuche immune composite peptide.The mensuration of IL-4 and IFN-γ in antibody by immune mouse and antibody subtype, spleen lymphocyte proliferation, the serum.Estimate the immunological adjuvant effect of genetically engineered Schweineseuche immune composite peptide.
For realizing above technical essential, introduce technical scheme of the present invention below in detail
A kind of engineering strain that efficiently expresses swine foot-and-mouth disease recombinant immune composite peptide, its structure may further comprise the steps:
1) the overlapping PCR (SOE) of swine foot-and-mouth disease recombinant immune composite peptide genes of SEQ .ID.NO.1 amplification.Designed three PCR primers:
5’-CCG
GAATTCGGCGGCGGCGGCAGCGATGATGATGATAAAATTAGCATTAGCGAAATTAAAGGCGTG-3’EcoRI
5’-GGGGTGCTGCCGCCGCCGCCAAACAGAATGGTTTCAATTTTATGCACAATCACGCCTTTAATTTCG-3’
5’-GCGGCGGCAGCACCCCGAACCTGAAACATGGCACCCCGAACCTGAAACATGGCTAA
GTCGACTCG-3’SalI
PCR reaction system 50 μ l:10 * PCR Buffer, 5 μ L, MgCl
2, 3 μ L; DNTP, 10mmol/L, 1 μ L; Primers F 1, F2 and primers F 2, final concentration are each 2 μ L of 20pmol/L; TaKaRa ExTaq 0.5 μ L; The sterilization ultrapure water, 34.5 μ L;
The PCR reaction conditions: 94 ℃ of pre-sex change 2min enter TD-PCR circulation: 94 ℃ of 30s, and annealing temperature is from 55 ℃, every circulation 1min, totally 30 circulations; 72 ℃ are extended 6min, reclaim the back through glue and obtain the swine foot-and-mouth disease recombinant immune composite peptide gene;
2) structure above-mentioned swine foot-and-mouth disease recombinant immune composite peptide gene PCR product and the pET32a that efficiently expresses the engineering strain of the described swine foot-and-mouth disease recombinant immune composite peptide gene of claim 1 all uses EcoRI, SalI double digestion, T4DNALigase connects, connect product Transformed E .coli DH5 α, recombinant expression plasmid carries out EcoRI and Sal I double digestion is identified; Enzyme is cut and is accredited as the order-checking of male plasmid, called after pET32a-KCMP;
3) adopt CaCl
2Conversion method enters in the e. coli bl21 (DE3) screening positive clone with recombinant plasmid pET32a-KCMP conversion.
The genetically engineered Schweineseuche immune composite peptide preparation method of solubility may further comprise the steps:
1) expression of swine foot-and-mouth disease recombinant immune composite peptide
Picking genetic engineering bacterium list colony inoculation is to filling in 3ml LB liquid nutrient medium (the 50 μ g/ml penbritin) test tube, in 37 ℃ of jolting overnight incubation, therefrom took out a certain amount of thalline in second day and be added to another and fill in the 3ml LB liquid nutrient medium, make cell concentration reach OD
6000.1,37 ℃ of jolting of ≈ was cultivated 2～4 hours, as cell concentration OD
600During ≈ 0.4-0.6, the adding final concentration was that the IPTG of 1mM carries out abduction delivering 4～6h, collected 100 μ L bacterium liquid every 1 hour.4000rpm, centrifugal 10min collects thalline, with the thalline collected with 100 μ L PBS resuspended after, add isopyknic 2 * sds gel sample loading buffer (100mmol/L TrisCl (pH6.8); 200mmol/L dithiothreitol (DTT) (DTT); 4% SDS (electrophoresis level); 0.2% tetrabromophenol sulfonphthalein; 20% glycerine), 100 ℃ are boiled 5min so that the protein distortion is got 10 μ L application of samples and carried out the SDS-PAGE gel electrophoresis.
2) purifying of swine foot-and-mouth disease recombinant immune composite peptide fusion rotein
The bacterium liquid of abduction delivering is precipitated in the centrifugal 10min results of 12000rmp, with washings (5mM imidazoles, 0.5M NaCl, 20mM Tris-HCl, pH7.9) resuspended thalline, after ultrasonic treatment 10min, the centrifugal 10min results of 12000rmp inclusion body precipitation and supernatant identify that through the SDS-PAGE electrophoresis expression product is mainly with solubility expression subsequently.This supernatant is carried out purifying with the Ni-NTA affinity chromatographic column.
3) the enteropeptidase enzyme is cut swine foot-and-mouth disease recombinant immune composite peptide and purifying
Hold the enteropeptidase that has the His label to cut by N again, can obtain to keep the swine foot-and-mouth disease recombinant immune composite peptide of natural N end except that Trx.Carry out affinity chromatography once more, collect and penetrate the peak, the albumen of purifying is dialysed with PBS, obtain the swine foot-and-mouth disease recombinant immune composite peptide of based on very high purity.And at the quantitative postlyophilization of GeneQuant pro RNA/DNA Calculator.
The application of genetically engineered Schweineseuche immune composite peptide may further comprise the steps: utilize mouse model, cooperate the pig inactivated vaccine to use the Schweineseuche immune composite peptide.The mensuration of IL-4 and IFN-γ in antibody by immune mouse and antibody subtype, spleen lymphocyte proliferation, the serum.Estimate the immunological adjuvant effect of genetically engineered Schweineseuche immune composite peptide.
Beneficial effect
1 improves the foot and mouth disease vaccine immune effect
The present invention uses swine foot-and-mouth disease recombinant immune composite peptide as molecule adjuvant, the plain simulating peptide of capsule of Schweineseuche helper T cell epi-position and pair copy is merged the novel swine foot-and-mouth disease recombinant immune composite peptide of formation by flexible Linker (G-G-G-S), can strengthen the immunogenicity of Schweineseuche inactivated vaccine, after swine foot-and-mouth disease recombinant immune composite peptide cooperated Schweineseuche inactivated vaccine combined immunization BALB/c mouse, its humoral immunization and cellular immunization is all than independent Schweineseuche inactivated vaccine good immune effect, and do not have any anaphylaxis.
2 are easy to realize mass production
The present invention selects prokaryotic expression carrier when using swine foot-and-mouth disease recombinant immune composite peptide as molecule adjuvant, its advantage is that technology is simple, and cost is low, the output height, and purifying process is simple, is easy to realize mass production.
Description of drawings:
The expression schema of Fig. 1 Schweineseuche immune composite peptide
The gene PCR amplification and the recombinant expression vector of Fig. 2 Schweineseuche immune composite peptide are identified figure
M.DL2000 Marker; 1,3 EcoRI and Sal I double digestion are identified positive plasmid; The gene PCR amplification of 2 Schweineseuche immune composite peptides
The SDS-PAGE of Fig. 3 Schweineseuche immune composite peptide fusion rotein purifying analyzes, product
M. albumen Marker; The collection peak of 1,2,3 Schweineseuche immune composite peptide fusion rotein purifying
Fig. 4 Schweineseuche immune composite peptide Tricine-SDS-PAGE
M1, M2. albumen Marker; The collection peak of 1,2,3 Schweineseuche immune composite peptide purifying
Fig. 5 lymphopoiesis (MTT) is analyzed
1:PBS group 2: inactivated vaccine group 3: inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group
Fig. 6 foot and mouth disease virus antibody and antibody subtype detect
The content of cytokine in Fig. 7 mice serum
A:IFN-γ content 1:PBS group 2: inactivated vaccine group 3: inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group
B:IL-4 content 1:PBS group 2: inactivated vaccine group 3: inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group
Embodiment:
Overlapping PCR (SOE) amplification of 1 swine foot-and-mouth disease recombinant immune composite peptide gene
Have a liking for codon design swine foot-and-mouth disease recombinant immune composite peptide gene partially according to intestinal bacteria, add in primers F 1 respectively to add terminator codon and SalI restriction enzyme site in EcoRI restriction enzyme site, the primers F 3.The expression schema of swine foot-and-mouth disease recombinant immune composite peptide is seen (Fig. 1)
5’-CCG
GAATTCGGCGGCGGCGGCAGCGATGATGATGATAAAATTAGCATTAGCGAAATTAAAGGCGTG-3’EcoRI
5’-GGGGTGCTGCCGCCGCCGCCAAACAGAATGGTTTCAATTTTATGCACAATCACGCCTTTAATTTCG-3’
5’-GCGGCGGCAGCACCCCGAACCTGAAACATGGCACCCCGAACCTGAAACATGGCTAA
GTCGACTCG-3’SalI
Primer is synthetic by Shanghai Invitrongen company
PCR reaction system 50 μ l:10 * PCR Buffer, 5 μ L, MgCl
2, 3 μ L; DNTP, 10mmol/L, 1 μ L; Primers F 1, F2 and primers F 2, final concentration are each 2 μ L of 20pmol/L; TaKaRa ExTaq 0.5 μ L; The sterilization ultrapure water, 34.5 μ L;
The PCR reaction conditions: 94 ℃ of pre-sex change 2min enter TD-PCR circulation: 94 ℃ of 30s, and annealing temperature is from 55 ℃, every circulation 1min, totally 30 circulations; 72 ℃ are extended 10min, the PCR product is through containing ethidium bromide (Ethidium Bromide, EB) after 1% agarose gel electrophoresis is identified, downcut the purpose band, reclaiming test kit (Dalian TaKaRa company) operation instruction by glue subsequently reclaims, and the recovery product is carried out electrophoresis identify that about 144bp size fragment is swine foot-and-mouth disease recombinant immune composite peptide gene (Fig. 2), behind gene sequencing, the swine foot-and-mouth disease recombinant immune composite peptide of its coding of deriving is 48 amino acid.
The construction method of gene engineering strain of 2 swine foot-and-mouth disease recombinant immune composite peptide genes
Use EcoR I, Sal I carries out double digestion to swine foot-and-mouth disease recombinant immune composite peptide gene and plasmid vector pET-32a, and places 37 ℃ of water-bath effect 2h, enzyme to cut product equally after 1% agarose gel electrophoresis is identified, glue reclaims test kit and reclaims evaluation.The swine foot-and-mouth disease recombinant immune composite peptide gene that the process enzyme is cut spends the night for 4 ℃ by the mol ratio of 1:3 with the pET-32a carrier and is connected.Get the adding of connection product and contain in the polypropylene centrifuge tube of 100 μ L competence DH5 α, gently ice bath 30min behind the mixing.Polypropylene centrifuge tube is taken out back 42 ℃ of heat-shocked 90sec from ice, then ice bath 2min immediately.The LB substratum that adds 37 ℃ of preheatings of 800 μ L is in 37 ℃ of jolting (100～150rpm) 45min.Get 100 μ L bacterium liquid evenly coating contain the agar LB flat board of penbritin (Amp) 50 μ g/ml, 37 ℃ just putting 20min after, be inverted and cultivate 16～20h.By the alkaline lysis method of extracting plasmid on " molecular cloning experiment guide ".Plasmid carries out EcoRI and Sal I double digestion is identified to extracting.Cut out the positive plasmid of plasmid (Fig. 2) of big or small dna fragmentation about existing 144bp with enzyme.And with positive plasmid called after pET32a-KCMP.Serve the order-checking of extra large Invitrongen company.Adopt CaCl
2Conversion method enters recombinant plasmid pET32a-KCMP conversion in the e. coli bl21 (DE3), and screening positive clone is engineering strain.
The expression of 3 swine foot-and-mouth disease recombinant immune composite peptides
Picking engineering strain list colony inoculation is to filling in 3ml LB liquid nutrient medium (the 50 μ g/ml penbritin) test tube, in 37 ℃ of jolting overnight incubation, therefrom took out a certain amount of thalline in second day and be added to another and fill in the 3ml LB liquid nutrient medium, make cell concentration reach OD
6000.1,37 ℃ of jolting of ≈ was cultivated 2～4 hours, as cell concentration OD
600During ≈ 0.4-0.6, the adding final concentration was that the IPTG of 1mM carries out abduction delivering 4～6h, collected 100 μ L bacterium liquid every 1 hour.4000rpm, centrifugal 10min collects thalline, with the thalline collected with 100 μ L PBS resuspended after, add isopyknic 2 * sds gel sample loading buffer (100mmol/L TrisCl (pH6.8); 200mmol/L dithiothreitol (DTT) (DTT); 4% SDS (electrophoresis level); 0.2% tetrabromophenol sulfonphthalein; 20% glycerine), 100 ℃ are boiled 5min so that the protein distortion is got 10 μ L application of samples and carried out the SDS-PAGE gel electrophoresis, and the preparation of SDS-PAGE running gel and deposition condition are with reference to the molecular cloning handbook.
To cover on the separation gel behind the aforesaid liquid mixing, insert comb subsequently, after placement 10min treats that gelling is solid under the room temperature, take out comb, in electrophoresis chamber, pour Tris-glycine electrophoretic buffer (25mmol/L Tris into; 250mmol/L glycine (electrophoresis level) (pH8.3); 0.1% SDS), application of sample finishes back connection power supply.Groove on the power cathode termination, groove under the anodal termination.Voltage is 80V in concentrating glue, enters that voltage is adjusted into 120V in the separation gel.Arrive back, separation gel bottom powered-down up to sample, take out gel, use coomassie brilliant blue staining 1h, the 1-2h that on decolorization swinging table, decolours subsequently, observations.
The purifying of 4 swine foot-and-mouth disease recombinant immune composite peptide fusion roteins
The bacterium liquid of abduction delivering is precipitated in the centrifugal 10min results of 12000rmp, with washings (5mM imidazoles, 0.5M NaCl, 20mM Tris-HCl, pH7.9) resuspended thalline, after ultrasonic treatment 10min, the centrifugal 10min results of 12000rmp inclusion body precipitation and supernatant identify that through the SDS-PAGE electrophoresis expression product is mainly with solubility expression subsequently.This supernatant is carried out purifying with protein N i post affinity chromatography, and specific operation process is as follows;
After resin shaken up, in pillar, add 5.0ml resin suspension, place to make its natural subsidence under the room temperature, guarantee that column volume is 2.5ml, add 3 times of volumes subsequently respectively and get pure water, 5 times of volume 1xCharge buffer, 3 times of volume 1xBinding buffer.When 1xBinding buffer flows to post bed when bottom, in pillar, add expression product, the control flow velocity is crossed post with the flow of 25ml per hour, guarantees that albumen can be attached on the pillar fully.Then adding 25ml1xBingding buffer washs, subsequently with 15ml 1xWash buffer washing, finally, promptly obtain the purified product of swine foot-and-mouth disease recombinant immune composite peptide fusion rotein, the about 26KDa of molecular weight with the 1x Elutebuffer eluted protein of 15ml.This fusion rotein is connected with Trx at swine foot-and-mouth disease recombinant immune composite peptide N end.(Fig. 3).
5 enteropeptidase enzymes are cut swine foot-and-mouth disease recombinant immune composite peptide and purifying
Hold the enteropeptidase that has the His label to cut by N again, can obtain to keep the swine foot-and-mouth disease recombinant immune composite peptide of natural N end except that Trx.Carry out Ni post affinity chromatography once more, collect and penetrate the peak, the albumen of purifying is dialysed with PBS, obtain the swine foot-and-mouth disease recombinant immune composite peptide (Fig. 4) of the about 6KDa of based on very high purity molecular weight.And at the quantitative postlyophilization of GeneQuant pro RNA/DNA Calculator.
6 immune mouses
With the swine foot-and-mouth disease recombinant immune composite peptide of the about 6KDa of above-mentioned based on very high purity molecular weight, cooperate the foot and mouth disease vaccine combined immunization, estimate its immunoenhancement result.6 ages in week, female BALB/c mouse was divided into 3 groups (inactivated vaccine group, inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group, PBS control groups), and 10 every group, the used dosage of swine foot-and-mouth disease recombinant immune composite peptide is the 20ug/ mouse.Adopt peritoneal injection, two all immunity once are total to immunity three times at interval.And last immunity one all tail vein bloods.The content of IL-4 and IFN-γ in detection foot and mouth disease virus antibody and antibody subtype and the serum.Separating spleen lymphocyte detects spleen lymphocyte proliferation simultaneously.O type FMD inactivated vaccine is biological pharmaceutical factory, a Zhongmu Stocks Trading Co. Lanzhou product.
7 tetramethyl-azo azoles blue laws (MTT)
Inactivated vaccine mice immunized group OD570 mean value is 0.46 ± 0.032 separately
b, inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group is 0.72 ± 0.012
a, the PBS group is 0.15 ± 0.033
cThese three groups by statistics credit analyse, inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group and independent inactivated vaccine group significant difference (P＜0.05), this result shows that inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group lymphopoiesis is better than independent inactivated vaccine group (Fig. 5).
8 foot and mouth disease virus antibody and antibody subtype detect
IgG hypotype detected result shows that conventional inactivated vaccine mainly induces the generation of IgG1, and inactivated vaccine+swine foot-and-mouth disease recombinant immune composite peptide group not only can be induced the generation of high-level IgG1, and induces the ability of the generation of IgG2a to be better than deactivation vaccine.The antibody-secreting level of inducing mouse is better than inactivated vaccine immunity (Fig. 6) separately behind the two combined immunization of inactivated vaccine and swine foot-and-mouth disease recombinant immune composite peptide.
The mensuration of IL-4 and IFN-γ in 9 serum
Use quantitative ELISA IL-4 in the serum and IFN-γ are carried out the secretion that quantitative analysis finds that deactivation vaccine is mainly induced IL-4, the immune composite peptide group still adds the immune composite peptide group and induces the secretion of IFN-γ apparently higher than the deactivation vaccine group.As Fig. 7.
＜110〉Agricultural University Of Nanjing
＜120〉preparation method of swine foot-and-mouth disease recombinant immune composite peptide and application
＜130〉specification sheets
<140>00
<141>2008-09-18
<160>5
<170>PatentIn?version?3.1
<210>1
<211>147
<212>DNA
＜213〉synthetic
<220>
＜221〉gene of swine foot-and-mouth disease recombinant immune composite peptide
<222>(1)..(147)
<223>
<400>1
ggcggcggcg?gcagcgatga?tgatgataaa?attagcatta?gcgaaattaa?aggcgtgatt?60
gtgcataaaa?ttgaaaccat?tctgtttggc?ggcggcggca?gcaccccgaa?cctgaaacat?120
ggcaccccga?acctgaaaca?tggctaa 147
<210>2
<211>66
<212>DNA
＜213〉synthetic
<220>
＜221〉primers F 1
<222>(1)..(66)
<223>
<400>2
ccggaattcg?gcggcggcgg?cagcgatgat?gatgataaaa?ttagcattag?cgaaattaaa?60
ggcgtg 66
<210>3
<211>66
<212>DNA
＜213〉synthetic
<220>
＜221〉primers F 2
<222>(1)..(66)
<223>
<400>3
ggggtgctgc?cgccgccgcc?aaacagaatg?gtttcaattt?tatgcacaat?cacgccttta?60
atttcg 66
<210>4
<211>65
<212>DNA
＜213〉synthetic
<220>
＜221〉primers F 3
<222>(1)..(65)
<223>
<400>4
gcggcggcag?caccccgaac?ctgaaacatg?gcaccccgaa?cctgaaacat?ggctaagtcg 60
actcg 65
<210>5
<211>48
<212>PRT
＜213〉synthetic
<220>
＜221〉swine foot-and-mouth disease recombinant immune composite peptide
<222>(1)..(48)
<223>
<400>5
Gly?Gly?Gly?Gly?Ser?Asp?Asp?Asp?Asp?Lys?Ile?Ser?Ile?Ser?Glu?Ile
1 5 10 15
Lys?Gly?Val?Ile?Val?His?Lys?Ile?Glu?Thr?Ile?Leu?Phe?Gly?Gly?Gly
20 25 30
Gly?Ser?Thr?Pro?Asn?Leu?Lys?His?Gly?Thr?Pro?Asn?Leu?Lys?His?Gly
35 40 45
Claims (7)
1, a kind of genetically engineered swine foot-and-mouth disease recombinant immune composite peptide gene, its sequence is the nucleotide sequence shown in the SEQ.ID.NO.1.
2, a kind of swine foot-and-mouth disease recombinant immune composite peptide of genetic expression, its sequence are the aminoacid sequence shown in the SEQ.ID.NO.5.
3, the application of the described swine foot-and-mouth disease recombinant immune composite peptide of claim 2.
4, a kind of described swine foot-and-mouth disease recombinant immune composite peptide engineering strain of claim 2 that efficiently expresses, its structure may further comprise the steps:
1) the overlapping extension splicing pcr amplification SOE-PCR of swine foot-and-mouth disease recombinant immune composite peptide gene:
Design three PCR primers:
Primers F 1, SEQ.ID.NO.2:
5’-CCGGAATTCGGCGGCGGCGGCAGCGATGATGATGATAAAATTAGCATTAGC
GAAATTAAAGGCGTG-3’
Primers F 2, SEQ.ID.NO.3:
5’-GGGGTGCTGCCGCCGCCGCCAAACAGAATGGTTTCAATTTTATGCACAATC
ACGCCTTTAATTTCG-3’
Primers F 3, SEQ.ID.NO.4:
5’-GCGGCGGCAGCACCCCGAACCTGAAACATGGCACCCCGAACCTGAAACAT
GGCTAAGTCGACTCG-3’
PCR reaction system 50 μ l:10 * PCR Buffer, 5 μ L, MgCl
2, 3 μ L; DNTP, 10mmol/L, 1 μ L; Primers F 1, F2 and primers F 2, final concentration are each 2 μ L of 20pmol/L; TaKaRa ExTaq 0.5 μ L; The sterilization ultrapure water, 34.5 μ L;
The PCR response procedures: 94 ℃ of pre-sex change 2min enter TD-PCR circulation: 94 ℃ of 30s, and annealing temperature is from 55 ℃, every circulation 1min, totally 30 circulations; 72 ℃ are extended 6min, reclaim the back through glue and obtain the swine foot-and-mouth disease recombinant immune composite peptide gene;
2) structure of pET32a recombinant expression vector
Above-mentioned swine foot-and-mouth disease recombinant immune composite peptide gene PCR product and pET32a all use EcoRI, SalI double digestion, and T4DNA Ligase connects, and connect product Transformed E .coli DH5 α, and recombinant expression plasmid carries out EcoRI and Sal I double digestion is identified; Enzyme is cut and is accredited as the order-checking of male plasmid, called after pET32a-KCMP;
3) recombinant expression plasmid pET32a-KCMP transformed into escherichia coli BL21, screening positive clone is the engineering strain that efficiently expresses the swine foot-and-mouth disease recombinant immune composite peptide gene that is obtained.
5, the solubility gene engineering expression product swine foot-and-mouth disease recombinant immune composite peptide for preparing with the described engineering strain of claim 4.
6, the application of the described expression product swine foot-and-mouth disease recombinant immune composite peptide of claim 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101557252A CN101376887B (en) | 2008-10-08 | 2008-10-08 | Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101557252A CN101376887B (en) | 2008-10-08 | 2008-10-08 | Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101376887A true CN101376887A (en) | 2009-03-04 |
| CN101376887B CN101376887B (en) | 2010-10-20 |
Family
ID=40420626
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101557252A Expired - Fee Related CN101376887B (en) | 2008-10-08 | 2008-10-08 | Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101376887B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102178950A (en) * | 2011-05-06 | 2011-09-14 | 河南科技大学 | Subunit vaccine immunologic adjuvant and application thereof |
| CN102286465A (en) * | 2011-07-08 | 2011-12-21 | 华中农业大学 | Pig IFITM3 gene for inhibiting mouth disease virus multiplication, and construction method and application |
| CN102936602A (en) * | 2012-10-24 | 2013-02-20 | 中国科学院广州生物医药与健康研究院 | Recombinant human insulin-like growth factor-2 protein and production method thereof |
| CN103145854A (en) * | 2013-03-05 | 2013-06-12 | 河南科技大学 | Recombined Tbeta 4-BP5 fusion peptide, gene, engineering bacteria and application |
| CN104744593A (en) * | 2013-12-25 | 2015-07-01 | 深圳先进技术研究院 | Anti-tumor angiogenesis immune composite peptide, and preparation method and application thereof |
-
2008
- 2008-10-08 CN CN2008101557252A patent/CN101376887B/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102178950A (en) * | 2011-05-06 | 2011-09-14 | 河南科技大学 | Subunit vaccine immunologic adjuvant and application thereof |
| CN102286465A (en) * | 2011-07-08 | 2011-12-21 | 华中农业大学 | Pig IFITM3 gene for inhibiting mouth disease virus multiplication, and construction method and application |
| CN102286465B (en) * | 2011-07-08 | 2012-10-17 | 华中农业大学 | Pig IFITM3 gene for inhibiting mouth disease virus multiplication, and construction method and application |
| CN102936602A (en) * | 2012-10-24 | 2013-02-20 | 中国科学院广州生物医药与健康研究院 | Recombinant human insulin-like growth factor-2 protein and production method thereof |
| CN103145854A (en) * | 2013-03-05 | 2013-06-12 | 河南科技大学 | Recombined Tbeta 4-BP5 fusion peptide, gene, engineering bacteria and application |
| CN103145854B (en) * | 2013-03-05 | 2014-11-26 | 河南科技大学 | Recombined Tbeta 4-BP5 fusion peptide, gene, engineering bacteria and application |
| CN104744593A (en) * | 2013-12-25 | 2015-07-01 | 深圳先进技术研究院 | Anti-tumor angiogenesis immune composite peptide, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101376887B (en) | 2010-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101376887B (en) | Preparation and use of swine foot-and-mouth disease recombinant immune composite peptide | |
| CN103160530B (en) | A kind of fusion and its application | |
| CN101451145B (en) | Tuberculosis gene vaccine based on T cell epitope as well as preparation method and use thereof | |
| CN101088559A (en) | Polyepitope tuberculosis gene vaccine and its prepn process | |
| CN111548395A (en) | Bivalent multi-epitope recombinant virus-like particle of foot-and-mouth disease virus and application thereof | |
| CN106350527A (en) | Diphtheria toxin mutant with characteristic of soluble high expression in Escherichia coli | |
| CN108840946A (en) | Dog albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of dog long-acting interferon | |
| CN110358741B (en) | Recombinant baculovirus expressing porcine Seneca virus VP2 gene and preparation method and application thereof | |
| CN102406929A (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
| CN109021115A (en) | A kind of pig circular ring virus trivalent subunit vaccine | |
| CN100409900C (en) | Use of staphylococcal enterotoxin A gene and its coded protein | |
| CN103145854B (en) | Recombined Tbeta 4-BP5 fusion peptide, gene, engineering bacteria and application | |
| CN102294027A (en) | Respiratory syncytial virus F2 protein subunit vaccine and preparation method thereof | |
| US20100055135A1 (en) | Enhancin of hepatitis b virus vaccine and its gene | |
| CN108822221A (en) | A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and recombinant chIL-2 | |
| CN108794644A (en) | A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α | |
| Zuckerman | Subunit, recombinant and synthetic hepatitis B vaccines | |
| CN108840950A (en) | A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha | |
| CN108864302A (en) | A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 | |
| CN100518818C (en) | Vaccine for preventing and/or treating tumour of digestive system | |
| CN108840941A (en) | A kind of fusion protein and preparation method thereof for recombinating sheep long-acting interferon γ and preparing this long-acting interferon γ | |
| CN100575491C (en) | Transmembrane and secretor type HIV Gag antigen encoding gene and comprise its AIDS vaccine | |
| CN103740736B (en) | The HSV2 virus gE glucoprotein extracellular region gene fragment of chemosynthesis and expression, application | |
| CN103145853B (en) | Recombined Talpha 1-BP5 fusion peptide, gene, engineering bacteria and application | |
| CN107254001A (en) | It is a kind of by dog albumin and dog interferon γ fusion protein constituted and preparation method thereof and a kind of canine recombinant long-acting interferon γ |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101020 Termination date: 20131008 |