CN101328506B - Fluorescent quantitative PCR rapid diagnosis reagent kit for specific detection of classical swine fever virus wild virus infection and its application method - Google Patents
Fluorescent quantitative PCR rapid diagnosis reagent kit for specific detection of classical swine fever virus wild virus infection and its application method Download PDFInfo
- Publication number
- CN101328506B CN101328506B CN2008100485168A CN200810048516A CN101328506B CN 101328506 B CN101328506 B CN 101328506B CN 2008100485168 A CN2008100485168 A CN 2008100485168A CN 200810048516 A CN200810048516 A CN 200810048516A CN 101328506 B CN101328506 B CN 101328506B
- Authority
- CN
- China
- Prior art keywords
- swine fever
- fluorescent
- wild
- fever virus
- classical swine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a fluorescence quantitative PCR rapid diagnosis kit for specifically detecting the Hog cholera virus and wild virus infection and an application method thereof, belonging to the virus nucleic acid detection field. The fluorescence quantitative PCR rapid diagnosis kit is applied to the rapid quantitative detection of the CSFV wild virus clinically and in scientific research and can remove the false positive caused by the CSFV HCLV vaccine immunization. Compared with the prior art, the fluorescence quantitative PCR rapid diagnosis kit has the advantages that: the Hog cholera virus and wild virus infection and the vaccine immunization can be verified and diagnosed, the problem of the incapability of removing the false positive caused by the vaccine immunization is solved; the specificity is good, the high specificity hybridization double control of the primer high specificity amplification and the fluorescence probe is realized, the accuracy is high, the false positive is low; the sensitivity is high; the detection speed is high, only one hour is needed and two to three hours are needed when the extraction process of the nucleic acid and the preparation process of the cDNA are added; and the post treatment is not necessary, the processes such as hybridization, electrophoresis and photo are not necessary and no pollution is caused.
Description
Technical field
Fluorescent quantitative PCR rapid diagnosis reagent box and application method thereof that a kind of special detection wild-type classical swine fever virus involved in the present invention infects, belong to the viral nucleic acid detection range, be applicable to that the fast quantification to the wild poison of CSFV detects in clinical and the scientific research, can get rid of the false positive that the weak poison of CSFV rabbitization (HCLV) vaccine immunity brings.
Background technology
(Classical Swine Fever is that (mortality ratio is up to more than 90% for Classical Swine Fever Virus, acute, the contagious disease of the pig that CSFV) causes by Pestivirus suis CSF) to swine fever.Swine fever takes place in worldwide and is popular, causes serious harm and tremendous economic loss to pig industry, and (OIE) classifies one of the Notifiable disease that must declare as by the International Animal Health tissue.China also is one of state occurred frequently of swine fever, the epidemic characteristic of China's swine fever, chronic swine fever popular, persistent infection and subclinical infection in recent years to distribute, and the control that makes swine fever is difficulty more, and harm is on the rise.The Chinese government all pays much attention to the anti-system of swine fever always, and a series of anti-system measure proposed in succession, requirement is carried out hog cholera lapinised virus vaccine (Hog Cholera Lapinized Virus to pig, HCLV) immunity, but along with being extensive use of of swine fever HCLV vaccine, more increase the monitoring difficulty of swine fever, be easy to generate false positive.
Existing diagnostic method is as viral separation and Culture (Virus Isoloation, VI), enzyme-linked immunosorbent assay (Enzyme-Linked ImmunoSorbent Assay, ELISA), reverse transcription-polymerase chain TRAP (ReverseTranscript-Polymerase Chain Reaction, RT-PCR), (ImmunoFluorescenceAssay, IFA) grade all can not be distinguished pig CSFV wild virus infection and vaccine immunity to immunofluorescence technique.Therefore, setting up a kind of differential diagnosis method that can distinguish wild-type classical swine fever virus infection and vaccine immunity is a problem demanding prompt solution.
The genome of Pestivirus suis is the RNA molecule of sub-thread, normal chain, non-segmented negative.The nucleotide homology analysis revealed: wild-type classical swine fever virus and HCLV vaccine all have distinctive separately nucleotide sequence.By the specific hybridization probe of design wild-type classical swine fever virus, simultaneously in conjunction with the sensitive detection technique, just can detect, thereby realization is to the differential diagnosis of wild-type classical swine fever virus and vaccine to the distinctive nucleotide sequence of wild-type classical swine fever virus.(Fluorogenetic Quantitative PCR, FQ-PCR) method just can be carried out efficient detection to this class hybridization probe to the quantitative fluorescent PCR that the mid-90 in 20th century grows up.This technology is to have increased a fluorescent label DNA probe with high specific on the basis of regular-PCR, by initial point quantitatively and fluorescence detecting system monitor in real time and accumulate fluorescence intensity and realize nucleic acid is carried out detection by quantitative.But advantages such as this technology has weak point highly sensitive, consuming time, high specificity detection by quantitative.According to the FQ-PCR technology, at home and abroad no matter the people cures application facet, or animal doctor's application facet, has all developed multiple fluorescent quantitative PCR rapid diagnosis reagent box.
Prior art is about the document of Pestivirus suis antigen, antibody test and fluorescent quantitative PCR technique, mainly contain following several, as patent No. application number is that the document method and the enzyme linked immunological kit thereof of specific antibody " detect Pestivirus suis " of 200710176125X discloses a kind of detection Pestivirus suis antigen prepd and antibody detection method, but does not relate to the Pestivirus suis detection of antigens; The patent No. is 200610109404 document " pig pestivirus fluorescence RT-PCR diagnostic kit ", number of patent application is that 02109350.4 " a kind of fast quantification detects the PCR kit for fluorescence quantitative and the application of Pestivirus suis and hog cholera lapinised virus vaccine " discloses two kinds of Pestivirus suis detection of antigens methods, does not infect differential diagnosis technology with vaccine immunity but relate to wild-type classical swine fever virus.
Summary of the invention
Another object of the present invention is to provide a kind of fluorescent quantitative PCR technique that utilizes to prepare the fluorescent quantitative PCR rapid diagnosis reagent box that a kind of special detection wild-type classical swine fever virus infects, this test kit can specially detect wild-type classical swine fever virus antigen delicately, and the HCLV vaccine antigen of immunity can not detect, thereby realizes that wild-type classical swine fever virus infects and the differential diagnosis of vaccine immunity.
The object of the present invention is to provide a kind of accurately easy antigenic method of detection by quantitative wild-type classical swine fever virus that is used for.
The present invention is that the technical scheme that solves the problems of the technologies described above employing is: the fluorescent quantitative PCR rapid diagnosis reagent box that a kind of special detection wild-type classical swine fever virus infects, it is characterized in that this test kit comprises: a) RNA lysate, b) inverse transcription reaction liquid, c) fluorescent quantitation reaction solution, d) wild-type classical swine fever virus strong positive and critical positive quality control product, e) negative quality control product and f) the quantitative criterion product, inverse transcription reaction liquid contains primer RCSFV, and its sequence is 5 '-TGCCCACAGTAGGACTAGCAAAC-3 ' 23nt; The fluorescent quantitation reaction solution contains upstream primer FCSFV and downstream primer RCSFV and fluorescent probe PCSFV, and upstream primer FCSFV sequence is: 5 '-TGCCCACAGTAGGACTAGCAAAC-3 ' 23nt; Downstream primer RCSFV sequence is: 5 '-CAGGACTTAGACCACCCAGGG-3 ' 21nt; Fluorescent probe PCSFV sequence is 5 '-TCGCCACTACGGCTAG-3 ' 16nt, that fluorescent probe PCSFV 5 ' holds mark is fluorescence report group FAM, 3 ' end mark is non-fluorescent quenching group, 3 ' end other mark MGB (minor groove binder) binding substances.
Press such scheme, described inverse transcription reaction liquid is by 1 * RT Buffer, dNTPs 0.5mM, and M-MLV enzyme 50U and primer RCSFV 0.4 μ M form.
Press such scheme, the fluorescent quantitation reaction solution is by 1 * PCR Buffer, MgCl
24mM, dNTPs 0.5mM, Taq enzyme 2U, each 0.2 μ M of primers F CSFV and RCSFV and fluorescent probe PCSFV 0.2 μ M form.
Press such scheme, the Pestivirus suis crossdrift strain that described wild-type classical swine fever virus strong positive is high titre (is generally 10
6～10
7TCID
50/ ml), its propagation that goes down to posterity on the PK15 cell obtains through after the deactivation; Critical positive quality control product is that the wild-type classical swine fever virus strong positive is through 10
3Make after the dilution.
Press such scheme, described negative quality control product is to gather healthy and each tissue of pig that do not have cause of disease, adds PBS liquid in 1: 5 by volume, fully homogenate fragmentation, and centrifugal removal precipitation, supernatant is preserved standby.
Press such scheme, described quantitative criterion product are synthetic long-chain primers, and its sequence is CAGGACTTAGACCACCCAGGGAGCTCGCCACTACGGCTAGTCCCTCCGTTTGCTAG TCCTACTGTGGGCATGGCTAGCCCAGTTCGGCCGTCGCTG.
The application method of the fluorescent quantitative PCR rapid diagnosis reagent box that a kind of special detection wild-type classical swine fever virus infects is characterized in that including following steps:
1) extraction of Pestivirus suis geneome RNA: respectively to 200 μ l sample to be detected, d) adds 1ml RNA lysate in wild-type classical swine fever virus strong positive and the critical positive quality control product, after leaving standstill 5min, add 200 μ l chloroforms, draw supernatant behind the high speed centrifugation, add isopyknic Virahol in the supernatant, carry out ice bath and high speed centrifugation precipitation again, gained precipitates with after 75% washing with alcohol, with the dissolving of 20 μ l aqua sterilisas, gained solution is the RNA template;
2) reverse transcription reaction: in the RNA template 18 μ l of step 1) preparation, add inverse transcription reaction liquid 7 μ l respectively, 42 ℃ down temperature bathe reaction 30min, water-bath is warmed to 95 ℃ of reaction 5min again, treat that reverse transcription reaction finishes after, the gained reaction solution is the cDNA template;
3) get step 2 respectively) the quantitative criterion product that obtain the serial dilution of cDNA template and same amount join in the fluorescent quantitation reaction solution, carry out PCR with the fluorescent quantitation detector and react the fluorescence intensity that discharges in the also real-time detection reaction process, the PCR reaction obtains the pig plague virus specific amplifying target genes, and described pig plague virus specific amplifying target genes sequence is: TGCCCACAGTAGGACTAGCAAACGGAGGGACTAGCCGTAGTGGCGAGCTCCCTGGG TGGTCTAAGTCCTG;
4) treating the initial copy number of examining sample by the circulation thresholding of sample more to be detected and standard substance carries out quantitatively.
Main technical principle of the present invention is: quantitative fluorescent PCR (FQ-PCR) technology comprises two kinds of probe method and dye methods.Probe method is to utilize the increase of indicating amplified production with the probe of target sequence specific hybridization, is representative with the Taqman probe method, and fluorescence report group commonly used is FAM, VIC, JOE, Cy5 etc.; Dye class be adopt a kind of can with double-stranded DNA ditch bonded fluorescence dye, fluorescent signal is strong and weak relevant with the quantity of double-stranded DNA, can converse the double-stranded DNA quantity of PCR in reacting according to fluorescent signal, commonly used is SYBR green I dyestuff.
Commonly used in fluorescent quantitation detects is the Taqman probe method, can be divided into two kinds of conventional TaqMan probe and TaqMan-MGB probes again according to the difference of the quenching of fluorescence group of its 3 ' end mark.Conventional TaqMan probe 5 ' end is marked with the fluorescent emission group, and 3 ' end is marked with the quenching of fluorescence group, and this probe can not be extended in the PCR process.When probe was kept perfectly, 3 ' end quencher group suppressed the fluorescent emission of 5 ' emission group.In the annealing phase of PCR, the dna profiling generation specific hybrid in probe and the sequence that primer comprises.The extended peroid primer extends at the downward dna profiling of Taq enzyme effect, and when arriving the tat probe place, the Taq enzyme is sent out brightness 5 ' → 3 ' exonuclease activity, replaces then.After cutting off probe, the emission group is away from the quencher group, and fluorescent signal obtains discharging.At this moment the fluorescence detection system just can detect optical density(OD) increases to some extent.Template is whenever duplicated once, just has a probe to be cut off, and with the release of a fluorescent signal.Because d/d fluorophor number and PCR product quantity are man-to-man relations in theory, and optical density(OD) is also proportional with the number of the fluorophor that discharges, so this technology can be carried out accurately quantitatively template.Efficient is higher more in short-term owing to amplified production, so amplification length is generally 50-150bp.
The TaqMan-MGB fluorescent probe is compared with conventional TaqMan fluorescent probe, and two main differences are arranged: the one, probe 3 ' end mark self non-luminous quench fluorescence molecule, to replace the fluorescent mark that routine can be luminous.This reduces the fluorescence background, and fluorescence spectrum resolving power is improved greatly.The 2nd, probe 3 ' end combines the MBG binding substances in addition, makes the Tm value raising of probe, has increased the hybrid stability of probe greatly, makes that the result is more accurate, resolving power is higher, and probe design generally should meet following condition: (1) GC base contents is at 40%-60%; (2) avoid continuous repetition, the especially G of mononucleotide sequence; (3) avoid 5 ' end for G,, make the C number as far as possible more than G because G has restraining effect to fluorescence; (4) length should be about 15-25 base, to guarantee the bonded specificity; (5) the Tm value of probe exceeds about 10 ℃ at least than the Tm value of primer.In addition, probe and primer can not form dimer, and position and upstream primer are approaching as far as possible but not overlapping.
The present invention compared with prior art has the following advantages:
1, can infect and vaccine immunity carry out differential diagnosis wild-type classical swine fever virus, solved can not get rid of the immune vaccine band during clinical sample detects the false positive problem;
2, specificity is good, and the dual control of high specific hybridization by high specific amplified of primer and fluorescent probe has very high accuracy, and false positive is low;
3, highly sensitive, reaction process is monitored in real time by fluorescence detecting system, and fluorescence detecting system has very high detection sensitivity to fluorescent signal;
4, detection speed is fast, and only 1 hour, add the extraction of nucleic acid and the preparation of cDNA, need 2-3 hour altogether;
5, there is not aftertreatment, need not hybridization, electrophoresis, process such as take pictures, all reagent all are once to increase, and need not uncap, and do not produce pollution.
Description of drawings
Fig. 1 is that 10 times of gradient dilutions of standard substance carry out the resulting amplification curve of quantitative fluorescent PCR.X-coordinate is represented cycle number, and ordinate zou is represented fluorescence intensity, and the parallel and straight line principle X-coordinate is represented the fluorescence threshold values among the figure.
Fig. 2 is that 10 times of gradient dilutions of standard substance carry out the resulting amplification curve of quantitative fluorescent PCR.X-coordinate is represented copy number, and ordinate zou is represented cycle number.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be appreciated that these examples only to be used to the present invention is described and be not used in restriction the scope of protection of present invention.
The fluorescent quantitative PCR rapid diagnosis reagent box that special detection wild-type classical swine fever virus infects is formed and preparation
1. reagent is formed:
Trizol RNA lysate is an Invitrogen company product; Taq enzyme (5U/ μ l), dNTPs (10mM), MgCl
2(25mM), M-MLV enzyme (50U/ μ l) is all available from Promega company; The PCR primer is synthesized by the living worker in Shanghai bio-engineering corporation FCSFV and RCSFV, quantitative criterion product primer; The Taqman-MGB probe is synthetic by last sea base health bio-engineering corporation; Pestivirus suis crossdrift standard strain is preserved by this laboratory.
2. reagent preparation:
A) inverse transcription reaction liquid: 1 * RT Buffer, dNTPs 0.5mM, M-MLV enzyme 50U, primer RCSFV 0.4 μ M; Primer RCSFV wherein, its sequence is 5 '-TGCCCACAGTAGGACTAGCAAAC-3 ' 23nt;
B) fluorescent quantitation reaction solution: 1 * PCR Buffer, MgCl
24mM, dNTPs 0.5mM, Taq enzyme 2U, each 0.2 μ M of primers F CSFV and RCSFV, fluorescent probe PCSFV 0.2 μ M; Wherein upstream primer FCSFV sequence is: 5 '-TGCCCACAGTAGGACTAGCAAAC-3 ' 23nt; Downstream primer RCSFV sequence is: 5 '-CAGGACTTAGACCACCCAGGG-3 ' 21nt; Fluorescent probe PCSFV sequence is 5 '-TCGCCACTACGGCTAG-3 ' 16nt, fluorescent probe PCSFV 5 ' end mark be fluorescence report group FAM, 3 ' end mark is non-fluorescent quenching group, other mark of 3 ' end the MGB binding substances;
C) wild-type classical swine fever virus strong positive and critical positive quality control product: the Pestivirus suis crossdrift strain of the high titre propagation that on the PK15 cell, goes down to posterity, standby after the deactivation.Critical positive quality control product is that the wild-type classical swine fever virus strong positive is through 10
3Make after the dilution;
D) negative quality control product: gather healthy and each tissue of pig that do not have cause of disease, added PBS liquid in 1: 5 by volume, fully homogenate fragmentation, centrifugal removal precipitation, supernatant (being negative quality control product) is preserved standby;
E) quantitative criterion product: quantitative criterion product primer is diluted to 10 through aqua sterilisa
6, 10
5, 10
4Copy number/μ l is preserved standby.
F) provide reagent for oneself: 75% ethanol of the sterilization distilled water that chloroform, Virahol, DEPC are handled, the sterilization distilled water preparation handled with DEPC.
Embodiment 2
The using method of the fluorescent quantitative PCR rapid diagnosis reagent box that special detection wild-type classical swine fever virus infects
1, the processing of sample
A) tested sample is a tissue sample: get sample 50-100mg to be checked in the homogenizer of cleaning, sterilization and oven dry, add PBS liquid with 1: 5 volume ratio, fully homogenate, the centrifugal 10min of 4000rpm, get 100 μ l supernatant liquors (each reaction) and change in the aseptic 1.5ml centrifuge tube, number standby;
B) tested sample is liquid sample (as: whole blood, serum, a nose swab etc.), directly gets 100 μ l to change in the aseptic 1.5ml centrifuge tube, numbers standby.
2, the extraction of tested sample rna
Get the 1.5ml centrifuge tube of n sterilization, wherein n to be the test sample number contrast with the contrast of wild-type classical swine fever virus strong positive, critical positive quality control product and negative quality control product and; Every pipe adds tested sample, the contrast of wild-type classical swine fever virus strong positive, critical positive quality control product and each 100 μ l of negative quality control product contrast respectively, adds 500 μ l RNA lysates more respectively, and fully mixing leaves standstill 5min; Add 100 μ l chloroforms again, vibration mixing, 4 ℃ of centrifugal 15min of 12000rpm; Draw supernatant to another centrifuge tube, add isopyknic Virahol, ice bath 15min, 4 ℃ of centrifugal 10min of 12000rpm; Abandon most supernatant, add 1ml 75% ethanol, mixing, 4 ℃ of centrifugal 10min of 12000rpm thoroughly abandon supernatant.Behind the precipitation Air drying 5min, be dissolved in the sterilization distilled water that 20 μ l DEPC handled, promptly get the RNA template;
3, the synthetic cDNA of reverse transcription reaction
Get the RNA 18 μ l of the 2nd step gained, hatch 5min for 85 ℃, put 5min on ice rapidly, add inverse transcription reaction liquid 7 μ l then, 42 ℃ of temperature are bathed reaction 30min (carrying out reverse transcription reaction), and water-bath is warmed to 95 ℃ of reaction 5min (termination reverse transcription reaction) again, and reaction promptly makes the cDNA template after finishing;
4, quantitative fluorescent PCR reaction
Get each 19 μ l of fluorescent quantitation reaction solution respectively, get the cDNA template and the quantitative criterion product (10 of the 3rd step gained
6, 10
5, 10
4Copy number/μ l) each 1 μ l adds different PCR reaction tubess respectively, detects at the enterprising performing PCR of quantitative fluorescent PCR reaction instrument.Cycling condition is: 95 ℃ of pre-sex change 5min; 95 ℃ of 5sec, 60 ℃ of 25sec, amplification 40 each circulation.The program setting of fluoroscopic examination is carried out when each round-robin second EOS, and the detection wavelength is 530nm;
5, the result judges
A) interpretation of result condition enactment
After the loop ends, the utilization instrument carries the software analysis detected result.The circulation thresholding (Threshold Cycle, Ct) setting principle is adjusted according to the noise of instrument situation, is as the criterion with the vertex of Ct value line just above normal negative sample amplification curve;
B) quality control standard
Negative control does not have the Ct value and does not have amplification curve;
The Ct value of positive control should about 20, typical amplification curve should and appear about 30 in weak positive control Ct value.Otherwise it is invalid that experiment this time is considered as.
C) result judges
Negative findings is judged: no Ct value, and do not have typical amplification curve;
Positive findings is judged: the Ct value is less than 35, and typical amplification curve occurs.Viral level is converted by the standard substance relative quantification and draws;
The experiment gray area: Ct value is greater than 35, and the sample suggestion that typical amplification curve occurs is reformed.The result that reforms the Ct value occurs and typical amplification curve person is positive, otherwise negative.
The application of the fluorescent quantitative PCR rapid diagnosis reagent box that special detection wild-type classical swine fever virus infects
1, sensitivity test
Standard substance (1.0 * 10 with 10 times of serial dilutions
1～1.0 * 10
7Copy/μ l) as template, on quantitative real time PCR Instrument, detects, obtain PCR in real time amplification curve and typical curve and see accompanying drawing 1 and accompanying drawing 2 respectively.Accompanying drawing 1 shows, when standard plasmid concentration 〉=10 copy/μ l, kinetic curve is in rising trend, therefore, the detection sensitivity of this method is that (this detection sensitivity is the cDNA template concentrations of tested sample to 10 copy/μ l, as to be scaled test sample concentration should be 2.5 * 10
3Copy/ml).Accompanying drawing 2 shows that the linearity range of this method detection by quantitative is 1.0 * 10
1～1.0 * 10
7Copy/μ l, coefficient R=0.999.
2, specificity test
The fluorescent quantitative PCR rapid diagnosis reagent box that adopts special detection wild-type classical swine fever virus to infect carries out the specificity test to Pestivirus suis HCLV vaccine strain, bovine viral diarrhea virus (BVDV), PRV (Pseudorabies virus) (PRV), Schweineseuche virus (FMDV), pig breeding with dyspnoea syndrome virus (PRRSV), pig japanese b encephalitis virus (JEV), pig circular ring virus II type (PCV II), and is all negative to the detected result of above-mentioned 7 kinds of viruses.In addition, all negative to the various tissue detection results of PK-15 cell, water and SPF pig.Above result proves that fully this test kit has excellent specificity in the detection of clinical sample.
Strong arsenic bloom door strain of Pestivirus suis standard and the wild poison of the local separation of other 5 strains are detected, and detected result is all positive.It is good that preliminary this method of proof detects adaptability to wild strains of classical swine fever virus.
3, replica test
Repeatability detected between the viral sample of getting 3 parts of different titers levels was organized, and obtained table 1, calculated to such an extent that the between-group variation factor beta value of repeated detection is respectively %, %, %, all less than 5%, proved that this detection method has excellent specificity.
Repeatability detects the virus titer result between the group of table 1 sample
A: circulation thresholding
B: mean CT-number
C: sample concentration (copy/μ l)
SEQUENCE?LISTING
＜110〉Animal Husbandry and Veterinary Inst., Hubei Academy of Agricultural Sciences (C
＜120〉a kind of fluorescent quantitative PCR rapid diagnosis reagent box and application method thereof of special detection wild-type classical swine fever virus infection
<160>4
<210>1
<211>70
<212>DNA
＜213〉Pestivirus suis (Classical Swine Fever Virus)
<400>1
tgcccacagt?aggactagca?aacggaggga?ctagccgtag?tggcgagctc?cctgggtggt 60
ctaagtcctg 70
<210>2
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉relatively design according to the Pestivirus suis nucleotide sequence, be used to detect the specific primer sequence that wild-type classical swine fever virus infects
<400>2
tgcccacagt?aggactagca?aac 23
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<220>
＜223〉relatively design according to the Pestivirus suis nucleotide sequence, be used to detect the specific primer sequence that wild-type classical swine fever virus infects
<400>3
caggacttag?accacccagg?g 21
<210>4
<211>16
<212>DNA
＜213〉artificial sequence
<220>
＜223〉relatively design according to the Pestivirus suis nucleotide sequence, be used to detect the specificity fluorescent probe that wild-type classical swine fever virus infects, 5 '
That hold mark is fluorescence report group FAM, 3 ' what hold mark is non-fluorescent quenching group;
<400>4
tcgccactac?ggctag 16
Claims (5)
1. fluorescent quantitative PCR rapid diagnosis reagent box that special detection wild-type classical swine fever virus infects, it is characterized in that this test kit comprises: a) RNA lysate, b) inverse transcription reaction liquid, c) fluorescent quantitation reaction solution, d) wild-type classical swine fever virus strong positive and critical positive quality control product, e) negative quality control product and f) the quantitative criterion product, inverse transcription reaction liquid contains primer RCSFV, and its sequence is 5 '-TGCCCACAGTAGGACTAGCAAAC-3 ' 23nt; The fluorescent quantitation reaction solution contains upstream primer FCSFV and downstream primer RCSFV and fluorescent probe PCSFV, and upstream primer FCSFV sequence is: 5 '-TGCCCACAGTAGGACTAGCAAAC-3 ' 23nt; Downstream primer RCSFV sequence is: 5 '-CAGGACTTAGACCACCCAGGG-3 ' 21nt; Fluorescent probe PCSFV sequence is 5 '-TCGCCACTACGGCTAG-3 ' 16nt, that fluorescent probe PCSFV 5 ' holds mark is fluorescence report group FAM, 3 ' what hold mark is non-fluorescent quenching group, 3 ' end other mark the MGB binding substances, described quantitative criterion product are synthetic long-chain primers, and its sequence is CAGGACTTAGACCACCCAGGGAGCTCGCCACTACGGCTAGTCCCTCCGTTTGCTAG TCCTACTGTGGGCATGGCTAGCCCAGTTCGGCCGTCGCTG.
2. press the fluorescent quantitative PCR rapid diagnosis reagent box that the described a kind of special detection wild-type classical swine fever virus of claim 1 infects, it is characterized in that described inverse transcription reaction liquid is by 1 * RT Buffer, dNTPs 0.5mM, M-MLV enzyme 50U and primer RCSFV0.4 μ M form.
3. the fluorescent quantitative PCR rapid diagnosis reagent box that infects by claim 1 or 2 described a kind of special detection wild-type classical swine fever virus is characterized in that the fluorescent quantitation reaction solution is by 1 * PCR Buffer, MgCl
24mM, dNTPs 0.5mM, Taq enzyme 2U, each 0.2 μ M of primers F CSFV and RCSFV and fluorescent probe PCSFV 0.2 μ M form.
4. press the fluorescent quantitative PCR rapid diagnosis reagent box that claim 1 or 2 described a kind of special detection wild-type classical swine fever virus infect, it is characterized in that the Pestivirus suis crossdrift strain that described wild-type classical swine fever virus strong positive is high titre, its propagation that goes down to posterity on the PK15 cell obtains through after the deactivation; Critical positive quality control product is that the wild-type classical swine fever virus strong positive is through 10
3Make after the dilution.
5. press the fluorescent quantitative PCR rapid diagnosis reagent box that claim 1 or 2 described a kind of special detection wild-type classical swine fever virus infect, it is characterized in that described negative quality control product is to gather healthy and each tissue of pig that do not have cause of disease, added PBS liquid in 1: 5 by volume, fully homogenate fragmentation, centrifugal removal precipitation, supernatant is preserved standby.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100485168A CN101328506B (en) | 2008-07-24 | 2008-07-24 | Fluorescent quantitative PCR rapid diagnosis reagent kit for specific detection of classical swine fever virus wild virus infection and its application method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100485168A CN101328506B (en) | 2008-07-24 | 2008-07-24 | Fluorescent quantitative PCR rapid diagnosis reagent kit for specific detection of classical swine fever virus wild virus infection and its application method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101328506A CN101328506A (en) | 2008-12-24 |
| CN101328506B true CN101328506B (en) | 2010-11-03 |
Family
ID=40204514
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008100485168A Expired - Fee Related CN101328506B (en) | 2008-07-24 | 2008-07-24 | Fluorescent quantitative PCR rapid diagnosis reagent kit for specific detection of classical swine fever virus wild virus infection and its application method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101328506B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101812539B (en) * | 2009-12-03 | 2012-07-04 | 中国兽医药品监察所 | Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof |
| CN101900731B (en) * | 2010-08-05 | 2012-12-26 | 中国兽医药品监察所 | ELISA kit for distinctively detecting antibodies of classical swine fever (CSF) vaccine immunity and wild virus infection and preparation method thereof |
| CN102212617B (en) * | 2011-05-16 | 2013-04-10 | 北京世纪元亨动物防疫技术有限公司 | Primer pair, probe and kit for detecting classical swine fever virus wild strain |
| CN102676690B (en) * | 2011-10-31 | 2013-12-18 | 武汉大学 | Reagent kit, method, primers and probe for quantitative detection of nucleic acid of swine fever virus |
| CN102586477B (en) * | 2012-02-15 | 2013-11-13 | 山东省动物疫病预防与控制中心 | Reverse transcription-polymerase chain reaction (RT-PCR) detection for porcine reproductive and respiratory syndrome virus and classical swine fever virus and special primers for same |
| CN105506185A (en) * | 2016-02-17 | 2016-04-20 | 南阳师范学院 | Primers for detecting classical swine fever viruses and fluorescent quantitative RT-PCR detecting method |
| CN111044494B (en) * | 2019-11-26 | 2022-08-23 | 安徽云燕食品科技有限公司 | Rapid detection method for swine fever |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006086377A2 (en) * | 2005-02-09 | 2006-08-17 | Idexx Laboratories | Method of detection of classical swine fever |
| US20060286551A1 (en) * | 2005-06-17 | 2006-12-21 | Animal Health Research Institute, Council Of Agriculture, Executive Yuan | RT-PCR detection for differential diagnosis of field isolates or lapinized vaccine strain of classical swine fever virus (CSFV) in samples |
| CN101058830A (en) * | 2006-08-11 | 2007-10-24 | 中国兽医药品监察所 | Pig pestivirus fluorescence quantitative RT-PCR diagnosis agent kit |
-
2008
- 2008-07-24 CN CN2008100485168A patent/CN101328506B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006086377A2 (en) * | 2005-02-09 | 2006-08-17 | Idexx Laboratories | Method of detection of classical swine fever |
| US20060286551A1 (en) * | 2005-06-17 | 2006-12-21 | Animal Health Research Institute, Council Of Agriculture, Executive Yuan | RT-PCR detection for differential diagnosis of field isolates or lapinized vaccine strain of classical swine fever virus (CSFV) in samples |
| CN101058830A (en) * | 2006-08-11 | 2007-10-24 | 中国兽医药品监察所 | Pig pestivirus fluorescence quantitative RT-PCR diagnosis agent kit |
Non-Patent Citations (5)
| Title |
|---|
| Yan Li,Jian-Jun Zhao,Na Li,et al..A multiplex nested RT-PCR for the detection and differentiation of wild-type viruses from C-strain vaccine of classical swine fever virus..Journal of Virological Methods.2007, |
| Yan Li,Jian-Jun Zhao,Na Li,et al..A multiplex nested RT-PCR for the detection and differentiation of wild-type viruses from C-strain vaccine of classical swine fever virus..Journal of Virological Methods.2007. * |
| 温国元，万超，潘兹书，等.应用荧光定量PCR技术快速定量检测猪瘟病毒.武汉大学学报（理学版）.2004,50(6),746-750. |
| 温国元,万超,潘兹书等.应用荧光定量PCR技术快速定量检测猪瘟病毒.武汉大学学报(理学版).2004,50(6),746-750. * |
| 陈玉栋,张楚瑜,邹峻煊等.建立快速定量检测猪瘟兔化弱毒苗的荧光定量PCR技术.中国病毒学.2003,18(2),124-128. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101328506A (en) | 2008-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101328506B (en) | Fluorescent quantitative PCR rapid diagnosis reagent kit for specific detection of classical swine fever virus wild virus infection and its application method | |
| CN108300808A (en) | A kind of African hog cholera virus fluorescent PCR detection kit, preparation method and application method | |
| CN107513584B (en) | A kind of five heavy fluorescence quantitative kits detecting enterovirus | |
| CN103045755B (en) | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit | |
| CN112941189B (en) | Primer probe composition and kit for methylation detection of cervical cancer early screening marker ZNF671 gene and use method | |
| CN108504778B (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| CN103131798A (en) | Norovirus real-time fluorescent RT-PCR detection kit and application thereof | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN106048094A (en) | Wild porcine pseudorabies strain and gene-deleted strain dual real-time fluorescence quantification PCR detection kit, primers and probe | |
| CN106399585A (en) | Universal PCR primers and method for detecting group I aviadenovirus and detection kit | |
| CN101775443B (en) | LAMP kit for detecting PRV and preparation method thereof | |
| CN102212617B (en) | Primer pair, probe and kit for detecting classical swine fever virus wild strain | |
| CN109913591A (en) | A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method | |
| CN101812539B (en) | Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof | |
| CN115478120A (en) | Method for simultaneously detecting nodavirus and decapod iridovirus 1 of macrobrachium rosenbergii | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN103725793A (en) | Multiple fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) and application thereof | |
| CN111926110B (en) | African swine fever virus real-time fluorescent PCR amplification primer pair, probe primer and prepared kit | |
| CN101392299A (en) | Equine influenza detection kit and detection method | |
| CN102816865B (en) | H1N1, PRRSV and CSFV quadruple detection kit | |
| CN116024387A (en) | Quadruple fluorescence PCR detection kit for porcine viral diarrhea pathogen and application thereof | |
| CN101440400B (en) | Fluorescent detection kit and method for Streptococcus suis 2 type nucleic acid containing 89K pathogenicity island gene | |
| CN103014180A (en) | Detection primer, probe and detection method of human astrovirus nucleotide | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN102676691B (en) | H1N1, PRRSV and O-FMDV quadruple detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101103 Termination date: 20130724 |