CN101328212A - Cultivating method for improving cotton fiber quality - Google Patents

Abstract

The invention discloses a method for breeding cotton with improved fiber quality. Proteins used by the method are proteins as shown in (a) and (b): (a). proteins which are formed by amino acid sequences shown from a first amino acid residue to a 793rd amino acid residue from the amino terminal in a sequence 2 in a sequence table; and (b). proteins which are derived from the (a) and have the same function, through substitution and/or deletion and/or addition of one or a plurality of amino acid residues of the amino acid sequences shown from the first amino acid residue to the 793rd amino acid residue from the amino terminal in the sequence 2 in the sequence table. The method expresses cobweb proteins in the cotton for the first time, thereby obviously improving the fiber strength of the cotton, improving the fiber quality of the cotton, and providing a novel germplasm material for producing and breeding the cotton. Therefore, the method has important economic use value.

Description

A kind of method of cultivation of improveing cotton fiber quality

Technical field

The present invention relates to a kind of method of cultivation of improveing cotton fiber quality.

Background technology

Cotton is most important in the world natural fiber crop, has the status that can not be substituted in the mankind's basic necessities of life activity.Along with the raising with people's living standard updated of spinning technique, to cotton fiber quality especially fibre strength have higher requirement (Liu Jinyuan etc., 2000, Botany Gazette, 42:951-955).How when improving output of cotton, the fibres modified quality has become the cotton breeding person to concentrate the problem of paying close attention to as early as possible.Because fibrous quality and output present negative correlation in heredity, rely on merely traditional breeding method improve synchronously significantly within a short period of time cotton fiber quality and output quite difficult (Zhang Tianzhen, the cotton journal, 2000,12:321-326).Engineered developing into is provided by the chain opportunity that provides of this badness, for the approach that provides is provided the orientation that realizes good goal gene, also have the offspring simultaneously and be easy to stablize, advantages such as breeding cycle weak point are expected to realize the synchronous improvement of cotton fiber quality and output.Adopt agrobacterium-mediated transformation that nptII gene and CAT gene are imported in the upland cotton kind jade-like stone word 312,310 from people's reported first such as Umbeck in 1987, obtained the first strain transgene cotton in the world.Afterwards, the progress of the research and development of cotton gene engineering is very rapid.At present, successfully cultivated pest-resistant (Perlak et al., Plant J.2001,27 (6): 489-501), antiweed (Fillatti etal., Proc Belwide Ctton Prod Conf.1989,17-19), colored cotton (Li X, et al., Plant CellRep, 2004,22:691-697.), low gossypol cotton (Sunilkumar et al., PNAS, 2006,103:18054-18059) with commentaries on classics polyhydroxybutyrate (PHB) synthase gene (John and Keller, Proc Natl Acad Sci USA.1996a 93:12768-12773) waits transformed variety.These transgene cottons are reducing production costs and are protecting and played very important effect aspect the environment, and have satisfied the requirement of people to natural characteristics such as colored cotton and fiber insulations to some extent; Simultaneously show that also it is feasible that foreign gene efficiently expresses in cotton.At present, obtaining major progress aspect the cotton breedings such as pest-resistant, anti-weeding, disease-resistant, degeneration-resistant border, but making slow progress aspect the research of high quality cotton and the breeding work, relevant molecular biology and genetically engineered research are then at the early-stage.Therefore, the genetically engineered research of fiber production and quality-improving becomes the focus and the difficult point of domestic and international cotton research.Utilize genetically engineered fibres modified quality that two Basic Ways are arranged: the one, isolation identification goes out and the closely-related gene of fibrous quality, it is imported cotton, increase or suppress the expression level of some protein relevant or enzyme with cotton fiber quality, thus the quality of fibres modified; The 2nd, from other species, select potential goal gene, it is imported cotton, to improve quality of fibre.Because the molecule mechanism that cotton fiber grows is still very unclear, is not cloned into the goal gene directly related with the cotton fiber yield and quality as yet.Therefore, by in cotton fiber, expressing suitable foreign gene, be at present the main path by genetically engineered improvement cotton fiber yield and quality (John and Keller, ProcNatl Acad Sci USA.1996,93:12768-12773).Cotton fiber strength is to yarn qualities and the bigger proterties of finished product properties influence thereof, and the inferior major reason of raw cotton fiber that China produces is exactly that fibre strength is on the low side.Therefore, the improvement of fibre strength is the main direction that improves China's raw cotton quality.

The spider traction fiber that the good reputation of " biological steel " is arranged is the micro-fibril based on fibrous protein that is produced by spider master ampulla gland, it is incorporated into high Zhang Qiangdu and snappiness all over the body rumly, be the best natural protein fibre (Osaki of nature mechanical property, Int J Biol Macromol, 1999,24:283-287).In numerous spider silks, the traction fiber of spider (spider dragline) especially makes one notice, it draws II (Kevlar II than nylon-6, Kev on physicalies such as intensity, elasticity, energy-to-break, be used for making the material of flak jackets) all high (Gosline et al., J Exp Biol.1999,23:3295-3303).Therefore, the spider traction fiber has and application prospects in fields such as weaving, medical treatment, military affairs, space flight, navigation, buildings.The protein amino acid sequence analysis discloses traction fiber and has two kinds of height multiple protein ingredients at least, and every kind of proteic repeating unit all demonstrates and is rich in the L-Ala zone and is rich in glycine zone alternative modular structure feature.Be rich in the L-Ala zone and mainly be folded into β-sheet, and then can be grouped to microcrystal, give the traction fiber high strength; And the GPGXX motif that is rich in the glycine zone can form β-turn, placed in-line β-turn has further formed β-spiral structure again, and the spirane structure of this spring-like may be given traction fiber with elasticity (Beek et al, PNAS, 2002,99:10266-10271).Traction fiber is exactly with such two kinds of protein components [spider silk fibroin I (SpidroinI at least, MaSP-I) and spider silk fibroin II (Spidroin II, MaSP-II)] a kind of protein fibre with hierarchical organization that forms for core, both combinations have constituted the special performance that fiber had.

The Partial cDNA of traction fiber is cloned and is identified, the same with many scleroproeins, drag in 2 kinds of protein of silk and all contain height multiple structural unit, the repeating unit of MaSP-I contains 2 β lamellas and 1 αLuo Xuanjiegou, and MaSP-II contains 1 β lamella and 2 βZhuan Jiao structure (Xu and Lewis, Proc Natl Acad Sci USA.1990,87:7120-7124).At present, utilization clone or synthetic spider's thread protein gene not only can be at intestinal bacteria (Prince et al., Biochem.1995, (34): 10879-10885) and yeast (Fahnestock and Bedzyk, Appl MicrobiolBiotech.1997, express 47:33-39), and can be at animal cell line (Lazaris et al., Science.2002,295 (5554): 472-476), tobacco and potato (Scheller et al., Nat Biotech.2001,19:573-577) and Arabidopis thaliana (Yang et al., Transgenic Research 2005,14:313-324) the middle expression.Although these researchs all are in order to produce spider's thread protein, rather than in order to change the specific trait of genetically modified organism, these researchs are laid a good foundation for spider's thread protein efficiently expressing in other biology.Wherein, proteic expression of spider traction fiber and molecular weight are negative correlation in microorganism and the zooblast; and produce traction fiber albumen as bio-reactor with plant; not only relatively inexpensive; be easy to mass-producing; and transfer-gen plant can efficiently and stably be expressed traction fiber albumen; even when expressing high molecular traction fiber albumen; expressed proteic processing location; thermostability; all uninfluenced (the Schelleret al. of expression amount and consistence; Nat Biotech.2001; 19:573-577), this shows that plant is to be fit to be used for expressing the proteic bio-reactor of traction fiber.

Agrobacterium-mediated transformation is the optimal method for transformation of dicotyledons, and 80% is to adopt this system in the conversion success example that obtains at present.Compare with other gene transformation methods, agrobacterium-mediated transformation has many advantages: change into the power height, and effective; The foreign gene majority that transforms is single copy, and genetic stability is good, helps the seed selection of isozygotying of transgenic progeny; Transformation mechanism is studied comparatively clearly, and method is the most ripe, and simple to operate, experimental installation is cheap or the like.These advantages make it become the first-selected conversion system of cotton genetic transformation.Document shows that most cotton conversion test adopts this system.Utilize biotechnologys such as genetically engineered to improve the cotton fiber quality characteristic to have become an important channel of cotton fiber quality breeding (John and Keller, Proc Natl Acad Sci USA.1996,93:12768-12773).In the research of transgenic plant, the integration of foreign gene on karyomit(e) is at random, also do not accomplish site-directed integration at present.The copy number that foreign gene is integrated in transgenic plant can be single copy, also can be multiple copied, or multi-copy integration (the forward polyphone that comprises same site repeats or oppositely repeats, or the multi-copy integration on the coloured differently body).But no matter the mode of integrating how, as long as can obtain integrating, has just been finished the effective conversion of foreign gene to plant.

Cotton E6 promotor is mainly expressed (John and Crow in the fiber of 5-28d after cotton blooms, Proc NatlAcad Sci USA.1992,89:5769-5773), be that primary wall forms phase and secondary wall synthesis phase this period, this moment, the E6 promotor instructed foreign gene to express (John and Keller in this period, Proc Natl Acad Sci USA.1996,93:12768-12773).If exogenous genes products can have improving effect to the quality of cotton fiber, the high expression level in this period will exert an influence to the quality of cotton fiber so.

Summary of the invention

An object of the present invention is to provide a kind of albumen, this albumen is the spider's thread protein of having optimized according to the codon preference of cotton, and this albumen can improve the fibrous quality of cotton.

Albumen provided by the present invention is following (a) or protein (b):

(a) protein of forming from the aminoacid sequence shown in N-terminal the 1st to the 793 amino acids residue by sequence in the sequence table 2;

(b) with sequence in the sequence table 2 from the aminoacid sequence shown in N-terminal the 1st to the 793 amino acids residue through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical function by (a) deutero-protein.

Above-mentioned proteic encoding gene also belongs to protection scope of the present invention.

Described proteic encoding gene can be following 1) or 2) or 3) gene:

1) its nucleotide sequence be in the sequence table sequence 1 from 5 ' dna molecular shown in terminal the 1st to 2379 Nucleotide;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

3) with 1) dna sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.

The recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain above-mentioned arbitrary described gene also belong to protection scope of the present invention.

Wherein, described recombinant expression vector can be by sequence in the sequence table 1 is obtained from the multiple clone site that the dna sequence dna shown in 5 ' terminal the 1st to 2379 Nucleotide inserts expression vector pPZP111.

Another object of the present invention provides a kind ofly cultivates that fibrous quality is improved or the method for the cotton of improveing.

The method of the cotton that cultivation fibrous quality provided by the present invention improves is that above-mentioned any recombinant expression vector is imported in the cotton cells, cultivates and obtains the cotton that fibrous quality improves.

Wherein, described fibrous quality is specifically as follows fibre strength.

The present invention is according to cotton codon-bias rule, according to spider's thread protein gene M aSP-I that delivers and the sequence signature of MaSP-II, synthesized spider's thread protein SPIII gene, by agrobacterium-mediated transformation with cotton fiber specific promoter E6 Drive Optimization the spider's thread protein gene import in cotton 14 genomes in upland cotton Ji, make its specifically expressing in cotton.Experiment shows, changes the cotton T that the present invention optimizes protein coding gene over to ₀Generation single copy strain series fiber fracture specific tenacity has improved 12.18% and 9.75%, T than two unconverted negative control cottons respectively ₂Fibre strength for non-homozygous lines has improved 7.12-13.69% than unconverted cotton; The cotton fiber strength of homozygous lines CTC-H8 has improved 11.06% than unconverted cotton, and relative crystallinity has improved 15.37%.Compare with unconverted cotton, the transgenic progeny cotton fiber strength is significantly improved, and the increase of the increase of transgenosis fibre strength and relative crystallinity has consistence preferably.Therefore, the present invention makes spider's thread protein express in cotton first, and has improved the intensity of cotton fiber, has improved the quality of cotton fiber, and the breeding of producing and improve cotton fiber quality for the cotton high-quality provides new germplasm materials.Therefore, the present invention has important Economic Application value.

Description of drawings

Fig. 1 is the structural representation of recombinant vectors pPZP111-E6-20SPI-II-CSP-6HIS-Tnos.

Fig. 2 is the cotton plants regenerated process that changes the spider's thread protein gene over to.

Fig. 3 changes the T of SPIII gene for part ₀Plant PCR detected result.

Fig. 4 changes SPIII gene T for part ₀Plant Southern hybridization analysis result.

Fig. 5 is the expression of recombinant spider silk protein 5SPIII.

Fig. 6 is the purifying of recombinant spider silk protein 5SPIII.

Fig. 7 measures for the 5SPIII antiserum titre.

Fig. 8 is the RT-PCR and the Western blot result of different transgenic lines and wild-type.

Fig. 9 is for changeing the T of SPIII gene ₀Compare for cotton fiber and control fiber length.

Figure 10 analyzes for RT-PCR and the Western blot of the cotton homozygous lines CTC-H8 of commentaries on classics SPIII gene.

Figure 11 compares for the cotton homozygous lines and the control fiber length of changeing the SPIII gene.

Figure 12 is for changeing the infrared spectrogram of SPIII gene cotton homozygous lines and control fiber element.

Figure 13 is for changeing the immuno-electron microscope result of SPIII gene cotton homozygous lines and contrast.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

(1) substratum of using in the experiment is composed as follows:

(1) LB substratum: 1% tryptone, 0.5% yeast extract, 1%NaCl, pH7.0, solid medium add 1.5% plain agar.

(2) YEP substratum: 1% tryptone, 1% yeast extract, 0.5%NaCl.Solid medium adds 1.5% plain agar.

(3) cotton tissue is cultivated and the genetic transformation substratum:

The substratum title	Medium component
		Minimum medium	MSB (MS inorganic salt+B5 is organic)
The seed germination substratum	MSB+Sugar 20g/L+Agar 6.5g/L pH 6.0
		The callus of induce substratum	MSB+IBA 1.0mg/L+KT 0.25mg/L+Glucose 30g/L+Gelrite 2.5g/L pH5.8
The embryo callus subculture inducing culture	MSB(1/2NH 4 +)+KNO 31.9g/L+IBA 0.5mg/L+KT 0.25 mg/L+Glucose 30g/L+Gelrite 2.5g/L pH5.8
		Be total to culture medium	MSB+IBA 1.0mg/L+KT 0.5mg/L+Glucose 30g/L+Gelrite 2.5 g/L+Ac 1.0g/L+As100μM pH5.4
The callus screening culture medium	MSB+IBA 1.0mg/L+KT 0.5mg/L+Glucose 30g/L+Gelrite 2.5 g/L+Ac 1.0g/L+Cef 250mg/L+Kan 50mg/L pH5.8

The embryo callus subculture screening culture medium	MSB(1/2NH 4 +)+KNO 3 1.9g/L+IBA 0.5mg/L+KT 0.25 mg/L+Glucose 30g/L+Gelrite 2.5g/L+Cef 200mg/L+Kan 50 mg/L pH5.8
		The fluid suspension culture base	MSB(1/2NH 4 +)+KNO 3 1.9g/L+KT 0.1mg/L+Glucose 15 g/L+Sugar10g/L+Cef 200mg/L+Kan 50mg/L pH5.8
Body embryo maturation medium	MSB(1/2NH 4 +)+KNO 31.9g/L+KT 0.1mg/L+Glucose 15g/L+Sugar 10g/L+Gelrite 2.5g/L+Cef 200mg/L+Kan 50mg/L pH5.8
		Body embryo elongation medium	MSB(1/2NH 4 +)+KNO 3 1.9g/L+Glucose 15g/L+Sugar 10 g/L+Gelrite 2.5g/L+Cef 200mg/L+Kan 50mg/L pH5.8
Become seedling substratum SH	SH+Sugar 20g/L+Gelrite 2.8g/L+Ac 0.5g/L pH 6.4

MS：Murashige & Skoog，1962，Physiol Plant 15：473-479.；B5：Gamborg，Experimental Cell Research，1968，50(1)：151-158；Gelrite：Sigma，St Louis，MO，USA；SH：Schenk & Hildebrandt，Can.J.Bot.1972，50，1999-2004。

(2) main solution formula

1, Southern detects

DNA extraction damping fluid: 100mM Tris-HCl (pH8.0), 20mM EDTA (pH8.0), 1.5M NaCl, 2%CTAB, 4% solvable polyvinylpyrrolidone (PVP) and 2% beta-mercaptoethanol (β-ME) use preceding the adding.TE：10mMTris-HCl pH8.0，1mM EDTA。1 * TAE electrophoretic buffer: 40mM Tris-acetate, 1mM EDTA.Southern changes film sex change liquid: 0.4M NaOH, 1.0M NaCl.Southern changes the film neutralizer: 0.5M Tris-Cl (pH7.2), 1.0M NaCl.20 * SSC:3M NaCl, the 0.3M Trisodium Citrate.50 * Denhardt ' s:1% glycan body, 400 (Ficoll400), 1%PVP, 1% bovine serum albumin (BSA).Prehybridization solution: 6 * SSC, 0.5%SDS, 5 * Denhardt, 0.1mg/ml salmon sperm DNA.Film washing liquid I:2 * SSC, 0.1%SDS.Film washing liquid II:0.5 * SSC, 0.1%SDS.Film washing liquid III:0.1 * SSC, 0.1%SDS.Developing solution: 0.22% N-methyl p-aminophenol sulfate, 0.88% Resorcinol, 0.4% Potassium Bromide, 7.2% sodium sulphite anhydrous 99.3,4.8% anhydrous sodium carbonate is sequentially added into dissolving.Stop shadow liquid: 0.3% Glacial acetic acid.Stop bath: 24% Sulfothiorine, 1.5% sodium sulphite anhydrous 99.3,1.34% Glacial acetic acid, 1.5% aluminium potassium powder is sequentially added into dissolving.

2, employed solution during Western detects

(1) protein extract: 100mM Tris-HCl pH 8.65,2%SDS adds before 30%sucrose and 2% β-ME uses.

(2) western blotting immunoassay damping fluid, reagent

A liquid: acrylamide storage liquid: acrylamide 87.6g, methylene bisacrylamide 2.4g adds sterilized water to 300ml, is stored in brown bottle after the filtration, and 4 ℃ keep in Dark Place.

B liquid: separation gel damping fluid: 1.5mol/LTris-HCl (pH8.8): Tris alkali 18.15g, add aqua sterilisa 60ml, transfer pH8.8 with 1mol/LHCl, be settled to 100ml.Filter back 4 ℃ of preservations.

C liquid: concentrate glue damping fluid: 0.5mol/L Tris-HCl (pH6.8): Tris alkali 6.0g, add aqua sterilisa 60ml, transfer pH6.8 with 1mol/LHCL, be settled to 100ml.Filter back 4 ℃ of preservations.

(annotate: these two kinds of damping fluids of B and C must use the preparation of Tris alkali, regulate the pH value with HCl again, and without Tris.Cl.)

D liquid: 10% (w/v) SDS: sodium lauryl sulphate 10g adds aqua sterilisa 100ml, room temperature preservation.

TEMED original solution: N, N, N ' N ' Tetramethyl Ethylene Diamine catalysis ammonium persulphate forms free radical and quickens the polymerization of two kind of third rare acid amides.

Ammonium persulfate solution (APS): 10% (w/v), deionized water face and use preceding preparation.

Sample-loading buffer: 5 * 80ml:0.5mol/L Tris damping fluid (pH6.8) 10ml, glycerine 8ml, 10%SDS 16ml, mercaptoethanol 4ml, 0.05% (w/v) tetrabromophenol sulfonphthalein 2ml, aqua sterilisa 40ml.

Tris-glycine electrophoretic buffer: 5 * 500ml:Tris alkali 7.5g, glycine 36g, SDS 2.5g, with dissolved in distilled water to 500ml.Face with 5 times of preceding dilutions.

Transferring buffered mother liquor (not containing methyl alcohol): 10 * 500ml:Tris alkali 15.15g, glycine 72g is with being settled to 500ml (natural pH) behind the dissolved in distilled water.4 ℃ of preservations are faced with 10 times of preceding dilutions.

Transfering buffering liquid: (25mmol/L Tris, 192mmol/L glycine, 20% methyl alcohol) 1 * 1000ml: transferring buffered mother liquor (10 *), 100ml; Anhydrous methanol: 200ml; Be settled to 1000ml with distilled water, 4 ℃ of preservations.

TBS damping fluid (20mmol/L Tris-HCl (pH7.5), 500mmol/L NaCl): 0.5mol/L Tris-HCl (pH7.5), 40ml; NaCl:8.18g; With being settled to 1000ml behind the dissolved in distilled water.

Sealing damping fluid: TBS damping fluid 100ml, skim-milk 5g.

One anti-hybridization solution: TBS damping fluid 20ml, first antibody: 2.5 μ l.

Two anti-hybridization solutions: TBS damping fluid 20ml, second antibody: 1.0 μ l.

TTBS damping fluid: TBS damping fluid 500ml, Tween 20 250 μ l.

3, employed solution during immuno-electron microscope detects

Electron microscopic sample stationary liquid: 4% Paraformaldehyde 96+0.5% glutaraldehyde (pH7.2, the preparation of 0.1M PBS);

Confining liquid (BL): 1%BSA (pH7.2, the PBS preparation of 0.1M);

One is anti-: BL dilution (1: the 50) antibody (contrast replaces with normal corresponding animal serum) that contains 0.05%Tween 20;

Two is anti-: BL dilution (1: 40) the colloid gold label goat anti-rabbit igg (10nm, Beijing three rich polygala root biotechnology limited liability companys) that contains 0.05%Tween 20

Embodiment 1, change the structure and the checking of cotton plants of the spider's thread protein encoding gene SPIII of optimization over to

One, optimizes the structure of spider's thread protein and encoding gene thereof

1, the structure of the repeat region (SPI-II) of the spider's thread protein encoding gene of You Huaing

(1) according to the sequence signature of the spider's thread protein gene of delivering and the cipher word that cotton is had a preference for, four oligonucleotide (synthetic by Shanghai biotechnology company limited) have been synthesized in design:

SP1(80nt)：AGATCTCAAGGTGCTGGAAGAGGTGGGTTGGGTGGACAGGGCGCAGGTGCAGCTGC-CGCTGCTGCAGCTGAAGGTGCTGG；

SP2(49nt)：GGATCCAAGCCCACCATAGCCACCCTGTCCAGCACCTCCAGCTGCAGCA；

SP3(80nt)：AGATCTGCTGCAGCTGCAGCCGCTGCAGCTGGTCCTGGAGGTTACGGACCAGGTCA-GCAAGGACCTGGTGGATATGGTCC；

SP4(59nt)：GGATCCAGGACCTGAAGGACCTTGCTGTCCTGGACCATATCCACCAGGTCCTTGCT-GAC。

(2) above-mentioned SP1 and SP2, SP3 and SP4 oligonucleotide extend through 72 ℃ of annealing, ExTaq (Takara) respectively, and Bgl II (AGATCT) and BamH I (GGATCC) restriction enzyme site have been introduced in two segment two ends that obtain.This two bar segment is connected respectively between the Bgl II and BamH I site of pGEM-T-vector (Promega company), transformed into escherichia coli DH5 α bacterial strain, according to the ordinary method screening positive clone, identify plasmid and insert fragment, finally obtained to contain respectively the recombinant plasmid of single copy recombinant spider silk protein gene redundancy unit (SPI or SPII), note is made pGEM-1SPI and pGEM-1SPII respectively.

(3) utilize BglII and SacI double digestion pGEM-1SPI and pGEM-1SPII respectively, reclaim small segment, note is made 1SPI and 1SPII; Another group BamH I and Sac I double digestion, reclaim big fragment, two kinds of small segments that will obtain respectively with dna ligase are connected with big fragment, transform DH5 α coli strain, screening positive clone, extract positive plasmid wherein, the recombinant plasmids of the repeating unit of containing two copy spider's thread protein genes that obtains are remembered respectively made pGEM-2SPI and pGEM-2SPII.

(4) utilize the two pGEM-2SPII that cut of two kinds of restriction enzymes of BamHI and SacI, the big fragment of downcutting is connected with the 1SPII fragment of acquisition in (3), transform DH5 α coli strain again, screening positive clone, identify plasmid and insert fragment, obtained to contain the recombinant plasmid of repeating unit (SPII) of the recombinant spider silk protein gene of 3 copies, note is made pGEM-3SPII.

(5) utilize the BamHI enzyme to cut pGEM-2SPI, form open loop, use alkaline phosphatase treatment, the dephosphorization acid groups; With BamHI and BglII double digestion pGEM-3SPII, obtain the fragment of about 0.3kb.Two kinds of fragments that obtain are connected, transform DH5 α coli strain, screening positive clone is identified plasmid and inserts fragment that obtained to contain the recombinant plasmid of the spider's thread protein gene redundancy unit (SPI and SPII) of 5 copies of heterozygosis, note is made pGEM-5SPI-II;

(6) utilize the small segment of BglII and SacI double digestion pGEM-5SPI-II to link to each other with the big fragment of SacI double digestion pGEM-5SPI-II, obtain pGEM-10SPI-II with BamHI.Equally, utilize BglII and SacI pair to cut the pGEM-10SPI-II small segment and link to each other with the big fragment of SacI double digestion pGEM-10SPI-II with BamHI, finally obtained to contain the plasmid of recombinant spider silk protein gene redundancy unit of 20 copies of SPI and SPII heterozygosis, note is made pGEM-20SPI-II.

2, the structure of the non-repeat region (CSP) of recombinant spider silk protein encoding gene

According to spider's thread protein MaSPII carboxyl terminal (C-end) aminoacid sequence of delivering, according to cotton codon-bias rule, design has also made up the non-repeat region (CSP) of recombinant spider silk protein encoding gene, its nucleotide sequence as sequence in the sequence table 1 from shown in 5 ' terminal the 2086th to 2379 Nucleotide.

Specific practice is as follows:

(1) designed 4 oligonucleotide (synthetic by Shanghai biotechnology company limited) according to this section sequence signature, sequence is as follows:

CSP-P1(88nt)：AGATCTCGTCTTGCTTCTCCTGATTCAGGAGCTAGAGTTGCATCAGCTGT-TTCTAACCTTGTATCCAGTGGTCCAACATCATCTGCTG；

CSP-P2(87nt)：TCTAGAAAGACCAGGATTAGATGCACCAATCTGAGACACAGCGTTAGAAA-TAACAGATGAGAGTGCAGCAGATGATGTTGGACCACT；

CSP-P3(85nt)：TCTAGATGTGATGTTCTTATTCAGGCTCTTCTCGAAATCGTTTCTGCTTG-CGTTACAATTCTTTCTTCATCCAGCATTGGTCAGG；

CSP-P4(89nt)：GGATCCGAATGCACTCAAAACGGATTGCCCGACAACTTGGGCAAACTGTG-AGGCCGCTCCATAATTAACCTGACCAATGCTGGATGAAG

(2) above-mentioned CSP-P1 and CSP-P2, CSP-P3 and CSP-P4 oligonucleotide are through 94 ℃ of sex change, 72 ℃ of annealing, ExTaq (Takara) extends, the product that obtains is connected respectively on the pGEM-T-vector (Promega), transform DH5 α coli strain, screening positive clone, identify plasmid and insert fragment, finally obtained to contain the segmental plasmid of different CSP respectively, wherein by the pairing of CSP-P1 and CSP-P2 oligonucleotide and extend the plasmid note that the gained fragment inserts and make pGEM-CSP1, and the pairing of CSP-P3 and CSP-P4 oligonucleotide and extend plasmid that the gained fragment inserts and remember and make pGEM-CSP2.

(3) utilize BglII and PstI double digestion pGEM-CSP1, XbaI and PstI double digestion pGEM-CSP2 to identify and insert segmental size and direction; Verify that with BglII and XbaI double digestion pGEM-CSP1, XbaI and BamHI double digestion pGEM-CSP2 it inserts segmental exactness.

(4) utilize XbaI and PstI double digestion pGEM-CSP1 and pGEM-CSP2, wherein pGEM-CSP1 reclaims the big fragment of carrier, pGEM-CSP2 reclaims about 170bp small segment, big fragment is linked to each other with small segment, connect the product note and make pGEM-CSP, BglII and BamHI enzyme are cut its exactness of checking, and send living worker to check order and identify its exactness.Finally obtained to contain the singly plasmid of the spider's thread protein gene non repetitive sequence (CSP) of copy of design length, note is made pGEM-CSP.

3, the structure of complete recombinant spider silk protein encoding gene

With restriction enzyme BamHI and SacI double digestion pGEM-20SPI-II, reclaim big fragment (SPI-II), it is linked to each other with the CSP fragment of downcutting with BglII and SacI double digestion pGEM-CSP, and acquisition pGEM-20SPI-II-CSP (20SPI-II+CSP) also carries out that enzyme is cut and sequence verification.Wherein, the nucleotide sequence of that optimize, complete recombinant spider silk protein encoding gene as sequence in the sequence table 1 from shown in 5 ' terminal the 1st to 2379 Nucleotide, the aminoacid sequence of encoded protein matter as sequence in the sequence table 2 from shown in terminal the 1st to the 793 amino acids residue of N-terminal.This unnamed gene is recombinant spider silk protein encoding gene SPIII, respective egg white matter called after recombinant spider silk protein SPIII.

Two, the structure that contains the recombinant expression vector of recombinant spider silk protein encoding gene SPIII

1, the clone of cotton fiber specifically-expressed promotor E6

Cotton E6 gene is the gene that high abundance is expressed in the elongate fiber growth course, its promotor is a cotton fiber specific promoter, and application (John ME succeeds in the research of changeing polyhydroxybutyrate (PHB) synthase gene cotton, Keller G.Proc Natl Acad Sci USA.1996,93:12768-12773).This laboratory is according to the sequence of the E6 promotor of the sea island cotton of having delivered, synthetic primer (E6-1:5 '-AAGCTTAAATTATAGCATACCTCACGATGT-3 ' and E6-2:5 '-GGATCCCATGGCTATGGTTGCTAA-TGCT-3 '), and PCR method routinely, from Chinese culture of cotton kind middle cotton amplify the promoter sequence (about 600bp) of E6 gene 12, and HindIII and BamHI restriction enzyme site have been introduced at its two ends, the PCR product is connected on the pGEM-T-vector (Promega company), transformed into escherichia coli bacterial strain JM109 competent cell, screening positive clone, extract recombinant plasmid and identify, the recombinant plasmid note of acquisition is made pGEM-E6.

2, derive from the separation of the terminator Tnos of binary vector pBI121

Tnos is transgenic plant terminators commonly used.Utilize two restriction enzymes of SacI and EcoRI to downcut the Tnos terminator from general binary vector pBI121 well known in the art, and be connected on the pUC18 according to ordinary method, transformed into escherichia coli bacterial strain JM109 competent cell again, screening positive clone, the extraction recombinant plasmid is also identified, obtained to contain the recombinant plasmid of Tnos sequence (276bp), note is made pUC-Tnos.

3, the structure that contains the expression cassette of E6 promotor, SPIII gene and Tnos terminator

According to universal method well known in the art, cut pGEM-E6 with HindIII and two restriction enzyme of BamHI, the E6 promoter fragment that downcuts is connected to HindIII and the BamHI site of carrier pUC18, transformed into escherichia coli bacterial strain JM109 competent cell, screening positive clone, the extraction plasmid is also identified, finally obtained to contain the recombinant plasmid of E6 promoter fragment, and note is made pUC-E6.

Utilize that two restriction enzymes of BamHI and SacI are two cuts pUC-E6, reclaim big fragment; With BglII and the two pGEM-20SPI-II-CSP that cut of two kinds of restriction enzymes of SacI, reclaim the recombinant spider silk protein gene fragment (20SPI-II-CSP) of about 2.4kb again.Two fragments that will be recovered to by universal method couple together then, and conversion JM109 competent cell, screening positive clone, extract recombinant plasmid and carry out the double digestion evaluation, obtained to contain the recombinant plasmid of E6 promotor and recombinant spider silk protein gene fragment (20SPI-II-CSP) expression cassette, note is made pUC-E6-20SPI-II-CSP.

Ordinary method is connected to the Tnos terminator at the 3 ' end in the CSP zone on the pUC-E6-20SPI-II-CSP plasmid.Before connection, adopt round pcr to add the 6 histidine-tagged nucleotide sequences of encoding earlier, and introduced BamH I (GGATCC) restriction enzyme site in its 5 ' upstream at 5 ' of Tnos.Specifically be synthetic two primers (HT-1:5 '-GGA TCC CATCAC CAT CAT CAT CAC TGA GAG CTC GAA TTT CCC CG-3 ' and HT-2:5 '-GAA TTC CCG ATCTAG TAA CAT AGA TGA C-3 '), and PCR method routinely, the Tnos fragment is carried out pcr amplification, acquisition contains the fragment (about 300bp) of 6 Histidine encoding sequences and Tnos sequence, and BamHI and EcoRI restriction enzyme site have been introduced at its two ends, be connected to the site of the BamHI and the EcoRI of pUC18 carrier, and transformed into escherichia coli bacterial strain JM109 competent cell, screening positive clone, the extraction recombinant plasmid is also identified, obtained correct recombinant plasmid, note is made pUC-6HIS-Tnos.Then adopt two kinds of restriction enzymes of BamHI and EcoRI double digestion pUC-E6-20SPI-II-CSP and pUC-6HIS-Tnos respectively, reclaim the big fragment of pUC-E6-20SPI-II-CSP and the 6HIS-Tnos small segment that cuts out from pUC-6HIS-Tnos, then these two fragments are coupled together, transform the JM109 competent cell, screening positive clone, the extraction recombinant plasmid is also identified, the positive recombinant plasmid note that obtains is made pUC-E6-20SPI-II-CSP-6HIS-Tnos, and this plasmid contains the required complete recombinant spider silk protein encoding gene SPIII expression cassette of this experiment.

4, the structure of recombinant spider silk protein encoding gene SPIII conversion carrier

With restriction enzyme HindIII and EcoRI double digestion pUC-E6-20SPI-II-CSP-6HIS-Tnos, obtain about 3.3kb fragment; Open pPZP111 with HindIII and EcoRI double digestion in addition, reclaiming big fragment links to each other with the former, and transformed into escherichia coli bacterial strain DH5 α, the clone who obtains contains the conversion carrier of the recombinant spider silk protein expression casette of optimization, note is made pPZP-E6-20SPI-II-CSP-6HIS-Tnos, and has kalamycin resistance.Carrier structure as shown in Figure 1.

Three, the structure of reorganization Agrobacterium

Agrobacterium is selected agrobacterium tumefaciens (Agrobacterium tumefaciens) strains A GL1 for use.

Used plasmid is pPZP-E6-20SPI-II-CSP-6HIS-Tnos, has kalamycin resistance.

Carrier pPZP-E6-20SPI-II-CSP-6HIS-Tnos is imported Agrobacterium AGL1: carrier pPZP-E6-20SPI-II-CSP-6HIS-Tnos is imported among the Agrobacterium AGL1 by the electric shock conversion method.Utilize kalamycin resistance to screen the reorganization Agrobacterium that obtains containing carrier pPZP-E6-20SPI-II-CSP-6HIS-Tnos, called after reorganization Agrobacterium AGL1/pPZP-E6-20SPI-II-CSP-6HIS-Tnos.

Four, the genetic transformation of cotton

Cotton transformation receptor material is cotton No. 14 of upland cotton (Gossypium hirsutum L.) Ji.This kind is used as the stock of grafting transgenic seedling simultaneously.

(1) acquisition of cotton aseptic seedling and embryo callus

Cotton seeds is peeled off back with 0.1% mercuric chloride (HgCl ₂) sterilization 8-10min, be placed on shaking culture on the shaking table (110rpm) behind aseptic water washing 5-6 time, to treat to be inoculated in when seed shows money or valuables one carries unintentionally on the seed germination substratum, 28 ℃, dark condition are sprouting 5-7d down, to obtain aseptic cotton seedling.Choose the aseptic seedlings hypocotyl of robust growth, the segment that is cut into about 0.5cm is standby.

(2) preparation of cultivation of reorganization bacterium and inoculation bacterium liquid

The reorganization Agrobacterium AGL1/pPZP-E6-20SPI-II-CSP-6HI-Tnos of the plant expression vector that carries the recombinant spider silk protein gene that above-mentioned screening is obtained activates on the YEP solid medium that contains 50mg/L Km and 25mg/L Carb.Choose the single colony inoculation of Agrobacterium and contain in the identical antibiotic YEP liquid nutrient medium in 5ml, 28 ℃, 200rpm shaking culture spend the night.Be transferred to 25ml in 1: 20 ratio in second day and contain in the identical antibiotic YEP liquid nutrient medium, continue to cultivate 3-5h, behind the centrifugal 2min of 6000rpm, thalline is resuspended with liquid MSB (containing 100 μ M Acetosyringene) substratum, adjustment OD ₆₀₀It is 0.5 standby that value is about.

(3) dip-dye and cultivation altogether

The hypocotyl that cuts is put into the Agrobacterium bacterium liquid of adjusting concentration contaminate 10min, the bacterium liquid that inclines is inhaled the bacterium liquid that goes hypocotyl surperficial unnecessary with aseptic thieving paper, and inoculation moves on on the common substratum, cultivates 2d altogether for following 24 ℃ in dark condition.

(4) screening of transformant

After cultivating 2d altogether hypocotyl is transferred on the callus screening culture medium, taken off bacterium and select and cultivate.Culture condition is 27 ± 2 ℃, 16h illumination (2000Lx).Every 3-4 week subculture once.After 1-2 month, some hypocotyls show kalamycin resistance, the two ends otch expand gradually (Fig. 2 A, B), grow resistant calli (Fig. 2 C, D).Choose loose callus and be transferred on the embryonic callus induction substratum and cultivate, every 2-3 week subculture once.Can generate embryo callus (Fig. 2 E) in 1-2 month.Select poor growth, loose, faint yellow, granular embryo callus piece and insert in the fluid suspension culture base, on shaking table 120rpm vibration suspension culture with obtain a large amount of body embryos (Fig. 2 F, G).2 week backs are with 30 eye mesh screens filtration suspension culture, and throw out off the net is transferred and cultivated on the body embryo maturation medium.3-4 is after week, the mature embryo of sprouting is changed on the body embryo elongation inducing culture cultivates, the elongation of inductor embryo, sprout (Fig. 2 H, I, J).4-6 is after week, length is transferred to into seedling substratum SH greater than the sprouting embryo of 0.5cm goes up and cultivate, grow become behind cotyledon and the true leaf regrowth (Fig. 2 K, L).Treat that seedling is long during to about 3cm height (Fig. 2 L), can transplant (Fig. 2 M) or grafting (Fig. 2 N), change over to and cultivate and do further Molecular Detection in the flowerpot, the detected result that obtains positive, have that resistance regrowth of card and be T ₀In generation, transform seedling.

(5) transplanting and grafting

A transplanting selection robust growth, the regeneration plant that root growth is good are used for transplanting.Concrete grammar: the plant that will take root at room temperature tempered for 1 week, then the substratum of root was cleaned, and preserved moisture under the room temperature, was transplanted in the nutrition pot after generating new root, with plastic film plant was covered and preserved moisture, and putting leaks informaton gradually after 1 week of cultivation in the greenhouse in takes down plastic film.Wait to grow to be transplanted in the big flowerpot behind the young leaves and grow.

B grafting transgenosis regeneration cotton is generally all adopted band root method for transplanting, and requires healthy and strong, the well developed root system of regeneration cotton plant.Owing to transplant 1 first quarter moon of the minimum needs of seedling-slowing stage of cotton, to add a little less than many regrowth growths, root system is undeveloped or do not have root system, and therefore, the surviving rate of render transgenic regeneration cotton plant has become a great problem in the cotton genetic transformation.If adopt grafting to address this problem well.Concrete grammar: in native basin, plant stock cotton seedling earlier, when treating that rootstock seedling grows 4-6 sheet true leaf, remove toply, stay unfolded blade 3-5 sheet, earlier with the knife blade osculum that about 2cm grows of in the middle of stem, riving, again the transgenosis cotton plant is removed root, be whittled into wedge type (length 1.7-1.8cm) on stem stalk both sides with scalper, be attached on the rootstock seedling, the grafting mouth is all twined reality with Parafilm, then with plastic film grafting cotton complete stool sealing, leaking informaton gradually behind the 10d takes down plastic film and gets final product.Be transplanted to after Graft survives in the big flowerpot and grow.

Five, T ₀Molecular Biological Detection for transgenic cotton plant

(1) PCR detects

Utilize the non-iteron of recombinant spider silk protein gene (CSP, about 300bp) design primer, primer sequence is as follows: CSP1:GATTCAGGAGCTAGAGTTGCATCAGC; CSP2:CCGACAACTTGGGCAAACTGTGAGG.Picked at random is extracted DNA to the positive plant young leaflet tablet that Kan is the resistance reaction.Genomic dna with extraction is a template, carries out pcr amplification with above-mentioned primer CSP1/CSP2.The PCR reaction system is that 10 * PCR buffer, 2.5 μ l (contain 25mM MgCl ₂), dNTP (2.5mM) 0.25 μ l, each 0.5 μ l of primer (10pmol/ μ l), template DNA 0.5 μ l, Tag enzyme (5U/ μ l) 0.25 μ l adds ddH ₂O is to cumulative volume 25 μ l (the PCR test kit is a TaKaRa company product).The PCR response procedures is: behind 94 ℃ of pre-sex change 5min, and 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s carry out 30 circulations, and 72 ℃ are extended 10min.With the negative contrast of the genomic dna of not successful converting cotton plant, to contain the positive contrast of plasmid pPZP-E6-20SPI-II-CSP-6HIS-Tnos of recombinant spider silk protein gene.

The result as shown in Figure 3.Swimming lane 1 is Marker (DL2000), swimming lane 2 positive contrasts, and swimming lane 3-12 is for changeing SPIII gene T ₀Plant, swimming lane 13 are the Ji cotton 14 that not success transforms, and swimming lane 14 is middle cotton 35 wild-types.The SPIII transfer-gen plant has all amplified a band consistent with positive control, and the non repetitive sequence CSP size that designs in clip size and the recombinant spider silk protein gene is similar, does not then amplify specific band in the adjoining tree that success transforms.Preliminary definite spider's thread protein gene SPIII has been integrated in the cotton plants genome.

(2) Southern hybridization

Cotton seedling to the PCR tests positive further carries out Southern hybridization evaluation.With cotton No. 14 plant in the upland cotton Ji that transforms and the negative contrast of middle cotton 35 plant, make positive control with the non repetitive sequence CSP (being the non-iteron of recombinant spider silk protein gene (CSP) the PCR product that obtains during above-mentioned PCR detects) of recombinant spider silk protein gene.

Hybridize also the non-iteron of recombinant spider silk protein gene (CSP) PCR product of used probe for from above-mentioned PCR detects, obtaining, adopt the random primer labelling test kit of TaKaRa company to use [α- ³²P] dCTP carries out probe mark to above-mentioned DNA.According to improved method of CTAB (Permingeat et al., Plant Mol Biol Reptr.1998,16:1-6) plant and the negative control cotton plants to the PCR tests positive carries out the extraction of total DNA, uses DraI (TaKaRa) that total DNA is carried out enzymolysis then and be used for Southern to hybridize.The Southern hybridization step carries out with reference to " molecular cloning experiment guide " (Sambrook and Russell, 2001, Cold Spring Harbor) and TaKaRa test kit specification sheets.

The Southern results of hybridization of the transgene cotton strain of 9 PCR test positive system as shown in Figure 4, the wherein positive contrast of swimming lane P, swimming lane 0-8 is different commentaries on classics SPIII gene T ₀Plant, swimming lane c1 and c2 are respectively Ji cotton 14 and middle cotton 35 wild-types that not success transforms.All PCR are accredited as the male transgenic cotton plant as seen from the figure all positive hybridization signal, and cotton No. 14 plant in unconverted upland cotton Ji and the equal amixia signal of middle cotton 35 wild-types.Particularly swimming lane 1 and 4 samples have 5 hybrid belts, and all the other swimming lanes all show 1 hybrid belt.Show that recombinant spider silk protein gene SPIII gene successfully is incorporated in cotton 14 genomes in Ji, in 9 transgenic lines, 7 strains are single copy, and 2 strains are that 5 copies insert.

(3) RT-PCR of transfer-gen plant detects

In order to detect the expression of recombinant spider silk protein gene SPIII in the transgene cotton fiber, the expression level of gene SPIII in the transgenic line fiber has been carried out the RT-PCR analysis.Choose 5 T ₀Different transgene cotton strain of generation system (0,1,3,4,5; Wherein 0,3,5 is that single copy inserts, and 1 and 4 is that 5 copies insert) and cotton No. 14 plant in upland cotton Ji (negative control) that transform be used for analyzing as the target plant.

Get strain respectively and be bloom cotton fiber (the sample band seed that wherein preceding 3 samples are the same day, 3 days and the 5 days) sample of the same day, bloom back 3,5,10,15,20,25,30d of cotton, adopt plant RNA out test kit (the damp genetically engineered in the sky company limited of improvement, Mianyang, China) carry out the extraction of RNA, carry out RT-PCR then and analyze.The upstream and downstream primer that is used to detect the analysis of SPIII gene expression dose is respectively CSP1:GATTCAGGAGCTAGAGTTGCATCAGC; CSP2:CCGACAACTTGGGCAAACTGTGAGG.Mark (Zhuet al. in this experiment is done with cotton Histone3 gene (GhHis3), Plant Physiol, 2003,133:580-588), the upstream and downstream primer according to this gene of delivering sequences Design is respectively HIS1:GAAGCCTCATCGATACCGTC and HIS2:CTACCACTACCATCATGGC.

RT-PCR result wherein schemes A as shown in Figure 8: represent different cotton transgenic strain systems and wild-type spend the back 15d the total RNA of fiber, figure B be result's (29 circulations) of GhHis3 gene RT-PCR, figure C be result's (34 circulations) of SPIII gene RT-PCR.Wherein swimming lane 1-5 is respectively different cotton T ₀Transgenic line 0,1,3,4,5, the negative contrast of c).It is that SPIII expression of gene amount is higher in 0,3,5 the transgene cotton fiber that the result shows in the strain of single copy, and be that faint expression is only arranged in 1 and 4 in the multiple copied strain, in not genetically modified wild-type fiber of phase contemporaneously, then do not detect SPIII genetic expression.

(4) the Western blot of transfer-gen plant detects

1,5SPI-II recombinant spider silk protein prokaryotic expression and Antibody Preparation

(1) structure of expression vector:

1), and reclaims small segment with Bgl II and the two pGEM-5SPI-II plasmids of cutting of SacI;

2) cut pET-32a (+) plasmid with BamHI and SacI are two, and reclaim big fragment;

3) with step 1) and step 2) respective segments be connected, be built into expression vector pET32-5SPI-II.

(2) abduction delivering of recombinant protein and purifying:

With the heat shock method pET32-5SPI-II is transformed in the expression strain e. coli bl21, and adopts PCR and sequential analysis to identify.With identifying correct bacterial strain bed board picking clone, contain in the screw socket pipe of LB substratum of 100mg/L Amp 37 ℃ at 4ml and cultivate 8-10h, add IPTG and induce, final concentration is 1mM, induces 8h; Get 1ml bacterium liquid, the centrifugal 1min of 12,000 * g, supernatant discarded adds ddH then ₂Each 100 μ L of O and SDS-PAGE sample-loading buffer, boiling water bath 5min, the centrifugal 3min of 12,000 * g gets 20 μ L supernatants at last and is used for SDS-PAGE, detects whether to give expression to target protein.

The result as shown in Figure 5, swimming lane 1 for IPTG induce before BL21 bacterium cracking total protein, swimming lane 2 is induced BL21 bacterium cracking total protein afterwards for IPTG, and swimming lane M is albumen Marker.The result shows that the expression amount of target protein is higher, can carry out next step purifying.

Positive colony 37 ℃ of cultivation 8-10h in the screw socket pipe of the LB substratum of 4ml 100mg/L Amp that will contain the pET32-5SPI-II plasmid, take out 2ml then, be transferred to respectively (100ml LB substratum/bottle) in the 500ml triangular flask, cultivate 3-4h, OD to be cultured to for 37 ℃ ₆₀₀Be 0.6-0.8, add IPTG and induce that final concentration is 1.0mM, induces 8h; Induce and finish the centrifugal 25min collection of back 5000 * g thalline.Thalline is resuspended in 50ml ultrasonic degradation liquid (50mM NaH ₂PO ₄, pH 8.0,300mM NaCl, 20mM imidazoles), adding N,O-Diacetylmuramidase to final concentration is 1mg/ml, places 30min on ice.Ice-bath ultrasonic cracking (power 300W, ultrasonic 3s stops 3s, totally 100 times), 4 ℃, the centrifugal 20min of 12,000 * g collects supernatant liquor.By constant flow pump supernatant liquor is slowly pumped into in the good Ni-NTA chromatography column of lysate balance, with 5-10 times of volume washings (50mM NaH ₂PO ₄, pH 8.0,1M NaCl, 40mM imidazoles, 5mM beta-mercaptoethanol, 0.2%Tween20,5% ethanol) and wash post, until the OD of effluent liquid ₂₈₀Approach 0.Use 10ml elutriant (50mM NaH at last ₂PO ₄, pH 8.0,300mM NaCl, 150mM imidazoles) and wash-out, every pipe is collected about 1ml.The gained elutriant detects with Coomassie brilliant blue reagent (Coomassie brilliant blue G-250100mg is dissolved in 50ml 95% ethanol, adds 120ml 85% phosphoric acid again, is diluted with water to 1L), merges the higher several pipes of protein content, and 4 ℃ of preservations are standby after the mensuration concentration.Purification effect is identified by SDS-PAGE.

The result as shown in Figure 6, swimming lane 1 is induced back BL21 bacterium supernatant liquor for IPTG, swimming lane 2 is induced back BL21 bacterial precipitation for IPTG, swimming lane 3 is induced BL21 bacterium supernatant liquor behind the back purifying for IPTG, swimming lane 4 is the 5SPI-II albumen behind the purifying.The result shows that expression product 5SPI-II recombinant spider silk protein proportion in the solubility total protein is about 15%.

(3) polyclonal antibody preparation and detection

, mix with the freund's adjuvant equal-volume and to make subcutaneous multi-point injection immunizing rabbit as antigen with the 5SPI-II spider's thread protein of purification of Recombinant, carry out altogether six times.Immunity finishes the back and gets blood from rabbit carotid artery, and 8000 * g is centrifugal, and supernatant is antiserum(antisera).Get the preceding rabbit blood of immunity and make negative control.It is ℃ frozen that all serum are distributed into aliquot-20.(Enzyme-linked immunosorbent assay ELISA) measures antiserum titre, the negative serum contrast is set and does not add antigenic blank, and experiment is carried out on 96 porocyte culture plates with enzyme-linked immunosorbent assay.

ELISA result shows that sero-fast the tiring of 5SPI-II surpassed 100,000, has very strong immune response activity (Fig. 7).

2, transgenic line and wild-type contrast total protein extracts and measures

In order to detect the expression level of recombinant spider silk protein SPIII in the transgene cotton fiber, the fiber sample of transgenic cotton plant has been carried out Western blot analyzed.Identical when detecting with RT-PCR, choose 5 T of SPIII transgene cotton ₀Different transgenic lines 0,1,3,4,5 of generation (wherein 0,3,5 is single copy, and 1 and 4 is that 5 copies insert) and cotton No. 14 plant in the upland cotton Ji that transforms carry out the sample that Western blot analyzes.

Get above-mentioned each plant blossom same day equally respectively, spend cotton fiber (preceding 3 the sample band seeds) sample of back 3,5,10,15,20,25,30d, phenol extraction process (Yuan Yao by improvement, et a1.Electrophoresis, 2006,27:4559-4569) extract the gross protein of each sample respectively, and (Bradford, Anal Biochem.1976 72:248-254) measure its total protein content to adopt the Bradford method.Each material repeated sampling three times, each sample triplicate.

3, western blotting immunoassay (Western Blot)

With recombinant spider silk protein (5 repetitions) antiserum(antisera) of purifying as first antibody, the goat anti-rabbit immunoglobulin antibody of commercial horseradish peroxidase (HRP) mark is as second antibody, according to " molecular cloning experiment guide " (Sambrookand Russell, 2001) method is carried out proteinic molecular hybridization, manifests the target protein band at last in the luminous substrate of horseradish peroxidase.

Western blot result and RT-PCR are similar, promptly the target protein hybridization signal is stronger in the back 15 days fiber of blooming of transgenic line 0,3,5, and be that faint signal is arranged in 1 and 4 fibers in the multiple copied strain, (Fig. 8 D, 0,1,3,4,5 is different cotton T then not have the protein band appearance in the contrast ₀Transgenic line; The negative contrast of c).

RT-PCR and Western blot result show, external source spider's thread protein gene SPIII successfully changes in cotton 14 genes in Ji, and can transcribe out corresponding mRNA, also needs further research and the expression amount in the strain of the multiple copied number system is why very low.

(5) transgene cotton T ₀For the fibrous quality analysis

Randomly drawing drying in the sun changes the fiber that contains seed of SPIII gene cotton, with pin with the fiber on the seed separately along the seed centre joint, with comb that the fiber combing is straight and be attached to the flannelette surface then, measure the length of fiber with ruler, each individual plant is measured 15 samples, takes the mean.Add up each individual plant data of each strain system, take the mean as the staple length of strain system.To send Ministry of Agriculture's cotton quality supervision to detect test center (Anyang) after transgenic line cotton fibre sample and contrast (the converting cotton plant that does not contain the SPIII gene) the branch individual plant results, according to ASTM D5867-95 " HVI900 large vol fiber test (High Volume Inspenction, HVI) instrument test method ", adopt HFT9000 in temperature (20 ± 2) ℃, under the envrionment conditions of relative humidity (65 ± 3) %, 5 indexs such as upper half mean length, reguarity index, specific tenacity, elongation, mic value are tested.Wherein survey T ₀For the used control material of fibrous quality is unconverted regrowth, and other contrast selects for use the isolating SPIII transfer-gen plant that do not contain as negative control.

The cotton of cotton 14 wild-types in the upgrowth situation of SPIH transgene cotton and Ji does not have evident difference.To the SPIII transgene cotton T that randomly draws ₀Ginning outturn and length for strain system and contrast mature fibers are measured, and the result shows changes SPIII gene T ₀Ginning outturn and length for the mature fibers of strain system do not have evident difference (Fig. 9) compared with the control.

Except that ginning outturn and length, also indexs such as intensity and fineness are measured.According to the report of cotton quality supervision detection test center of the Ministry of Agriculture (Anyang), according to the standard of HVI system, each index determining of the cotton fiber of censorship the results are shown in Table 1.

Table 1, SPIII transgene cotton T ₀Quality for fiber and contrast compares

The result shows, the result of relevant with fibre strength two indexs fracture specific tenacitys and elongation at break shows, no matter is under the identical cultivation condition or under different condition, SPIII transgenosis T ₀Generation single copy strain is T ₀0 fibre breakage specific tenacity improves 12.18% and 9.75% than two contrasts respectively, and elongation contrasts descended 18.84% and 12.5% (table 1) than two respectively.And SPIII transgenosis T ₀For the multiple copied strain is T ₀1 and T ₀4 fibre breakage specific tenacitys and elongation do not have significant difference (table 1) compared with the control.According to the Cotton in China grade scale, according to fracture specific tenacity difference with cotton be divided into very poor, poor, medium, by force, very strong six grades (GB 1103-2007).Very poor level value is at 24.0cN/tex and following; The difference span is 24.0-25.9cN/tex; Medium span is 26.0-28.9cN/tex; The value of taking by force scope is 29.0-30.9; Very the value of taking by force scope be 31.0 and more than.Change SPIII gene T ₀Generation single copy strain is T ₀The fracture specific tenacity value of 0 cotton fibre is 30.4cN/tex, belongs in the intensity level scope; And contrast cotton fibre fracture specific tenacity value 27.1cN/tex belongs to middle grade, illustrates that the intensity of changeing SPIII gene plant fiber is improved.

Six, transfer-gen plant offspring's screening and detection

1, the transfer-gen plant descendant inheritting is analyzed

Whether foreign gene can genetic stability in acceptor cotton gene group, and the most reliable evidence is that trace analysis is carried out in the expression in the offspring to this gene.According to the Southern results of hybridization, 3 single copy (T are selected in this research ₀In generation, be numbered 0,3,5) the T of commentaries on classics SPIII gene ₀Plant in the greenhouse for selfed seed, adopt kalamycin resistance test and PCR to detect two kinds of methods T ₁The plant offspring carries out Molecular Detection and genetic analysis.Method is as follows:

1) kantlex screening: with the T of results ₀Behind cotton selfed seed usefulness warm water soaking 12-24h, simple grain is sowed in the nutrition pot, after waiting to grow 2-4 sheet true leaf, 1% kantlex solution is spread upon equably the middle part of new unfolded rough leaf with writing brush or absorbent cotton, observe the colour-change at foliar treatment position behind the 7-9d, add up the resistant plant and the non-resistance plant of each test group respectively.

2) PCR detects: on the basis of kantlex screening, to blocking the T of that resistance ₁Carry out PCR for transfer-gen plant and detect, add up the positive plant and the non-positive plant of each test group respectively.

The employing kantlex screens and detects in conjunction with PCR, can monitor the transgenic progeny separate condition, can in time eliminate a part of non-transformant, reduce the quantity of the non-transformant that moves into the land for growing field crops, thereby save experimentation cost and test space, and improve screening efficiency.

3) proterties is separated

According to the result of kantlex and PCR detection, to T ₁Carry out Chi-square test for transfer-gen plant, to determine whether the heredity of recombinant spider silk protein gene SPIII in transgene cotton meets mendelian inheritance.

The result shows, the x that 0 strain of single copy is ²=0.032, the x that 3 strains of single copy are ²=0.058, according to the real x that gets ²Value and degree of freedom are 1 to look into x ²Table (test statistics method, Gai Junyi chief editor, Chinese agriculture press, 2006), as can be seen, real both x that get ²All less than x ²(0.05)=3.84, i.e. difference between experimental observation value and theoretical value is not remarkable.Therefore, 0 and 3 strains of single copy are that the offspring meets the Mendelian inheritance law of segregation, are heredity in normal 3: 1 and separate.This shows external source recombinant spider silk protein gene SPIII heredity in transgenic progeny really.But the strain of single copy is 5 because T ₁Fail to finish analysis (table 2) for sample is few.

Table 2, transfer-gen plant T ₁The heredity in generation separates

The transformant numbering	Total strain number	T 1For actual strain number (O)	Theoretical strain number (E)	O-E	|O-E|-1 /2	(|O-E|-1 /2) 2/E
							0	65	47	48.75	1.75	1.25	0.032
3	71	51	53.25	2.25	1.75	0.058

4) screening of homozygous lines

To derive from 13 T of 2 different transformants (0 and 3) ₁Sow in big Tanaka for selfed seed, adopt kalamycin resistance test and PCR to detect two kinds of methods and determine homozygous lines, obtain 2 strain homozygous lines at last, difference called after CTC-H8 and CTC-H2, and breeding T ₂For homozygous lines further to carry out the attributional analysis of transgene cotton strain system.

2, transgenic cotton plant offspring's phenotype changes

To change the SPIII gene plant and separate the negative control plant that obtains and carry out interlacing contrast cultivation, the profile of plant is observed evidence obtaining.The result shows that at aspects such as size of the growing state of plant height, leaf morphology, size, color and luster, leaf branch, fruit branch, floral organ and forms changeing SPIII gene cotton does not have evident difference compared with the control.

3, external source SPIII gene is at the expression characterization of homozygous lines cotton fiber

The E6 promotor has and drives gene specific expressed feature in fiber, mainly expresses in the fiber of back 5-28d of blooming, and expression amount is the highest when blooming back 15-22d.The front we to T ₀Measure on RNA and protein level for SPIII expression of gene level in the transgenic cotton plant.After obtaining homozygous lines we again equally to homozygous lines in external source SPIII expression of gene level measure.Get isozygoty transgenic line CTC-H8 and CTC-H2 bloom the same day, spend the fiber (preceding 3 samples contain seed) of back the 3rd, 5,10,15,20,25,30d, extract respectively according to the method described above that total RNA and total protein carry out RT-PCR and Western blot analyzes.

The result as shown in figure 10, wherein plate A is total RNA electrophoretic band figure of the different development stage of cotton ovule and fiber, plate B is the electrophoresis result of GhHis3 Gene RT-PCR amplification (29 circulation), plate C is the electrophoresis result of target gene SPIII gene RT-PCR amplification (34 circulation), and plate D is the Western blot analytical results of target sample.These results clearly illustrate that, express in the fiber of the SPIII gene that the E6 promotor is driven 5-30d after the transgenic line CTC-H8 that isozygotys spends, and peak expression concentrates in the fiber of spending back 20-25d, the expression amount of 15d and 10d is relative not high after blooming, and is relatively low at the expression amount of bloom back 5d and 30d.On the other hand, on the same day and to spend back 3d to express stronger of blooming of the transgenic line CTC-H2 that isozygotys, spend back 5d to express a little less than.Driving feature as for SPIII expression of gene in the CTC-H2 homozygous lines and E6 promotor is not inconsistent, and most probable reason may be the influence of inserting the site, but definite reason remains further to be studied.

4, change the mensuration of SPIII gene cotton fiber quality

(1) non-homozygous lines fibrous quality is measured

To the non-T that isozygotys of SPIII transgenosis ₂Generation 15 individual plants (comprising 2 homozygous lines) are gathered in the crops cotton boll respectively, carry out the mensuration of ginning outturn and staple length.With the cotton No. 14 isolating negative contrasts of plant that do not contain the SPIII gene of plant in the upland cotton Ji that transforms.The ginning outturn measurement result shows that the ginning outturn of changeing SPIII gene cotton does not have significant difference compared with the control.And adopt aforesaid method to change the cotton fiber that the SPIII gene plant contains seed to randomly drawing drying in the sun, with pin with the fiber on the seed separately along the seed centre joint, with comb that the fiber combing is straight and be attached to the flannelette surface then, measure the length of fiber with ruler, each individual plant is measured 15 samples, takes the mean.Add up each individual plant data of each strain system, take the mean as the staple length of strain system.The result shows that the mature fibers length that the strain of the different SPIII of commentaries on classics gene pure is does not have evident difference compared with the control yet.

Except that ginning outturn and staple length, also to T ₂Isozygoty transgenic line and indexs such as contrast intensity of cotton fiber and fineness of Dai Fei are measured.According to the report of cotton quality supervision detection test center of the Ministry of Agriculture (Anyang), according to the standard of HVI system, each index determining of the cotton fiber of censorship the results are shown in Table 3.

Table 3, SPIII transgene cotton T ₂Quality for fiber and contrast compares

Annotate: the result that the numeric representation in the bracket records increases or reduces.+: increase;-: reduce

From the result of table 3 as can be seen, contrast and the different dimension reguarity exponential average of changeing between the SPIII gene strain system have improved 4.41%, and staple length does not then have significant difference.Under identical cultivation condition, two indexs fracture specific tenacitys of different time results cotton fiber and elongation at break have tangible difference compared with the control, and the fibre strength comparison of promptly changeing SPIII gene strain system is according to having improved 7.12-13.69%; The 0.99-6.67% and elongation has descended.And the variation tendency unanimity of these two indexs, the cotton fiber strength that promptly changes the SPIII gene has obtained enhancing, and elongation at break has then descended.On this basis, the mic value of most of genetically modified cotton fiber also presents downtrending, illustrates that the transgene cotton fiber strengthens in fibre strength, and when elongation at break descended, the fineness of fiber further attenuated, and is a kind of comparatively ideal results.According to the Cotton in China grade scale, according to fracture specific tenacity difference with cotton be divided into very poor, poor, medium, by force, very strong six grades (GB1103-2007).Very poor level value is at 24.0cN/tex and following; Difference level span is 24.0-25.9cN/tex; Medium span is 26.0-28.9cN/tex; The value of taking by force scope is 29.0-30.9; Very the value of taking by force scope is more than 31.0.The fracture specific tenacity value of transgenic cotton fibre mainly between 31.0-34.46cN/tex, belongs to very strong scope; And contrast cotton fibre fracture specific tenacity value 29.22cN/tex and 30.43cN/tex belong to intensity level.As seen fibre strength is an important preparation of grading cotton fiber quality, and behind the recombinant spider silk protein gene SPIII converting cotton that the present invention selects, has obviously improved the intensity of cotton fiber, has realized aim of the present invention.

(2) the homozygous lines fibrous quality is measured

Equally, two homozygous lines CTC-H2 of the commentaries on classics SPIII gene cotton that the present invention is obtained and CYC-H8 also carry out a series of attributional analysises.These analyze the cotton No. 14 negative contrasts of plant in upland cotton Ji that all transform not succeed.

The ginning outturn measurement result shows that the ginning outturn of changeing spIII gene cotton homozygous lines does not have significant difference compared with the control.The cotton of randomly drawing drying in the sun commentaries on classics SPIII gene cotton homozygous lines CTC-H2 and CTC-H8 contains the cotton fiber of seed, with pin with the fiber on the seed separately along the seed centre joint, with comb that the fiber combing is straight and be attached to the flannelette surface then, measure the length of fiber with ruler, each individual plant is measured 15 samples, takes the mean.Add up each individual plant data of each strain system, take the mean as the staple length of strain system.The result shows 2 length of changeing the mature fibers of SPIII gene pure strain system does not have evident difference (Figure 11) compared with the control yet.

Except that ginning outturn and staple length, also indexs such as the intensity of transgenosis homozygous lines CTC-H2 and CTC-H8 cotton fiber and fineness are measured.According to the report of cotton quality supervision detection test center of the Ministry of Agriculture (Anyang), according to the standard of HVI system, each index determining of the cotton fiber of censorship the results are shown in Table 4.

From the result of table 4 as can be seen, under identical cultivation condition, there is gap compared with the control in two indexs of fibre strength and elongation at break, i.e. 2 commentaries on classics SPIII gene pures strain is that the cotton fiber strength of CTC-H2 and CTC-H8 is compared according to having improved 1.53% and 11.06% respectively; Elongation has then descended 1.67% and 3.33% respectively.

The quality of table 4, SPIII transgenosis homozygous lines cotton fiber and contrast is (2007.11) relatively

Sample number into spectrum	Reguarity index %	Upper half mean length (mm)	Mic value	Elongation %	Fracture specific tenacity cN/tex
						ck	32.07	84.4	4.62	6.0	30.43
CTC-H2	30.51(-4.87)	84.1 (-0.39)	4.95 (+7.22)	5.9 (-1.67)	30.9 (+1.53)
						CTC-H8	32.84(+2.39)	84.7 (+0.32)	3.97 (-14.01)	5.8 (-3.33)	33.8 (+11.06)

Annotate: the result that the numeric representation in the bracket records increases or reduces.+: increase;-: reduce

(3) variation of transgene cotton homozygous lines Mierocrystalline cellulose relative crystallinity

Degree of crystallinity is to describe the Ultrastructural important parameter of cotton fibre, and its expression cotton fibre crystallizing field accounts for the whole shared ratio of Mierocrystalline cellulose.Method (the Anal Chem.1957 of the O ' connor of employing improvement etc., 29 (7): 998-1005), 0.5-1.0g ripe cotton fiber is fully pulverized, and after crossing 20 order aperture sieve, after getting 10mg and KBr grinding jointly on a small quantity, get 10mg compressing tablet 10min, (U.S. Nicolet company produces with infrared spectrometer, 60SXR) measure resolving power 4cm ^-1Get 1372cm ^-1And 2900cm ^-1Near the wave number peak value is as absorption intensity, and (J Appl Poly Sci.1964,8 (3): the 1311-1324) formula of Ti Chuing: K1=a1/a2 calculates relative degree of crystallinity according to Nelson and O ' connor.K1 is a crystallinity index in the formula; A1 is 1372cm ^-1The absorption intensity of bands of a spectrum; A2 is 2900cm ^-1The absorption intensity of bands of a spectrum.With isolated cotton No. 14 negative contrasts of plant in upland cotton Ji that do not contain the SPIII gene.Compared with the control, variation (Figure 12, wherein 1 represents CTC-H8,2 expression CTC-H2,3 expression ck) has taken place because of the peak value of the different wave length of cotton homozygous lines CTC-H2 and CTC-H8 in commentaries on classics SPIII, and relative crystallinity has improved 5.82% and 15.37% (table 5) respectively.

The plain relative crystallinity of table 5, transgene cotton homozygous lines and control fiber

Numbering	a1	a2	Relative crystallinity (%)
				ck	0.2203	0.3578	61.57
H 2	0.4733	0.7024	67.39
				H 8	2.5289	3.2870	76.94

5, immuno-electron microscope analysis

Getting bloom back 20 days fibers and mature fibers of SPIII transgenosis homozygous lines CTC-H8 and negative control (the isolating cotton plants that does not contain the SPIII gene) detects.One anti-is 5 multiple spider's thread proteins of purification of Recombinant antiserum(antisera), and two anti-ly are the goat anti-rabbit immunoglobulin antibody of commercial horseradish peroxidase (HRP) mark.

Show by the colloid gold label thing immune response is to determine antigenicly whether exist in changeing the fiber that the strain of SPIII gene pure is CTC-H8.The result shows that transgene cotton homozygous lines fiber secondary wall can clearly be seen the formed gold grain of expression product, all has more golden mark on the fiber secondary wall, form a continuous system (Figure 13, the positive sample of A, B is contrast, scale=800nm); And almost do not have golden mark on the negative control fiber secondary wall, show that The above results is reliable.

To sum up show: this research is according to cotton codon-bias rule, according to spider's thread protein gene M aSP-I that delivers and the sequence signature of MaSP-II, both are synthesized spider's thread protein SPI-II gene by same ratio, connect the non repetitive sequence (CSP) of the preceding paragraph spider's thread protein gene again, constitute the spider's thread protein gene SPIII of reorganization.The recombinant spider silk protein gene SPIII that cotton fiber specific promoter E6 is regulated and control by agrobacterium-mediated transformation imports the upland cotton Ji cotton No. 14.PCR, Southern, RT-PCR and Western detect and show that the SPIII gene has been integrated into the cotton gene group, and in cotton fibre normal expression.Fiber detects and shows T ₀Generation single copy strain is T ₀0 fibre breakage specific tenacity is compared respectively according to improving 12.18% and 9.75%, and elongation is compared respectively according to having descended 18.84% and 12.5%.And SPIII transgenosis T ₀For the multiple copied strain is T ₀1 and T ₀4 fibre breakage specific tenacitys and elongation do not have significant difference (table 2) compared with the control.Change SPIII gene T ₂The fibre strength comparison of non-homozygous lines is according to having improved 5.07-13.69%; The 0.99-6.67% and elongation has descended.The cotton fiber strength comparison of homozygous lines CTC-H2 and CTC-H8 is according to having improved 1.53% and 11.06% respectively, and relative crystallinity has improved 5.82% and 15.37% respectively; Elongation has then descended 1.67% and 3.33% respectively.Compared with the control, the transgenic progeny cotton fiber strength all is improved to some extent, and elongation then generally descends.This shows that according to the partial amino-acid series of MaSP-I and MaSP-I, the spider's thread protein SPIII gene of reorganization shows the result that can improve cotton fiber strength.Cotton fibre tension fracture is the result of chemical bond rupture and intermolecular slippage comprehensive action, the crystalline region is as the point of the physical crosslinking between cellulose macromolecule, has the effect that stops slippage relatively between macromolecular chain, improves mechanical property, thereby degree of crystallinity is higher to improving more useful (the Benedict et al. of fiber tensile strength, Crop Sci.1994,34:147-151).Binding fiber intensity and relative crystallinity result, as can be seen, the increase of transgenosis fibre strength and the increase of relative crystallinity have consistence preferably.The increase that the transgenosis staple length is described is because the expression increase that imports owing to foreign gene SPIII causes.

Sequence table

<160>2

<210>1

<211>2400

<212>DNA

<220>

<223>

<400>1

atgggatctc aaggtgctgg aagaggtggg ttgggtggac agggcgcagg tgcagctgcc 60

gctgctgcag ctggaggtgc tggacagggt ggctatggtg ggcttggatc tcaaggtgct 120

ggaagaggtg ggttgggtgg acagggcgca ggtgcagctg ccgctgctgc agctggaggt 180

gctggacagg gtggctatgg tgggcttgga tctgctgcag ctgcagccgc tgcagctggt 240

cctggaggtt acggaccagg tcagcaagga cctggtggat atggtccagg acagcaaggt 300

ccttcaggtc ctggatctgc tgcagctgca gccgctgcag ctggtcctgg aggttacgga 360

ccaggtcagc aaggacctgg tggatatggt ccaggacagc aaggtccttc aggtcctgga 420

tctgctgcag ctgcagccgc tgcagctggt cctggaggtt acggaccagg tcagcaagga 480

cctggtggat atggtccagg acagcaaggt ccttcaggtc ctggatctca aggtgctgga 540

agaggtgggt tgggtggaca gggcgcaggt gcagctgccg ctgctgcagc tggaggtgct 600

ggacagggtg gctatggtgg gcttggatct caaggtgctg gaagaggtgg gttgggtgga 660

cagggcgcag gtgcagctgc cgctgctgca gctggaggtg ctggacaggg tggctatggt 720

gggcttggat ctgctgcagc tgcagccgct gcagctggtc ctggaggtta cggaccaggt 780

cagcaaggac ctggtggata tggtccagga cagcaaggtc cttcaggtcc tggatctgct 840

gcagctgcag ccgctgcagc tggtcctgga ggttacggac caggtcagca aggacctggt 900

ggatatggtc caggacagca aggtccttca ggtcctggat ctgctgcagc tgcagccgct 960

gcagctggtc ctggaggtta cggaccaggt cagcaaggac ctggtggata tggtccagga 1020

cagcaaggtc cttcaggtcc tggatctcaa ggtgctggaa gaggtgggtt gggtggacag 1080

ggcgcaggtg cagctgccgc tgctgcagct ggaggtgctg gacagggtgg ctatggtggg 1140

cttggatctc aaggtgctgg aagaggtggg ttgggtggac agggcgcagg tgcagctgcc 1200

gctgctgcag ctggaggtgc tggacagggt ggctatggtg ggcttggatc tgctgcagct 1260

gcagccgctg cagctggtcc tggaggttac ggaccaggtc agcaaggacc tggtggatat 1320

ggtccaggac agcaaggtcc ttcaggtcct ggatctgctg cagctgcagc cgctgcagct 1380

ggtcctggag gttacggacc aggtcagcaa ggacctggtg gatatggtcc aggacagcaa 1440

ggtccttcag gtcctggatc tgctgcagct gcagccgctg cagctggtcc tggaggttac 1500

ggaccaggtc agcaaggacc tggtggatat ggtccaggac agcaaggtcc ttcaggtcct 1560

ggatctcaag gtgctggaag aggtgggttg ggtggacagg gcgcaggtgc agctgccgct 1620

gctgcagctg gaggtgctgg acagggtggc tatggtgggc ttggatctca aggtgctgga 1680

agaggtgggt tgggtggaca gggcgcaggt gcagctgccg ctgctgcagc tggaggtgct 1740

ggacagggtg gctatggtgg gcttggatct gctgcagctg cagccgctgc agctggtcct 1800

ggaggttacg gaccaggtca gcaaggacct ggtggatatg gtccaggaca gcaaggtcct 1860

tcaggtcctg gatctgctgc agctgcagcc gctgcagctg gtcctggagg ttacggacca 1920

ggtcagcaag gacctggtgg atatggtcca ggacagcaag gtccttcagg tcctggatct 1980

gctgcagctg cagccgctgc agctggtcct ggaggttacg gaccaggtca gcaaggacct 2040

ggtggatatg gtccaggaca gcaaggtcct tcaggtcctg gatctcgtct tgcttctcct 2100

gattcaggag ctagagttgc atcagctgtt tctaaccttg tatccagtgg tccaacatca 2160

tctgctgcac tctcatctgt tatttctaac gctgtgtctc agattggtgc atctaatcct 2220

ggtctttcta gatgtgatgt tcttattcag gctcttctcg aaatcgtttc tgcttgcgtt 2280

acaattcttt cttcatccag cattggtcag gttaattatg gagcggcctc acagtttgcc 2340

caagttgtcg ggcaatccgt tttgagtgca ttcggatccc atcaccatca tcatcactga 2400

<210>2

<211>799

<212>Pro

<220>

<223>

<400>2

Met Gly Ser Gln Gly Ala Gly Arg Gly Gly Leu Gly Gly Gln Gly Ala

1 5 10 15

Gly Ala Ala Ala Ala Ala Ala Ala Gly Gly Ala Gly Gln Gly Gly Tyr

20 25 30

Gly Gly Leu Gly Ser Gln Gly Ala Gly Arg Gly Gly Leu Gly Gly Gln

35 40 45

Gly Ala Gly Ala Ala Ala Ala Ala Ala Ala Gly Gly Ala Gly Gln Gly

50 55 60

Gly Tyr Gly Gly Leu Gly Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly

65 70 75 80

Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro

85 90 95

Gly Gln Gln Gly Pro Ser Gly Pro Gly Ser Ala Ala Ala Ala Ala Ala

100 105 110

Ala Ala Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly

115 120 125

Tyr Gly Pro Gly Gln Gln Gly Pro Ser Gly Pro Gly Ser Ala Ala Ala

130 135 140

Ala Ala Ala Ala Ala Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly

145 150 155 160

Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Ser Gly Pro Gly Ser

165 170 175

Gln Gly Ala Gly Arg Gly Gly Leu Gly Gly Gln Gly Ala Gly Ala Ala

180 185 190

Ala Ala Ala Ala Ala Gly Gly Ala Gly Gln Gly Gly Tyr Gly Gly Leu

195 200 205

Gly Ser Gln Gly Ala Gly Arg Gly Gly Leu Gly Gly Gln Gly Ala Gly

210 215 220

Ala Ala Ala Ala Ala Ala Ala Gly Gly Ala Gly Gln Gly Gly Tyr Gly

225 230 235 240

Gly Leu Gly Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly Pro Gly Gly

245 250 255

Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln

260 265 270

Gly Pro Ser Gly Pro Gly Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly

275 280 285

Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro

290 295 300

Gly Gln Gln Gly Pro Ser Gly Pro Gly Ser Ala Ala Ala Ala Ala Ala

305 310 315 320

Ala Ala Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly

325 330 335

Tyr Gly Pro Gly Gln Gln Gly Pro Ser Gly Pro Gly Ser Gln Gly Ala

340 345 350

Gly Arg Gly Gly Leu Gly Gly Gln Gly Ala Gly Ala Ala Ala Ala Ala

355 360 365

Ala Ala Gly Gly Ala Gly Gln Gly Gly Tyr Gly Gly Leu Gly Ser Gln

370 375 380

Gly Ala Gly Arg Gly Gly Leu Gly Gly Gln Gly Ala Gly Ala Ala Ala

385 390 395 400

Ala Ala Ala Ala Gly Gly Ala Gly Gln Gly Gly Tyr Gly Gly Leu Gly

405 410 415

Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly Pro Gly Gly Tyr Gly Pro

420 425 430

Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Ser

435 440 445

Gly Pro Gly Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly Pro Gly Gly

450 455 460

Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln

465 470 475 480

Gly Pro Ser Gly Pro Gly Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly

485 490 495

Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro

500 505 510

Gly Gln Gln Gly Pro Ser Gly Pro Gly Ser Gln Gly Ala Gly Arg Gly

515 520 525

Gly Leu Gly Gly Gln Gly Ala Gly Ala Ala Ala Ala Ala Ala Ala Gly

530 535 540

Gly Ala Gly Gln Gly Gly Tyr Gly Gly Leu Gly Ser Gln Gly Ala Gly

545 550 555 560

Arg Gly Gly Leu Gly Gly Gln Gly Ala Gly Ala Ala Ala Ala Ala Ala

565 570 575

Ala Gly Gly Ala Gly Gln Gly Gly Tyr Gly Gly Leu Gly Ser Ala Ala

580 585 590

Ala Ala Ala Ala Ala Ala Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln

595 600 605

Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Ser Gly Pro Gly

610 615 620

Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly Pro Gly Gly Tyr Gly Pro

625 630 635 640

Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln Gly Pro Ser

645 650 655

Gly Pro Gly Ser Ala Ala Ala Ala Ala Ala Ala Ala Gly Pro Gly Gly

660 665 670

Tyr Gly Pro Gly Gln Gln Gly Pro Gly Gly Tyr Gly Pro Gly Gln Gln

675 680 685

Gly Pro Ser Gly Pro Gly Ser Arg Leu Ala Ser Pro Asp Ser Gly Ala

690 695 700

Arg Val Ala Ser Ala Val Ser Asn Leu Val Ser Ser Gly Pro Thr Ser

705 710 715 720

Ser Ala Ala Leu Ser Ser Val Ile Ser Asn Ala Val Ser Gln Ile Gly

725 730 735

Ala Ser Asn Pro Gly Leu Ser Arg Cys Asp Val Leu Ile Gln Ala Leu

740 745 750

Leu Glu Ile Val Ser Ala Cys Val Thr Ile Leu Ser Ser Ser Ser Ile

755 760 765

Gly Gln Val Asn Tyr Gly Ala Ala Ser Gln Phe Ala Gln Val Val Gly

770 775 780

Gln Ser Val Leu Ser Ala Phe Gly Ser His His His His His His

785 790 795

Claims (10)

1, a kind of albumen is following (a) or protein (b):

(a) protein of forming from the aminoacid sequence shown in N-terminal the 1st to the 793 amino acids residue by sequence in the sequence table 2;

(b) with sequence in the sequence table 2 from the aminoacid sequence shown in N-terminal the 1st to the 793 amino acids residue through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical function by (a) deutero-protein.

2, the described proteic encoding gene of claim 1.

3, gene according to claim 2 is characterized in that: described encoding gene is following 1) or 2) or 3) gene:

1) its nucleotide sequence be in the sequence table sequence 1 from 5 ' dna molecular shown in terminal the 1st to 2379 Nucleotide;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

3) with 1) dna sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.

4, the reorganization bacterium that contains claim 2 or 3 described genes.

5, contain claim 2 or 3 described expression of gene boxes.

6, the transgenic cell line that contains claim 2 or 3 described genes.

7, the recombinant expression vector that contains claim 2 or 3 described genes.

8, recombinant expression vector according to claim 7 is characterized in that: described recombinant expression vector is that sequence in the sequence table 1 is obtained from the multiple clone site that the dna sequence dna shown in 5 ' terminal the 1st to 2379 Nucleotide inserts expression vector pPZP111.

9, a kind of method of cultivating the cotton of fibrous quality raising is that claim 7 or 8 described recombinant expression vectors are imported in the cotton cells, cultivates and obtains the cotton that fibrous quality improves.

10, method according to claim 9 is characterized in that: described fibrous quality is a fibre strength.

Images