CN101322840A - Human cystathionine beta-synthetase recombinant protein and use - Google Patents

Abstract

The invention discloses the application of a recombinant human cystathionine Beta-synthase (rhCBS) in the preparation of drugs for curing or preventing hyperhomocysteinemia and related diabetes and cardiovascular diseases and a preparation method thereof. The preparation method mainly adopts an E.coli prokaryotic expression system to obtain highly active rhCBS by the optimization of the expression conditions. The rhCBS can significantly reduce the HCY concentration in a cell-culture medium and improve the survival rate of myocardial cells and endothelial cells at the high HCY level. In an overall animal model with hyperhomocysteinemia, compared with traditional folic acid, VitB6 and VitB12 for curing the hyperhomocysteinemia, the rhCBS can greatly reduce the HCY level in plasma of a rat fed by homomethionin and alleviate the damage to cardiac muscle and vessels and has extremely obvious curative effects on the hyperhomocysteinemia. In addition, the rhCBS can be applied to the preparation of drugs for curing or preventing the hyperhomocysteinemia and related cardiovascular diseases and has broad market prospect.

Description

A kind of human cystathionine beta-synthetase recombinant protein and application

Technical field

The invention belongs to biological technical field, relate to that a kind of recombined human cystathionine (rhCBS) protokaryon efficiently expresses technology and recombiant protein is used to prevent and treat the medicinal application of cardiovascular disease in preparation, by complete people CBS cDNA is cloned, the independent prokaryotic expression system that makes up people CBS, and give expression to and have wild active recombinant C BS albumen, utilize cardiovascular cells in vitro culture model and rat hyperhomocysteinemiainjury model to determine the therapeutical effect of recombinant C BS albumen as medicine.

Background technology

Homocysteine is metabolic intermediate in the methionine cyclic process.Research is in recent years confirmed, the hyperhomocysteinemiainjury and the substantial connection that has as multiple cardiovascular disease such as human first killer's atherosclerosis, hypertension, myocardial infarctions, be of cardiovascular disease new independently and important risk. effective inhibition of high homotype half Guang mass formed by blood stasis has been become one of the cardiovascular disease control very important medical approach.

There are two kinds of metabolic pathways in vivo in HCY: the synthetic methionine that methylates again, or change cysteine into through cystathionie by changeing the sulfur approach.Therebetween, Methylene tetrahydrofolate reductase (MTHFR), cystathionine and methionine synthetase (MS) are necessary three key enzymes of HCY metabolism; These enzymatic activitys reduce or lack, and perhaps its corresponding coenzyme is as VitB ₆, VitB ₁₂With the shortage of folic acid, will cause the HCY Developmental and Metabolic Disorder, plasma concentration raises.Discover, the commentaries on classics sulfur approach of CBS is responsible for the HCY of transformant interior 46%, its conversion capability to HCY be by MS and BHMT the nearly twice of catalytic two metabolic pathways that methylate, the gene expression of CBS and functional status are most important to keeping normal HCY blood plasma level, the excalation of CBS enzyme gene, or can cause hyperhomocysteinemiainjury because of the nutrition reason causes coenzyme disappearance; The experiment of cbs transgenic mice shows that the high expressed of CBS then can reduce the level of blood plasma HCY.Yet, the high incidence that but is difficult to annotate hyperhomocysteinemiainjury with the incidence rate and the basic nutrition situation of present human inheritance's property defective, the research of hyperhomocysteinemiainjury patient's individuality also shows, the reason that has the patient of significant proportion not exist hereditary detect and nutrient to lack.The etiology mechanism of hyperhomocysteinemiainjury it be unclear that so far, also be difficult to reach damaging action and the pathogenesis thereof that hyperhomocysteinemiainjury causes cardiovascular function from the approach of the blocking-up cause of disease, relevant hyperhomocysteinemiainjury animal model etc. has been failed system of systems, and the exogenous coenzyme VitB that gives is just generally adopted in the treatment measure of hyperhomocysteinemiainjury ₆, VitB ₁₂With the method for folic acid strengthening above-mentioned metabolic enzyme, but how undesirable clinical effectiveness is.

CBS is positioned endochylema, is the homotetramer that is made of 63kDa subunit (551 aminoacid).CBS is a hemoprotein, belongs to the B family in pyridoxal phosphate (PLP) the dependence enzyme.Each subunit combines with haemachrome and these two cofactors of PLP.People CBS comprises catalyst structure domain and adjustment structure territory of a haem bonding pad, a high conservative.Haemachrome is incorporated into N-and holds preceding 70 amino acid residues, and this zone C ys52 and His65 are that heme iron is ionic in conjunction with residue.Studies show that haemachrome does not participate in catalytic step, but the redox state of its iron ion can influence the catalytic rate of holoenzyme.The catalyst structure domain of high conservative is positioned at the 40th～413 amino acid residue, can form the active center of 45kDa.This area L ys119 residue be PLP in conjunction with residue, PLP is the necessary dependence factor of CBS catalytic reaction.The adjustment structure territory that 140 amino acid residues of C-end constitute plays an important role for the activation of tetrameric formation of people CBS and enzyme, and it comprises what is called " CBS domain ", and this hydrophobicity series comprises the 415th～468 amino acid residue, and its function it be unclear that.C-end adjustment structure territory comprises a S2 ademetionine, and (its binding site is at amino acid residue the 421st～468 place for adenosylmethionine, AdoMet) the self-inhibition zone of binding site.AdoMet is the important adjusting hinge in the methionine metabolic process, it is the allosteric activation agent of CBS, also be 5,10-Methylene tetrahydrofolate reductase (5,10-methylenetetrahydrofolatereductase, MTHFR) and betanin-homocysteine methyltransgerase (betaine-homocys-teinemethyltransferase, BHMT) allosteric inhibitor of catalytic reaction.

At present, many researchs show, CBS brings into play crucial effects in homocysteine mass formed by blood stasis generating process, its active disappearance or point mutation all can cause people CBS enzymatic activity to reduce, this active reduction and hyperhomocysteinemiainjury have a close dependency, and the medicinal research of relevant CBS in the homocysteine mass formed by blood stasis does not appear in the newspapers as yet, but its molecular structure and biological characteristics have been obtained quite deep understanding; People's cbs gene is cloned, but does not domesticly see that the CBS enzyme clone is expressed and medicinal action oriented research.We are improved on the basis of existing research, have set up the technique for gene engineering platform of preparation CBS recombiant protein, and expression and purification goes out to have bioactive recombinant C BS albumen; And set up the animal model of hyperhomocysteinemiainjury; the detection of hyperhomocysteinemiainjury therapeutic effect and appraisement system; on this model basis; observe the survival that recombinant C BS albumen can significantly promote human endothelial cell under the high concentration HCY level; significantly reduce HCY level in the blood; the protection cardiovascular system significantly reduces the damage of the cardiovascular system that high HCY causes.CBS has been carried out design and carried out its application experiment as the development technology path of the bio-pharmaceutical of treatment hyperhomocysteinemiainjury.

Summary of the invention

The object of the present invention is to provide a kind of biological preparation (rhCBS albumen) that can treat hyperhomocysteinemiainjury, and the biological engineering preparation method of the activated rhCBS of a large amount of preparations, it is characterized in that people's cbs gene is cloned, make up the CBS prokaryotic expression system separately, acquisition has the rhCBS albumen of biologic activity, and the therapeutical effect of definite rhCBS albumen in hyperhomocysteinemiainjury.

The present invention adopts following technical proposals:

(1) people's cbs gene obtains and the pET-32a-CBS construction of recombinant plasmid

(2) proteic expression of the structure of BL21-CBS engineering bacteria and rhCBS and purification

(3) the rhCBS protein active is measured

(4) application of rhCBS protein for treatment hyperhomocysteinemiainjury

(5) rhCBS albumen and folic acid, VitB ₆, VitB ₁₂Treatment hyperhomocysteinemiainjury effect assessment reaches the application at the treatment related cardiovascular disease

The process stabilizing of being set up, purity height, active good.Main feature of the present invention is:

1. utilize the prokaryotic expression system successful expression and had a wild active rhCBS; and biologic activity according to known CBS; based on us to relevant rhCBS in the histiocyte and the influence of HCY level in the cell culture fluid; and find that rhCBS albumen has defencive function to endotheliocyte and myocardial cell under the high-level HCY effect; can significantly reduce in the rat hyperhomocysteinemiainjury model HCY level in the blood; significantly alleviate the cardiovascular injury that homocysteine causes, propose the biological preparation as treatment hyperhomocysteinemiainjury and related cardiovascular disease thereof with rhCBS.

2. set up the exogenous rhCBS treatment hyperhomocysteinemiainjury Evaluation on effect system of estimating.Comprise: whole animal blood plasma, cardiovascular function damage and the monitoring that recovers, the detection method of isolated cells HCY level, the detection method of cardiovascular cell injury etc.

3. set up the technology path that rhCBS efficiently expresses.Comprise: the utilization of recombinant DNA technology, the method of best abduction delivering time, temperature and IPTG concentration is determined in the orthogonal experiment design, thereby product is expressed with soluble form and have a wild-type activity, and improved the expression of product, increased the specific binding capacity of rhCBS albumen and HCY and changeed the sulfur catalysis ability.

Figure of description

The order-checking of Fig. 1 CBS pcr amplification.Pcr amplification carries out sequencing to DNA.

Fig. 2 cbs gene clone.1DNA marker; Swimming lane 2-5PCR amplified production; About 1600bp location specific DNA band between 1200-2000bp is the CBS DNA band of pcr amplification shown in the arrow.

Fig. 3 rhCBS protein expression.Swimming lane 1, albumen Marker; 2, the normal bacterium of BL21; 3, BL21 (transforming the pET-32a-CBS plasmid) induces bacterium; About swimming lane 3 molecular weight 70kD, the specific proteins band occurs, be rhCBS albumen shown in the arrow.

Fig. 4 rhCBS albumen Wtstern Blotting identifies.1, normal rabbit serum; 2, the CBS polyclonal antibody.Antigen all is rhCBS albumen, applied sample amount 30ug; The dilution in 1: 500 of serum and antibody, two dilutions in anti-1: 5000 of goat-anti rabbit.

Fig. 5 rhCBS protein active is measured.Method by embodiment 6 is measured, and compare with hepatic tissue albumen * P＜0.05.

The influence of HCY level in Fig. 6 rhCBS albumen pair cell culture fluid.Method by embodiment 7 is carried out, and cultured cells is that compare with matched group Human umbilical vein endothelial cells * P＜0.05, and matched group is for adding isocyatic BSA albumen.

Fig. 7 rhCBS albumen adopts 10mmol/L HCY to intervene cultured cell 24h to the influence of cultured rat myocardial and Human umbilical vein endothelial cells mortality rate, and wherein contrast is hepatic tissue albumen.* compare with matched group P＜0.05.

Fig. 8 rhCBS albumen and folic acid, VitB6, VitB12 are respectively to the influence of rat plasma homocysteine level. ^*Compare with the homomethionin group P＜0.05; #P＜0.05 is organized relatively with folic acid, VitB6, VitB12.

The specific embodiment

The present invention is further illustrated below in conjunction with specific embodiment.

Embodiment 1

The preparation method of a kind of recombined human cystathionine (rhCBS), it is characterized in that people's cbs gene is cloned, make up the rhCBS prokaryotic expression system separately, the rhCBS albumen that acquisition has enzymatic activity biology, concrete steps comprise: make up the pET-32a-CBS expression plasmid; Transform BL21 host bacterium; The rhCBS albumen that express, separation and purification has enzymatic activity.

Embodiment 2

The cbs gene clone obtains:

In view of escherichia coli to the preference of amino acid code and the difference of human body cell, the present invention designs and has synthesized the dna fragmentation that people's gene 5 ' end contains the escherichia coli preference codons, it can improve the expression of CBS in escherichia coli on aminoacid composition that does not change product people CBS and the basis that puts in order; Based on the full cDNA sequence of people CBS of Genbank report, two pairs of primers have been designed, noncoding region primer 1 P1 (forward primer) P2 (downstream primer) in the noncoding region and the coding region of the upstream and downstream of cbs gene; Design and synthesize primer 2 P3 (forward primer) P4 (downstream primer) in the coding region, primer amplification is contained the CBS genes of interest of start codon ATG with this.Wherein primer P3 (forward primer) introduces restriction enzyme site EcoR I, and primer P4 (downstream primer) introduces restriction enzyme site BamH I and corresponding protection base.Primer is synthetic by Shanghai Ying Jun biotech firm.Referring to table 1, adopt nest-type PRC amplification total length CBS.

Primer	Sequence	The amplification fragment length
			P1 P2 P3 P4	5’CACCAGGATCCCATGACAGATTCTGTTG 3’ 5’GTCACGTTCTGGAACATTCTGTCATCAC 3’ 5’CGGAATTCCAGCACATCTGTCCGGTCCA 3’ 5’CCGAAGCTTCCAGGCCAGGCAGTTACCAAT 3’	2021bp 1700bp

Adopt micro-guanidinium isothiocyanate/phenol/chloroform one-step method from the total RNA of human hepatoma cell line HepG2's purification, make A260/A280 ratio＞1.8, get the total RNA of 10 μ l (about 5 μ g), add 50pmol 3 ' end primer, 70 ℃ of thermal denaturation 5min, the room temperature cooling is lowered the temperature it naturally, after waiting to reduce to room temperature, adds following sample in 42 ℃ of water-baths successively:

Reverse transcription reaction system: 5 * reverse transcription buffer, 5 μ l

RNA enzyme inhibitor 20U

40nM tetrasodium pyrophosphate 3 μ l

AMV reverse transcriptase 15U (1 μ l)

DNTP (each 2.5mM) 2 μ l

Add no RNA enzyme water to 25 μ l

42 ℃ of water-bath 60min of said mixture add H ₂70 ℃ of effects of O 75 μ l 5min deactivation reverse transcription, this reactant can be used as the starting template of pcr amplification, and negate transcription product 20 μ l add following ingredients:

2×Pfu 10μl

P1 primer 2 0pmol

P2 primer 2 0pmol

Add H ₂O to 20 μ l

Said mixture reaction condition: 95 ℃, 4min; 95 ℃ of 1min, 56 ℃ of 60s, 72 ℃ of 3min carry out extending 10min behind 30 circulation amplified reactions, get reactant and carry out the electrophoresis evaluation, observe the band of locating about 2kb; Reclaim test kit with gel and reclaim this regional band, reclaiming product with this again is template, carries out pcr amplification with primer 2, reaction condition: 95 ℃, 5min; 95 ℃ of 1min, 55 ℃ of 60s, 72 ℃ of 4min carry out extending behind 35 circulation amplified reactions 10min result and see single band about 1700bp, and are consistent with the CBS sequence length.Shown in Figure 2

Embodiment 3

Expression and the sequence analysis of people's cbs gene in escherichia coli

The structure of expression vector can be by being template amplification cbs gene total length with cDNA, through restricted enzyme EcoR

I and BamH I double digestion genes of interest product and expression vector plasmid pET-32a, obtain mole mixing such as two dna fragmentations through agarose gel electrophoresis separation and recovery, 12-16 ℃ of coupled reaction of T4DNA ligase spent the night, and junctional complex pET-32a-CBS recombinant plasmid transformed is gone into CaCl ₂Among the E.Coli BL21 that handles, through the ampicillin screening and culturing.Select single bacterium colony, the preparation plasmid is identified with digestion with restriction enzyme, contains the correct person of people's cbs gene fragment and direction of insertion and is the purpose engineering bacteria; Measure the cbs gene sequence,,, see Fig. 1 with 100% coupling of Genbank report through the Blast comparison.It can efficiently express in e. coli bl21, makes CBS account for about 20% of bacterial protein, and expression rate does not reduce through going down to posterity more than 100 times.Fig. 3

Engineering bacteria is used liquid LB culture medium amplification cultivation, is designed by the orthogonal experiment to temperature, IPTG and three variablees of induction time under 37 ℃ of conditions, the best abduction delivering condition of determining engineering bacteria at last is 30 ℃, 0.5mmol/LIPTG, induces 4h, this moment, rhCBS albumen existed with soluble form, have more a specific proteins band about 70kd, this albumen can present specific reaction with people CBS polyclonal antibody.See Fig. 4

Embodiment 4

The proteic separation and purification of rhCBS

According to the method for embodiment 2, at 1L LB fluid medium great expression rhCBS albumen, concentrate bacterium liquid with 10: 1, add the 1mg/mL lysozyme ,-70 ℃ of multigelations 3 times, at 30% energy, the ultrasonication of 6s/6s interval.Through the centrifugal 10min of 12000rpm, collect supernatant, carry out purification by the HisTrap purification kit that utilizes Pharmacia Corp.

1ml HisTrap prepacked column is through balance liquid balance 8ml---go up sample (1ml supernatant, flow velocity 0.2ml/min)---post cleaning mixture washing 8ml---the 20mmol/L miaow pre-eluting 8ml of eluent that consults---300mmol/L miaow consult eluent eluting---collects the 2-8ml eluent, collect the rhCBS eluent of 70kd, again through bag filter (the about 10kd of the molecular weight that dams) dialysed overnight, change liquid therebetween 4 times, with the dialyzed sample lyophilization ,-70 ℃ of preservations.

Embodiment 5

The proteic evaluation of rhCBS

Press the rhCBS albumen SDS-PAGE method purity checking of embodiment 3 preparations, used spacer gel is 5%, and separation gel is 10%; Testing result shows that purity is all more than 98%.Identify through Western Bloting, it is one anti-selecting people CBS polyclonal antibody for use, 4 ℃ of overnight incubation are washed film three times, the goat antirabbit two anti-1h of hatching, wash film three times, ECL develops, and the visible specific band clearly at the 70kd place shows that rhCBS albumen can be discerned by polyclonal antibody, have antigenicity, be fit to further experiment.See Fig. 4.

Embodiment 6

The rhCBS protein active is measured

The external enzyme activity determination of rhCBS is with reference to the assay method of pertinent literature [Kraus, 1987].Whole reaction system is 100mM Tris-HCl (pH 8.6), 10mM[ ¹⁴C] serine (1000cpm/nmol) (Bio-Rad), the 1.5mM serine, 0.5mg/ml BSA, the 4mM L-cystathionine, 0.5mM PLP, 0.5mM AdoMet adds the pure product albumen of 150ug recombinant C BS in the system.Add 15mM L-homocysteine and start entire reaction, hatched 4 hours at 37 ℃.Reaction system is centrifugal, and 10ul supernatant point is on thin chromatosheet, and TLC is at isopropyl alcohol: formic acid: water (80: 6: 20v/v) chromatography in the liquid.With L-cystathionine standard substance Indicator Reaction product position, downcut corresponding chromatographic zone, immerse in the scintillation solution (toluene that contains 0.5%PPO and 0.04%POPOP), with Phosphoimager (Tri-Carb 2100TR, Packard-Perkin Elmer, Boston, MA) measure [ ¹⁴C] the cystathionie radioactive activity, represent the CBS activity with nmol/hmgprotein, setting up matched group simultaneously is fresh liver tissue albumen (the CBS enzymatic activity is the highest in the liver); Different three people's repeated measure 3 times are averaged.The result: the rhCBS protein active of prokaryotic expression purification can reach 117.8nmol/hmg, is significantly higher than the enzymatic activity in the hepatic tissue, sees Fig. 5.RhCBS can obviously reduce the level of the HCY in the cultured cell liquid simultaneously, sees Fig. 6.Show that rhCBS albumen can be applied to external application.

Embodiment 7

RhCBS albumen is to the protective effect of cardiovascular cell

External conventional cultured rat myocardial adds 10 at cell culture fluid ^-2M HCY gives 0.8mM PLP simultaneously, 0.8mM AdoMet, and the 12mM serine adds rhCBS albumen 0.2mg/ml, and effect 4h detects HCY concentration change in the myocardial cell culture fluid, and detects the mortality rate of myocardial cell.The result shows: rhCBS albumen makes HCY content reduction by 32% in the myocardial cell culture fluid, and the cardiomyocyte cell death rate reduces by 3.1 times.Show that exogenous rhCBS albumen has defencive function to the myocardial cell under the high-level HCY effect.See Fig. 7 A

The external conventional Human umbilical vein endothelial cells of cultivating adds 10 at cell culture fluid ^-2M HCY gives 0.8mM PLP simultaneously, 0.8mM AdoMet, and the 12mM serine adds rhCBS albumen 0.2mg/ml, and effect 4h detects HCY concentration change in the culture fluid of endothelial cell, and detects the function and the mortality rate of endotheliocyte.The result shows that rhCBS albumen makes HCY content reduction by 39% in the culture fluid of endothelial cell, and the endotheliocyte mortality rate reduces by 4.2 times.Show that exogenous rhCBS albumen has defencive function to the endotheliocyte under the high-level HCY effect.See Fig. 7 B

Above result shows that rhCBS can significantly reduce high HCY to the effect of cardiovascular cells injury,

Embodiment 8

RhCBS albumen is to the protective effect of rat hyperhomocysteinemiainjury

Adult Wistar rats, male and female half and half, body weight 180-200g is divided into matched group at random, the homomethionin group, homomethionin+folic acid group, homomethionin+vitamin B12, homomethionin+vitamin B6 group, homomethionin+rhCBS group, every group 12, normal group gives normal feedstuff, and homomethionin gives high egg forage feed, sets up rat hyperhomocysteinemiainjury model.The result shows, folic acid group, vitamin B12, vitamin B6 group, rhCBS group all can make hyperhomocysteinemiainjury rat plasma HCY level reduce, the rhCBS group reduces the most remarkable, compare with the homomethionin group, reduce about 4.4 times, after the rhCBS treatment, rat plasma HCY level returns to normal level substantially, sees Fig. 8.Rat aorta and myocardium pathological section show: folic acid group, vitamin B12 group, vitamin B6 group, rhCBS group compare with the homomethionin group, all can alleviate cardiovascular injury, and wherein the protective effect of rhCBS group is the most obvious.Show that exogenous rhCBS albumen can significantly reduce HCY level in the hyperhomocysteinemiainjury rat serum, suppress the damaging action of homocysteine to cardiovascular system, rhCBS albumen can be used as the cardiovascular disease that the treatment hyperhomocysteinemiainjury causes.Therapeutic effect is better than folic acid, vitamin B12, the vitamin B6 of traditional treatment hyperhomocysteinemiainjury, and effect is more remarkable.

Claims (3)

1. recombined human cystathionine (rhCBS) is used for the treatment of or prevents application in the medicine of hyperhomocysteinemiainjury and relevant diabetes and cardiovascular disease in preparation.

2. rhCBS according to claim 1, it is characterized in that with Genbank in the people CBS albumen of including the recombiant protein of the homology more than 90% is arranged.

3. according to claim 1 and 2 described rhCBS, its preparation method is to be but to be not limited only to following recombination method, and key step comprises:

1. make up the pET-32a-CBS expression plasmid, transformed into escherichia coli is as BL21.

2. the rhCBS albumen that in BL21 host bacterium, express, separation and purification has enzymatic activity;

3. in the rhCBS of purification albumen, add pharmaceutic adjuvant acceptable, be prepared into pharmacy and the clinical preparation of accepting.

Images