CN101319227A - Method for regulating and controlling xylogen content of plants - Google Patents

Abstract

The invention discloses a method for regulating and controlling the lignin content in a plant. The method for regulating and controlling the lignin content in the plant comprises the following steps of: transforming the plant through an expression vector containing a 4CL1 gene to obtain the plant having increased lignin content; and transforming the plant through an expression vector containing an anti-sense 4CL1 gene to obtain the plant with decreased lignin content. The method is used to produce transgenic plants, particularly transgenic trees with increased or decreased lignin content through introducing the 4CL1 gene or the anti-sense 4CL1 gene into a plant cell via the vector, thereby providing an important approach for culturing plants with increased or decreased lignin content or modifying the wood property of trees.

Description

A kind of method of regulating and controlling plant lignin content

The application is that application number is 200410070603.5, the applying date is on July 22nd, 2004, invention and created name is divided an application for " a kind of method of regulating and controlling plant lignin content ".

Technical field

The present invention relates to the method for a kind of regulating and controlling plant lignin content in the bioengineering field.

Background technology

Xylogen is the phenol polymer by three kinds of alcohol monomers or single wooden phenol (to tonquinol, lubanol, sinapyl alcohol) a kind of complexity of synthetic.In the lignification of cell walls, xylogen penetrates in the cell walls, is filled in the Mierocrystalline cellulose framework, as the formation of conduit and test-tube baby cell.Because the infiltration of xylogen, strengthened the hardness of cell walls, the mechanical holding power or the ultimate compression strength of cell have been strengthened, promote the formation of mechanical tissue, to help effects such as consolidation and support plant materials and the defeated road of moisture, the while is owing to the chemical property of xylogen, as the phenol polymer of insolubility with complexity, make xylem have the cell walls hydrophobicity, also strengthened resistance against diseases.

The secondary xylem of trees has Mierocrystalline cellulose (β-1-4-glucosides) xylogen (phenyl polymer) and hemicellulose (special-shaped polysaccharide), and ratio is about 2: 1: 1.When arboreal growth, cellulose microfibril provides tension force for cell walls, and xylogen increases the hardness of cellulose microfibril.The timber that content of lignin is high is widely used in building and field of furniture owing to hardness is high.But in paper-making process, need to remove xylogen.The xylogen of removing at present in the wood pulp generally needs by the higher chemical substance of toxicity, this procedure be expend the energy in the paper industry most, to a link of environmental hazard maximum.Be that content of lignin or the reduction content of lignin that improves trees all will be of value to production.

From strategy, can carry out content of lignin control from many aspects: the synthetic of various enzymes system (1) control xylogen route of synthesis is an important channel, as transforming and might achieve the goal carrying out inverted defined gene from the PAL enzyme to superoxide enzyme/laccase etc.; (2) structure that changes xylogen is formed and chemical property.Because one of free-revving engine of research content of lignin heritable variation is exactly to be industrial papermaking service, is being difficult to directly reduce under the content of lignin situation, the structure composition that changes xylogen might reach same effect indirectly; (3) precursor that must recognize xylogen is a synthetic in tenuigenin, transfer to cell walls then and carry out dehydrogenation polymerization and form xylogen, therefore the synthetic regulation and control of xylogen also note the effect that relates to some non-zymochemistry molecules, promptly transmit the control of transportation, but the rarely found so far report research of the research of this respect.Interaction between the effect of single enzyme and a plurality of enzyme is significant for the synthesis mechanism of exploring xylogen, so the molecular biological characteristic of lignin biosynthesis and Study on mechanism are paid attention to day by day.

The method of at present direct using gene engineering changes the existing report of research of content of lignin.The CCR that Piquemal etc. separate from ridge Buddhist nun eucalyptus (Eucalyptus) (hydroxyl cinnyl CoA-reductase) is the antisense construct carrier of the cDNA of enzyme (EC1.2.1.44), be transformed on the tobacco (Nicotianatabacum L.) by Agrobacterium (Agrobacerium), the result demonstrates CCR mRNA content and the active decline of CCR when stable state, and the plant tracheid wall that content descends is orange-brown, the ratio of Syringa oblata Lindl. base and guaiacyl improves, and undesired cell walls aldehydes matter occurs.Yet the active serious plant that descends of CCR is except showing xylogen descends, and it is little, leaf unusual and crimp feature such as conduit also to show body.It has been generally acknowledged that CAD (hydroxyl cinnamyl-alcohol dehydrogenase) is the enzyme of catalysis xylogen precursor synthetic final step, therefore reduce the CAD activity and might reduce the synthetic of xylogen precursor.The cDNA of the CAD enzyme that researchs such as Baucher will be separated from comospore poplar * eastern cottonwood (P.trichocarpa Torr.Et Groy * P.deltoides Marsh.) carries out justice by Agrobacterium and antisense is transformed into trembling poplar * white poplar (P.tremula L. * P.alba L.), the result shows that 3 antisenses transform and the active decline 70% of the CAD of xylem organization of the strain that 2 are suppressed altogether, in the CAD activity is less than 60% strain, can detect red xylem, but content of lignin is similar to check clone with composition, does not descend.But the chemical property difference of cell walls, behind the application phloroglucinol stain, the xylem of normal strain is typical incarnadine, and is red-brown after the active strain dyeing that descends of CAD.After handling with NaOH, by with after having alkali-soluble part in the cell walls and carrying out acidification, the xylogen of strain with red xylem is precipitable, and the xylogen of the strain of white wooden portion does not precipitate.Willow vanillin food grade,1000.000000ine mesh and Syringa oblata Lindl. base aldehyde that spectroscopic analysis demonstrates red xylem improve.The active strain that descends of paper pulp evidence CAD has only a spot of xylogen to be stored in the paper pulp.Similarly report also has Higuchi etc., and CAD antisense plants transformed content of lignin does not descend, but change has taken place for the composition of xylogen and chemical property.The CAD antisense transforms the back content of lignin and does not descend, and the result of this and occurring in nature torch pine CAD mutant is inconsistent.OMT is important control lignin biosynthesis, after being transformed in the tobacco gene group after enhanser, promotor and the terminator assembling with the antisense sequences of the OMT that encodes in the Populus tremuloides (EC2.1.1.6) enzyme and CaMV35S gene such as Dwivedi, transfer-gen plant shows normal phenotype.In the stem of 4 transfer-gen plants, the active average of OMT (coffic acid O-methyltransgerase) enzyme descends 29%.Stem's wood chemistry analytical results demonstrates Syringa oblata Lindl. base unit content and descends, and content of lignin decline level is relevant with OMT enzymic activity degree.After Doorsselaere etc. used antisense COMT (coffic acid methyltransgerase) and transform trembling poplar * white poplar, it is normal 5% that the COMT activity drops to, but content of lignin does not descend.Transform the research report that single enzyme genetic method is transformed the tobacco content of lignin according to using, reduce single enzyme OMT, CAD, POD (peroxidase), COMT and F5H enzymic activitys such as (forulic acid 5-hydroxylases), not influencing content of lignin changes, and reduce enzyme is PAL (phenylalanine ammonia lyase), C4H (styracin 4-hydroxylase) and CCR enzymic activitys such as (hydroxyl cinnyl CoA-reductases), then can reduce content of lignin.

Be tested and appraised the enzyme and the gene of xylogen route of synthesis in trees and the herbaceous plant, made great efforts to reduce the content of xylogen in the trees in the past, by tone coded coffic acid O-methyltransgerase or cinnamyl-alcohol dehydrogenase content are not succeedd the structure of just having modified xylogen down.The content that reduces these enzymes in transgene tobacco shows the content that does not reduce xylogen.Yet by reduce phenylalanine deaminase content in transgene tobacco, significantly reduced the content of xylogen, the approach that enters phenylpropyl derivatives in this enzyme catalysis xylogen route of synthesis has caused a series of phenotypes undesired.Same in transgenic arabidopsis and tobacco, also reduced the content of (25%-40%) xylogen, but caused the committee of cell walls to contract and downgrade by the content that reduces the styracin CoA-reductase.These vegetation systems have clearly shown the possibility of modifying secondary metabolism and xylogen quality.Therefore, can the problem of trees biotechnology be reduce content of lignin and do not influence the hardness of structure and the growth of trees.

The ligation of the 4CL of willow (4-coumaric acid CoA ligase) albumen Pt4CL1, Pt4CL2 catalysis hydroxycinnamic acid and CoA is for the biosynthesizing of xylogen and flavonoid provides the phenols precursor.Pt4CL2 expresses in the epidermic cell of stem and leaf, and is synthetic relevant with flavonoid.Pt4CL1 expresses in the xylem vascular tissue of growing, synthetic relevant with xylogen.

The innovation and creation content

The method that the purpose of this invention is to provide a kind of regulating and controlling plant lignin content.

The method of regulating and controlling plant lignin content provided by the present invention is to transform plant with containing the 4CL1 expression carrier, obtains the plant that content of lignin raises; To contain antisense 4CL1 expression carrier and transform plant, obtain the plant that content of lignin reduces.

Described 4CL1 gene is the polynucleotide sequence with sequence 1 in the sequence table, and described antisense 4CL1 gene is the polynucleotide sequence with sequence 2 in the sequence table.

Sequence 1 in the sequence table is by 1741 based compositions, and sequence 2 is by 1637 based compositions.

The carrier that sets out that is used to make up the described 4CL1 of containing expression carrier or contain antisense 4CL1 expression carrier can be Ti class plasmid vector and virus vector, is preferably Ti class plasmid vector.

Described Ti class plasmid vector is preferably binary vector, as pBI121.The described 4CL1 of containing expression carrier is preferably pB4CL; The described antisense 4CL1 expression carrier that contains is preferably pBan4CL.

Described method for transformation can be agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method, is preferably the agrobacterium mediation converted method.

In the inventive method, described plant can be herbaceous plant or xylophyta, and wherein, described herbaceous plant is preferably tobacco, and described xylophyta is preferably willow.

The present invention is by introducing 4CL1 gene or antisense 4CL1 gene with carrier in vegetable cell, the transgenic plant that produce the content of lignin rising or reduce are transgenic trees particularly, provides an important approach for cultivating content of lignin reduction or the plant that raises and improveing the trees wood property.

Description of drawings

Fig. 1 is a 35S-4CL1 fusion gene carrier pB4CL building process synoptic diagram

Fig. 2 is that the PCR of pB4CL identifies collection of illustrative plates

Fig. 3 is for changeing the transgenic tobacco plant photo of 35S-4CL1 fusion gene

Fig. 4 detects collection of illustrative plates for the PCR that changes 35S-4CL1 fusion gene tobacco

Fig. 5 is for changeing the southern hybridization collection of illustrative plates of 35S-4CL1 fusion gene tobacco

Fig. 6 is for changeing the northern hybridization collection of illustrative plates of 35S-4CL1 fusion gene tobacco

Fig. 7 a is for changeing the 4CL1 activation analysis histogram in the 35S-4CL1 fusion gene tobacco leaf

Fig. 7 b is for changeing the 4CL1 activation analysis histogram in the 35S-4CL1 fusion gene tobacco stem

Fig. 8 a is for changeing 35S-4CL1 fusion gene tobacco plant photo

Fig. 8 b is blank tobacco plant photo

Fig. 9 compares histogram for water content, xylogen and the content of cellulose that changes 35S-4CL1 fusion gene tobacco and blank tobacco

Figure 10 is for changeing the content of lignin distribution curve of 35S-4CL1 fusion gene tobacco and blank tobacco

Figure 11 is for changeing the content of cellulose distribution curve of 35S-4CL1 fusion gene tobacco and blank tobacco

Figure 12 a is a 35S-antisense 4CL1 fusion gene carrier pBan4CL building process synoptic diagram

Figure 12 b is for changeing the PCR detected result collection of illustrative plates of 35S-antisense 4CL1 fusion gene tobacco plant

Figure 13 is for changeing the Southern results of hybridization collection of illustrative plates of 35S-antisense 4CL1 fusion gene tobacco plant

Figure 14 is the protein standard curve

Figure 15 a is a 4CL1 enzymic activity dynamic curve in the blank tobacco plant

Figure 15 b is for changeing 4CL1 enzymic activity dynamic curve in the 35S-antisense 4CL1 fusion gene tobacco plant

Figure 16 is for changeing 4CL1 enzymic activity histogram in 35S-antisense 4CL1 fusion gene tobacco plant and the blank tobacco plant

Figure 17 a is the glucose typical curve

Figure 17 b compares histogram for the content of lignin that changes 35S-antisense 4CL1 fusion gene tobacco plant and blank tobacco plant

Figure 17 c compares histogram for the content of cellulose that changes 35S-antisense 4CL1 fusion gene tobacco plant and blank tobacco plant

Figure 18 a compares histogram for the content of lignin that changes 35S-4CL1 fusion gene tobacco plant and blank tobacco plant

Figure 18 b compares histogram for the content of cellulose that changes 35S-4CL1 fusion gene tobacco plant and blank tobacco plant

Embodiment

The transgene tobacco that embodiment 1, cultivation content of lignin improve

The article No. of the high-new test kit in ground that present embodiment is used is 92445820,31 Oct 2003, Boehringer company.

1,35S-4CL1 fusion gene carrier pB4CL makes up

With the total DNA of willow that extracts according to ordinary method is template, at primers F 6:CGGATCCGCAATGGACGCCACAATG AATCC, under the guiding of F7:CCGGGTACTGTCTTACGTTGGGTACG, according to following cycling program: 94 degree 5min; 94 degree 30sec, 55 degree 45sec, 72 degree 90sec, 30 circulations; 72 degree 10min carry out pcr amplification, recovery, purifying pcr amplification product, obtain the 4CL1 gene fragment, utilize Xba I and Sma I enzyme to cut the pcr amplification product and the PUC18 of purifying respectively, connect then, will connect product transformed into escherichia coli DH5 α, obtain positive colony through screening, extract the plasmid in the positive colony, obtain subcloning vector pU4CL.

35S-4CL1 fusion gene carrier pB4CL building process as shown in Figure 1, concrete steps are as follows: the 4CL1 gene fragment is downcut from subcloning vector pU4CL with Xba I/SmaI according to ordinary method, and be connected with the pBI121 carrier of cutting through the XbaI/SmaI enzyme, obtain to contain the recombinant vectors pB4CL of fusion gene 35S-4CL1 gene.With plasmid pB4CL according to ordinary method transformed into escherichia coli JM109 competent cell.After the dull and stereotyped cultivation screening of the LB that contains kantlex, extract that plasmid carries out simultaneously that Xba I/SmaI enzyme is cut and be that primer carries out PCR and identifies with primer 1:CGCAATGGACGCCACAATGAATCC and primer 2: TACTGTCTTACGTTGGGTACG, the result shows that the 4CL1 gene has inserted expression vector as shown in Figure 2.According to a conventional method plasmid pB4CL is checked order, the result shows that the 4CL1 gene of insertion has the nucleotide sequence of sequence 1 in the sequence table, between the 5827bp-7567bp of pB4CL; Sequence 1 in the sequence table is by 1741 based compositions, and the open reading frame of 4CL1 gene is from the 5th-1627 nucleotide sequences of 5 ' end.

2, conversion of tobacco and identification and analysis

By improved An method, directly transform Agrobacterium LBA4404, at the enterprising row filter of YEB substratum of Streptomycin sulphate (Sm) 125mg/L and Ka Na mycin (Km) 50mg/L, and the picking mono-clonal extracts plasmid and carries out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of tobacco aseptic seedling is cut, remove vein, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 2-3min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the MS substratum of the filter paper in shop, surface, 28 ℃ of dark cultivations 4 days, explant transferred to contain 100mg/L Km, the MS substratum of 500mg/L Car (0.5mg/L IAA, 2.0mg/L BA) continues to cultivate for last 28 ℃, simultaneously unconverted tissue is handled equally as negative contrast.Changed a subculture every 14 days.When resistant buds is grown to 1-3cm, downcut, forward long shoot in the substratum to.Long during when stem to 3-5cm, forward in the root media that contains kantlex and carboxylic benzyl mycin according to the method for document (Wang Guanlin, Fang Hongjun, 1998, Science Press) and to take root, the result obtains regrowth 37 strains as shown in Figure 3.With the total DNA of blade of the conversion seedling of taking root on the resistance substratum and total DNA of unconverted tobacco leaf is template, under the guiding of primer 1:CGCAATGGACGCCACAATGAATCC and primer 2: TACTGTCTTACGTTGGGTACG, carry out pcr amplification according to a conventional method, amplified production carries out the agarose gel electrophoresis analysis, the result as shown in Figure 4, show to transform the fragment that produces an about 1700bp in the seedling sample that unconverted tobacco sample is this fragment not then.Preliminary proof 4Cl1 gene has been incorporated in the tobacco gene group.

3, the southern of transgene tobacco hybridization

Extract total DNA of transgene tobacco and non-transgenic tobacco according to ordinary method, with the non-transgenic tobacco is contrast, use the BamHI/SmaI restriction enzyme to spend enzymolysis after 3 hours 37,1% agarose gel electrophoresis, running gel is placed on sex change liquid (the 1.5M NaCl of 10 times of volumes, 0.5M concussion 40min NaOH), again at neutralizer (the 1.5M NaCl of 10 times of volumes, 0.5M Tris-Cl, pH 7.0) middle concussion 40min, using 20 * SSC to carry out DNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.Get the 4CL1 gene fragment that 1ug PCR obtains, adding distil water is to 16ul.Boiling water bath 10min places frozen water 5min rapidly.Add 2ulDIG-HIGH PRIME, mixing.37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (carry in the high-new test kit hybridization solution) is to 42 ℃.Prehybridization 30min.Get dna probe (the probe consumption is the 25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change dna probe adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble, seal, 42 ℃ are spent the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1%SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings-100ml toxilic acid damping fluid (Maleic acid buffer) (0.1M toxilic acid, 0.15M NaCl, pH 7.5) the middle 0.3ml tween20 cleaning 1-5min that adds, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result shows the band that occurs a 1700bp in the transgene tobacco as shown in Figure 5, and transgene tobacco does not then have this band, proves that this 4CL1 gene inserts in the transgene tobacco.Among Fig. 5, CK is the contrast of non-transgenic tobacco, and 1-4 is a transgene tobacco.

4, the Northern of transgene tobacco hybridization

According to total RNA of ordinary method extraction transgene tobacco, be contrast with the non-transgenic tobacco, carry out the sex change agarose gel electrophoresis.Using 20 * SSC to carry out RNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.The DNA of the 4CL1 gene that obtains by PCR with 1ug, adding distil water is to 16ul, and boiling water bath 10min places frozen water 5min rapidly, adds 2ul DIG-HIGH PRIME, mixing, 37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (high-new test kit in carry) is to 42 ℃.Prehybridization 30min.Get rna probe and boil 5min, rapidly in placement and the frozen water.Mixing in the sex change probe rna adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble and seal, 42 ℃ spend the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1%SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings-100ml toxilic acid damping fluid (Maleic acid buffer) (0.1M toxilic acid 0.15M NaCl, pH7.5) add 0.3ml tween20 in and clean 1-5min, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result as shown in Figure 6, showing has tangible hybrid belt in transgene tobacco, but not transgene tobacco do not have, and proves that the 4CL1 gene expresses in transgene tobacco.Among Fig. 6, CK is the non-transgenic tobacco, and sample is a transgenic tobacco plant.

5. the mensuration of transgene tobacco 4CL1 enzymic activity

Transgene tobacco blade and stem are pulverized under liquid nitrogen respectively, with extracting damping fluid (0.2M Tris-HCl pH7.5,8mM MgCl ₂, 5mM DTT, 30% glycerine, 1ug/ml leupeptin (Leupeptin)) extract, extracting solution is at 18000g, 4 ℃ of centrifugal 15min, and supernatant liquor is used for enzyme activity assay.Use BSA to do typical curve, quantitative to protein crude extract.Comprise .0.2M Tris-HCl in the 1ml enzyme reaction solution, pH7.5,8mM MgCl ₂, 0.8mM ATP, 0.1mM substrate (being respectively the 4-coumaric acid, forulic acid and coffic acid) and 25-30ul crude extract are measured A then in 24 ℃ of reactions 12 minutes ₃₃₃, A ₃₄₆, A ₃₅₀Increase.Each sample is done 3 parallel laboratory tests.The result show that the 4CL1 enzymic activity improves 2-4 doubly in the leaf of transgene tobacco, and the 4CL1 enzymic activity improves 40%-50% in the stem of transgene tobacco shown in table 1, table 2, Fig. 7 a and Fig. 7 b.It is more that the 4CL1 enzymic activity increases ratio in the leaf of transgene tobacco.But the absolute increasing amount of 4CL1 enzymic activity is identical substantially in the transgene tobacco base of leaf, illustrates in this serial transgene tobacco, and the 4CL1 enzyme obtains a large amount of and average expression in each tissue of transgene tobacco.Among Fig. 7 a and Fig. 7 b, CK is the non-transgenic tobacco plant, and 1-9 is a transgenic tobacco plant.

4CL1 enzyme activity assay in the table 1. transgene tobacco leaf

	4-coumaric acid (4-coumaric acid) pKa/mg albumen	Coffic acid (Caffeic acid) pKa/mg albumen	Acid Wei (Ferulic acid) pKa/mg albumen
				CK	17.7	8.1	10.3
1	87.3	21.2	29.7
				2	76.5	19.8	25.7
3	91.8	25.4	32.5
				4	97.8	22.6	31.5
5	104.7	30.1	39.0
				6	71.6	21.2	21.2
7	88.5	25.7	25.7
				8	78.3	32.8	27.6
9	71.9	28.8	27.7

4CL1 enzyme activity assay in the table 2. transgene tobacco stem

	4-coumaric acid (4-coumaric acid) pKa/mg albumen	Coffic acid (Caffeic acid) pKa/mg albumen	Acid Wei (Ferulic acid) pKa/mg albumen
				CK	157.4	46.3	66.3
1	247.4	72.5	107.9
				2	226.3	64.2	99.4
3	209.0	65.9	89.3
				4	241.0	75.5	101.4
5	257.6	64.1	112.2
				6	205.4	59.6	81.7
7	231.1	73.3	96.7
				8	218.0	66.1	92.1
9	219.6	67.7	93.9

6, change water content, xylogen and the Mierocrystalline cellulose distributional analysis of 35S-4CL1 fusion gene tobacco

(1) morphologic observation of commentaries on classics 35S-4CL1 fusion gene tobacco

Under homologue's culture condition, become the commentaries on classics 35S-4CL1 fusion gene tobacco plant and the non-transgenic tobacco plant of seedling to be transplanted in the flowerpot, cultivated under the same conditions 45 days, change the height of seedling 58.5cm of 35S-4CL1 fusion gene tobacco plant, the long 12.5cm of root, 52 pieces of the numbers of blade, the height of seedling 58.0cm of non-transgenic tobacco plant, the long 15cm of root, 48 of the numbers of blade.By from the observation of the whole growth growth course of blooming, set seeds of being transplanted to tobacco and above the data analysis of surveying, transfer-gen plant and blank tobacco plant (non-transgenic plant) be (Fig. 8 a and Fig. 8 b) except that form is acted normally, and blooms, time of result do not have evident difference yet.Therefore, tentatively think and change that the 4CL1 gene can effectively be regulated and control the biosynthesizing of xylogen and the normal growth that do not influence plant is grown.

(2) water content, xylogen and the content of cellulose of the root of commentaries on classics 35S-4CL1 fusion gene tobacco, stem, leaf

Water content, xylogen and content of cellulose such as the table 3, shown in Figure 9 of the root of commentaries on classics 35S-4CL1 fusion gene tobacco, stem, leaf, show that the water content and the blank of changeing root, stem, leaf in the 35S-4CL1 fusion gene tobacco are more or less the same, and the content of xylogen is higher than the content in the blank tobacco plant respectively, cellulosic content then in contrast, this is consistent with top comparative result to whole strain plant.Among Fig. 9, Trans represents to change 35S-4CL1 fusion gene tobacco, and CK represents blank tobacco (non-transgenic).

The water content of table 3. transgene tobacco and blank tobacco, xylogen and content of cellulose are relatively

(3) the content of lignin distributional analysis of commentaries on classics 35S-4CL1 fusion gene tobacco

Choose tobacco root and stem section (one section of every 10cm) sample, once number 1,2,3,4,5,6,7 by order from low to high.Measure xylogen and the content of cellulose that changes 35S-4CL1 fusion gene tobacco and blank tobacco respectively according to ordinary method, result such as table 4, table 5, Figure 10, table 6, table 7 and shown in Figure 11, show that the content of lignin that changes 35S-4CL1 fusion gene tobacco reduces with its increase highly, cellulosic content then increases with the increase of its height, this may be because: in (1) plant the cell of old tissue than the cell maturation of newborn tender tissue, the institute so that foreign gene is expressed more abundant in tissue; (2) xylem of axis base portion is flourishing, and the xylem form layers of newborn tender tissue that is that all right is ripe.Form the continuous reduction trend of content of lignin and the continuous rising tendency of content of cellulose thus.In addition, in blank plant, also show same increasing progressively and decline trend, but with transfer-gen plant significant difference is arranged on its xylogen and content of cellulose: the content of lignin that shows blank plant each several part is low with respect to the content of lignin of transfer-gen plant each several part, and content of cellulose is then higher.Among Figure 10 and Figure 11, Trans represents to change 35S-4CL1 fusion gene tobacco, and CK represents blank tobacco (non-transgenic).

Table 4. changes 35S-4CL1 fusion gene cigarette content of lignin

Sample number	Before the oven dry heavy (g)	Oven dry back heavy (g)	Xylogen heavy (g)	Content of lignin (%)
					1	1.8848	1.8911	0.0063	63
2	1.9664	1.9732	0.0068	68
					3	1.9038	1.91	0.0062	62
4	1.9407	1.9466	0.0059	59
					5	1.8843	1.8898	0.0055	55
6	1.9586	1.9635	0.0049	49
					7	1.9211	1.9256	0.0045	45

The blank tobacco content of lignin of table 5.

Table 6. changes 35S-4CL1 fusion gene cigarette content of cellulose

Sample number	Cuvette difference	OD 590nm	Correction value	The Y value	The X value	Content of cellulose (%)
							1	-0.001	0.412	0.413	0.009	0.024007	3.213935
2	-0.01	0.397	0.407	0.015	0.037102	4.9669904
							3	-0.008	0.38	0.388	0.034	0.078568	10.518333
4	-0.006	0.373	0.379	0.043	0.09821	13.147916
							5	-0.01	0.369	0.379	0.043	0.09821	13.147916
6	-0.009	0.352	0.361	0.061	0.137495	18.407082
							7	-0.01	0.345	0.355	0.067	0.150589	20.160137

The blank baccy fiber cellulose content of table 7.

Sample number	Cuvette difference	OD 590nm	Correction value	The Y value	The X value	Content of cellulose (%)
							1	-0.001	0.375	0.376	0.046	0.1047577	14.849411
2	-0.01	0.368	0.378	0.044	0.1003928	14.230685
							3	-0.008	0.315	0.323	0.099	0.2204278	31.245635
4	-0.006	0.309	0.315	0.107	0.2378874	33.720537
							5	-0.01	0.301	0.311	0.111	0.2466172	34.957988
6	-0.009	0.292	0.301	0.121	0.2684417	38.051615
							7	-0.01	0.286	0.296	0.126	0.279354	39.598429

The transgene tobacco that embodiment 2, cultivation content of lignin reduce

1,35S-antisense 4CL1 fusion gene carrier pBan4CL makes up

With the total DNA of willow that extracts according to ordinary method is template, at primers F AN1:CTCTAGATTATATGCCTGCCAAC TTTTC, under the guiding of FAN2:CCCCGGGATGGACGCCACAATGAATCCAC, according to following cycling program: 94 degree 5min; 94 degree 30sec, 55 degree 45sec, 72 degree 90sec, 30 circulations; 72 degree 10min carry out pcr amplification, recovery, purifying pcr amplification product, obtain the 4CL1 gene fragment of antisense, utilize Xba I and Sma I enzyme to cut the pcr amplification product and the PUC18 of purifying respectively, connect then, will connect product transformed into escherichia coli DH5 α, obtain positive colony through screening, extract the plasmid in the positive colony, obtain subcloning vector pUan4CL.

35S-antisense 4CL1 fusion gene carrier pBan4CL building process is shown in Figure 12 a, concrete steps are as follows: antisense 4CL1 gene (anti-4CL1) fragment is downcut from subcloning vector pUan4CL with Xba I/Sma I according to ordinary method, and be connected with the pBI121 carrier of cutting through Xba I/Sma I enzyme, obtain to contain the recombinant vectors pBan4CL of fusion gene 35S-antisense 4CL1 gene.With plasmid pBan4CL according to ordinary method transformed into escherichia coli JM109 competent cell.After the dull and stereotyped cultivation screening of the LB that contains kantlex, extract plasmid and according to a conventional method plasmid pBan4CL is checked order, the result shows the nucleotide sequence that antisense 4CL1 fusion gene has sequence 2 in the sequence table, between the 5827bp-7463bp of pBan4CL; Sequence 2 in the sequence table is by 1637 based compositions.

2, conversion of tobacco and identification and analysis

By improved An method, directly transform Agrobacterium LBA4404, at the enterprising row filter of YEB substratum of Sm 125mg/L and Km 50mg/L, and the picking mono-clonal extracts plasmid and carries out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of tobacco aseptic seedling is cut, remove vein, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 2-3min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the MS substratum of the filter paper in shop, surface, 28 ℃ of dark cultivations 4 days, explant transferred to contain 100mg/L Km, the MS substratum (0.5mg/L IAA, 2.0mg/L BA) of 500mg/L Car (carboxylic Bian mycin) continues to cultivate for last 28 ℃, simultaneously unconverted tissue is handled equally as negative contrast.Changed a subculture every 14 days.When resistant buds is grown to 1-3cm, downcut, forward long shoot in the substratum to.Long during when stem to 3-5cm, forward to according to the method for document (Wang Guanlin, Fang Hongjun, 1999, Science Press) and contain kantlex and carboxylic benzyl mycin is taken root in root media, obtain regrowth.Total DNA with the total DNA of blade, pBan4CL plasmid and the unconverted tobacco leaf of the conversion seedling of taking root on the resistance substratum is a template, under the guiding of primers F an1-TTATATGCCTGCCAACTTTTC and Fan2-ATGGACGCCACAATGAATCCAC, carry out pcr amplification according to a conventional method, amplified production carries out the agarose gel electrophoresis analysis, the result is shown in Figure 12 b, show to transform the fragment that produces an about 1700bp in the seedling sample, and with unconverted plant for the negative PCR product that contrasts at the no band in 1.7Kb place.Proof antisense 4CL1 fusion gene has been incorporated in the tobacco gene group.Among Figure 12 b ,+ck is a pBan4CL plant binary expression vector, and-ck is unconverted tobacco sample, and M is the nucleic acid molecular weight standard, and Trans is for changeing 35S-antisense 4CL1 fusion gene tobacco sample.

3, the southern of transgene tobacco hybridization

Extract total DNA of transgene tobacco and non-transgenic tobacco according to ordinary method, with the negative contrast of non-transgenic tobacco, with the positive contrast of pBan4CL plant binary expression vector, use the BamHI/SmaI restriction enzyme to carry out enzymolysis 3 hours at 37 degree, carry out 1% agarose gel electrophoresis, running gel is placed on sex change liquid (the 1.5M NaCl of 10 times of volumes, 0.5M concussion 40min NaOH), again at neutralizer (the 1.5M NaCl of 10 times of volumes, 0.5M Tris-Cl, pH 7.0) middle concussion 40min, use 20 * SSC to carry out DNA commentaries on classics film and spend the night, wash film with 2 * SSC, in 80 ℃ of dryings 2 hours.With 1ug PCR make antisense 4CL1 gene as the template DNA adding distil water to 16ul.Boiling water bath 10min places frozen water 5min rapidly.Add 2ulDIG-HIGH PRIME, mixing.37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (high-new test kit carry) is to 42 ℃.Prehybridization 30min.Get dna probe (the probe consumption is the 25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change dna probe adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble, seal, 42 ℃ are spent the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1%SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings (100ml toxilic acid damping fluid (0.1M toxilic acid, 0.15M NaCl, pH 7.5) the middle 0.3ml tween20 that adds) cleaning 1-5min, add 80ml confining liquid (high-new test kit carry) insulation 30min, with 20ml antibody liquid (high-new test kit carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result shows the band that occurs a 1700bp in the transgene tobacco as shown in figure 13, and transgene tobacco does not then have this band, proves that this antisense 4CL1 gene inserts in the transgene tobacco.Among Figure 13, CK is a non-transgenic tobacco negative control, 1 positive contrast pBan4CL plant binary expression vector, and 2-4 is for changeing 35S-antisense 4CL1 fusion gene tobacco.

4, change the mensuration of 4CL1 enzymic activity in the 35S-antisense 4CL1 fusion gene tobacco

Transgene tobacco blade and stem are pulverized under liquid nitrogen, with extracting damping fluid (0.2M Tris-HCl pH7.5,8mMMgCl ₂, 5mM DTT, 30% glycerine, 1ug/ml leupeptin (Leupeptin)) extract, extracting solution is at 18000g, 4 ℃ of centrifugal 15min, and supernatant liquor is used for enzyme activity assay.Use BSA to do typical curve, quantitative to protein crude extract.The measured value of protein standard curve is as shown in table 8, and the typical curve that obtains as shown in figure 14.Comprise 0.2M Tris-HCl in the 1ml enzyme reaction solution, pH7.5,8mM MgCl ₂, 0.8mM ATP, 0.1mM substrate (being respectively the 4-coumaric acid, forulic acid and coffic acid) and 25-30ul crude extract reacted respectively 5,10,15,20,25,30,35 minutes in 24 ℃, measured A then ₃₃₃, A ₃₄₆, A ₃₅₀Obtain the blank tobacco contrast shown in Figure 15 a and 15b and change 4CL1 enzymic activity curve in the 35S-antisense 4CL1 fusion gene tobacco, show that the activity of 4CL1 enzyme when 15min is the highest, enzymic activity when therefore, this research is 15min during 4CL1 active in the employing reaction times in measuring transfer-gen plant and blank plant.And the 4CL1 enzymic activity of changeing 35S-antisense 4CL1 fusion gene tobacco plant is starkly lower than the enzymic activity of blank plant.

1ml enzyme reaction solution and 25-30ul crude extract react 15 minutes mensuration A respectively in 24 ℃ ₃₃₃, A ₃₄₆, A ₃₅₀Minimizing.Each sample is done 3 parallel laboratory tests.Result such as table 9 and shown in Figure 16 show that the 4CL1 enzymic activity of changeing in the 35S-antisense 4CL1 fusion gene tobacco is starkly lower than the 4CL1 enzymic activity in the blank tobacco.Among Figure 16, CK1, CK2 and CK3 are blank tobacco plant, and Sample1-Sample6 is for changeing 35S-antisense 4CL1 fusion gene tobacco plant.

Table 8. protein standard curve determination value

4CL1 enzyme assay value in table 9. transfer-gen plant and the blank plant

5, change xylogen and content of cellulose analysis in 35S-4CL1 fusion gene, the commentaries on classics 35S-antisense 4CL1 fusion gene tobacco plant

The glucose typical curve

Cellulosic mensuration is under the effect of concentrated acid, is monose with cellulose degradation.With the monose quantitative (table 10) of glucose typical curve to being degraded, resulting glucose typical curve is shown in Figure 17 a.

Table 10. glucose standard curve determination value

The pipe number	1	2	3	4	5	6	7
								Sugar degree	0	0.1	0.2	0.3	0.4	0.5	0.6
OD 590nm	0.479	0.429	0.362	0.343	0.301	0.255	0.215
								Correction value	0	0.046	0.098	0.136	0.177	0.224	0.273

(1) from the commentaries on classics of strain more than the 80 35S-antisense 4CL1 fusion gene tobacco plant that obtains, gets 5,6 strains, detected respectively that content of lignin and content of cellulose change in they and the blank tobacco plant, the result is shown in Figure 17 b and Figure 17 c, the content of lignin that shows transgenic tobacco plant has on average descended 19.1% than blank plant, simultaneously, content of cellulose has on average raise 11.4%.

35S-4CL1 fusion gene tobacco plant and blank tobacco plant xylogen and content of cellulose are changeed in 6 strains that obtain among the embodiment 1 to be analyzed, the result is shown in Figure 18 a and Figure 18 b, show that the content of lignin that changes 35S-4CL1 fusion gene plant has on average raise 36.83% than blank plant, simultaneously, content of cellulose has on average descended 23.70%.

By the analysis of changeing 35S-4CL1 fusion gene, 35S-antisense 4CL1 fusion gene tobacco plant is found, no matter all show the relation of mutual compensation between the transfer-gen plant xylogen of justice still to be inverted defined gene transform acquisition and the Mierocrystalline cellulose.Be content of lignin when descending, content of cellulose then rises to some extent; Vice versa.

The transgenosis Cortex Populi Tomentosae 741 that embodiment 3, cultivation content of lignin raise

1, the conversion of Cortex Populi Tomentosae 741

With the 35S-4CL1 plant binary expression vector pB4CL that builds, by improved An method, directly transform Agrobacterium LBA4404, at the enterprising row filter of YEB substratum of Sm 125mg/L and Km 50mg/L, and the picking mono-clonal extracts plasmid and carries out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of Cortex Populi Tomentosae 741 aseptic seedling is cut, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 10min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the Cortex Populi Tomentosae 741 blade division culture mediums-MS substratum (0.1mg/LNAA, 1.0mg/L BA), 28 ℃ of dark cultivations 4 days, explant transferred to contain 100mg/L Km, the blade differentiation MS substratum (0.1mg/L IAA, 1.0mg/L BA) of 250mg/L Car (carboxylic Bian mycin), 28 ℃ are continued to cultivate, and simultaneously unconverted tissue are handled equally as negative contrast.Changed a subculture every 14 days.Long during to 3-5cm when stem, (0.3mg/L NAA is taken root in 1.0mg/LBA), and the result obtains regrowth 14 strains to forward the root media 1/2MS substratum that contains kantlex and carboxylic benzyl mycin to.

2, the southern of transgenosis Cortex Populi Tomentosae 741 hybridization

Extract total DNA of transgenosis Cortex Populi Tomentosae 741 and non-transgenic Cortex Populi Tomentosae 741 according to ordinary method, with the non-transgenic tobacco is contrast, use the SmaI restriction enzyme to spend enzymolysis after 10 hours 30,1% agarose gel electrophoresis, running gel is placed on sex change liquid (the 1.5M NaCl of 10 times of volumes, 0.5M concussion 40min NaOH), again at neutralizer (the 1.5M NaCl of 10 times of volumes, 0.5M Tris-Cl, pH 7.0) middle concussion 40min, using 20 * SSC to carry out DNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.Make probe with 1ug by the 4CL1 gene fragment that PCR obtains, adding distil water is to 16ul, and boiling water bath 10min places frozen water 5min rapidly.Add 2ulDIG-HIGH PRIME, mixing.37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (carry in the high-new test kit hybridization solution) is to 42 ℃.Prehybridization 30min.Get dna probe (the probe consumption is the 25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change dna probe adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble, seal, 42 ℃ are spent the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1%SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings-100ml toxilic acid damping fluid (Maleic acid buffer) (0.1M toxilic acid, 0.15M NaCl, pH 7.5) the middle 0.3ml tween20 cleaning 1-5min that adds, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result shows the band that occurs a 1700bp in the transgenosis Cortex Populi Tomentosae 741, and transgenosis Cortex Populi Tomentosae 741 does not then have this band, proves that this 4CL1 gene has inserted in the transgenosis Cortex Populi Tomentosae 741.

3, the mensuration of transgenosis Cortex Populi Tomentosae 741 4CL1 enzymic activitys

Annual transgenosis Cortex Populi Tomentosae 741 blades are pulverized under liquid nitrogen, with extracting damping fluid (0.2M Tris-HClpH7.5,8mM MgCl ₂, 5mM DTT, 30% glycerine, 1ug/ml leupeptin (Leupeptin)) extract, extracting solution is at 18000g, 4 ℃ of centrifugal 15min, and supernatant liquor is used for enzyme activity assay.Use BSA to do typical curve, quantitative to protein crude extract.Comprise .0.2M Tris-HCl in the 1ml enzyme reaction solution, pH7.5,8mM MgCl ₂, 0.8mMATP, 0.1mM substrate (4-coumaric acid) and 25-30ul crude extract are measured A then in 24 ℃ of reactions 12 minutes ₃₃₃Increase.Each sample is done 3 parallel laboratory tests.The result is as shown in table 11, shows that the 4CL1 enzymic activity of the blade of transgenosis Cortex Populi Tomentosae 741 increases to some extent.

4CL1 enzyme activity assay in table 11. transgenosis Cortex Populi Tomentosae 741 blades

	OD eventually	At the beginning of the OD	OD	Protein content ug	Vigor OD/mg	Than vigor OD/mg/min
							Change 35S-4CL1 fusion gene Cortex Populi Tomentosae 741	0.742	0.678	0.064	17.67	3.62	0.72
CK	0.794	0.742	0.052	31.6	2.45	0.485

4, change xylogen, the Mierocrystalline cellulose analysis of 35S-4CL1 fusion gene Cortex Populi Tomentosae 741 blades

According to document (willis.A.lignin.Methods in Enzymology, 1988,161; 13-30) method of Miao Shuing has been measured sulfuric acid xylogen and the content of cellulose of annual transgenosis Cortex Populi Tomentosae 741 and blank Cortex Populi Tomentosae 741 plant, the result is as shown in table 12, the Cortex Populi Tomentosae 741 4Cl1 genes that show the 35S startup can change the xylogen and the content of cellulose of transgenosis Cortex Populi Tomentosae 741 blades in the transgenosis Cortex Populi Tomentosae 741 of stably express.

Table 12. transgenosis Cortex Populi Tomentosae 741 blade xylogen, Mierocrystalline cellulose analysis

	Content of lignin %	Content of cellulose %
			CK	16.78	45.12
Change 35S-4CL1 fusion gene Cortex Populi Tomentosae 741	20.72	17.93

The transgenosis Cortex Populi Tomentosae 741 that embodiment 4, cultivation content of lignin reduce

1, the conversion of Cortex Populi Tomentosae 741

By improved An method, the 35S-antisense 4CL1 fusion gene carrier pBan4CL that builds among the embodiment 2 is directly transformed Agrobacterium LBA4404, at the enterprising row filter of YEB substratum of Sm 125mg/L and Km 50mg/L, and the picking mono-clonal extracts plasmid and carries out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of Cortex Populi Tomentosae 741 aseptic seedling is cut, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 10min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the Cortex Populi Tomentosae 741 blade division culture mediums-MS substratum (0.1mg/LNAA, 1.0mg/L BA) 28 ℃ of dark cultivations 4 days, explant transferred to contain 100mg/L Km, the blade differentiation MS substratum (0.1mg/L IAA, 1.0mg/L BA) of 250mg/L Car (carboxylic Bian mycin) continues to cultivate for last 28 ℃, simultaneously unconverted tissue is handled equally as negative contrast.Changed a subculture every 14 days.Long during to 3-5cm when stem, (0.3mg/L NAA is taken root in 1.0mg/LBA), and the result obtains regrowth 19 strains to forward the root media 1/2MS substratum that contains kantlex and carboxylic benzyl mycin to.

2, the southern of transgenosis Cortex Populi Tomentosae 741 hybridization

Extract total DNA of transgenosis Cortex Populi Tomentosae 741 and non-transgenic Cortex Populi Tomentosae 741 according to ordinary method, with the non-transgenic tobacco is contrast, use the SmaI restriction enzyme to spend enzymolysis after 10 hours 30,1% agarose gel electrophoresis, running gel is placed on sex change liquid (the 1.5M NaCl of 10 times of volumes, 0.5M concussion 40min NaOH), again at neutralizer (the 1.5M NaCl of 10 times of volumes, 0.5M Tris-Cl, pH 7.0) middle concussion 40min, using 20 * SSC to carry out DNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.Make probe with the antisense 4CL1 gene fragment that 1ug PCR obtains, adding distil water is to 16ul, and boiling water bath 10min places frozen water 5min rapidly.Add 2ul DIG-HIGH PRIME, mixing.37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (carry in the high-new test kit hybridization solution) is to 42 ℃.Prehybridization 30min.Get dna probe (25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change dna probe adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble, seal, 42 ℃ are spent the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1%SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings-100ml Maleic acid buffer (0.1M Maletic acid 0.15MNaCl, pH 7.5) the middle 0.3ml tween20 cleaning 1-5min that adds, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result shows the band that occurs a 1700bp in the transgenosis Cortex Populi Tomentosae 741, and transgenosis Cortex Populi Tomentosae 741 does not then have this band, proves that antisense 4CL1 gene has been incorporated in the transgenosis Cortex Populi Tomentosae 741.

3, change the mensuration of 4CL1 enzymic activity in the 35S-antisense 4CL1 fusion gene Cortex Populi Tomentosae 741

Annual transgenosis Cortex Populi Tomentosae 741 blades are pulverized under liquid nitrogen, with extracting damping fluid (0.2M Tris-HClpH7.5,8mM MgCl ₂, 5mM DTT, 30% glycerine, 1ug/ml leupeptin (Leupeptin)) extract, extracting solution is at 18000g, 4 ℃ of centrifugal 15min, and supernatant liquor is used for enzyme activity assay.Use BSA to do typical curve, quantitative to protein crude extract.Comprise .0.2M Tris-HCl in the 1ml enzyme reaction solution, pH7.5,8mM MgCl ₂, 0.8mMATP, 0.1mM substrate (4-coumaric acid) and 25-30ul crude extract are measured A then in 24 ℃ of reactions 12 minutes ₃₃₃Increase.Each sample is done 3 parallel laboratory tests.The result is as shown in table 13, shows that the 4CL1 enzymic activity of changeing in the 35S-antisense 4CL1 fusion gene Cortex Populi Tomentosae 741 is starkly lower than the 4CL1 enzymic activity in the blank Cortex Populi Tomentosae 741.

4CL1 enzyme assay value in table 13. transgenosis Cortex Populi Tomentosae 741 and blank Cortex Populi Tomentosae 741 plant

Code name	OD eventually	At the beginning of the OD	OD	Protein content ug	Vigor OD/mg	Than vigor OD/mg/min
							CK	0.794	0.742	0.052	31.6	2.45	0.485
Change 35S-antisense 4CL1 fusion gene Cortex Populi Tomentosae 741	1.095	1.029	0.066	76.85	0.86	0.17

4, annual transgenosis Cortex Populi Tomentosae 741, the bark of trunk and the water content of xylem, xylogen and content of cellulose are measured

According to document (willis.A.lignin.Methods in Enzymology, 1988,161; 13-30) method of Miao Shuing has been measured water content, sulfuric acid xylogen and the content of cellulose of annual transgenosis Cortex Populi Tomentosae 741 and wild Cortex Populi Tomentosae plant, the result is as shown in table 14, the water content and the content of lignin that show transgenosis Cortex Populi Tomentosae 741 xylems and bark all are lower than wild Cortex Populi Tomentosae corresponding site, the content of cellulose of transgenosis Cortex Populi Tomentosae 741 xylems is lower than the xylem of wild Cortex Populi Tomentosae, and the content of cellulose of transgenosis Cortex Populi Tomentosae 741 barks is higher than the bark of wild Cortex Populi Tomentosae.

Water content, xylogen and the Mierocrystalline cellulose distributional analysis table of the annual commentaries on classics 35S-of table 14. antisense 4CL1 fusion gene Cortex Populi Tomentosae 741

Sequence table

<160>2

<210>1

<211>1741

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

cgcaatggac gccacaatga atccacaaga agaattcatc tttcgctcaa aattaccaga 60

catctacatc ccgaaaaacc ttcccctgca ttcatacgtt cttgaaaact tgtctaacca 120

ttcatcaaaa ccttgcctga taaatggcgc gaatggagat gtctacacct atgctgacgt 180

tgagctcaca gcaagaagag ttgcttctgg tctgaacaag attggtattc aacaaggtga 240

cgtgatcatg ctcttcctac caagttcacc tgaattcgtg cttgctttcc taggcgcttc 300

acacagaggt gccattatca ctgctgccaa tcctttctcc acccctgcag agctagcaaa 360

acatgccaag gcctcgagag caaagcttct gataacacag gcttgttact acgagaaggt 420

taaagatttt gcccgagaaa gtgatgttaa ggtcatgtgc gtggactctg ccccggatgg 480

atgcttgcac ttttcagagc taacacaggc agacgaaaat gaagcgcctc aggtcgacat 540

tagtcccgat gatgtcgtag cattgcctta ttcatcaggg actacagggt tgccaaaagg 600

ggtcatgtta acgcacaaag ggctaataac cagtgttgct caacaggtag atggagacaa 660

tcctaacctg tattttcaca gtgaagatgt gattctgtgt gtgctgccta tgttccatat 720

ctatgctctg aattcaataa tgctctgcgg gctgagagtc ggtgccccga ttttgataat 780

gccaaagttt gagattggtt ctttactggg attgattgag aagtacaagg tatctatagc 840

accggttgtt ccacctgtga tgatgtcaat tgctaagtca cctgatcttg acaagcatga 900

cttgtcttct ttgaggatga taaaatctgg aggggctcca ttgggcaagg aacttgaaga 960

tactgtcaga gctaagtttc ctcaggctag acttggtcag ggatatggaa tgaccgaggc 1020

aggacctgtt ctagcaatgt gcttggcatt tgccaaggaa ccattcgaca taaaaccagg 1080

tgcatgtggg actgtagtca ggaatgcaga gatgaagatt gttgacccag aaacaggggc 1140

ctctctaccg aggaaccagc ctggtgagat ctgcatccgg ggtgatcaga tcatgaaagg 1200

atatcttaat gaccctgagg caacctcaag aacaatagac aaagaaggat ggctgcacac 1260

aggcgatatc ggctacattg atgatgatga tgagcttttc atcgttgaca gattgaagga 1320

attgatcaag tataaagggt ttcaggttgc tcctgctgaa ctcgaagctt tgttaatagc 1380

ccatccagag atatccgatg ctgctgtagt aggattgaaa gatgaggatg cgggagaagt 1440

tcctgttgca tttgtagtga aatcagaaaa gtctcaggcc accgaagatg aaattaagca 1500

gtatatttca aaacaggtga tattctacaa gagaataaaa cgagttttct tcattgaagc 1560

tattcccaag gcaccatctg gcaagatcct gaggaagaat ctgaaagaaa agttggcagg 1620

catataactg aagatgttac tgaacattta atcctctgtc ttatttcttt aatacttgag 1680

aatcattgta gtgttgaacc aagcatgctt ggaaaagaca cgtacccaac gtaagacagt 1740

a 1741

<210>2

<211>1637

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>2

ctctagatta tatgcctgcc aacttttctt tcagattctt cctcaggatc ttgccagatg 60

gtgccttggg aatagcttca atgaagaaaa ctcgttttat tctcttgtag aatatcacct 120

gttttgaaat atactgctta atttcatctt cggtggcctg agacttttct gatttcacta 180

caaatgcaac aggaacttct cccgcatcct catctttcaa tcctactaca gcagcatcgg 240

atatctctgg atgggctatt aacaaagctt cgagttcagc aggagcaacc tgaaaccctt 300

tatacttgat caattccttc aatctgtcaa cgatgaaaag ctcatcatca tcatcaatgt 360

agccgatatc gcctgtgtgc agccatcctt ctttgtctat tgttcttgag gttgcctcag 420

ggtcattaag atatcctttc atgatctgat caccccggat gcagatctca ccaggctggt 480

tcctcggtag agaggcccct gtttctgggt caacaatctt catctctgca ttcctgacta 540

cagtcccaca tgcacctggt tttatgtcga atggttcctt ggcaaatgcc aagcacattg 600

ctagaacagg tcctgcctcg gtcattccat atccctgacc aagtctagcc tgaggaaact 660

tagctctgac agtatcttca agttccttgc ccaatggagc ccctccagat tttatcatcc 720

tcaaagaaga caagtcatgc ttgtcaagat caggtgactt agcaattgac atcatcacag 780

gtggaacaac cggtgctata gataccttgt acttctcaat caatcccagt aaagaaccaa 840

tctcaaactt tggcattatc aaaatcgggg caccgactct cagcccgcag agcattattg 900

aattcagagc atagatatgg aacataggca gcacacacag aatcacatct tcactgtgaa 960

aatacaggtt aggattgtct ccatctacct gttgagcaac actggttatt agccctttgt 1020

gcgttaacat gacccctttt ggcaaccctg tagtccctga tgaataaggc aatgctacga 1080

catcatcggg actaatgtcg acctgaggcg cttcattttc gtctgcctgt gttagctctg 1140

aaaagtgcaa gcatccatcc ggggcagagt ccacgcacat gaccttaaca tcactttctc 1200

gggcaaaatc tttaaccttc tcgtagtaac aagcctgtgt tatcagaagc tttgctctcg 1260

aggccttggc atgttttgct agctctgcag gggtggagaa aggattggca gcagtgataa 1320

tggcacctct gtgtgaagcg cctaggaaag caagcacgaa ttcaggtgaa cttggtagga 1380

agagcatgat cacgtcacct tgttgaatac caatcttgtt cagaccagaa gcaactcttc 1440

ttgctgtgag ctcaacgtca gcataggtgt agacatctcc attcgcgcca tttatcaggc 1500

aaggttttga tgaatggtta gacaagtttt caagaacgta tgaatgcagg ggaaggtttt 1560

tcgggatgta gatgtctggt aattttgagc gaaagatgaa ttcttcttgt ggattcattg 1620

tggcgtccat cccgggg 1637

Claims (9)

1, a kind of method of regulating and controlling plant lignin content is to transform plant with containing antisense 4CL1 expression carrier, obtains the plant that content of lignin reduces.

2, method according to claim 1 is characterized in that: described antisense 4CL1 gene is the polynucleotide sequence with sequence 2 in the sequence table.

3, method according to claim 1 and 2 is characterized in that: being used to make up the described carrier that sets out that contains antisense 4CL1 expression carrier is Ti class plasmid vector and virus vector.

4, method according to claim 3 is characterized in that: the described carrier that sets out is a Ti class plasmid vector.

5, method according to claim 4 is characterized in that: described Ti class plasmid vector is a binary vector.

6, method according to claim 5 is characterized in that: described binary vector is pBI121.

7, method according to claim 6 is characterized in that: the described antisense 4CL1 expression carrier that contains is pBan4CL.

8, according to claim 1,2 or 3 described methods, it is characterized in that: described plant is herbaceous plant or xylophyta; Described herbaceous plant is preferably tobacco, and described xylophyta is preferably willow.

9, according to claim 1,2 or 3 described methods, it is characterized in that: described method for transformation is agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method, is preferably the agrobacterium mediation converted method.

Images