CN1733923A - Method for regulating plant lignin content - Google Patents

Abstract

The invention provides a process for regulating plant lignin content, which comprises transforming plants with expression vectors containing GRP1.8 promotor-4CL1 fusion gene, obtaining plants with increased lignin content, and transforming plants with expression vectors containing antisense 4CL1 gene and fusion gene of the glycine-rich protein grp1.8 gene promotor, thus obtaining plants with decreased lignin content.

Description

The method of regulating and controlling plant lignin content

Technical field

The present invention relates to the method for a kind of regulating and controlling plant lignin content in the bioengineering field.

Background technology

Effective vascular tissue of plant evolution formation is vital for the appearance of terrestrial plant.For the perennial woody plant, because its perennial and specificity forms timber, it is even more important that vascular tissue seems especially.The plant vasular tissue comprises phloem and xylem.Xylem and phloem all in the development of plants process by cambial cell differentiation with approach and form breaking up again of ancient piece of jade, round, flat and with a hole in its centre cell.The key of cytodifferentiation is that cell is according to certain program generation differential gene expression.The key link of differential gene expression is synthetic narrow spectrum mRNA.It has been generally acknowledged that gene now differentially expressed be that the specific regulating element of this gene waits as promotor.Current research thinks that the promotor of tissue-specific gene plays an important role to the tissue specific expression of this gene.In order to study the molecule mechanism in plant vasular tissue development and the atomization, the research to the vascular tissue specificity promoter in recent years becomes focus.

Keller etc. find that in the research of glycin-rich protein grp1.8 gene promoter there is the mutual coordination between just regulating of cis element and negative the adjusting in Kidney bean glycin-rich protein grp1.8 gene promoter.In the promotor of total length 496bp, comprise four organizing specific controlling elements: NRE negative regulatory element, RSE controlling element (26bp ,-98 to-73), VSE controlling element, SE1 (24bp ,-119 to-96), SE2.Caulimovirus 35S promoter minimal segment (not expressing the gus gene activity in transgene tobacco) (is comprised NRE with a 169bp (205 to-35) of grp1.8 promotor and the fragment of 141bp (205 to-64), SE1, RSE) be connected, and transformation of tobacco, finding can the specific GUS activity that detects in vascular tissue.Discover that RSE energy genes activated specifically is specific expressed in vascular tissue.Find that simultaneously the VSE controlling element not only works to the specific expressed of gene, can also promote the quantity of genetic expression.

Antisense technology is according to the base complementrity principle, with synthetic or organism synthetically particular complementary DNA or RNA segment (or chemically modified product) suppresses or the technology of sealing genetic expression.Mainly comprise antisense oligonucleotide technology, Antisense RNA Technique and ribozyme (Ribozyme) technology etc.

Because the foundation of plant soma totipotency and group training system, the progress of the biological significance of external source sense-rna in eukaryotic cell is very fast.First sense-rna system that is applied to plant is Nos promotor and 3 ' terminal being connected on the pUC18 carrier afterwards that the CAT gene of bacterium is connected Agrobacterium, and the protoplastis of transformation of carrot finds that the CAT expression of gene has been subjected to inhibition.The Holland scholar oppositely is connected the cDNA of cinnamophenone (CHS) with the 35S promoter of CaMV, regenerated transgenic plant behind the conversion petunia, and its pattern becomes pink and is mingled with white from original red-purple, and some plant flower becomes white fully.A series of detections show that endogenous CHS mRNA of transgenic petunia and protein content reduce, thereby have reduced the biosynthesizing of flavonoid.The test of backcrossing shows that also this proterties gives the offspring by the karyomit(e) genetic stability.This is that the activity that utilizes the artificial sequence antisense rna system to regulate Plant Genome has first obtained success, for a new field has been opened up in the Horticulture breeding.

Xylogen is the phenol polymer by three kinds of alcohol monomers or single wooden phenol (to tonquinol, lubanol, sinapyl alcohol) a kind of complexity of synthetic.In the lignification of cell walls, xylogen penetrates in the cell walls, is filled in the Mierocrystalline cellulose framework, as the formation of conduit and test-tube baby cell.Because the infiltration of xylogen, strengthened the hardness of cell walls, the mechanical holding power or the ultimate compression strength of cell have been strengthened, promote the formation of mechanical tissue, to help effects such as consolidation and support plant materials and the defeated road of moisture, the while is owing to the chemical property of xylogen, as the phenol polymer of insolubility with complexity, make xylem have the cell walls hydrophobicity, also strengthened resistance against diseases.

The secondary xylem of trees has Mierocrystalline cellulose (β-1-4-glucosides) xylogen (phenyl polymer) and hemicellulose (special-shaped polysaccharide), and ratio is about 2: 1: 1.When arboreal growth, cellulose microfibril provides tension force for cell walls, and xylogen increases the hardness of cellulose microfibril.The timber that content of lignin is high is widely used in building and field of furniture owing to hardness is high.But in paper-making process, need to remove xylogen.The xylogen of removing at present in the wood pulp generally needs by the higher chemical substance of toxicity, this procedure be expend the energy in the paper industry most, to a link of environmental hazard maximum.Be that content of lignin or the reduction content of lignin that improves trees all will be of value to production.

From strategy, can carry out content of lignin control from many aspects: the synthetic of various enzymes system (1) control xylogen route of synthesis is an important channel, as transforming and might achieve the goal carrying out inverted defined gene from the PAL enzyme to superoxide enzyme/laccase etc.; (2) structure that changes xylogen is formed and chemical property.Because one of free-revving engine of research content of lignin heritable variation is exactly to be industrial papermaking service, is being difficult to directly reduce under the content of lignin situation, the structure composition that changes xylogen might reach same effect indirectly; (3) precursor that must recognize xylogen is a synthetic in tenuigenin, transfer to cell walls then and carry out dehydrogenation polymerization and form xylogen, therefore the synthetic regulation and control of xylogen also note the effect that relates to some non-zymochemistry molecules, promptly transmit the control of transportation, but the rarely found so far report research of the research of this respect.Interaction between the effect of single enzyme and a plurality of enzyme is significant for the synthesis mechanism of exploring xylogen, so the molecular biological characteristic of lignin biosynthesis and Study on mechanism are paid attention to day by day.

The method of at present direct using gene engineering changes the existing report of research of content of lignin.The CCR that Piquemal etc. separate from ridge Buddhist nun eucalyptus (Eucalyptus) (hydroxyl cinnyl CoA-reductase) is the antisense construct carrier of the cDNA of enzyme (EC1.2.1.44), be transformed on the tobacco (Nicotianatabacum L.) by Agrobacterium (Agrobacerium), the result demonstrates CCR mRNA content and the active decline of CCR when stable state, and the plant tracheid wall that content descends is orange-brown, the ratio of Syringa oblata Lindl. base and guaiacyl improves, and undesired cell walls aldehydes matter occurs.Yet the active serious plant that descends of CCR is except showing xylogen descends, and it is little, leaf unusual and crimp feature such as conduit also to show body.It has been generally acknowledged that CAD (hydroxyl cinnamyl-alcohol dehydrogenase) is the enzyme of catalysis xylogen precursor synthetic final step, therefore reduce the CAD activity and might reduce the synthetic of xylogen precursor.The cDNA of the CAD enzyme that researchs such as Baucher will be separated from comospore poplar * eastern cottonwood (P.trichocarpa Torr.Et Groy * P.deltoides Marsh.) carries out justice by Agrobacterium and antisense is transformed into trembling poplar * white poplar (P.tremula L. * P.alba L.), the result shows that 3 antisenses transform and the active decline 70% of the CAD of xylem organization of the strain that 2 are suppressed altogether, in the CAD activity is less than 60% strain, can detect red xylem, but content of lignin is similar to check clone with composition, does not descend.But the chemical property difference of cell walls, behind the application phloroglucinol stain, the xylem of normal strain is typical incarnadine, and is red-brown after the active strain dyeing that descends of CAD.After handling with NaOH, by with after having alkali-soluble part in the cell walls and carrying out acidification, the xylogen of strain with red xylem is precipitable, and the xylogen of the strain of white wooden portion does not precipitate.Willow vanillin food grade,1000.000000ine mesh and Syringa oblata Lindl. base aldehyde that spectroscopic analysis demonstrates red xylem improve.The active strain that descends of paper pulp evidence CAD has only a spot of xylogen to be stored in the paper pulp.Similarly report also has Higuchi etc., and CAD antisense plants transformed content of lignin does not descend, but change has taken place for the composition of xylogen and chemical property.The CAD antisense transforms the back content of lignin and does not descend, and the result of this and occurring in nature torch pine CAD mutant is inconsistent.OMT is important control lignin biosynthesis, after being transformed in the tobacco gene group after enhanser, promotor and the terminator assembling with the antisense sequences of the bi-OMT that encodes in the Populus tremuloides (EC2.1.1.68) enzyme and Ca MV3 5S gene such as Dwivedi, transfer-gen plant shows normal phenotype.In the stem of 4 transfer-gen plants, the active average of OMT (coffic acid O-methyltransgerase) enzyme descends 29%.Stem's wood chemistry analytical results demonstrates Syringa oblata Lindl. base unit content and descends, and content of lignin decline level is relevant with bi-OMT enzymic activity degree.After Doorsselaere etc. used antisense COMT (coffic acid methyltransgerase) and transform trembling poplar * white poplar, it is normal 5% that the COMT activity drops to, but content of lignin does not descend.Transform the research report that single enzyme genetic method is transformed the tobacco content of lignin according to using, reduce single enzyme OMT, CAD, POD (peroxidase), COMT and F5H enzymic activitys such as (forulic acid 5-hydroxylases), not influencing content of lignin changes, and reduce enzyme is PAL (phenylalanine ammonia lyase), C4H (styracin 4-hydroxylase) and CCR enzymic activitys such as (hydroxyl cinnyl CoA-reductases), then can reduce content of lignin.

Be tested and appraised the enzyme and the gene of xylogen route of synthesis in trees and the herbaceous plant, made great efforts to reduce the content of xylogen in the trees in the past, by tone coded coffic acid O-methyltransgerase or cinnamyl-alcohol dehydrogenase content are not succeedd the structure of just having modified xylogen down.The content that reduces these enzymes in transgene tobacco shows the content that does not reduce xylogen.Yet by reduce phenylalanine deaminase content in transgene tobacco, significantly reduced the content of xylogen, the approach that enters phenylpropyl derivatives in this enzyme catalysis xylogen route of synthesis has caused a series of phenotypes undesired.Same in transgenic arabidopsis and tobacco, also reduced the content of (25%-40%) xylogen, but caused the committee of cell walls to contract and downgrade by the content that reduces the styracin CoA-reductase.These vegetation systems have clearly shown the possibility of modifying secondary metabolism and xylogen quality.Therefore, can the problem of trees biotechnology be reduce content of lignin and do not influence the hardness of structure and the growth of trees.

The ligation of the 4CL of willow (4-coumaric acid CoA ligase) albumen Pt4CL1, Pt4CL2 catalysis hydroxycinnamic acid and CoA is for the biosynthesizing of xylogen and flavonoid provides the phenols precursor.Pt4CL2 expresses in the epidermic cell of stem and leaf, and is synthetic relevant with flavonoid.Pt4CL1 expresses in the xylem of growing, synthetic relevant with xylogen.

The innovation and creation content

The method that the purpose of this invention is to provide a kind of regulating and controlling plant lignin content.

The method of regulating and controlling plant lignin content provided by the present invention is that the expression vector that will contain GRP1.8 promotor-4CL1 fusion gene transforms plant, obtains the plant that content of lignin raises; The expression vector that will contain GRP1.8 promotor-antisense 4CL1 fusion gene transforms plant, obtains the plant that content of lignin reduces.

Described GRP1.8 promotor-4CL1 fusion gene has the polynucleotide sequence of sequence 1 in the sequence table.

Sequence 1 in the sequence table is by 2378 based compositions, and the open reading frame of 4CL1 gene is from the 635th-2254 nucleotide sequences of 5 ' end.

The polynucleotide sequence that described GRP1.8 promotor-antisense 4CL1 fusion gene has sequence 2 in the sequence table.

Sequence 2 in the sequence table is by 2248 based compositions.

The carrier that sets out that is used to make up the expression vector of the described GRP1.8 of containing promotor-4CL1 fusion gene or contain the expression vector of GRP1.8 promotor-antisense 4CL1 fusion gene can be Ti class plasmid vector and virus vector, is preferably Ti class plasmid vector.

Described Ti class plasmid vector is preferably binary vector, as pBI121.The expression vector of the described GRP1.8 of containing promotor-4CL1 fusion gene is preferably PBPI; The expression vector of the described GRP1.8 of containing promotor-antisense 4CL1 fusion gene is preferably PBCHFA1.

Described method for transformation can be agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method, is preferably the agrobacterium mediation converted method.

In the inventive method, described plant can be herbaceous plant or xylophyta, and wherein, described herbaceous plant is preferably tobacco, and described xylophyta is preferably willow.

The present invention is by introducing 4CL1 gene and the fusion gene of glycin-rich protein grp1.8 gene promoter or the fusion gene of antisense 4CL1 gene and glycin-rich protein grp1.8 gene promoter in vegetable cell, the transgenic plant that produce the content of lignin rising or reduce are transgenic trees particularly, provides an important approach for cultivating content of lignin reduction or the plant that raises and improveing the trees wood property.

Description of drawings

Fig. 1 is the building process synoptic diagram of GRP1.8 promotor-4CL1 fusion gene carrier PBPI

Fig. 2 is for changeing GRP1.8 promotor-4CL1 fusion gene tobacco regrowth photo

Fig. 3 detects collection of illustrative plates for the PCR that changes GRP1.8 promotor-4CL1 fusion gene tobacco regrowth

Fig. 4 is for changeing the southern hybridization collection of illustrative plates of GRP1.8 promotor-4CL1 fusion gene tobacco

Fig. 5 is for changeing the northern hybridization collection of illustrative plates of GRP1.8 promotor-4CL1 fusion gene tobacco

Fig. 6 a is for changeing the 4CL1 activation analysis histogram in GRP1.8 promotor-4CL1 fusion gene tobacco leaf

Fig. 6 b is for changeing the 4CL1 activation analysis histogram in GRP1.8 promotor-4CL1 fusion gene tobacco stem

Fig. 7 changes synoptic diagram for changeing GRP1.8 promotor-4CL1 fusion gene content of lignin

The tobacco photo of Fig. 8 in the resistance substratum, taking root

The transgene tobacco seedling photo of Fig. 9 in the greenhouse, growing

Figure 10 detects collection of illustrative plates for changeing GRP1.8 promotor-antisense 4CL1 fusion gene tobacco DNAPCR

Figure 11 is for changeing GRP1.8 promotor-antisense 4CL1 fusion gene tobacco xylogen individual plant content histogram

Figure 12 is for changeing the plain individual plant content of GRP1.8 promotor-antisense 4CL1 fusion gene baccy fiber histogram

Figure 13 is the southern hybridization collection of illustrative plates of transgenosis Cortex Populi Tomentosae 741

Embodiment

The article No. of the used high-new test kit in ground is 92445820,31 Oct 2003 in following examples, Boehringer company.

The transgene tobacco that embodiment 1, cultivation content of lignin improve

1, the structure of GRP1.8 promotor-4CL1 fusion gene carrier PBPI

According to a conventional method, extract total RNA of Cortex Populi Tomentosae vegetable material, separating mRNA, cDNA is synthesized in reverse transcription, under the guiding of primer 1:5-CGCAATGGACGCACAATGAAT-3 and primer 2: 5-ANTGTCTTACGTTGGGTACG-3, with cDNA is the template pcr amplification, purifying reclaims the purpose fragment, and the back transformed into escherichia coli JM109 that links to each other with the pUC18-T carrier obtains positive colony through screening, extract the plasmid in the positive colony, obtain containing the carrier pt4CL of willow 4CL1 gene.

According to a conventional method, extract the total DNA of locust tree, with this total DNA is template, under the guiding of primer 1:5-GATGGCACTCTTGAAGC-3 and primer 2: 5-ATGAGAGTGAAGTGAAGCT-3, carry out pcr amplification, transformed into escherichia coli JM109 after amplified production purifying recovery back links to each other with the pUC18-T carrier, obtain positive colony through screening, extract the plasmid in the positive colony, obtain containing the carrier pGRP of locust tree GRP1.8 promotor.

With pt4CL is template, at primer 1:CAAGCTTGCAATG GACGCCACAATGAATCC, and primer 2: under the guiding of CGGATCCCTGTCTT ACGTTGGGTACG, according to following cycling program: 94 degree 5min; 94 degree 30sec, 55 degree 45sec, 72 degree 90sec, 30 circulations; 72 degree 10min carry out pcr amplification, recovery, purifying pcr amplification product, obtain the 4CL1 gene fragment, utilize PstI and BamHI enzyme to cut the pcr amplification product and the PUC18 of purifying respectively, connect then, will connect product transformed into escherichia coli DH5 α, obtain positive colony through screening, extract the plasmid in the positive colony, obtain subcloning vector p4CL1.

Use same quadrat method, with pGRP is template, at primer 3:CAAGCTTTGATGG CACTCTTGAAGC, carry out pcr amplification under the guiding of primer 4:CCTGCAGGAGAGTGAAGTGAAGCTG, recovery, purifying pcr amplification product, obtain locust tree GRP1.8 promoter gene fragment, utilize PstI and HindIII enzyme to cut the pcr amplification product and the PUC18 of purifying respectively, connect then, to connect product transformed into escherichia coli DH5 α, obtain positive colony through screening, extract the plasmid in the positive colony, obtain subcloning vector pGrp.

The building process of GRP1.8 promotor-4CL1 fusion gene carrier PBPI as shown in Figure 1, detailed process is as follows: with the HindIII/PstI enzyme locust tree GRP1.8 promotor (sjGRP1.8p) fragment is downcut from subcloning vector pGrp, with with the PstI/BamHI enzyme 4CL1 fragment is connected from the fragment that subcloning vector p4CL1 downcuts, connecting product recovery back is connected with the pBI121 carrier that the HindIII/BamHI enzyme is cut, acquisition contains the carrier PBPI of GRP1.8 promotor-4CL1 fusion gene, and PBPI changes competent escherichia coli cell according to a conventional method over to.After the dull and stereotyped cultivation screening of the LB that contains Km (kantlex) 100mg/L, extract that plasmid carries out simultaneously that the HindIII/BamHI enzyme is cut and be that primer carries out PCR and identifies, confirm that GRP1.8 promotor-4CL1 fusion gene is all in carrier PBPI with primer 3:CAAGCTTTGATGGCACTCTTGAAGC and primer 2: CGGATCCCTGTCTTACGTTGGGTACG.According to a conventional method plasmid PBPI is checked order, the result shows that GRP1.8 promotor-4CL1 fusion gene has the nucleotide sequence of sequence 1 in the sequence table, between the 4951bp-7323bp of PBPI; Sequence 1 in the sequence table is by 2378 based compositions, and the open reading frame of 4CL1 gene is from the 635th-2254 nucleotide sequences of 5 ' end.

2, conversion of tobacco and identification and analysis

By improved An method, directly transform Agrobacterium LBA4404, at the enterprising row filter of YEB substratum of Streptomycin sulphate (Sm) 125mg/L and Km 50mg/L, and the picking mono-clonal extracts plasmid and carries out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of tobacco aseptic seedling is cut, remove vein, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 2-3min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the MS substratum of the filter paper in shop, surface, 28 ℃ of dark cultivations 4 days, explant transferred to contain 100mg/L Km, the MS substratum of 500mg/L Car (0.5mg/L IAA, 2.0mg/L BA) continues to cultivate for last 28 ℃, simultaneously unconverted tissue is handled equally as negative contrast.Changed a subculture every 14 days.When resistant buds is grown to 1-3cm, downcut, forward long shoot in the substratum to.When stem length arrives 3-5cm, according to document (Wang Guanlin, Fang Hongjun, 1998, Science Press) method forwards in the root media (100mg/L Km, 500mg/L carboxylic Bian mycin (Car)) takes root, the result obtains 74 strains commentaries on classics GRP1.8 promotor-4CL1 fusion gene tobacco regrowth as shown in Figure 2.Get 20 strains and change GRP1.8 promotor-4CL1 fusion gene tobacco regrowth, extract the total DNA of plant according to a conventional method, at primer primer 3:CAAGCTTTGATGGCACTCTTGAAGC, carry out pcr amplification under the guiding of primer 4:CCTG CAGGAGAGTGAAGTGAAGCTG according to a conventional method, 13 strains as a result are that PCR detects positive (Fig. 3).

3, the southern of transgene tobacco hybridization

Extract total DNA that PCR detects male transgene tobacco and non-transgenic tobacco plant according to ordinary method, with the non-transgenic tobacco is contrast, use restriction enzyme Xba I to spend enzymolysis 3 hours 37, carry out 1% agarose gel electrophoresis, running gel is placed on sex change liquid (the 1.5M NaCl of 10 times of volumes, 0.5M concussion 40min NaOH), again at neutralizer (the 1.5M NaCl of 10 times of volumes, 0.5M Tris-Cl, pH7.0) concussion 40min in, using 20 * SSC to carry out DNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.Get the 4CL1 gene fragment that 1ug PCR obtains, adding distil water is to 16ul.Boiling water bath 10min places frozen water 5min rapidly.Add 2ulDIG-HIGH PRIME, mixing.37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (carry in the high-new test kit hybridization solution) is to 42 ℃.Prehybridization 30min.Get dna probe (the probe consumption is the 25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change dna probe adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble, seal, 42 ℃ are spent the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1% SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings-(100ml toxilic acid damping fluid (Maleic acid buffer) (0.1M toxilic acid, 0.15M NaCl, pH7.5) add 0.3ml tween20 in) cleaning 1-5min, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid (high-new test kit in carry) balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result shows to occur hybrid belt in the transgene tobacco that transgene tobacco does not then have hybrid belt as shown in Figure 4, proves that this GRP1.8 promotor-4CL1 fusion gene inserts in the transgene tobacco.Among Fig. 4, CK is the contrast of non-transgenic tobacco, and 1-3 is a transgene tobacco.

4, the Northern of transgene tobacco hybridization

Extracting total RNA that PCR detects the male transgenic tobacco plant according to ordinary method, is contrast with the non-transgenic tobacco, carries out the sex change agarose gel electrophoresis.Using 20 * SSC to carry out RNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.The DNA of the 4CL1 gene that obtains with 1ug PCR, adding distil water is to 16ul, and boiling water bath 10min places frozen water 5min rapidly, adds 2ul DIG-HIGH PRIME, mixing, 37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (high-new test kit in carry) is to 42 ℃.Prehybridization 30min.Get rna probe (the probe consumption is the 25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change probe rna adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble and seal, 42 ℃ spend the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml0.5 * SSC, 0.1% SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings (100ml toxilic acid damping fluid (Maleic acid buffer) (0.1M toxilic acid 0.15M NaCl, pH7.5) add 0.3mltween20 in) cleaning 1-5min, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid (high-new test kit in carry) balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-touse, seal, folder X-ray sheet, room temperature was placed 1 hour.The result as shown in Figure 5, showing has tangible hybrid belt in transgene tobacco, but not transgene tobacco do not have, and proves that the 4CL1 gene expresses in transgene tobacco.Among Fig. 5, CK is the non-transgenic tobacco, and sample is a transgenic tobacco plant.

5. the mensuration of transgene tobacco 4CL1 enzymic activity

PCR detects male transgene tobacco blade and stem is pulverized under liquid nitrogen respectively, with extracting damping fluid (0.2MTris-HCl pH7.5,8mM MgCl ₂, 5mM DTT, 30% glycerine, 1ug/ml leupeptin (Leupeptin)) extract, extracting solution is at 18000g, 4 ℃ of centrifugal 15min, and supernatant liquor is used for enzyme activity assay.Use BSA to do typical curve, quantitative to protein crude extract.Comprise 0.2M Tris-HCl (pH7.5) in the 1ml enzyme reaction solution, 8mM MgCl ₂, 0.8mM ATP, 0.1mM substrate (being respectively the 4-coumaric acid, forulic acid and coffic acid) and 25-30ul crude extract are measured A then in 24 ℃ of reactions 12 minutes ₃₃₃, A ₃₄₆, A ₃₅₀Increase.Each sample is done 3 parallel laboratory tests.The result is shown in table 1, table 2, Fig. 6 a and Fig. 6 b, and showing in the stem of transgene tobacco that the 4CL1 enzymic activity has more significantly improves (increasing 20-30%) and absolute increasing amount is also apparent in view.And in leaf increasing amount not obvious (increase 6-12%).Illustrate that the sjGRP1.8 promotor can be in the expression of the increase 4CL1 enzyme of the form layers site specific of transgene tobacco.In table 1 and the table 2,1-9 represents transfer-gen plant; Among Fig. 6 a and Fig. 6 b, sample1-sample9 is a transfer-gen plant.

Table 1. changes 4CL1 enzyme activity assay (is parallel with three groups) in GRP1.8 promotor-4CL1 fusion gene tobacco leaf

	4-coumaric acid (4-coumaric acid) pKa/mg albumen	Coffic acid (Caffeic acid) pKa/mg albumen	Forulic acid (Ferulic acid) pKa/mg albumen
				CK	17.7	8.1	10.3
1	18.9	9.2	11.2
				2	20.1	9.8	11.8
3	16.7	7.5	9.8
				4	18.7	8.4	10.9
5	17.1	7.9	10.0
				6	18.2	8.4	11.7

7	17.9	8.1	11.5
				8	21.3	9.1	13.5
9	23.1	9.0	13.7

Table 2. changes 4CL1 enzyme activity assay (is parallel with three groups) in GRP1.8 promotor-4CL1 fusion gene tobacco stem

	4-coumaric acid (4-coumaric acid) pKa/mg albumen	Coffic acid (Caffeic acid) pKa/mg albumen	Forulic acid (Ferulic acid) pKa/mg albumen
				CK	157.4	46.4	66.3
1	202.5	61.0	93.3
				2	184.3	51.4	84.9
3	173.2	50.9	69.3
				4	178.6	53.7	88.4
5	254.3	70.5	113.2
				6	182.7	52.3	70.9
7	199.8	68.3	84.9
				8	181.0	59.1	88.5
9	184.2	60.5	80.8

6, the mensuration of content of lignin in the transgene tobacco

PCR detects the transgene tobacco seedling rooting of the positive and 4CL1 enzyme activity vary stable and cultivates after 30 days, gets each 6 strain of blank (non-transgenic tobacco) and transfer-gen plant respectively, grinds under the liquid nitrogen freezing condition, takes by weighing 1.00g, adds the H of 6mL72% ₂SO ₄, 30-40 ℃ of water bath with thermostatic control constantly stirred 1 hour.Arrive H with distilled water diluting ₂SO ₄Concentration is to digest 1 hour 4%, 121 ℃ of second time.With the xylogen in different solvents (acetone, water, ethanol) the dissolving transgene tobacco, measure content, solid is dried to constant weight for 60 ℃ through centrifugal, calculates content of lignin.Result such as table 3, table 4, table 5 and shown in Figure 7 show that content of lignin is improved to some extent.Since different extracting method, its content different (4.0%-5.7%).In table 3, table 4 and the table 5,1-3 represents transfer-gen plant; Among Fig. 7, sample1-sample3 is a transfer-gen plant.

The variation of the content of lignin that table 3. acetone solution extracts (averaging for three times whenever for data determination)

Sample	Measured value	Increasing amount	Increase %	The average % that increases
					Contrast	19.733			5.617％
1	20.925	1.193	6.046％
				2	20.743	1.010	5.118％
3	20.855	1.122	5.686％

The variation of the content of lignin that table 4. water dissolution is extracted

Sample	Measured value	Increasing amount	Increase %	The average % that increases
					Contrast	12.900			5.720％
1	13.780	0.880	6.850％
				2	13.980	1.080	8.372％
3	13.150	0.250	1.938％

The variation of the content of lignin that table 5. dissolve with ethanol extracts

Sample	Measured value	Increasing amount	Increase %	The average % that increases
					Contrast	7.750			3.999％
1	8.140	0.390	5.030％
				2	8.060	0.310	4.000％
3	7.980	0.230	2.968％

The transgene tobacco that embodiment 2, cultivation content of lignin reduce

1, the structure of GRP1.8 promotor-antisense 4CL1 integrative gene expression vector PBCHFA1

Use primer a, b, c, d are template with pGRP that contains the GRP1.8 promotor and the pt4CL that contains the 4CL1 gene respectively, and the amplification target gene is used primer a, and the b amplification should obtain the band of a 600bp, uses primer c, and the d amplification should obtain the band of a 1700bp.

The reaction solution of PCR polymerase chain reaction is formed: 1 * buffer solution system; Oligonucleotide primer, 0.2umol/L; Dna profiling, 1ug/ul; Deoxynucleoside triphosphate, 100umol/L; Heat-staple TagDNA polysaccharase, 2.5U/100ul.Response procedures adopts 94 ℃ of sex change 5 minutes, 94 ℃ of template sex change 30 seconds, and 65 ℃ of primer annealings 45 seconds, 72 ℃ were extended 60 seconds, and after 30 circulations, 72 ℃ are extended and finished reaction in 10 minutes.Then two PCR reaction solutions are mixed, continue reaction 20 times with above-mentioned PCR program.Result product has three bands: be respectively 2300bp, and 1700bp, 600bp reclaims the band that test kit reclaims 2300bp with the glass of vast science and technology milk.

Primer a 5 '-CTCTAGATGATGGCACTCTTGAAGC-3 '

Primer b 5 '-AGTTGGCAGGCATATAAAGTGAAGTGAAGCTGAAA-3 '

Primer c 5 '-TTATATGCCTGCCAACT-3 '

Primer d 5 '-CCCCGGGATGGACGCCACAATGAATCCAC-3 '

To reclaim the 2300bp segment of purifying, spending the night for 16 ℃ with PMD-18T carrier (Takara) is connected, and obtain recombinant vectors transformed into escherichia coli JM109 (Frederick 1992), and by Shanghai Shen worker's sequence verification, this carrier is named and is T-CH.With T-CH carrier and the pBI101 vector plasmid XbaI/SmaI double digestion of verifying.The insertion dna segment ligation through the 2248bp of the PBI101 of XbaI/SmaI double digestion 1ul and purifying of getting that purifying reclaims obtains GRP1.8 promotor-antisense 4CL1 integrative gene expression vector PBCHFA1.With plasmid PBCHFA1 according to ordinary method transformed into escherichia coli JM109 competent cell.After the dull and stereotyped cultivation screening of the LB that contains Km 100mg/L, to be the bacterial strain Shanghai Shen worker order-checking of the PCR tests positive of primer through the XbaI/SmaI double digestion with primer a, d, the result shows the nucleotide sequence that the GRP1.8 promotor-antisense 4CL1 fusion gene has sequence 2 in the sequence table, between the 4975bp-7214bp of PBCHFA1; Sequence 2 in the sequence table is by 2248 based compositions.

2, conversion of tobacco and identification and analysis

By improved An method, PBCHFA1 directly transforms Agrobacterium LBA4404, and at the enterprising row filter of YEB substratum of Sm 125mg/L and Km 50mg/L, and the picking mono-clonal extracts plasmid and carry out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of tobacco aseptic seedling is cut, remove vein, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 2-3min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the MS substratum of the filter paper in shop, surface, 28 ℃ of dark cultivations 4 days have been transferred to explant on the division culture medium (MS substratum+0.5mg/L IAA+2.0mg/L BA) of selecting pressure (Km 100mg/L, Car 250mg/L), at 25 ℃, 14 hours illumination condition was cultivated down, changed a subculture every 14 days, simultaneously unconverted tissue was handled equally as negative contrast.Seedling to be transformed is long during to 1cm, forwards in the root media (Km 100mg/L, Car 250mg/L) according to the method for document (Wang Guanlin, Fang Hongjun, 1999, Science Press) and takes root, and takes root after the week.Unconverted indefinite bud is withered in selecting substratum, can not normal growth.Cultivate screening through antibiotic, obtain to contain 65 of the plant (Fig. 8) of GRP1.8 promotor-antisense 4CL1 gene respectively.

Transgenic seedling after taking root was cultivated 45 days under conditions of tissue culture, in hardening, the transplanting basin.Obtain transgene tobacco seedling as shown in Figure 9, with the tobacco blank, the physiology growth does not have considerable change with form.

Extract total DNA of transgene tobacco according to a conventional method, carry out PCR with primer a, b according to ordinary method and detect, simultaneously with the non-transgenic tobacco as blank.The result obtains the amplified band of 600bp as shown in figure 10 in transgene tobacco, show that GRP1.8 promotor-antisense 4CL1 fusion gene is transferred in the regrowth.Among Figure 10, M is a molecular weight marker, and 1-5 is a transgene tobacco, and 6 is blank.

3, transgenic plant Mierocrystalline cellulose and content of lignin analysis

Measure xylogen and the content of cellulose that changes GRP1.8 promotor-antisense 4CL1 fusion gene tobacco and blank tobacco respectively according to ordinary method, result such as table 6, Figure 11 and shown in Figure 12, Klason xylogen (sulfuric acid xylogen) content that shows the transgene tobacco that six strains are detected all has reduction in various degree, and what the content of lignin reduction was maximum reaches 24%.The average Klason content of lignin of transfer-gen plant is 14.5 ± 3.94, and the Klason content of lignin of adjoining tree is 28.2 ± 4.62, and the xylogen average content comparison of many strains transfer-gen plant is according to having reduced by 13.7% (table 6).The cellulosic content of individual plant transgene tobacco then raises to some extent, and the content of cellulose individual plant raises and maximum reaches 32.1%, the Mierocrystalline cellulose average content of many strains transfer-gen plant 15.6% (table 6) that raise.The reduction of transfer-gen plant content of lignin, the changing over to of 4CL1 gene of the antisense that GRP1.8 starts is described, interfered transcribing or expressing of normal 4CL1 RNA, reduced the activity of 4-coumaric acid ligase enzyme, thereby disturbed the biosynthesizing of xylogen, reduced the content of lignin of transgenic plant.Among Figure 11 and Figure 12,1-6 is a blank, and 8-13 is a transgene tobacco.

Table 6. transgene tobacco xylogen, Mierocrystalline cellulose average content synopsis

	The xylogen average content	The Mierocrystalline cellulose average content	Mierocrystalline cellulose/xylogen ratio (L: C)
				Contrast	28.2±4.62	25.4±7.41	0.900
Transgene tobacco	14.5±3.94	41.0±6.48	2.828
				Contrast changes	-48.52	+61.42	213.93

The Cortex Populi Tomentosae 741 that embodiment 3, cultivation content of lignin raise

1, the conversion of Cortex Populi Tomentosae 741

With the GRP1.8-4CL1 plant binary expression vector PBPI that builds, by improved An method, directly transform Agrobacterium LBA4404, at the enterprising row filter of YEB substratum of Sm 125mg/L and Km 50mg/L, and the picking mono-clonal extracts plasmid and carries out enzyme and cut evaluation, obtains positive colony.

The Agrobacterium LBA4404 that contains expression vector is at YEB substratum (Sm 100mg/l, Km50mg/L) OD600=0.6-0.8 is cultivated in 28 ℃ of concussions in, ratio in 1%-2% is diluted with fresh YEB substratum (Sm 100mg/L), continues to cultivate OD600=0.2-0.3.The blade of Cortex Populi Tomentosae 741 aseptic seedling is cut, be cut into the fritter of 0.5-1.0cm, in bacterium liquid, soak 10min, constantly shake therebetween, thin slice is fully contacted with bacterium liquid, take out, blot surperficial bacterium liquid with aseptic filter paper, be placed on the Cortex Populi Tomentosae 741 blade division culture mediums-MS substratum (0.1mg/LNAA, 1.0mg/L BA), 28 ℃ of dark cultivations 4 days, explant transferred to contain 100mg/L Km, blade division culture medium-MS substratum (0.1mg/L NAA, 1.0mg/L BA) of 250mg/L Car (carboxylic Bian mycin), 28 ℃ are continued to cultivate, and simultaneously unconverted tissue are handled equally as negative contrast.Changed a subculture every 14 days.When stem length arrives 3-5cm, forward in the root media 1/2MS substratum (0.3mg/LNAA, 1.0mg/L BA) that contains kantlex and carboxylic benzyl mycin and take root, the result obtains regrowth 20 strains.

2, the southern of transgenosis Cortex Populi Tomentosae 741 hybridization

Extract total DNA of transgenosis Cortex Populi Tomentosae 741 and non-transgenic Cortex Populi Tomentosae 741 according to ordinary method, with the non-transgenic tobacco is contrast, use the SmaI restriction enzyme to spend enzymolysis after 10 hours 30,1% agarose gel electrophoresis, running gel is placed on sex change liquid (the 1.5M NaCl of 10 times of volumes, 0.5M concussion 40min NaOH), again at neutralizer (the 1.5M NaCl of 10 times of volumes, 0.5M Tris-Cl, pH7.0) concussion 40min in, using 20 * SSC to carry out DNA changeed film and spends the night, and washes film with 2 * SSC, in 80 ℃ of dryings 2 hours.Make probe with 1ug by the 4CL1 gene fragment that PCR obtains, adding distil water is to 16ul, and boiling water bath 10min places frozen water 5min rapidly.Add 2ulDIG-HIGH PRIME, mixing.37 ℃ of insulation 1h add 0.2M EDTA (PH=8.0), mixing.Preheating hybridization solution (carry in the high-new test kit hybridization solution) is to 42 ℃.Prehybridization 30min.Get dna probe (the probe consumption is the 25ng/ml hybridization solution) and boil 5min, be positioned in the frozen water rapidly.Mixing in the sex change dna probe adding hybridization solution is put into hybridization bag with Hybond membrane.Remove bubble, seal, 42 ℃ are spent the night.Take out Hybond membrane 50ml 2 * SSC, 0.1%SDS cleans 2 times, each 5min.100ml 0.5 * SSC, 0.1% SDS cleans 2 times for 50 ℃, each 5min.With 100ml washings-100ml toxilic acid damping fluid (Maleic acid buffer) (0.1M toxilic acid, 0.15M NaCl, pH7.5) add 0.3ml tween20 in and clean 1-5min, add 80ml confining liquid (high-new test kit in carry) insulation 30min, with 20ml antibody liquid (high-new test kit in carry) insulation 30min, clean 2 times each 15min with the 100ml washings.Detect liquid balance 2-5 minute with 20ml, Hybond membrane is placed in the new hybridization bag, add CSPD-ready-to use 1ml and remove bubble, be incubated 4 minutes.Remove CSPD-ready-to use, seal, folder X-ray sheet, room temperature was placed 1 hour.The result as shown in figure 13, show the band that occurs a treaty 1700bp in the transgenosis Cortex Populi Tomentosae 741, transgenosis Cortex Populi Tomentosae 741 does not then have this band, the band that has only a treaty 3350bp, this band is the 4CL1 gene that contains intron that Cortex Populi Tomentosae 741 has self, proves that this 4CL1 gene has inserted in the transgenosis Cortex Populi Tomentosae 741.Among Figure 13,1,2 is transgenosis Cortex Populi Tomentosae 741 plant.

3, the mensuration of transgenosis Cortex Populi Tomentosae 7414CL1 enzymic activity

Annual transgenosis Cortex Populi Tomentosae 741 blades are pulverized under liquid nitrogen, with extracting damping fluid (0.2M Tris-HClpH7.5,8mM MgCl ₂, 5mM DTT, 30% glycerine, 1ug/ml leupeptin (Leupeptin)) extract, extracting solution is at 18000g, 4 ℃ of centrifugal 15min, and supernatant liquor is used for enzyme activity assay.Use BSA to do typical curve, quantitative to protein crude extract.Comprise 0.2M Tris-HCl in the 1ml enzyme reaction solution, pH7.5,8mM MgCl ₂, 0.8mMATP, 0.1mM substrate 4-coumaric acid and 25-30ul crude extract are measured the increase of A333 then in 24 ℃ of reactions 12 minutes.Each sample is done 3 parallel laboratory tests.The result is as shown in table 7, shows that the enzymic activity of the blade of genetically modified willow 741 decreases.

4CL1 enzyme activity assay in table 7. transgenosis Cortex Populi Tomentosae 741 blades

The first OD protein content ug vigor OD/mg of the whole OD of OD is than vigor OD/mg/min

CK 0.794 0.742 0.052 31.6 2.45 0.485

Change GRP1.8-4CL1

Fusion gene Cortex Populi Tomentosae 0.841 0.793 0.048 76.55 0.63 0.13

4, change xylogen, the analysis of moisture content of GRP1.8-4CL1 fusion gene Cortex Populi Tomentosae 741

The content of lignin that changes GRP1.8-4CL1 fusion gene Cortex Populi Tomentosae 741 trunks is 23.1%, and contrast is 20.6%, and the xylogen of transgenosis trunk is improved.Change the annual Cortex Populi Tomentosae 741 of GRP1.8-4CL1 fusion gene, the bark of stem and the water content of xylem are as shown in table 8, show that the water content of the xylem of transgenosis Cortex Populi Tomentosae 741 stems is lower than not transgenosis Cortex Populi Tomentosae 741.

Trunk, the bark analysis of moisture content of table 8. transgenosis Cortex Populi Tomentosae 741 stems

	The xylem water content	The bark water content
			Transfer-gen plant 1	26.2	50.8
Transfer-gen plant 2	22.1	63.1
			Transfer-gen plant 3	32.7	51.3
Ck	41.3	57.3

Sequence table

<160>2

<210>1

<211>2378

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

aagcttggtg atggcactct tgaagccata tcaatggtaa taagttaatt tgagaagaat 60

tgttccatgc attcaaataa tgctagtagt cttcactttt tttacttaaa tatcatcagt 120

agtaaattaa taaaatgttc tatcttccaa atatatctag cgattaacaa atttataaaa 180

aagaggtatg tttgcagttg cacccgatga tagtggtggc aataagaaaa gaaagggaag 240

acagaaggaa gaagaagatt gagaaagtaa aatgcagtgc aaaatggtgg tgagtgggag 300

gtagaaaaga gggataagat aggtaggtgt gaaaaagaaa ggaaaaaagc gtaggtttgt 360

tggagtagct agtgtatttg tatgggtact gcatgctccg ttggatgtgg aagacagcag 420

aagcacacaa tgaagctcca gtatgagtgg tttcagtgta tctctgtatg ttggcataat 480

gggccacact gtgggggcat ccaactttca tatccatgtg cttcaaccac tctttgctct 540

ctacgcgcct tcccaatccc tataaatacc cttcaagtct cctcacttca aaaccaacct 600

atttcagctt cacttcacta atgctgcagg cgcaatggac gccacaatga atccacaaga 660

agaattcatc tttcgctcaa aattaccaga catctacatc ccgaaaaacc ttcccctgca 720

ttcatacgtt cttgaaaact tgtctaacca ttcatcaaaa ccttgcctga taaatggcgc 780

gaatggagat gtctacacct atgctgacgt tgagctcaca gcaagaagag ttgcttctgg 840

tctgaacaag attggtattc aacaaggtga cgtgatcatg ctcttcctac caagttcacc 900

tgaattcgtg cttgctttcc taggcgcttc acacagaggt gccattatca ctgctgccaa 960

tcctttctcc acccctgcag agctagcaaa acatgccaag gcctcgagag caaagcttct 1020

gataacacag gcttgttact acgagaaggt taaagatttt gcccgagaaa gtgatgttaa 1080

ggtcatgtgc gtggactctg ccccggatgg atgcttgcac ttttcagagc taacacaggc 1140

agacgaaaat gaagcgcctc aggtcgacat tagtcccgat gatgtcgtag cattgcctta 1200

ttcatcaggg actacagggt tgccaaaagg ggtcatgtta acgcacaaag ggctaataac 1260

cagtgttgct caacaggtag atggagacaa tcctaacctg tattttcaca gtgaagatgt 1320

gattctgtgt gtgctgccta tgttccatat ctatgctctg aattcaataa tgctctgcgg 1380

gctgagagtc ggtgccccga ttttgataat gccaaagttt gagattggtt ctttactggg 1440

attgattgag aagtacaagg tatctatagc accggttgtt ccacctgtga tgatgtcaat 1500

tgctaagtca cctgatcttg acaagcatga cttgtcttct ttgaggatga taaaatctgg 1560

aggggctcca ttgggcaagg aacttgaaga tactgtcaga gctaagtttc ctcaggctag 1620

acttggtcag ggatatggaa tgaccgaggc aggacctgtt ctagcaatgt gcttggcatt 1680

tgccaaggaa ccattcgaca taaaaccagg tgcatgtggg actgtagtca ggaatgcaga 1740

gatgaagatt gttgacccag aaacaggggc ctctctaccg aggaaccagc ctggtgagat 1800

ctgcatccgg ggtgatcaga tcatgaaagg atatcttaat gaccctgagg caacctcaag 1860

aacaatagac aaagaaggat ggctgcacac aggcgatatc ggctacattg atgatgatga 1920

tgagcttttc atcgttgaca gattgaagga attgatcaag tataaagggt ttcaggttgc 1980

tcctgctgaa ctcgaagctt tgttaatagc ccatccagag atatccgatg ctgctgtagt 2040

aggattgaaa gatgaggatg cgggagaagt tcctgttgca tttgtagtga aatcagaaaa 2100

gtctcaggcc accgaagatg aaattaagca gtatatttca aaacaggtga tattctacaa 2160

gagaataaaa cgagttttct tcattgaagc tattcccaag gcaccatctg gcaagatcct 2220

gaggaagaat ctgaaagaaa agttggcagg catataactg aagatgttac tgaacattta 2280

atcctctgtc ttatttcttt aatacttgag aatcattgta gtgttgaacc aagcatgctt 2340

ggaaaagaca cgtacccaac gtaagacagt agggatcc 2378

<210>2

<211>2248

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>2

ctctagatga tggcactctt gaagccatat caatggtaat aagttaattt gagaagaatt 60

gttccatgca ttcaaataat gctagtagtc ttcacttttt ttacttaaat atcatcagta 120

gtaaattaat aaaatgttct atcttccaaa tatatctagc gattaacaaa tttataaaaa 180

agaggtatgt ttgcagttgc acccgatgat agtggtggca ataagaaaag aaagggaaga 240

cagaaggaag aagaagattg agaaagtaaa atgcagtgca aaatggtggt gagtgggagg 300

tagaaaagag ggataagata ggtaggtgtg aaaaagaaag gaaaaaagcg taggtttgtt 360

ggagtagcta gtgtatttgt atgggtactg catgctccgt tggatgtgga agacagcaga 420

agcacacaat gaagctccag tatgagtggt ttcagtgtat ctctgtatgt tggcataatg 480

ggccacactg tgggggcatc caactttcat atccatgtgc ttcaaccact ctttgctctc 540

tacgcgcctt cccaatccct ataaataccc ttcaagtctc ctcacttcaa aaccaaccta 600

tttcagcttc acttcacttt atatgcctgc caacttttct ttcagattct tcctcaggat 660

cttgccagat ggtgccttgg gaatagcttc aatgaagaaa actcgtttta ttctcttgta 720

gaatatcacc tgttttgaaa tatactgctt aatttcatct tcggtggcct gagacttttc 780

tgatttcact acaaatgcaa caggaacttc tcccgcatcc tcatctttca atcctactac 840

agcagcatcg gatatctctg gatgggctat taacaaagct tcgagttcag caggagcaac 900

ctgaaaccct ttatacttga tcaattcctt caatctgtca acgatgaaaa gctcatcatc 960

atcatcaatg tagccgatat cgcctgtgtg cagccatcct tctttgtcta ttgttcttga 1020

ggttgcctca gggtcattaa gatatccttt catgatctga tcaccccgga tgcagatctc 1080

accaggctgg ttcctcggta gagaggcccc tgtttctggg tcaacaatct tcatctctgc 1140

attcctgact acagtcccac atgcacctgg ttttatgtcg aatggttcct tggcaaatgc 1200

caagcacatt gctagaacag gtcctgcctc ggtcattcca tatccctgac caagtctagc 1260

ctgaggaaac ttagctctga cagtatcttc aagttccttg cccaatggag cccctccaga 1320

ttttatcatc ctcaaagaag acaagtcatg cttgtcaaga tcaggtgact tagcaattga 1380

catcatcaca ggtggaacaa ccggtgctat agataccttg tacttctcaa tcaatcccag 1440

taaagaacca atctcaaact ttggcattat caaaatcggg gcaccgactc tcagcccgca 1500

gagcattatt gaattcagag catagatatg gaacataggc agcacacaca gaatcacatc 1560

ttcactgtga aaatacaggt taggattgtc tccatctacc tgttgagcaa cactggttat 1620

tagccctttg tgcgttaaca tgaccccttt tggcaaccct gtagtccctg atgaataagg 1680

caatgctacg acatcatcgg gactaatgtc gacctgaggc gcttcatttt cgtctgcctg 1740

tgttagctct gaaaagtgca agcatccatc cggggcagag tccacgcaca tgaccttaac 1800

atcactttct cgggcaaaat ctttaacctt ctcgtagtaa caagcctgtg ttatcagaag 1860

ctttgctctc gaggccttgg catgttttgc tagctctgca ggggtggaga aaggattggc 1920

agcagtgata atggcacctc tgtgtgaagc gcctaggaaa gcaagcacga attcaggtga 1980

acttggtagg aagagcatga tcacgtcacc ttgttgaata ccaatcttgt tcagaccaga 2040

agcaactctt cttgctgtga gctcaacgtc agcataggtg tagacatctc cattcgcgcc 2100

atttatcagg caaggttttg atgaatggtt agacaagttt tcaagaacgt atgaatgcag 2160

gggaaggttt ttcgggatgt agatgtctgg taattttgag cgaaagatga attcttcttg 2220

tggattcatt gtggcgtcca tcccgggg 2248

Claims (10)

1, a kind of method of regulating and controlling plant lignin content is that the expression vector that will contain GRP1.8 promotor-4CL1 fusion gene transforms plant, obtains the plant that content of lignin raises; The expression vector that will contain GRP1.8 promotor-antisense 4CL1 fusion gene transforms plant, obtains the plant that content of lignin reduces.

2, method according to claim 1 is characterized in that: described GRP1.8 promotor-4CL1 fusion gene has the polynucleotide sequence of sequence 1 in the sequence table.

3, method according to claim 1 is characterized in that: the polynucleotide sequence that described GRP1.8 promotor-antisense 4CL1 fusion gene has sequence 2 in the sequence table.

4, according to claim 1,2 or 3 described methods, it is characterized in that: the carrier that sets out that is used to make up the expression vector of the described GRP1.8 of containing promotor-4CL1 fusion gene or contain the expression vector of GRP1.8 promotor-antisense 4CL1 fusion gene is Ti class plasmid vector and virus vector.

5, method according to claim 4 is characterized in that: the described carrier that sets out is a Ti class plasmid vector.

6, method according to claim 5 is characterized in that: described Ti class plasmid vector is a binary vector.

7, method according to claim 6 is characterized in that: described binary vector is pBI101.

8, method according to claim 7 is characterized in that: the expression vector of the described GRP1.8 of containing promotor-4CL1 fusion gene is PBPI; The expression vector of the described GRP1.8 of containing promotor-antisense 4CL1 fusion gene is PBCHFA1.

9, according to claim 1,2 or 3 described methods, it is characterized in that: described plant is herbaceous plant or xylophyta; Described herbaceous plant is preferably tobacco, and described xylophyta is preferably willow.

10, according to claim 1,2 or 3 described methods, it is characterized in that: described method for transformation is agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method, is preferably the agrobacterium mediation converted method.

Images