CN113444727B - LncRNA and application thereof - Google Patents

Abstract

The invention provides a gene corresponding to LncRNA, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The invention also provides LncRNA transcribed correspondingly by the gene and application thereof. The gene corresponding to the LncRNA and the LncRNA transcribed by the gene can specifically respond to low-temperature stress reaction and drought stress reaction. The gene is further transferred into cassava, and the fact that transgenic lines are short and small in plants, long and narrow in leaves, tolerant to low-temperature stress and drought stress, high in survival rate, high in proline content in the transgenic lines and low in malondialdehyde content after drought or cold stress treatment is found, shows that the LncRNA and the gene thereof can regulate plant growth and improve low-temperature and drought tolerance of plants. In the future, the LncRNA and the gene thereof can be used for carrying out genetic improvement on plants, and effective resources are provided for promoting the growth of the plants and improving the low-temperature tolerance and the drought tolerance of the plants.

Description

LncRNA and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to LncRNA and application thereof.

Background

Cassava has the advantages of drought tolerance, barren tolerance, high yield and no land contention with major cash crops, and is therefore widely planted in more than 100 countries and regions around the world. Since cassava is introduced in China, the cassava is widely planted in tropical and subtropical areas of China. The yield per mu of cassava is high, and the cassava root contains a large amount of starch, which is one of the main raw materials for producing starch and industrial alcohol. Despite the advantages of cassava, the cassava originates from amazon river basin in south america and is a typical tropical crop, so that the planting area is limited to tropical and subtropical areas in China. Cassava is extremely sensitive to low temperature, the low temperature can cause the reduction of the cassava yield, and the serious freezing injury can cause the death and the top harvest of the cassava, so the temperature condition is an important factor for limiting the northward movement of the cassava. The traditional cross breeding screening period is long, the cost is high, the urgent need of people for cassava varieties cannot be met, and with the wide application of a high-throughput technology and a genetic engineering technology in the aspect of plant research, the breeding of high-quality cassava varieties can be greatly accelerated by applying a new technology to research the cold-resistant molecular mechanism of cassava and culture of cassava germplasm resources.

The state of plant fixation determines the stillness of its lifestyle, and plants produce organic matter mainly through photosynthesis and acquire energy required for growth and development. Plants respond to cold and drought stress by producing malondialdehyde, proline, and the like. Malondialdehyde is produced in plants in response to abiotic stress, which can overoxidise the plasma membrane, thereby damaging the membrane structure and thus altering the membrane permeability, which can affect the normal physiological and biochemical activities of cells and, if severe, can cause cell death. In contrast, an increase in proline content may act to protect plant cells. With the continuous and deep research on cold stress of cassava, people have preliminary understanding on how cassava responds to low-temperature stress, but people also need to strengthen mutual cooperation with international research teams for researching cassava and deeply understand the cold resistance mechanism of cassava in order to further understand how cassava responds to low-temperature stress and obtain more drought-tolerant, cold-resistant and high-yield high-quality cassava resources. High-yield and disease-resistant cassava resources are continuously introduced abroad, the cassava germplasm resource library of China is continuously enriched, and high-quality original materials are provided for the cold-resistant related research of cassava. Continuously screening the cold-resistant related genes in the cassava, and modifying the existing cassava varieties by using a molecular biology method to strive for breeding high-quality cassava varieties with cold resistance, drought resistance and high yield as soon as possible. In the past, the breeding of low-temperature-resistant cassava varieties depends on a conventional crossbreeding method, but the conventional crossbreeding method has many limitations: the cold-resistant cassava is short in resource, long in screening period, high in experimental cost and low in germination rate of hybrid seeds, the cold-resistant variety of the cross-bred cassava is difficult due to various reasons, and with the continuous development of genetic engineering, people begin to breed the cassava by using methods of genetic engineering, molecular biology and the like.

Long non-coding RNAs (lncRNAs) are RNAs with a length of more than 200nt and without protein coding ability. Since it does not encode a protein, it has been mistaken for some time that lncRNA is "noise" in the translation process. With the intensive research on lncRNA, it is found that lncRNA is an important regulator in animals and plants, can regulate and control the expression of genes at multiple levels of transcription, translation, growth and development, participation in abiotic stress and the like, and becomes a hot spot of the current research. According to the invention, lncRNA specifically expressed under stress conditions is identified through screening and analysis, and is successfully inserted into a cassava genome in a single copy manner, so that germplasm resources are provided for the research of the function of lncRNA in cassava in vivo. The function of lncRNA in stress resistance of plants is understood and explored by studying how the lncRNA is expressed and functions in cassava bodies. Transgenic cassava tissue culture seedlings are obtained through genetic engineering, cold-resistant cassava varieties are screened out, the cassava simultaneously obtains the excellent characteristics of cold resistance and drought resistance, high-quality cassava plants with drought resistance and cold resistance are obtained, high-quality seedlings can be provided for the northshift of cassava planting areas, when the cassava is stressed by cold, the damage of the cassava due to the cold can be resisted as much as possible, and the influence of the cold damage on the cassava plants and the yield is reduced. The lncRNA related to cold resistance and drought resistance in cassava is also a high-quality gene resource, and the lncRNA related to cold resistance and drought resistance stress is screened, identified and modified and then can be transduced into other crops through a gene engineering method, so that the cold stress tolerance of the other crops is improved, and the high-quality gene resource is provided for the cold resistance research of the crops.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides LncRNA and application thereof.

The first aspect of the present invention provides a gene corresponding to LncRNA, named LncRNA-114 gene, and its nucleotide sequence is shown in SEQ ID No. 1.

In a second aspect of the present invention, there is provided an LncRNA, designated LncRNA-114, having a nucleotide sequence shown in SEQ ID NO. 2. The LncRNA-114 is an RNA which is transcribed in sequence from a gene corresponding to the LncRNA described in the first aspect of the present application after the cleavage site has been removed by means of both BamH I and Sal I restriction enzymes.

A third aspect of the present invention provides a recombinant vector comprising the original vector and the gene of claim 1.

As the original vector, there can be used a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The invention is not limited in this regard. In one embodiment of the present invention, the original vector is the pCambia1301 vector plasmid, but it is understood that the present invention may also be used with other plasmids, or viruses, etc.

Preferably, the original vector is pCambia1301 vector plasmid, and the gene of the first aspect of the invention and pCambia1301 vector plasmid are double-digested with BamH I and Sal I restriction enzymes.

A fourth aspect of the present invention provides the use of the gene according to the first aspect of the present invention, or the LncRNA according to the second aspect of the present invention, or the recombinant vector according to the third aspect of the present invention, for increasing low temperature tolerance, and/or drought tolerance in plants.

In a fifth aspect, the present invention provides the use of a gene according to the first aspect of the present invention, or an LncRNA according to the second aspect of the present invention, or a recombinant vector according to the third aspect of the present invention for regulating the growth of a plant.

The sixth aspect of the present invention provides a method for amplifying a gene according to the first aspect of the present invention, comprising the steps of: extracting total RNA from cassava leaves, performing reverse transcription by PolyT to obtain cDNA as a template, and performing reverse transcription by using Lnc114-SBamH I (SEQ ID NO: 3): CGGGATCCAACAAACTATAAGCAAACAATG and Lnc114-ASal I (SEQ ID NO: 4): ACGCGTCGACGTTAGTATATACTAATTTGTGA is a primer, and the gene corresponding to LncRNA of the first aspect of the invention is obtained by PCR amplification, and the sequence is shown in SEQ ID NO. 1.

The seventh aspect of the present invention provides a primer pair, which comprises: lnc114-S BamH I: CGGGATCCAACAAACTATAAGCAAACAATG and Lnc114-ASal I: ACGCGTCGACGTTAGTATATACTAATTTGTGA are provided.

The gene corresponding to the LncRNA of the present invention (named LncRNA-114 gene) and the LncRNA transcribed therefrom (named LncRNA-114) can specifically respond to low temperature stress response and drought stress response. The LncRNA-114 gene is further transferred into cassava to obtain a cassava LncRNA-114 high expression strain, and compared with a non-transgenic strain, the LncRNA-114 high expression strain is short and small in plant length, slender in stem, long and narrow in leaf, more tolerant to low-temperature stress and drought stress, and greatly improved in survival rate, meanwhile, the content of proline in the LncRNA-114 high expression strain is remarkably improved, and the content of Malonaldehyde (MDA) after drought or cold stress treatment is remarkably reduced, so that the LncRNA-114 and LncRNA-114 gene can regulate plant growth, improve low-temperature tolerance and drought tolerance of the plant, and the like, and the LncRNA-114 and LncRNA-114 gene can be used for carrying out genetic improvement on the plant in the future, so that effective resources are provided for promoting plant growth, and improving the low-temperature tolerance and drought tolerance of the plant.

Drawings

FIG. 1 shows the results of the identification of the Lnc RNA in response to cassava stress and the identification of the expression of Lnc RNA-114.

FIG. 2 shows the predicted secondary structure of Lnc RNA-114 by RNAfold software.

FIG. 3 shows the constructed Lnc RNA-114 gene evolutionary tree.

FIG. 4 shows the screening results of Lnc RNA-114 transgenic cassava, wherein OE # 1-12 are 12 transgenic cassava strains.

FIG. 5 shows the result of phenotypic verification of high expression lines of transgenic cassava Lnc RNA-114.

FIG. 6 shows the result of measuring physiological indexes of transgenic cassava Lnc RNA-114 high-expression strains after stress treatment.

FIG. 7 shows the identification result of Lnc RNA-114 regulated downstream gene.

Detailed Description

The invention will be better understood from the following description of specific embodiments with reference to the accompanying drawings. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

1. Screening and identification of LncRNA114

Carrying out drought stress treatment and cold stress treatment on cassava (cold stress treatment: 2 days at 4 ℃ and culturing for 7 days at 26 ℃, drought stress treatment: non-watering till leaves and tops wither and then rehydrating), and finding that Lnc RNA of cassava plants is remarkably changed after the cold stress treatment and the drought stress treatment through clustering heatmap, and screening 318 Lnc RNA to participate in drought and cold stress (figure 1A). Lnc RNA is expressed specifically under drought and cold stress, and plays an important role in drought and cold stress.

In the enrichment study of Lnc RNA, a total of 318 Lnc RNAs involved in drought and cold stress were found, wherein 267 Lnc RNAs were specifically expressed under cold stress, 120 Lnc RNAs responded to drought stress, and 51 Lnc RNAs were specifically expressed under drought conditions, and at the same time, 69 Lnc RNAs responded to both cold stress and drought stress (FIG. 1B).

The selected Lnc RNA is analyzed and researched in the cold stress treatment group, and an Lnc RNA with obvious performance is selected and named as Lnc RNA-114. The cassava seedlings are subjected to cold stress again, the expression of Lnc RNA-114 under the cold stress is detected, and in the qPCR detection of the Lnc RNA-114, the Lnc RNA-114 under the cold stress is specifically expressed, the expression level is about 8 times that of a control group, and the expression level of the Lnc RNA-114 under the drought stress is about two times that of the control group (figure 1C). During 48 hours of cold stress treatment, the expression level of Lnc RNA-114 was gradually increased. The expression of Lnc RNA-114 increased slowly 12 hours before cold stress treatment, the expression level at the twelfth hour was about twice the initial expression level, the expression level of Lnc RNA-114 increased most rapidly at 12 to 24 hours after cold stress treatment, about 8 times the initial expression level, and the increase of Lnc RNA-114 was most gradual during 24 to 48 hours of stress treatment, from 8.2 times the initial expression level to 8.5 times the initial expression level (FIG. 1D).

2. Prediction of Lnc RNA-114 Secondary Structure

Single-stranded RNA forms a helical region and a loop through self-folding pairing, and prediction of RNA secondary structure is a research focus in the field of bioinformatics. The secondary structure of Lnc RNA-114 was predicted by the principle of minimum free energy, and the result is shown in FIG. 2. from the above figure, it can be seen that the secondary structure of Lnc RNA-114 is a multi-stem-loop hairpin structure, in which the structure prediction has 4 main branches, mainly comprising 17 stem loops and 4 bulge loops. The blue region is the 5 'end and the red is the 3' end. The blue area in the secondary structure shows that the matching degree of the base pair is higher, the free energy value is low and the stability is good. Studies have shown that the stem-loop structure of RNA plays a crucial role in the interaction of RNA with binding proteins. Therefore, the prediction of the secondary structure of Lnc RNA-114 can provide important reference for researching the function, action mechanism and the like of the Lnc RNA-114.

3. Obtaining of LncRNA-corresponding Gene (LncRNA-114 Gene)

Extracting total RNA by taking cassava leaves as a material, taking cDNA obtained by reverse transcription of PolyT as a template, and taking Lnc114-SBamH I: CGGGATCCAACAAACTATAAGCAAACAATG and Lnc114-ASal I: ACGCGTCGACGTTAGTATATACTAATTTGTGA is used as a primer, LncRNA-114 gene is obtained by PCR amplification, and the sequence is shown as SEQ ID No. 1 (with restriction enzyme cutting sites of BamH I and Sal I).

The PCR amplification reaction system is as follows:

PCR amplification procedure: 5 minutes at 98 ℃; 32 cycles of 10 seconds at 98 ℃, 5 seconds at 55 ℃, and 15 seconds at 72 ℃; 5 minutes at 72 ℃.

4. Construction of Lnc RNA-114 Gene clade

Through comparison and analysis of Lnc RNA-114 gene in NCBI database, 20 genes with high homology with Lnc RNA-114 gene are screened out (figure 3), wherein the genes are respectively mung bean, castor bean, Chinese date, balsam pear, anchovy, lettuce, poplar, Brazil rubber tree, Cynara cardunculus, olive, cocoa tree, cassava, Chinese rose, oil palm, cork oak, durian, grapevine, soybean, cotton and jatropha. The genetic evolutionary tree is constructed for analysis, and compared with the species with higher homology with the Lnc RNA-114 gene, a plurality of northern plants are found, and the Lnc RNA114 gene has the highest homology with XM 014662588.2 of mung beans. The Lnc RNA114 gene has high similarity with the cassava XM 021752436.1 gene, and the sequence of the Lnc RNA114 gene is relatively conserved through research.

5. Screening of transgenic cassava

The amplification product obtained from the acquisition of the gene corresponding to the 3 LncRNA (LncRNA-114 gene) is subjected to double enzyme digestion by BamH I and Sal I and then is connected to an expression vector pCambia1301 which is subjected to the same enzyme digestion, and the integrity of a target sequence and the correctness of a connection sequence are identified through sequencing. The DNA sequence comprising 35s and terminator and LncRNA-114 is shown in SEQ ID NO 5.

And transforming the constructed LncRNA gene overexpression vector into cassava embryogenic callus to obtain a positive transgenic cassava strain. In the qPCR validation of 12 transgenic cassava lines (FIG. 4), the expression level of Lnc RNA-114 was highest in OE #4 and OE #8 transgenic lines, with relative expression levels approximately 3100-fold and 1700-fold that of the control. The LncRNA-114 is shown to be highly expressed in the transgenic cassava, and meanwhile, the expression quantity of the Lnc RNA-114 of OE #1, OE #2, OE #4, OE #5, OE #7, OE #8, OE #9, OE #10, OE #11 and OE #12 strains is higher than that of a control group, which indicates that the Lnc RNA-114 is transduced into the cassava in a single-insertion or multi-insertion mode. The insertion in OE #5 and OE #8 was detected as a single copy by Sourther hybridization, so that the two lines OE #5 and OE #8 were selected mainly for the subsequent functional and phenotypic validation of Lnc RNA-114.

6. Phenotype verification of transgenic cassava

The transgenic cassava is planted in a field, and at the initial stage of cultivation, the transgenic cassava leaves are slender and weaker than the control group, but the OE5 leaves are darker green than the control group (figure 5A). After four months of field growth, the plant morphology of the transgenic cassava is greatly different from that of the control group, the transgenic plant is short and small, the stem is thin and the leaves are narrow, while the branches of the control group are tall and luxuriant, the stem is thick and strong, and the leaves are thick and strong (5B). In the statistics of the plant heights of the cassava plants in four months, the plant height difference between the transgenic plants and the control group is small when the cassava plants are cultivated in a field for one month, the plant height of the cassava plants in the control group is obviously higher than that of the transgenic plants along with the prolonging of the cultivation time, and the difference between the two transgenic plants is small. After four months of field cultivation, the height of the cassava plants in the control group was 248cm, while the height of the transgenic cassava plants was only 151cm and 143cm (FIG. 5C). The expression of Lnc RNA-114 in cassava bodies is proved to obviously influence the characters of cassava, so that the cassava plants have short and long leaves.

7. Stress management and determination of physiological indices

Cold stress treatment is carried out on transgenic seedlings of the transgenic cassava (treatment at 4 ℃ for 2 days, and culture at 26 ℃ for 7 days), and in the treatment, the plants are found to be quickly lodging and the leaves wither after the plants in the control group are subjected to the cold stress treatment. However, the transgenic cassava leaves are still dark green after cold stress treatment, and the difference of the plant morphology is small (fig. 6A).

Drought stress treatment is carried out on transgenic seedlings of the transgenic cassava (watering is not needed until leaves and tops are wilted and then rehydrated), the cassava seedlings of the transgenic plants show excellent resistance to the drought stress after the drought stress treatment, only three leaves close to roots of the transgenic cassava seedlings of the drought stress wither, the plants rapidly recover to grow after the drought stress treatment, the top buds start to grow, and the leaves are dark green (fig. 6B).

The survival rate statistics of cold stress and drought stress of the transgenic cassava shows that the transgenic plant has excellent tolerance to the cold stress and the drought stress. Under cold stress, the cassava in the control group has the worst tolerance, only about 10 percent of the cassava survives, the survival rates of the OE #5 transgenic cassava and the OE #8 transgenic cassava are respectively 90 percent and 85 percent, and the influence of the cold stress on transgenic plants is small. Meanwhile, the survival rate of the control group under drought stress is only 22%, while the survival rates of the OE #5 and OE #8 transgenic cassava plants are 80% and 75%, respectively, and the transgenic plants also show excellent tolerance to drought stress (fig. 6C).

In the stress response of plants, malondialdehyde and proline play an important role, the increase of the content of malondialdehyde can damage plant cell membranes, the high content of malondialdehyde can reflect that plant cells are seriously damaged to a certain extent, and meanwhile, proline has a certain protection effect on the plant cells. Before and after drought and cold stress treatment, transgenic plants OE #5 and OE #8 are significantly expressed, and the content of malondialdehyde in the control group is higher than that of transgenic cassava (FIG. 6D), and simultaneously, the content of proline in the transgenic cassava before and after drought and cold stress treatment is higher than that of the control group (FIG. 6E).

In the control of transgenic lines OE #5 and OE #8 it was found that the survival rate of the OE #5 line under drought and cold stress was higher than that of the OE #8 line. At the same time, the stress-treated OE #5 strain had a lower malondialdehyde content than the stress-treated OE #8 strain, while OE #5 proline was lower than OE #8, and therefore the cells were less damaged OE #5 than OE # 8. The strain OE #5 is more tolerant to stress treatment than the strain OE # 8.

The experimental result shows that the transgenic cassava is less affected under the drought and cold stress treatment than a control group and shows better tolerance when being subjected to the drought and cold stress treatment.

8. Cassava Lnc RNA-114 specific regulation and control of expression of multiple protein coding genes

In order to analyze the downstream key genes and genetic pathways regulated by Lnc RNA-114, cassava wild type and Lnc RNA-114 gene transferred lines are subjected to low-temperature treatment (4 ℃, 1 day), leaves and top ends of plants before and after treatment are collected, and transcriptome sequencing is carried out. After data analysis, DEseq is adopted to carry out downstream gene differential expression analysis, transgenic strains before and after treatment are compared with a control group, and genes with | log2Ratio | > 1 or |, and q <0.05 are selected as the downstream gene of differential expression.

Analysis shows that 1055 genes are up-regulated and 1457 genes are down-regulated in the control group of cassava, the transgenic cassava OE #5 and the transgenic cassava OE #8 after the control group of cassava, the transgenic cassava OE #5 and the transgenic cassava OE #8 are stressed by cold. Under cold stress, 192 gene expressions of the control group and the transgenic cassava OE #5 are up-regulated, 341 gene expressions of the control group and the transgenic cassava OE #8 are up-regulated, 269 gene expressions of the control group without cold stress and the transgenic cassava OE #5 are up-regulated, and 676 gene expressions of the control group without cold stress and the transgenic cassava OE #8 are up-regulated, wherein in the expression of all up-regulated genes, 72 gene-specific expressions are realized in comparison of WTC and OE # 5C, and 196 gene-specific expressions are realized in comparison of WTC and OE #8C (fig. 7A). Under cold stress, there were 471 downregulated gene expression in the WTC versus OE #5C comparison, 920 downregulated gene expression in the WTC versus OE #8C comparison, 472 downregulated gene expression in the WTN versus OE #5N comparison, and 481 downregulated gene expression in the WTN versus OE #8N comparison (fig. 7B). These genes will be intensively studied as a key target for subsequent studies.

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Sequence listing

<110> research institute of tropical biotechnology of Chinese tropical academy of agricultural sciences

<120> LncRNA and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2171

<212> DNA

<213> Artificial

<400> 1

cgggatccaa caaactataa gcaaacaatg tgttgctctg tttgtttgga ataaattttg 60

atacttttag atactagata gatagaagtt tgacatcagg aagtcatcat gtagagtgta 120

ttcttggtag tggccgggta ccctatcgat gatcatttac catcagtctg gcatgggaga 180

tgttaatcta tgttattcat cccttatcac tgtagctttt caatgcttag ctaaagttta 240

gaaaagctta tttaatgctt atgttataac tttaggatta agttagctaa agtgctttgc 300

cataacagtg agcatctaaa aaagaatgtc aagtatcatg catatttact tctgccaagg 360

tgctgtagga aaatgcaggc catgttatat gcccacacag cggaagttaa caaaaggtac 420

ctccttcatg agatgtatca actgatgcaa cactgatatg ttgcacaaaa gctgcataat 480

ctgatcctca accacccaat ttcccgatct taatttgccg tttcgttagc gtcagagagt 540

tgacttgtga aataagccta gttcatatga tgagagtcat cttctatctg taactttttg 600

ttctatggca atgtcatttt tactggtaac taaaatgtgg tttatcttta agtagtatgt 660

tcattataat caatttatca agatttgata tgagataaga ttatgcttac cacaggagag 720

ctgccagaac caagacatga cttggatggc tttgagttat gggggtcttg aaccattgaa 780

aatcagcaat aatccttttg tacgagtgag aggagttact tttttaaatt gtagtctaca 840

atgtgatatt ttactatgcc tctttatgtt agttgtctct gaagttgctt tatatcaaag 900

gacaaaatga tacgagatac gttttgttct tgtaccttag tggcttacat gttgtagctt 960

tattactttt gccggtaatg gcatttagtt ctacttgttt acatgcgcct ggattagtag 1020

ctcatcgagc tgagttgcaa aggtatgaaa tcctgcccct aaatactgca caatcaatgt 1080

tcgagtagga tatggccctt aaagctggca ttcccaactg gacagaaaaa ttcgtctttg 1140

agatttccac cctgtagctt tgcaaaaaag caacataaaa tgcacatgtt aaagttgcat 1200

gaagggctgc tttttcctgc gtcataattt ttgttttgct gagagggtaa ataacaaggc 1260

gtttattatg gcccaagaac ctctagcagt gctgctgtgc cactgttggg atcaacagca 1320

ccaactgtcc atgcttggac aaatctagaa atggttgcaa acggtgactt ctgtttttat 1380

ctatctggcc ttgtcttttc ttggctggcg caactagtgt caggtgaaat cctgaattcc 1440

tggtatattc tgctccccct gaaatctcat ccaaaaggtg tcatattctg tattcctaaa 1500

tgtgcacatg catatatata gacttgtgca gtcggagttc actgcttgca gcataatgag 1560

gttttaaaac cctggtcctg gtcctccatg tttgccactt gtccgcccat tgatctcatt 1620

atggtttcac catcaaatgc tgataagttg tgaaaataga atgtttctaa atgttaagtg 1680

tgattaagat aatggatttt aacctaattt ttattttcgt tttcatttcc cacttcccga 1740

cgaagcattt ggattttgga acgcctactt aaaatttcaa ctggtttttt tctgaaaata 1800

tcaaatctaa ctttgtagag gatggattgg tcttgaaaat gtagatttaa tttcatgata 1860

tgagcttctt ctgtttgtgt ctagtcatgt gataagattt tttactttaa aaatgaccaa 1920

aagtttcaat tatttatatt ataaagaaat tatttgaaaa taaaatatag aaatttgtaa 1980

tcttattggt aaaaagttcg attcaattga aagggacttt gaaattcttg tcctagtgat 2040

ctctattctt gagtttaatc ataaactgtt caaagttcgc agccaaattg gaccaacagt 2100

ttctagtaac tctaacttga tgataattca tatttaccct cacaaattag tatatactaa 2160

cgtcgacgcg t 2171

<210> 2

<211> 2153

<212> RNA

<213> Artificial

<400> 2

aacaaacuau aagcaaacaa uguguugcuc uguuuguuug gaauaaauuu ugauacuuuu 60

agauacuaga uagauagaag uuugacauca ggaagucauc auguagagug uauucuuggu 120

aguggccggg uacccuaucg augaucauuu accaucaguc uggcauggga gauguuaauc 180

uauguuauuc aucccuuauc acuguagcuu uucaaugcuu agcuaaaguu uagaaaagcu 240

uauuuaaugc uuauguuaua acuuuaggau uaaguuagcu aaagugcuuu gccauaacag 300

ugagcaucua aaaaagaaug ucaaguauca ugcauauuua cuucugccaa ggugcuguag 360

gaaaaugcag gccauguuau augcccacac agcggaaguu aacaaaaggu accuccuuca 420

ugagauguau caacugaugc aacacugaua uguugcacaa aagcugcaua aucugauccu 480

caaccaccca auuucccgau cuuaauuugc cguuucguua gcgucagaga guugacuugu 540

gaaauaagcc uaguucauau gaugagaguc aucuucuauc uguaacuuuu uguucuaugg 600

caaugucauu uuuacuggua acuaaaaugu gguuuaucuu uaaguaguau guucauuaua 660

aucaauuuau caagauuuga uaugagauaa gauuaugcuu accacaggag agcugccaga 720

accaagacau gacuuggaug gcuuugaguu augggggucu ugaaccauug aaaaucagca 780

auaauccuuu uguacgagug agaggaguua cuuuuuuaaa uuguagucua caaugugaua 840

uuuuacuaug ccucuuuaug uuaguugucu cugaaguugc uuuauaucaa aggacaaaau 900

gauacgagau acguuuuguu cuuguaccuu aguggcuuac auguuguagc uuuauuacuu 960

uugccgguaa uggcauuuag uucuacuugu uuacaugcgc cuggauuagu agcucaucga 1020

gcugaguugc aaagguauga aauccugccc cuaaauacug cacaaucaau guucgaguag 1080

gauauggccc uuaaagcugg cauucccaac uggacagaaa aauucgucuu ugagauuucc 1140

acccuguagc uuugcaaaaa agcaacauaa aaugcacaug uuaaaguugc augaagggcu 1200

gcuuuuuccu gcgucauaau uuuuguuuug cugagagggu aaauaacaag gcguuuauua 1260

uggcccaaga accucuagca gugcugcugu gccacuguug ggaucaacag caccaacugu 1320

ccaugcuugg acaaaucuag aaaugguugc aaacggugac uucuguuuuu aucuaucugg 1380

ccuugucuuu ucuuggcugg cgcaacuagu gucaggugaa auccugaauu ccugguauau 1440

ucugcucccc cugaaaucuc auccaaaagg ugucauauuc uguauuccua aaugugcaca 1500

ugcauauaua uagacuugug cagucggagu ucacugcuug cagcauaaug agguuuuaaa 1560

acccuggucc ugguccucca uguuugccac uuguccgccc auugaucuca uuaugguuuc 1620

accaucaaau gcugauaagu ugugaaaaua gaauguuucu aaauguuaag ugugauuaag 1680

auaauggauu uuaaccuaau uuuuauuuuc guuuucauuu cccacuuccc gacgaagcau 1740

uuggauuuug gaacgccuac uuaaaauuuc aacugguuuu uuucugaaaa uaucaaaucu 1800

aacuuuguag aggauggauu ggucuugaaa auguagauuu aauuucauga uaugagcuuc 1860

uucuguuugu gucuagucau gugauaagau uuuuuacuuu aaaaaugacc aaaaguuuca 1920

auuauuuaua uuauaaagaa auuauuugaa aauaaaauau agaaauuugu aaucuuauug 1980

guaaaaaguu cgauucaauu gaaagggacu uugaaauucu uguccuagug aucucuauuc 2040

uugaguuuaa ucauaaacug uucaaaguuc gcagccaaau uggaccaaca guuucuagua 2100

acucuaacuu gaugauaauu cauauuuacc cucacaaauu aguauauacu aac 2153

<210> 3

<211> 30

<212> DNA

<213> Artificial

<400> 3

cgggatccaa caaactataa gcaaacaatg 30

<210> 4

<211> 32

<212> DNA

<213> Artificial

<400> 4

acgcgtcgac gttagtatat actaatttgt ga 32

<210> 5

<211> 2971

<212> DNA

<213> Artificial

<400> 5

agtcaaagat tcaaatagag gacctaacag aactcgccgt aaagactggc gaacagttca 60

tacagagtct cttacgactc aatgacaaga agaaaatctt cgtcaacatg gtggagcacg 120

acacgcttgt ctactccaaa aatatcaaag atacagtctc agaagaccaa agggcaattg 180

agacttttca acaaagggta atatccggaa acctcctcgg attccattgc ccagctatct 240

gtcactttat tgtgaagata gtggaaaagg aaggtggctc ctacaaatgc catcattgcg 300

ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa gatggacccc 360

cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca aagcaagtgg 420

attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat ccttcgcaag 480

acccttcctc tatataagga agttcatttc atttggagag gacagggtac ccggggatcc 540

aacaaactat aagcaaacaa tgtgttgctc tgtttgtttg gaataaattt tgatactttt 600

agatactaga tagatagaag tttgacatca ggaagtcatc atgtagagtg tattcttggt 660

agtggccggg taccctatcg atgatcattt accatcagtc tggcatggga gatgttaatc 720

tatgttattc atcccttatc actgtagctt ttcaatgctt agctaaagtt tagaaaagct 780

tatttaatgc ttatgttata actttaggat taagttagct aaagtgcttt gccataacag 840

tgagcatcta aaaaagaatg tcaagtatca tgcatattta cttctgccaa ggtgctgtag 900

gaaaatgcag gccatgttat atgcccacac agcggaagtt aacaaaaggt acctccttca 960

tgagatgtat caactgatgc aacactgata tgttgcacaa aagctgcata atctgatcct 1020

caaccaccca atttcccgat cttaatttgc cgtttcgtta gcgtcagaga gttgacttgt 1080

gaaataagcc tagttcatat gatgagagtc atcttctatc tgtaactttt tgttctatgg 1140

caatgtcatt tttactggta actaaaatgt ggtttatctt taagtagtat gttcattata 1200

atcaatttat caagatttga tatgagataa gattatgctt accacaggag agctgccaga 1260

accaagacat gacttggatg gctttgagtt atgggggtct tgaaccattg aaaatcagca 1320

ataatccttt tgtacgagtg agaggagtta cttttttaaa ttgtagtcta caatgtgata 1380

ttttactatg cctctttatg ttagttgtct ctgaagttgc tttatatcaa aggacaaaat 1440

gatacgagat acgttttgtt cttgtacctt agtggcttac atgttgtagc tttattactt 1500

ttgccggtaa tggcatttag ttctacttgt ttacatgcgc ctggattagt agctcatcga 1560

gctgagttgc aaaggtatga aatcctgccc ctaaatactg cacaatcaat gttcgagtag 1620

gatatggccc ttaaagctgg cattcccaac tggacagaaa aattcgtctt tgagatttcc 1680

accctgtagc tttgcaaaaa agcaacataa aatgcacatg ttaaagttgc atgaagggct 1740

gctttttcct gcgtcataat ttttgttttg ctgagagggt aaataacaag gcgtttatta 1800

tggcccaaga acctctagca gtgctgctgt gccactgttg ggatcaacag caccaactgt 1860

ccatgcttgg acaaatctag aaatggttgc aaacggtgac ttctgttttt atctatctgg 1920

ccttgtcttt tcttggctgg cgcaactagt gtcaggtgaa atcctgaatt cctggtatat 1980

tctgctcccc ctgaaatctc atccaaaagg tgtcatattc tgtattccta aatgtgcaca 2040

tgcatatata tagacttgtg cagtcggagt tcactgcttg cagcataatg aggttttaaa 2100

accctggtcc tggtcctcca tgtttgccac ttgtccgccc attgatctca ttatggtttc 2160

accatcaaat gctgataagt tgtgaaaata gaatgtttct aaatgttaag tgtgattaag 2220

ataatggatt ttaacctaat ttttattttc gttttcattt cccacttccc gacgaagcat 2280

ttggattttg gaacgcctac ttaaaatttc aactggtttt tttctgaaaa tatcaaatct 2340

aactttgtag aggatggatt ggtcttgaaa atgtagattt aatttcatga tatgagcttc 2400

ttctgtttgt gtctagtcat gtgataagat tttttacttt aaaaatgacc aaaagtttca 2460

attatttata ttataaagaa attatttgaa aataaaatat agaaatttgt aatcttattg 2520

gtaaaaagtt cgattcaatt gaaagggact ttgaaattct tgtcctagtg atctctattc 2580

ttgagtttaa tcataaactg ttcaaagttc gcagccaaat tggaccaaca gtttctagta 2640

actctaactt gatgataatt catatttacc ctcacaaatt agtatatact aacgtcgacc 2700

tgcaggcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 2760

gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa 2820

tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 2880

tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 2940

tctatgttac tagatcggga attgccaagc t 2971

Claims (8)

1. A gene corresponding to LncRNA is characterized in that the gene is named LncRNA-114 gene, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

2. An LncRNA, which is named LncRNA-114 and has a nucleotide sequence shown as SEQ ID NO. 2.

3. A recombinant vector comprising the original vector and the gene of claim 1.

4. The recombinant vector of claim 3, wherein the original vector is pCambia1301 vector plasmid, and the gene of claim 1 is ligated to pCambia1301 vector plasmid by double restriction enzyme digestion with BamH I and Sal I.

5. Use of the gene of claim 1, or the LncRNA of claim 2, or the recombinant vector of claim 3 or 4 for increasing low temperature tolerance, and/or drought tolerance in plants.

6. Use of the gene of claim 1, or the LncRNA of claim 2, or the recombinant vector of claim 3 or 4 for regulating plant growth.

7. A method for amplifying the gene of claim 1, comprising the steps of: extracting total RNA by taking cassava leaves as a material, taking cDNA obtained by reverse transcription of PolyT as a template, and taking Lnc114-S BamH I: CGGGATCCAACAAACTATAAGCAAACAATG and Lnc114-A Sal I: ACGCGTCGACGTTAGTATATACTAATTTGTGA is a primer, and the gene corresponding to LncRNA of claim 1 is obtained by PCR amplification, and the sequence is shown in SEQ ID No. 1.

8. A primer set, comprising:

lnc114-S BamH I: CGGGATCCAACAAACTATAAGCAAACAATG and

Lnc114-A Sal I：ACGCGTCGACGTTAGTATATACTAATTTGTGA。

Images