CN101260435A - Molecule mark TIAF1 correlated with pig production character and application thereof - Google Patents

Molecule mark TIAF1 correlated with pig production character and application thereof Download PDF

Info

Publication number
CN101260435A
CN101260435A CNA2008100473921A CN200810047392A CN101260435A CN 101260435 A CN101260435 A CN 101260435A CN A2008100473921 A CNA2008100473921 A CN A2008100473921A CN 200810047392 A CN200810047392 A CN 200810047392A CN 101260435 A CN101260435 A CN 101260435A
Authority
CN
China
Prior art keywords
pig
sequence
gene
tiaf1
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA2008100473921A
Other languages
Chinese (zh)
Other versions
CN101260435B (en
Inventor
熊远著
王艳
雷明刚
任竹青
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN2008100473921A priority Critical patent/CN101260435B/en
Publication of CN101260435A publication Critical patent/CN101260435A/en
Application granted granted Critical
Publication of CN101260435B publication Critical patent/CN101260435B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the pig molecular marker assisted selection technical field, in particular relating to a molecular marker clone and application relative to pig production trait. A sequence of full-length cDNA of TIAFI gene relative to the pig production trait is obtained through clone, the sequence is referred to SEQ ID NO: 1. Molecular markers capable of being taken as the pig marker assisted selection application are obtained through analyzing the obtained cDNA segment through the clone, the markers position on the exons of TIAFI gene, relative to the pig production trait; nucleotides sequence of the molecular markers is referred to SEQ ID NO: 3, the 298th to 304th bases have six base deletions which lead Eco 47 I-RFLP to become polymorphic. The invention also discloses a molecular marker primer and a preparation method thereof. The correlation analysis of the pig production trait is performed through utilizing the molecular markers of the invention. The invention provides novel molecular markers for pig molecular marker assisted selection.

Description

Molecule marker TIAF1 and the application relevant with pig production character
Technical field
The invention belongs to pig marker assisted selection technical field, be specifically related to a kind of clone and application that is used for the molecule marker of pig marker assisted selection, this molecule marker is positioned on the exon of pig production character genes involved TIAF1, utilizes the molecule marker among the present invention that pig production character is carried out association analysis.
Background technology
In recent years, the development of advancing by leaps and bounds along with molecular genetics and biotechnology, the research of on the molecular biology level pig being carried out is also more and more, this is not only because pig is the important goods source of China people meat product consumption, and it also is the human heteroplastic important animal model of research and may becomes suitable transplant organ source of supply.Pig industry has critical role in China's livestock industry and national economy.Along with people to the continuous growth of animal proteinum food demand and the development of commodity economy, carcass quality evaluation has become heredity, breeding scholar, the producer, the problem that meat manager and human consumer generally are concerned about.People more and more pay close attention to the meat-based food lipid content, therefore the breeding objective of pig is also changed to lean meat species by lard type, so separating clone influence pig important economical trait new gene and seek important molecule marker and be used for the pig marker assisted selection, to quickening the seed selection of pig new variety, the development of accelerating China's pig industry is extremely important.
In Animal Genetics, marker assisted selection (MAS) is to be accompanied by molecular genetics, quantitative genetics and development of molecular biology and constantly to be widely used, and has become the focus of present domestic animal seed selection and research.Marker assisted selection has bigger quantity of information because the information of phenotype, pedigree and genetic marker that made full use of is compared with the conventional seed choosing method that only utilizes phenotype and pedigree information.So-called molecular marker assisted selection is exactly to utilize selection on the dna level to replace selection based on phenotypic number or breeding value.Two kinds of situations are generally arranged: one, to known, select by measuring its genotype, be the gene assisted Selection again; Its two, itself does not know gene, but known chain with it mark can be selected chain with it gene indirectly by label information.Because it is not subjected to the influence of environment, and nonsexual restriction, thereby allows to choose seeds in early days, can shorten the generation interval, improves selection intensity, thereby improve the efficient of seed selection and the accuracy of seed selection.In view of the above, can QTL detect and localized basis on, the importing that utilizes the information of mark to come auxiliary gene especially for the proterties of hanging down heritability, as reproductive trait, helps to accelerate its genetic progress.At present, MAS has obtained some successful examples in the seed selection of animal, pig fluothane (halothane, HAL) gene and estrogen receptor (estrogen receptor, the ESR) dna marker of gene detection application in the practices of breeding; Two fleshes (double muscling, DM) gene of ox; Chicken short and small (dwarf, dw) gene also use in breeding with in producing (Lu Shaoxiong etc., assisted Selection research of animal genetic marker and applied science thereof. heredity, 2002,3:359-362).
From 1974, Grodjicker etc. propose restriction fragment length polymorphism RFLP (Restriction Fragment LengthPolymorphism) technology as first-generation DNA genetic marker since, the DNA genetic marker has greatly promoted human research for dna polymorphism.Compare with the genetic marker of classics, dna marker has a lot of advantages: can measure on pig any etap, tissue and cell levels in life, its detection is not influenced by genetic expression; Can spontaneous generation on same seat more allelotrope, the mark of unlimited amount is arranged in theory; In most cases there is not phenotypic effect; Allelotrope is generally codominance, seldom has epistatic effect between the seat.In the breeding of pig, RFLP and PCR-RFLP technology have been brought into play enormous function as molecular genetic marker, mainly are used in the drafting and the goal gene mark of pig genetic linkage map.Up to now, various vegeto-animal linkage maps are mainly drawn by the RFLP mark.The PCR-RFLP technology of the be combined into of RFLP and round pcr has obtained using widely especially in the recent period.Along with the project implementation of pig genome, pig genomic dna mark also becomes one of focus of research.
TIAF1 is the apoptotic factor of a kind of inhibition of transforminggrowthfactor-(transforming growth factor-β 1, TGF-β 1) mediation.Transforming growth factor-beta (transforming growth factor-β, TGF-β) family becomes to be grouped into by more than 30, comprise TGF-β s (being the TGF-β of narrow sense), activin (activins) and bone morphogenic protein (bone morphogenic proteins, BMPs), it plays an important role aspect the numerous biological respinse of human bodies such as cell life cycle, fetal development regulating.TGF-signal abnormality will cause heteroplasia embryonic stage, if it occurs unusually giving birth to the back, will cause many illness, and will be common as tumour, autoimmune disease, tissue fibrosis etc.Mammal TGF-β has 3 kinds of isomer: TGF-β 1, TGF-β 2, TGF-β 3, they are respectively by 3 clear and definite genes encodings, with LTGF-beta form (potential precursor molecule) secretion, bring into play the signal conduction then but need could combine with the TGF-beta receptor with sophisticated activity form.
Some studies show that TGF-signal path plays a significant role in the kinds of tumors that comprises cancer of the stomach develops, this path has become one of focus of tumor research.TGF-signal path plays a dual role in the developing of tumour, in normal cell and early stage tumour, TGF-β by cell cycle regulation, suppress the formation that cell proliferation and cell death inducing suppress tumour; And, then promote the invasion and attack and the transfer of tumour by the interaction of immunosuppression/escape, increase vasculogenesis and increase tumour cell and extracellular matrix to the progressive stage tumour.TGFB1 and TGFBR2 are the core genes of this path, and can the heritable variation of the two be proved to be with the power of TGF-signal and normally pass closely relatedly down, participates in comprising the developing of kinds of tumors of cancer of the stomach.The TGFB1 gene polymorphic may relevant (Derynck R, et al., TGF-betasignaling in tumor suppression and cancer progression.Nat Genet, 2001,29:117-129 with the genetic predisposition of tumour; Dunning A M, et al., A transforming growth factor betal signal peptide variantincreases secretion in vitro and is associated with increased incidence of invasivebreast cancer.Cancer Res, 2003,63:2610-2615).
(Zhang Haixiao etc. such as Zhang Haixiao, transforming growth factor-beta signal transduction pathway and myocardial fibrosis. China-Japan Friendship Hospital's journal, 2007:110-112) report TGF-β has the fibroblastic conversion of the flesh of promotion in myocardial fibrosis generation, evolution, promote collagen gene expression, promoting extracellular matrix to synthesize with deposition and wait effect, is one of most important short myocardial fibrosis cytokine.Myocardial fibrosis is the common pathological change that multiple heart disease develops into certain phase, is one of main performance of myocardial remodelling.TGF-β is the polypeptide that a class can be regulated the cell Growth and Differentiation, possesses the various biological function, and it participates in the formation of propagation, differentiation, migration, apoptosis and the matrix of cell.TGF-β activation can promote the fibroblastic conversion of flesh under chronically infected condition, suppresses extracellular matrix degradation, increases extracellular matrix mRNA expression and protein synthesis, and TGF-β plays an important role in the evolution of myocardial fibrosis.
TGF-β 1 is a kind of multi-functional intercellular signal albumen, regulates multiple target gene expression, plays a significant role in cell proliferation, identification, apoptosis, special differentiation and extracellular matrix are synthetic, has the various biological effect.TGF-β 1 in conjunction with and activated receptor after, signaling molecule carried out after its signal transmission need have a series of acceptors, wherein Smad albumen is to activate substrate in the TGF-β1Shou Ti born of the same parents main known at present, has mediated transduction in the born of the same parents of TGF-β 1 signal.TIAF1 is the factor of a TGF-β 1 mediation, and it protects the L929 inoblast to avoid the apoptosis of TNF mediation.But the overexpression of this gene can cause growth to be suppressed again and cause monocytic series U937 and several non-fibroblastic programmed death simultaneously.TIAF1 and the p53 common regulating cell apoptosis that interacts in addition, and TIAF1 might participate in the nuclear transposition of active p53.The normal expression of TIAF1 gene in the L929 cell can improve the L929 cell to the toxic resistibility of TNF, and also improved the L929 cell to TNF acceptor adaptin (TRADD), fatty acid synthetase associated death domain protein (FADD) (Hsu H., et al., TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signaltransduction pathways.Cell, 1996a, 84:299-308) and the acceptor albumen (RIP) that influences each other cross to express toxigenous resistibility (Hsu H., et al., TNF-Dependent recruitment of the protein kinase RIP to the TNFreceptor-1 signaling complex.Immunity, 1996b, 4:387-396).But TIAF1 is that how to block the Cytotoxic mechanism of TNF not clear.IKB-α be NF-KB activity inhibitor (Baeuerle P.A., et al., I-KAPPA-B-Aspecific inhibitor of the NF-KAPPA-B transcription factor.Science, 1988,242:540-546).Stimulate the L919 cell to cause TIAF1 to express 1h with TGF-β 1, but suppress IKB-alpha expression 2-4h.Same, the stably express of TIAF1 gene in the L929 cell can suppress the expression of IKB-α significantly, the TIAF1 expression of gene suppresses relevant (the Chang N.S. of IKB-alpha expression with TGF-β 1, et al., Cloning and Characterization of a Novel TransformingGrowth Factor-b1-Induced TIAF1 Protein That Inhibits Tumor Necrosis Factor Cytotoxicityl.Biochem Bioph Res Co, 1998,253:743-749).
Research about the TIAF1 gene at present also mainly concentrates on the protein level, and research is less on dna level.
Do not see relevant TIAF1 gene up to now as yet as the clone of pig molecule mark and as the application of pig molecule mark assisted Selection.
Summary of the invention
The objective of the invention is to overcome the prior art defective, the cDNA full length sequence of clone and pig production character genes involved TIAF1, seek this gene mutation site and corresponding pleiomorphism detecting method, by the application of proterties association analysis, for the marker assisted selection of pig provides a kind of useful molecule marker.The invention still further relates to the preparation method and the application on the pig marker assisted selection of this molecule marker in addition.
The present invention realizes by following technology:
Applicant clone obtain with the full length cDNA sequence (comprising complete coding region sequence and 3 ' UTR and 5 ' UTR) of pig production character (carcass trait and meat proterties) genes involved TIAF1 as described in the sequence table SEQ ID NO:1, this sequence total length is 1633bp.
The present invention is by the cDNA fragment analysis to above-mentioned clone obtained, found that a kind of molecule marker that the pig marker assisted selection is used that can be used as, this mark is relevant with pig production character, its nucleotide sequence is shown in sequence table SEQ ID NO:3, there are 6 base deletions at 299-304 bit base place in this sequence, causes Eco47 I-RFLP polymorphism.
The applicant has prepared the forward and reverse primer that detects base deletion among the sequence table SEQ ID NO:3, and the dna sequence dna of this primer is as follows:
Forward primer: 5 '-GCCTACTGGGACATTCTCG-3 ',
Reverse primer: 5 '-GTGGGTGGGATGGGTTTA-3 '.
Clone of molecule marker and preparation method thereof carries out according to following steps among the present invention:
Personnel selection TIAFI gene cDNA sequence is the information probe, does the homologous sequence screening in expressed sequence tag (EST) database of pig, obtains the EST of homology more than 80%; Then EST is spliced; Obtain the cDNA sequence of pig according to the sequences Design primer of splicing, roughly draw the coding region sequence of pig TIAF1 gene according to comparison result with the cDNA sequence of people TIAF1 gene, design two positive and negative amplimers then, its fragment that obtains comprises the whole coding region sequence of pig TIAF1 gene, extract the DNA in the pig blood, utilize the whole coding region sequence of the primer PCR amplification pig TIAF1 gene of design, the PCR product reclaims, the clone, order-checking, obtain sequence and carry out interracial multisequencing comparison, seek important molecule marker, the sequence of acquisition as shown in figure 15.
The present invention clone's molecule marker can be used on the pig marker assisted selection, and comprising at the pig intramuscular fat, the scoring of longissimus dorsi muscle marble grain is used in the proterties association analysiss such as the heavy and shoulder thickness of backfat of caul-fat.
More detailed technical scheme is referring to " embodiment ".
Description of drawings
To be the present invention utilize SeqMan program among the DNAStar to be spliced into a complete cDNA sequence pig production character genes involved TIAF1 full sequence that is obtained to sequence table SEQ ID NO:1 (comprises 348bp CDS total length, 905bp 3 ' UTR and 380bp 5 ' UTR are sequence shown in Figure 5), among the figure shown in the square frame is the translation initiation codon and the terminator codon of this gene, and tailing signal is by shown in the underscore.
The protein sequence of the pig production character genes involved TIAF1 that sequence table SEQ ID NO:2 is among the present invention to be obtained.
Sequence table SEQ ID NO:3 is the nucleotide sequence (being sequence shown in Figure 6, also is the L1 among Figure 15) that first external pig kind " Large White " TIAF1 gene that the present invention clones comprises molecule marker.
Fig. 1: be that heavily increase difference in Large White and the Mei Shan pig liver tissue of the present invention shows the sequence of EST167.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 2: be that the present invention clones the pig production character genes involved TIAF1 Partial cDNA Sequence that obtains.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 3: be that the present invention clones the pig production character genes involved TIAF1 Partial cDNA Sequence that obtains.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 4: be that the present invention utilizes 5 ' RACE to clone the 5 ' UTR of the pig production character genes involved TIAFI that obtains.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 5: be that the present invention utilizes the SeqMan program among the DNAStar to be spliced into a complete cDNA sequence (comprising 348bp CDS total length and 905bp 3 ' UTR and 380bp 5 ' UTR is sequence shown in the sequence table SEQ ID NO:1) the pig production character genes involved TIAF1 full sequence that is obtained, among the figure shown in the square frame is the translation initiation codon and the terminator codon of this gene, and tailing signal is by shown in the underscore.
Fig. 6: be that first external pig kind " Large White " TIAF1 gene that the present invention clones comprises that the nucleotide sequence of molecule marker (is sequence shown in the sequence table SEQ ID NO:3, also be the L1 among Figure 15), 6 bases shown in the square frame are the molecule marker among the present invention, these 6 bases of disappearance in the pig kind of plum mountain.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 7: be that second external pig kind " Large White " (being the L2 among Figure 15) TIAF1 gene that the present invention clones comprises the nucleotide sequence of molecule marker.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 8: be that first domestic local pig breed " plum mountain pig " (being the M1 among Figure 15) TIAF1 gene that the present invention clones comprises the nucleotide sequence of molecule marker.Sequence shown in the underscore is the primer sequence that the present invention designs.
Fig. 9: be that second domestic local pig breed " plum mountain pig " (being the M2 among Figure 15) TIAF1 gene that the present invention clones comprises the nucleotide sequence of molecule marker.Sequence shown in the underscore is the primer sequence that the present invention designs.
Figure 10: pig TIAF1 Gene Partial cDNA Sequence electrophoresis picture among the present invention, clip size are 771bp (agarose gel concentration is 1.5%).Among the figure: the M swimming lane is a dna molecular amount standard (DL2000).
Figure 11: pig TIAF1 Gene Partial cDNA Sequence electrophoretogram among the present invention, clip size are 1015bp (agarose gel concentration is 1.5%).Among the figure: the M swimming lane is a dna molecular amount standard (DL2000).
Figure 12: the electrophoresis picture of pig TIAF1 gene 5 ' RACE amplified production among the present invention, clip size are 415bp (agarose gel concentration is 1.5%).Among the figure: the M swimming lane is a dna molecular amount standard (DL2000).
Figure 13: pig TIAF1 gene comprises the segmental electrophoresis picture that complete CDS sequence is used for seeking molecule marker among the present invention, and clip size is 601bp (agarose gel concentration is 1.5%).Among the figure: the M swimming lane is a dna molecular amount standard (DL2000).
Figure 14: the amplified production electrophoretogram of pig TIAF1 gene test molecule marker among the present invention.(agarose gel concentration is 1.5%), among the figure: the M swimming lane is a dna molecular amount standard (DL2000).
Figure 15: use method of the present invention 2 " Large Whites " and 2 " plum mountain pigs " are comprised complete CDS nucleotide sequence comparison result.L1, L2 representative " Large White " among the figure, M1, M2 represent " plum mountain pig ", and among the figure shown in the square frame is the translation initiation codon and the terminator codon of this gene.
Figure 16: the three kinds of genotype of Eco 47 I-RFLP among the present invention on the pig TIAF1 gene extron (AA, AB and BB) electrophoretogram.(agarose gel concentration is 1.5%), among the figure: the M swimming lane is a dna molecular amount standard (DL2000).
Embodiment
Embodiment 1:
(1) TIAF1 gene cDNA sequence clone
(1) design of primers
Find an EST who only expresses by the mRNA differential display technique in the liver organization of Large White and Mei Shan pig in the pig of plum mountain, called after EST167 reclaims EST167, and AR4/T5 heavily increases with primer, order-checking, and the sequence that is obtained is as shown in Figure 1.This sequence is carried out the homology search in the NCBI sequence library, find that itself and people TIAF1 gene have 81% homology.Personnel selection TIAF1 gene mRNA (the GenBank number of including: NM 004740) is the information probe, utilize the BLAST instrument among the NCBI in GenBank pig est database, to do the homologous sequence screening, obtain a series of homologys and be the ESTs (fragment length is greater than 100bp) more than 80%, the number of including of these ESTs is inquired about corresponding sequence with ENTREZ (http://www.ncbi.nlm.nih.gov/Web/Search/index.html) in NCBI, use the SeqMan program construction pig EST-contig among the sequence analysis software DNAStar then.According to the initial and terminator codon position of comparing with the homology of people TIAF1 gene mRNA and NCBI goes up tentatively definite this gene of prediction (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) of open reading frame, design two couples of primer cT2F/cT2R, the cDNA sequence that cT3F/cT3R clone obtains as shown in Figures 2 and 3 (comprises 358bp CDS total length and part 3 '-UTR and part 5 '-UTR); Show that with the comparison result of the genome full length DNA sequence of people TIAF1 gene this gene has only an exon.According to downstream primer cT4R of the CDS sequences Design that is obtained, be template with SMART cDNA, with 5 ' art end of cT4R and 5 ' this gene of RACE primer amplification, obtain the amplified production of 415bp, its sequence is as shown in Figure 4.Utilize the SeqMan program among the DNAStar to splice the cDNA total length that obtains pig TIAF1 gene above-mentioned four sequences that obtain, its sequence is shown in sequence table SEQ ID NO:1.Design a pair of primer cT5F/cT5R amplification according to the cDNA total length of TIAF1 gene and comprise complete CDS sequence, the DNA that chooses 2 " Large Whites " and 2 " plum mountain pigs " does template, carry out pcr amplification, recovery, clone, order-checking, obtain the nucleotide sequence shown in sequence table SEQ ID NO:1 (comprise the sequence shown in L2, M1, the M2 in the accompanying drawing 15, wherein the L1 sequence has been included in the sequence shown in the SEQ ID NO:1).Find to exist 4 SNP of place by the ClusterW comparison, place deletion mutantion find plum mountain pig kind in 6 bases of 298-304bp place disappearance with the comparison of Large White kind, and because the disappearance of 6 bases causes the protein of its translation to lack two amino acid.As contain this 6 bases, can be designed a pair of primer cT6F/cT6R and carry out the evaluation of enzyme cutting type by restriction endonuclease Eco47 I identification just.
(2) the PCR-RFLP diagnostic method is set up
RFLP detects: with PCR product 5 μ L, 10 * Buffer, 1 μ L, restriction enzyme Eco47 I 0.3 μ L (3U), adding distilled water mends to 10 μ L, with centrifugal behind the sample mixing, 37 ℃ of incubators are placed 6h, detect with 1.5% agarose gel electrophoresis, imaging system is observed enzyme and is cut the result, the record genotype.
Cut primer amplification pig genomic dna with enzyme and obtained 483bp specific amplification fragment (seeing Figure 14 for details), the The sequencing results of accompanying drawing 15 shows the disappearance that has 6 bases behind the 298bp in the pig of plum mountain, and causes the Eco47I-RFLP-polymorphism.This gene mutation site is controlled by two allelotrope, and wherein A is the allelotrope that does not form restriction enzyme site, just has 6 base deletions, and B is the allelotrope that forms restriction enzyme site, does not just have 6 base deletions.These two allelotrope can form three kinds of genotype wherein the AA type homozygously (have only DNA band of 455bp during electrophoresis detection for what do not take place that enzyme cuts, also have the band of a 28bp detect less than), the BB type is that homozygous that the generation enzyme is cut (two DNA bands of 276bp and 179bp occur during electrophoresis detection, also have the band of a 28bp detect less than), AB be heterozygous (three DNA of 455bp, 276bp and 179bp band appears during electrophoresis detection, also have the band of a 28bp detect less than).
The primer of amplification TIAF1 gene cDNA sequence is as follows: (dividing 4 sections amplifications)
First section: find an EST167 who only in the pig of plum mountain, expresses, the primer that heavily increases by the mRNA differential display technique
AR4:5′ACAATTTCACACAGGATCCTAGACTC?3′,
T5:5′ACGACTCACTATAGGGATTTTTTTTTTTTCG?3′。
Second section: the amplification Partial cDNA Sequence
cT2F:5′TCAGATGATGAGCACGACC?3′,
cT2R:5′AACCCAAACCCAGAAGCA?3′。
The 3rd section: the amplification Partial cDNA Sequence
cT3F:5′AGAGGTGGAGGGAAGAGC?3′,
cT3R:5′AGCACAGCCCAATGAGTA3′。
The 4th section: 5 ' RACE, the 5 ' UTR that increases
5’RACE:5′AACGCAGAGTACGCGGG?3′,
cT4R:5′TGGGCTAGGCGTTGGTCT?3′。
Seek the sequence that important molecular markers obtained
cT5F:5′GGACATTCTCGGGTTGCT?3′,
cT5R:5′TCCATCCTCAGGCTTTCT?3′。
It is as follows to detect the used primer sequence of 298-304bp place 6 base deletions sudden change:
cT6F:5’GCCTACTGGGACATTCTCG?3’,
cT6R:5′GTGGGTGGGATGGGTTTA?3′。
(2) purifying of PCR product, clone and order-checking
Add dna profiling 1 μ L, 10 * PCR buffer, 2.5 μ L, MgCl in the reaction system of pcr amplification condition: 25uL 2(25mM) 1.5 μ L, each 0.5 μ L before and after dNTP (10mM) the 0.5 μ L, 10mM primer, Taq enzyme 1U, distilled water 17.5 μ L, the PCR reaction conditions is: 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 40s, annealing temperature sees Table 1, annealing time 45s, 72 ℃ of extension times see Table 1, totally 35 circulations; Last 72 ℃ are extended 10min, 25 ℃ of preservations.The PCR product detects through 1.5% agarose gel electrophoresis.
Table 1: amplification purposes and annealing temperature and extension time
Figure A20081004739200091
The purifying of PCR product: the concrete operations step is as follows: contain the segmental gel of purpose from the cutting-out of low melting-point agarose gel under ultraviolet lamp, put into 1.5mL Ependorff pipe, use PCR product purification test kit (purchase white Promega company) purified pcr product then, according to this test kit specification sheets operation, concrete steps are the S1 liquid that adds 300 μ L in the gel of every 100mg, melt fully in 65 ℃ of incubation 10min to gel, change the S1/DNA mixture over to the recovery post, the centrifugal 30s of 9200g makes slurries extrude by Minicolumn.Waste liquid in the following pipe is outwelled, and the W1 liquid that adds 500 μ L again is to pipe, and the centrifugal 15s of 9200g outwells the waste liquid in the pipe.Add the W1 liquid of 500 μ L again, leave standstill 1min, the centrifugal 30s of 9200g takes off Minicolumn and packs in the 1.5mlEpendorff pipe, adds aqua sterilisa or the TE liquid of 25 μ L, leaves standstill after the 1min, and the centrifugal 1min of 9200g is stored in the Ependorff pipe with eluted dna.
Ligation: purified pcr product is connected with pMDl8-T Vector (available from TaKaRa company), and the ligation cumulative volume is 10 μ L, comprising 2 * Rapid Ligation Bufer, and, 2.5 μ L; Vector (50ng), 0.5 μ L; Reclaim DNA, 7-8 μ L.Bullet is beaten and is mixed a little, connects more than the 1h or 4 ℃ of connections are spent the night in 16 ℃.
The preparation of competent cell: the single colony inoculation of DH5 α of picking is in 2mLLB from 37 ℃ of fresh flat boards of having cultivated 16-20h, in 37 ℃ of shaking table shaking culture 3h, switching 1mL bacterium liquid is in the saline bottle that contains 300mL LB, continuation is at 37 ℃ of about 4h of shaking table shaking culture, treat that when OD600 reaches 0.3-0.4 saline bottle being put ice bath from the shaking table taking-up cools off 10-15min, then bacterium liquid is changed in the centrifuge tube in 4 ℃ 4, the centrifugal 10min of 000g is with collecting cell, centrifuge tube is inverted to abandon clean nutrient solution, is iced the CaCl of the 0.1mol/L of precooling with 10mL 2Resuspended precipitation, ice bath 30min repeats 4 ℃ 4, and the centrifugal 10min of 000g once ices the CaCl of the 0.1mol/L of precooling with 4ml 2Resuspended precipitation, it is standby to put 4 ℃ of preservations.
Transform: in the 1.5mL centrifuge tube of sterilization, add 100 μ L competent cells, add on ice and connect product 5 μ L, with liquid-transfering gun piping and druming evenly, ice bath 30min; Centrifuge tube is placed 42 ℃ circulator bath (not vibrations), behind the heat shock 90s, rapid ice bath 2min; In centrifuge tube, add 400 μ L LB nutrient solutions again, bathe recovery 45-60min in 37 ℃ of shaking tables (200rpm/min) temperature; Centrifugal, remove the part supernatant liquor, the bacterium liquid of getting after 100 μ L recover is distributed on the flat board that contains Amp, smoothens; After treating that liquid fully absorbs, be inverted plate, in 37 ℃ of cultivations 14-16 hour, observation had or not bacterium colony to grow.
The evaluation of positive colony and order-checking:
The bacterial plaque that picking transforms from flat board inserts the 1.5mL centrifuge tube that contains 400 μ L LB and in 37 ℃ of shaking table joltings and cultivates about about 8h.With this bacterium liquid is template, selects for use the universal primer M13 (biotechnology company limited in Shanghai provides) of former primer or order-checking to carry out pcr amplification (annealing temperature 58-60 ℃).Electrophoresis detection, the bacterium liquid of picking positive colony is sent to order-checking, and sequencing is finished by Shanghai biotechnology company limited.
In this side's of enforcement example, pcr amplification product is special PCR product through the demonstration of 1.5% agarose gel electrophoresis detected result.The PCR product is reclaimed the purifying rear clone, order-checking, splicing, the result shows that resulting global cDNA sequence length is 1633bp, comprises 348bp CDS total length and 905bp 5 ' UTR and 380bp 3 ' UTR, (shown in sequence table SEQ ID NO:1); The fragment total length that comprises complete CDS sequence that the PCR product order-checking of searching important molecular markers obtains is 601bp, (shown in Figure 15 and sequence table SEQ ID NO:3), sequencing result show the deletion mutantion that has 6 bases (CCAGGT) at the 298-304bp place of this cDNA sequence.
(3) the dna sequence dna homology search is identified
By the American National biotechnology (NCBI of information center, http://www.ncbi.nlm.nih.gov) BLAST of website (Basic Local Alignment Search Tool) software, the known physiological function gene of announcing in the cDNA sequence that order-checking back is obtained and the GenBank database carries out sequence homology relatively, with evaluation with obtain the function information of this cDNA sequence.
(2) the PCR-RFLP diagnostic method is set up
RFLP detects: with PCR product 5 μ L, 10 * Buffer, 1 μ L, restriction enzyme Eco47 I is 0.3 μ L (3U), adding distilled water mends to 10 μ L, with centrifugal behind the sample mixing, 37 ℃ of incubators are placed 6h, detect enzyme with 1.5% agarose gel electrophoresis and cut the result, take pictures with gel imaging system, and the record genotype.
Cut primer amplification pig genomic dna with enzyme and obtained 483bp specific amplification fragment (seeing Figure 14 for details), the The sequencing results of accompanying drawing 15 shows the deletion mutantion that has 6 bases behind the 298bp of plum mountain pig sequence, and causes the Eco47I-RFLP polymorphism to change.This gene mutation site is controlled by two allelotrope, and wherein A is the allelotrope that does not form restriction enzyme site, and 6 base deletions are just arranged, and B is the allelotrope that forms restriction enzyme site, does not just have base deletion.These two allelotrope can form three kinds of genotype wherein the AA type homozygously (have only DNA band of 455bp during electrophoresis detection for what do not take place that enzyme cuts, also have the band of a 28bp detect less than), the BB type is that homozygous that the generation enzyme is cut (two DNA bands of 276bp and 179bp occur during electrophoresis detection, also have the band of a 28bp detect less than), AB be heterozygous (three DNA of 455bp, 276bp and 179bp band appears during electrophoresis detection, also have the band of a 28bp detect less than) (seeing Figure 16 for details).
(3) detection and the application of PCR-Eco47 I-RFLP polymorphism distribution situation in each pig kind
Utilize PCR-Eco47 I-RFLP to detect 5 pig kinds: the pig kind that wherein belongs to the place of china blood relationship is respectively eight eyebrow pigs, the Huainan pig, and plum mountain pig, the external pig kind that belongs to American-European blood relationship is respectively landrace and Large White.Genotype and the gene frequency of this mutational site in different pig kinds is as shown in table 2, the result shows that Chinese native pig breed and following pig kind allelotrope A and B proportion difference are bigger, Chinese native pig breed eight eyebrow pigs, plum mountain pig are A allelotrope and preponderate, and A allelotrope and B allelotrope respectively account for 50% in the pig of Huainan; And external pig kind Large White and landrace are B allelotrope and preponderate.
Table 2: the genotype and the gene frequency of TIAF1 genetically deficient mutation polymorphism in five pig kinds
Figure A20081004739200111
Embodiment 2:
The test materials that is used for statistical study comprises 2000,2003 and 2004 years three crowdes of Da Bai * Mei Shan F 2In generation, is 394 pigs altogether, and the proterties of being analyzed is mainly carcass trait and meat proterties.Carcass trait comprises the skin rate, bone rate, fat meat rate, lean ratio, thin fat meat ratio, carcass weight, dressing percentage, leaf fat is heavy, caul-fat is heavy, and the lactones rate is long to the atlas trunk, and is long to first rib chest trunk, the thickness of backfat between the 6-7 lumbar vertebrae, the shoulder thickness of backfat, the thickness of backfat between the chest lumbar vertebrae, the buttocks thickness of backfat, the average thickness of backfat, leg stern ratio, the eye muscle height, eye muscle is wide, eye muscle area.The meat proterties comprises longissimus dorsi muscle pH, biceps muscle of thigh pH, and semispinalis capitis muscle pH, percentage of water loss is a waterpower, longissimus dorsi muscle colour, biceps muscle of thigh colour, the scoring of longissimus dorsi muscle marble grain, the scoring of biceps muscle of thigh marble grain, intramuscular fat, intramuscular moisture.
The applicant adopts SAS statistical software (SAS Institute Inc, Version 8.0) glm program to carry out single mark variance analysis, adopts the reg program to calculate additive effect of gene and dominant effect simultaneously, and carries out test of significance, and the model that adopts is:
Y ijkl=μ+G i+S k+Y l(+b ijklX ijkl)+e ijkl
Y IjBe the proterties phenotypic number, μ is a mean value, G iBe the genotype effect; S k, Y iBe fixed effect, be respectively sex, annual effect, b IjklFor slaughter weight or butcher the regression coefficient of age in days, carcass trait is concomitant variable with the slaughter weight, and the meat proterties is a concomitant variable to butcher age in days, and concomitant variable is not considered in growth; e IjklBe the residual error effect.
Genotype detection result shows: 394 Da Bai * Mei Shan F that is being detected 2In individuality, 221 of AA genotype, 105 of AB genotype, 68 of BB genotype.The statistics of different genotype and carcass trait is summarized in table 3.The statistics of different genotype and meat proterties is summarized in table 4.
The statistical analysis table of table 3:Eco 47 I-RFLP genotype and carcass trait
Figure A20081004739200121
Annotate: above numerical value is least square mean value standard error, and target letter identical table differential is different not remarkable on the numerical value, letter not simultaneously, capitalization represents that difference is extremely remarkable, the lowercase alphabet differential is different significantly; The additive effect negative value represents that B allelotrope reduces the proterties phenotypic number, and its subscript * represents p<0.05, and * * represents p<0.01.
As can be seen from Table 3, TIAF1 genotype and caul-fat heavily are utmost point significant correlation, and be long to the atlas trunk with the bone rate, and it is significantly relevant that the shoulder thickness of backfat is.Aspect genetic effect, the heavy additive effect of caul-fat reaches conspicuous level; The skin rate, the bone rate, the fat meat rate, long to first rib chest trunk, the shoulder thickness of backfat, the high dominant effect of eye muscle reaches conspicuous level.The heavy utmost point of the individual caul-fat of AA genotype is significantly higher than BB genotype individuality, and its shoulder thickness of backfat also is significantly higher than AB genotype individuality, if therefore select the genotypic individuality of BB may improve carcass trait to a certain extent in breeding.Chinese native pig breed eight eyebrow pigs, plum mountain pig are A allelotrope and preponderate, the heavy utmost point of individual caul-fat that can be seen the AA type by last table again is significantly higher than BB genotype individuality, and its shoulder thickness of backfat also is significantly higher than AB genotype individuality, this is consistent with plum mountain kind phenotypic effect direction, because domestic local pig breed is the lard type kind mostly, and plum mountain pig is particularly outstanding.
The statistical analysis table of table 4:Eco 47 I-RFLP genotype and meat proterties
Figure A20081004739200131
Annotate: above numerical value is least square mean value standard error, and target letter identical table differential is different not remarkable on the numerical value, letter not simultaneously, capitalization represents that difference is extremely remarkable, the lowercase alphabet differential is different significantly; The additive effect negative value represents that B allelotrope reduces the proterties phenotypic number, and its subscript * represents p<0.05, and * * represents p<0.01.
As can be seen from Table 4, biceps muscle of thigh pH, longissimus dorsi muscle colour, biceps muscle of thigh colour, the scoring of longissimus dorsi muscle marble grain, the difference of intramuscular fat between different genotype reach significantly or utmost point conspicuous level.Longissimus dorsi muscle pH, biceps muscle of thigh pH, semispinalis capitis muscle pH flesh, intramuscular moisture dominant effect reach significantly or utmost point conspicuous level aspect genetic effect; Scoring of longissimus dorsi muscle marble grain and intramuscular fat additive effect reach utmost point conspicuous level.The genotypic individuality of AA has higher biceps muscle of thigh pH than the genotypic individuality of BB, the scoring of longissimus dorsi muscle marble grain, intramuscular fat; The genotypic individuality of BB has higher biceps muscle of thigh colour than the genotypic individuality of AA; The genotypic individuality of AB has higher longissimus dorsi muscle colour than the genotypic individuality of AA.Therefore in breeding, can select the individuality of different genotype, to improve the meat proterties according to different demands.
Sequence table
SEQUENCE?LISTING
<110〉Hua Zhong Agriculture University
<120〉molecule marker TIAF1 and the application relevant with pig production character
<130>
<141>2008-04-18
<160>3
<170>PatentIn?version?3.1
<210>1
<211>1633
<212>DNA
<213〉pig (Sus scrofa)
<220>
<221>gene
<222>(1)..(1633)
<223>
<220>
<221>polyA_signal
<222>(1599)..(1604)
<223>
<220>
<221>CDS
<222>(906)..(1253)
<223>
<400>1
gctctcgaaa?gagcaagaag?aaatccaaat?ccagaagaaa?gagaacagag?tctgaatctt 60
cctcgtctac?atccggtggc?tctactgtct?caggccacag?ccgctcaagt?gtgaagaagg 120
gcccggctcc?agaagaggag?gaggctgggc?aggggcgccg?gcaatctcgg?aaggaggaga 180
agaagcgcaa?gaaggaggtg?gacagcctga?tgatgcggta?cctgtaccgg?ccggagagcg 240
actagtgcac?cccaccagct?actggaagtc?ccttgcccct?gaccggtcag?atgatgagca 300
cgaccctctc?gacagcacct?ccagaccccg?atacacccac?aactatctga?gtgacagcgg 360
cacagaggcc?aagcagacag?agaccaacgc?ctagcccagg?gagtgatgtc?atgcccctcc 420
tacccagggc?ccactgctgc?catggcacac?ggggcacggg?tctcccccac?cggactgcgg 480
atctgcatgg?gaaacacctg?accctcttcg?gtcaggactc?ttcccaggct?gtgggtatct 540
gacgtctcca?catggaagag?gtggagggaa?gagcagaaaa?gagaactttc?tgctcctgcc 600
ttgggccacc?atgggtggca?ggtggcttgg?cactgcgtgg?agccagcatg?ttgacctgca 660
tctcagcccc?ctgctcaggg?acggtggaca?gattgcctac?tgggacattc?tcgggttgct 720
gggtccacgg?ggaggcgttt?agggtgggaa?cagcaattcc?ttccccctgg?cttggggtga 780
gggctttttc?ttctcagtgc?ctgctgtctt?tttactttaa?tttaaatacc?caacctctcc 840
atcatcaaag?ctgcacccct?gagagtggga?gggggctgcg?gcggcagccg?gccctgcctc 900
cccgc?atg?gga?gtg?act?agg?gga?atc?tca?acc?aca?tct?tca?ctc?ttc?aga 950
Met?Gly?Val?Thr?Arg?Gly?Ile?Ser?Thr?Thr?Ser?Ser?Leu?Phe?Arg
1 5 10 15
gaa?cag?tcc?ttt?ctc?tgt?gca?gct?gga?gag?acc?ggt?gag?cag?agc?tgg 998
Glu?Gln?Ser?Phe?Leu?Cys?Ala?Ala?Gly?Glu?Thr?Gly?Glu?Gln?Ser?Trp
20 25 30
gtc?cag?gtt?ctt?aag?agt?ccg?cgc?ggg?gag?ggg?ctc?tca?ggt?gct?tct 1046
Val?Gln?Val?Leu?Lys?Ser?Pro?Arg?Gly?Glu?Gly?Leu?Ser?Gly?Ala?Ser
35 40 45
ggg?ttt?ggg?ttg?agc?aaa?cct?cca?cag?aca?ggg?ctg?cac?atg?tac?cag 1094
Gly?Phe?Gly?Leu?Ser?Lys?Pro?Pro?Gln?Thr?Gly?Leu?His?Met?Tyr?Gln
50 55 60
cca?gaa?ctt?cca?gcc?ccc?acc?cct?ttg?cct?cat?cag?tgt?gtt?aag?tgc 1142
Pro?Glu?Leu?Pro?Ala?Pro?Thr?Pro?Leu?Pro?His?Gln?Cys?Val?Lys?Cys
65 70 75
aat?gac?cta?ttt?aag?agt?aaa?ccc?atc?cca?ccc?acg?cca?att?cgg?ggc 1190
Asn?Asp?Leu?Phe?Lys?Ser?Lys?Pro?Ile?Pro?Pro?Thr?Pro?Ile?Arg?Gly
80 85 90 95
tta?tcc?aag?cac?tgc?ctc?ccc?tcc?gcc?tct?gtc?caa?gtt?gcc?tgg?atc 1238
Leu?Ser?Lys?His?Cys?Leu?Pro?Ser?Ala?Ser?Val?Gln?Val?Ala?Trp?Ile
100 105 110
aca?agc?tca?act?tga?gagcgaaggc?cttgggttga?gggcttatga?tcagaaagcc 1293
Thr?Ser?Ser?Thr
115
tgaggatgga?agttttggtc?agtaacaatg?tgtattagac?acacgagtcc?tcaccctatg 1353
ttctgagact?gagttatttt?tcttcttcca?gtcgtcctgc?cccgcacact?tatcctagac 1413
acgacaacat?gcggactgac?agtcccagcc?cccaccctca?aggtcatccc?accaacccca 1473
ccagccttgg?gggcccaagg?gcagtgctgc?ctggtgccgc?tctcttctgc?tgtccctgct 1533
cccctcctgc?aattagtttg?tactcattgg?gctgtgctct?ctcccctgtt?tacctgatgt 1593
atagaaataa?atgtcctttt?cctcctcgaa?aaaaaaaaaa 1633
<210>2
<211>115
<212>PRT
<213〉pig (Sus scrofa)
<400>2
Met?Gly?Val?Thr?Arg?Gly?Ile?Ser?Thr?Thr?Ser?Ser?Leu?Phe?Arg?Glu
1 5 10 15
Gln?Ser?Phe?Leu?Cys?Ala?Ala?Gly?Glu?Thr?Gly?Glu?Gln?Ser?Trp?Val
20 25 30
Gln?Val?Leu?Lys?Ser?Pro?Arg?Gly?Glu?Gly?Leu?Ser?Gly?Ala?Ser?Gly
35 40 45
Phe?Gly?Leu?Ser?Lys?Pro?Pro?Gln?Thr?Gly?Leu?His?Met?Tyr?Gln?Pro
50 55 60
Glu?Leu?Pro?Ala?Pro?Thr?Pro?Leu?Pro?His?Gln?Cys?Val?Lys?Cys?Asn
65 70 75 80
Asp?Leu?Phe?Lys?Ser?Lys?Pro?Ile?Pro?Pro?Thr?Pro?Ile?Arg?Gly?Leu
85 90 95
Ser?Lys?His?Cys?Leu?Pro?Ser?Ala?Ser?Val?Gln?Val?Ala?Trp?Ile?Thr
100 105 110
Ser?Ser?Thr
115
<210>3
<211>601
<212>DNA
<213〉pig (Sus scrofa)
<220>
<221>gene
<222>(1)..(601)
<223>
<220>
<221>mutation
<222>(299)..(304)
<223>
<220>
<221>primer_bind
<222>(584)..(601)
<223>
<220>
<221>primer_bind
<222>(1)..(18)
<223>
<400>3
ggacattctc?gggatgctgg?gtccacgggg?aggcgtttag?ggtgggaaca?gcaattcctt 60
ccccctggct?tggggtgagg?gctttttctt?ctcagtgcct?gctgtctttt?tactttaatt 120
taaataccca?acctctccat?catcaaagct?gcacccctga?gagtgggagg?gggctgcagc 180
ggcagccggc?cctgcctccc?cgcatgggag?tgactagggg?aatctcaacc?acatcttcgc 240
tcttcagaga?acagtccttt?ctctgtgcag?ctggagagac?cggtgagcag?agctgggtcc 300
aggttcttaa?gagtctgcgc?ggggaggggc?tctcaggtgc?ttctgggttt?gggttgagca 360
aacctccaca?gacagggctg?cacatgtacc?agccagaact?tccagccccc?acccctttgc 420
ctcatcagtg?tgttaagtgc?aatgacctat?ttaagagtaa?acccatccca?cccacgccaa 480
ttcggggctt?atccaagcac?tgcctcccct?ccgcctctgt?ccaagttgcc?tggatcacaa 540
gctcaacttg?agagcgaagg?ccttgggttg?agggcttatg?atcagaaagc?ctgaggatgg 600
a 601

Claims (6)

1, a kind of molecule marker of using as the pig marker assisted selection relevant with pig production character, its nucleotide sequence is shown in sequence table SEQ ID NO:3.
2, molecule marker according to claim 1 is characterized in that, 6 base deletions in 299-304 bit base place of sequence shown in the sequence table SEQ ID NO:3 cause Eco 47 I-RFLP polymorphisms to change.
3, it is as follows that test right requires the dna sequence dna of forward and reverse primer of 2 described base deletions sudden change:
Forward: 5 '-GCCTACTGGGACATTCTCG-3 ',
Oppositely: 5 '-GTGGGTGGGATGGGTTTA-3 '.
4, a kind of preparation method who realizes claim 1 or 2 described molecule markers is characterized in that according to following steps:
Personnel selection TIAF1 gene cDNA sequence is the information probe, does the homologous sequence screening in expressed sequence tag (EST) database of pig, obtains the EST of homology more than 80%; Then EST is spliced; Obtain the cDNA sequence of pig according to the sequences Design primer of splicing, roughly draw the coding region sequence of pig TIAF1 gene according to comparison result with the cDNA sequence of people TIAF1 gene, design two positive and negative amplimers then, its fragment that obtains comprises the whole coding region sequence of pig TIAF1 gene, extract the DNA in the pig blood, utilize the whole coding region sequence of the primer PCR amplification pig TIAF1 gene of design, the PCR product reclaims, the clone, order-checking, obtain sequence and carry out interracial multisequencing comparison, seek important molecule marker, the sequence of acquisition is shown in sequence table SEQ ID NO:3.
5, claim 1 or 2 application of described molecule marker in the pig molecule mark assisted Selection.
6, the application of claim 5, comprising at the pig intramuscular fat, the scoring of longissimus dorsi muscle marble grain, the application in the heavy and shoulder thickness of backfat proterties association analysis of caul-fat.
CN2008100473921A 2008-04-18 2008-04-18 Molecule mark TIAF1 correlated with pig production character and application thereof Expired - Fee Related CN101260435B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2008100473921A CN101260435B (en) 2008-04-18 2008-04-18 Molecule mark TIAF1 correlated with pig production character and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2008100473921A CN101260435B (en) 2008-04-18 2008-04-18 Molecule mark TIAF1 correlated with pig production character and application thereof

Publications (2)

Publication Number Publication Date
CN101260435A true CN101260435A (en) 2008-09-10
CN101260435B CN101260435B (en) 2010-12-22

Family

ID=39961131

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2008100473921A Expired - Fee Related CN101260435B (en) 2008-04-18 2008-04-18 Molecule mark TIAF1 correlated with pig production character and application thereof

Country Status (1)

Country Link
CN (1) CN101260435B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101880663A (en) * 2010-07-05 2010-11-10 华中农业大学 Molecular markers related to swine production properties and preparation and application
CN101603087B (en) * 2009-07-24 2012-04-18 中国农业科学院北京畜牧兽医研究所 Method for detecting characteristics of birth weight and weaning weight of pig and special kit therefor
CN109101786A (en) * 2018-08-29 2018-12-28 广东省农业科学院动物科学研究所 A kind of genomic breeding value estimation method for integrating dominant effect
CN117044679A (en) * 2023-10-13 2023-11-14 成都铁骑力士饲料有限公司 Application of serum FAS in Sichuan black pig S05 line lean meat type pig breeding

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101603087B (en) * 2009-07-24 2012-04-18 中国农业科学院北京畜牧兽医研究所 Method for detecting characteristics of birth weight and weaning weight of pig and special kit therefor
CN101880663A (en) * 2010-07-05 2010-11-10 华中农业大学 Molecular markers related to swine production properties and preparation and application
CN109101786A (en) * 2018-08-29 2018-12-28 广东省农业科学院动物科学研究所 A kind of genomic breeding value estimation method for integrating dominant effect
CN109101786B (en) * 2018-08-29 2021-02-09 广东省农业科学院动物科学研究所 Genome breeding value estimation method integrating dominant effect
CN117044679A (en) * 2023-10-13 2023-11-14 成都铁骑力士饲料有限公司 Application of serum FAS in Sichuan black pig S05 line lean meat type pig breeding
CN117044679B (en) * 2023-10-13 2024-01-19 成都铁骑力士饲料有限公司 Application of serum FAS in Sichuan black pig S05 line lean meat type pig breeding

Also Published As

Publication number Publication date
CN101260435B (en) 2010-12-22

Similar Documents

Publication Publication Date Title
EP2045322B1 (en) Double-muscling in mammals
CN100554420C (en) Daily gain in pigs TEF-1 gene and the application in the pig molecule mark assisted Selection thereof
Enayati et al. Genomic growth hormone, growth hormone receptor and transforming growth factor β-3 gene polymorphism in breeder hens of Mazandaran native fowls
CN101260435B (en) Molecule mark TIAF1 correlated with pig production character and application thereof
CN100564526C (en) The clone of pig carcass character GFAT 1 gene and application
CN101392255B (en) FTO gene clone relating to pig meat quality trait and application of the same as molecular marker
CN101148668B (en) Clone for pork generation character related gene BTG1 of pig and application thereof in pig molecule mark auxiliary selection
CN101348832B (en) Clone and use of molecular marker related to pig growth and meat quality traits
CN101157922B (en) Clone of pig intramuscular fat content gene Lpinl and uses thereof
CN101245348B (en) Molecule making clone correlative to production deseription as pig making auxiliary selection and application thereof
CN101955931B (en) Molecular marker of gene Nudt6 related to pig leaf fat rate, lactone rate and leg breech meat-bone rate and application thereof
CN101215565B (en) Clone and application of molecule mark used as swine mark auxiliary selection and correlated with immunity
CN101701262B (en) Molecular marker relative to pig meat quality traits and application
Wu et al. Identification of four SNPs and association analysis with meat quality traits in the porcine Pitx2c gene
CN100554419C (en) A kind of clone of fat thickness at back of pig gene CMYA 1 and application thereof
CN100529073C (en) Clone and application for pig growth character gene INPP5F
CN101376884A (en) Clone of molecular marker related to pork quality character water holding capacity and use thereof
CN101343663B (en) Molecular marker clone correlated with pig growth rate and application thereof
CN101386852B (en) Molecular marker clone relative with pig flesh characters and applications
CN101481739B (en) Separated nucleic acid sequence of pork quality trait related gene TRIM63
CN101319252A (en) Pig muscle quality correlated numerator mark CSRP3 clone and application thereof
CN101358244B (en) Cloning and application of molecular marker relative with pig meat quality traits
CN102943076A (en) Cloning and application of beef quality-related gene CMYA1
CN101993879B (en) Separation nucleic acid sequence of pork quality trait correlation gene TRIM63
CN101481738B (en) Separated nucleic acid sequence of pork quality trait related gene TRIM54

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20101222

Termination date: 20140418