CN101319252A - Pig muscle quality correlated numerator mark CSRP3 clone and application thereof - Google Patents

Abstract

The invention belongs to the livestock gene engineering technical field, in particular relating to a molecular marker GSRP3 and an application thereof, wherein, the molecular marker GSRP3 is applied as porcine marker-assisted selection and relates to quality properties of porcine muscle. The molecular marker is produced by cloning a CSRP3 gene, and a cDNA sequence of the molecular marker is shown in a sequence table SEQ ID NO: 1. A base substitution of C1924-T1924 exists at 1924bpth of a sequence table SEQ ID NO: 2, and leads to the enzyme digestion polymorphism of TaqI PCR-RFLP. The invention also discloses a primer used for amplifying an intact cDNA sequence and a partial DNA sequence of the CSRP3 gene and a method for polymorphic detection, and provides a novel molecular marker for the porcine marker-assisted selection.

Description

A kind of and pig muscle correlation of attributes molecule marker CSRP3 clones and uses

Technical field

The invention belongs to the domestic animal gene engineering technology field, be specifically related to molecule marker CSRP3 clone and application a kind of and the pig muscle correlation of attributes.

Background technology

Pork is the main source of China people animal proteinum.Many decades is in the time in the past, and along with the introduction of external high lean ratio and fast speed of growth boar, the demand in market has quantitatively been satisfied in China's pork production gradually.But, to lean ratio and the speed of growth excessively select and the boar cultivated aspect the meat quality not as good as the place of china pig.Along with the change of growth in the living standard and consumption idea, the lean meat of all good and safety of color, nutrition more and more is subjected to human consumer's favor.Therefore, the improvement of meat quality has become the important goal of current high-quality pig breeding work, and the searching of related molecular marker is the important means of realizing this goal.

Meat quality is a comprehensive proterties, usually by muscle pH value, intramuscular fat content, marble grain, be that indexs such as waterpower, shearing force, drip loss, yellowish pink, tender degree, diameter of muscle fiber are measured.Be not independently between these indexs, but contact each other determine final meat quality jointly.Molecular marker screening for complex characters such as pig muscle qualities adopts the strategy of QTL scanning in conjunction with the candidate gene clone usually, promptly at first make up a resource colony, measure the relevant various indexs of meat quality, and carry out complete genomic QTL scanning, in the QTL zone, adopt function candidate gene method or position clone's the corresponding mark of Policy Filtering again.According to PigQTLdb ( Http:// www.animalgenome.org/QTLdb/pig.html) statistic data, the QTL relevant with meat quality is above 1000, almost be distributed on all karyomit(e) of pig, wherein No. 2, No. 4, No. 5, No. 6, No. 7, No. 11, No. 14, No. 15 with No. 17 karyomit(e) on the QTL relevant with meat quality the most intensive.

Although a large amount of QTLs relevant with meat quality are positioned, the gene and the molecule marking research that influence meat quality but lag far behind this.At present, the major gene of having identified that influences meat quality comprises both at home and abroad: (1) RYR1 gene (Fujii, J etc., Identification of amutation in porcine ryanodine raceptor associated with malignant hyperthermia.Science, 1991,253:448-451), the C1843T missense mutation that studies show that this gene be cause pig to produce stress syndromes and the meat quality main reasons for decrease takes place.(2) PRKAG3 gene (Milan, D etc., A mutation in PRKAG3 associated with excess glycogen content inpig skeletal muscle.Science, 2000,288:1248-1251), a sudden change that studies show that this gene is to cause hampshire to produce the major cause of " sour meat ".The reason of these two genes is suddenlyd change and is all identified, and has obtained good molecular biology explanation, therefore has been used as the breeding practice that molecule marker is used for eliminating " fluothane " sensitive gene and " sour meat " gene.

Although and some other gene relevant with meat quality is much to seek the reason sudden change now, but find that but there are significant correlation in its polymorphic and meat quality proterties, these genes comprise: (1) CAST gene (Ciobanu, D C etc., New alleles in calpastatin gene areassociated with meat quality traits in pigs.Joumal of Animal Science, 2004,82:2829-2839), studies show that there is significant correlation in a plurality of meat proterties such as a plurality of SNP of this gene and the tender degree of muscle.(2) H-FABP gene (Gerbens, F etc., The effectof adipocyte and heart fatty acid-binding protein genes on intramuscular fat and backfat content inMeishan crossbred pigs.Joumal of Animal Science, 2000,78:552-559), studies show that there are significant correlation in the sudden change of this gene and intramuscular fat content.(3) CA3 gene (Wang, H L etc., Molecular characterization and association analysisof porcine CA3.Cytogenetic and Genome Research, 2006,115:129-133), studies show that there are utmost point significant correlation in the sudden change of this gene and intramuscular fat content and leg stern ratio.Compare with localized QTL, identified the reason sudden change or found to exist relevant number gene to be nowhere near, illustrate that a large amount of genes relevant with meat quality remains further evaluation.

There are a large amount of QTLs relevant with meat quality in pig 2p14-17 chromosome segment, and the CSRP3 gene is an important function candidate gene that is positioned at this zone.(cysteine and glycine-rich protein 3, CSRP3) gene are called Muscle LIM protein (MLP) or cardiac LIM protein (CLP) again to CSRP3, are one of coding LIM domain protein CSRP gene family members.Studies show that mouse CSRP3 gene only expresses in voluntary muscle, and its expression is consistent with the flesh atomization, be a myogenetic positive regulating factor (Arber, S. etc., MuscleLIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation, Cell, 1994,79:221-31).The CSRP3 knock out mice shows the form and the Clinical symptoms (Arber of hyperplasia myocarditis and heart function disorder, S. etc., MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, andheart failure, Cell, 1997,88:393-403; Geier, C etc., Mutations in the human muscle LIM protein gene in familieswith hypertrophic cardiomyopathy, Circulation, 2003,107:1390-1395).Immunohistochemical analysis shows the expression of MLP albumen composition in the rat slow muscle, and low expression in fast muscle, and MLP is converted to up-regulated expression (Willmann in the slow type skeletal muscle protein process at fast type skeletal muscle albumen, R etc., Muscle LIM protein is upregulated in fast skeletal muscle during transition towardslower phenotypes, Am J Physiol Cell Physiol, 2001,280:C273-9); Other there are some researches show, CSRP3 gene encoding production MLP can be by a kind of physics mode and basic helix-loop-helix (bHLH) transcription factor of muscle tissue have an effect, this effect has the specificity of height, be that MLP is not with non-muscle-derived bHLH albumen (as E12 and E47) or become flesh enhancement factor-2 (the MEF2) (Kong that has an effect, Y etc., Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD, Mol Cell Biol, 1997,17:4750-60).MLP may be with the form promotion muscle-derived bHLH albumen of the co-activation factor and the (Kong that combines of specific DNA controlling element, Y etc., Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD, Mol Cell Biol, 1997,17:4750-60).This shows that the CSRP3 gene has important positive control in voluntary muscle is grown, and may participate in the adjusting of muscle fiber types and distribution.

Summary of the invention

The objective of the invention is to clone a kind of and the molecule marker CSRP3 pig muscle correlation of attributes, a kind of application of method is provided for the pig marker assisted selection.

The present invention realizes by following technology:

The clone obtains a kind of pig muscle correlation of attributes gene C SRP3, and its cDNA sequence is as described in the sequence table SEQ ID NO:1.The cDNA sequence total length that is obtained is 939bp, comprises the complete CDS of 585bp, 194 amino acid of encoding.

According to obtain as cDNA sequences Design primer as described in the sequence table SEQ ID NO:1, obtained the partial nucleotide sequence of CSRP3 gene by amplification and order-checking, as described in sequence table SEQ ID NO:2.This sequence length is 6231bp, and wherein there is the base mutation of a C1924-T1924 at the 1924bp place, causes TaqI PCR-RFLP polymorphism.

It is right that the present invention has designed the primer of a pair of detection C1924-T1924 base mutation, and its dna sequence dna is as follows:

Forward primer: 5 ' GGTACTGTTCGCCAAGGAGA 3 ',

Reverse primer: 5 ' TCCAGGAAAGTGGGTGAAGA 3 '.

A kind of screening is applicable to the molecular marker method of pig muscle quality trait marker assisted selection, according to following steps:

Personnel selection CSRP3 gene cDNA is a probe, does the homologous sequence screening, obtains the expressed sequence tag (EST) of homology more than 90%; Splice pig EST-contig then; According to EST-contig sequences Design primer, obtain as the described cDNA sequence of sequence table SEQ ID NO:1 by amplification; According to this cDNA sequences Design primer amplification Tongcheng pig and landrace genomic dna, obtain as the described dna sequence dna of sequence table SEQ ID NO:2, wherein comprise the C1924-T1924 sudden change.

Specific embodiments of the present invention is as described in " embodiment ".

Description of drawings

Sequence table SEQ ID NO:1 is the cDNA sequence of the present invention's CSRP3 gene relevant with the pig muscle quality trait of cloning;

Sequence table SEQ ID NO:2 is the nucleotide sequence of the present invention's CSRP3 gene relevant with the pig muscle quality trait of cloning;

Fig. 1: be the technology of the present invention schema;

Fig. 2: be to be used for the used pig CSRP3 gene DNA sequence fragment of TaqI PCR-RFLP somatotype among the present invention, underscore is a primer.

Fig. 3: three kinds of genotype electrophoresis result that are the TaqI PCR-RFLP of the present invention's pig CSRP3 gene the 4th exon of cloning.Among the figure: M:DNA molecular weight standard (100bp ladder)

Embodiment

The nucleotide sequence clone of embodiment 1 CSRP3 gene

1.CSRP3 the cDNA of gene clone

(1) design of primers

Utilize mRNA sequence (the GenBank number of including: NM_003476.2) be the information probe of the people CSRP3 gene of report, utilize the BLAST instrument among the NCBI in GenBank pig est database, to do the homologous sequence screening, obtain a series of homologys and be the ESTs (fragment length is greater than 100bp) more than 90%, utilize the SeqMan program construction pig CSRP3 gene EST-contig in the DNAStar software, design 5 ' RACE outside primer P-5O in view of the above respectively, the inboard primer P-5I of 5 ' RACE, the inboard primer P-3I of 3 ' RACE outside primer P-3O and 3 ' RACE, the primed DNA sequence is as shown in table 1:

Table 1: be used for the primer sequence design of CSRP3 gene cDNA clone

(2) RACE amplification

With reference to TriZoL test kit (U.S. GIBCO company product) specification sheets step, utilize this test kit from the landrace muscle tissue of growing up, to extract total RNA; Utilization is dissolved total RNA through the ultrapure water that DEPC handles, and utilizes Dnase I enzyme (U.S. Promega company product) to carry out the purifying of RNA in 37 ℃ of processing 30 minutes and through isopyknic phenol-imitative extracting; By Nucleic acid-determination of protein concentration instrument (U.S. Beckman company product) is measured the concentration of RNA, its integrity of formaldehyde gel electrophoresis detection with 1.2%.

Utilize RACE test kit (U.S. CLONTECH company product) at first to carry out the synthetic of cDNA first chain, serve as the amplification masterplate at first after cDNA first chain is synthetic with this product, utilize the universal primer in gene specific outside primer (GSP-5O and GSP-3O) and the above-mentioned RACE test kit to carry out first round pcr amplification, amplification system is according to this test kit specification sheets configuration; Amplification condition is: 95 ℃ of 3min; 34* (94 ℃, 30sec, 65 ℃, 30sec, 72 ℃, 1min); 72 ℃, 5min; 15 ℃, 2min.On this basis, with 100 times of first round pcr amplification product dilutions, with this diluent is masterplate, utilize inboard universal primer in inboard primer (GSP-5I and GSP-3I) of gene specific and the RACE test kit to carry out second and take turns pcr amplification, amplification system disposes to specifications, and the PCR reaction conditions is identical with first round amplification condition.

(3) RACE product purification, clone and order-checking

Carry out the purifying of RACE product according to PCR product purification test kit (TIANGEN Biotech's product) specification sheets operational requirement, purifying RACE product is connected with pGEM-T carrier (U.S. Promega company product), the ligation cumulative volume is 5 μ l, comprising 2.5 μ l2 * buffer, 0.5 the pGEM-T carrier of μ l, 0.5 the purified pcr product of μ l, 0.5 the T4 dna ligase of μ l (U.S. Promega company product), adding 1 μ l aqua sterilisa at last puts 16 ℃ of water-baths and spends the night: get 100～120 μ l competent cells under the sterile state in 1.5ml Ependorff pipe, the connection product of 5 μ l is added mixing, place 30min on ice, 42 ℃ of heat shock 90s, do not shake the Ependorff pipe therebetween, take out back ice bath 3～4min, the LB liquid nutrient medium that adds 400 μ l antibiotic-frees, 37 ℃ of shaking culture 45min.Get 100 μ l and coat in advance that 4h has been coated with on the agar plate of IPTG (Isopropylthio-β-D-galactoside, isopropylthio-) and X-gal, be inverted cultivation after keeping flat 1h for 37 ℃; Place 1.5ml Eppendorf pipe with toothpick picking mono-clonal, cultivated 6～8 hours for 37 ℃, get the masterplate of 1 μ l bacterium liquid, utilize the inboard primer (GSP5I/GSP3I) of RACE amplification to cooperate universal primer to carry out pcr amplification, have positive amplified production person to be positive colony as pcr amplification; Positive bacteria liquid send by Beijing AudioCodes Bioisystech Co., Ltd and finishes order-checking.

The result of pig CSRP3 gene cDNA clone: the two-way RACE amplification for the CSRP3 gene has all obtained special amplified production.Find through sequence verification, 5 ' RACE and 3 ' RACE product actual size are respectively 539bp and 562bp, find that by Seqman splicing sequencing sequence and the universal primer that removes external source pig CSRP3 gene cDNA total length is 939bp, 5 ' the UTR that comprises 103bp, the 3 ' UTR of the CDS of 585bp and 251bp.Find 194 amino acid of pig CSRP3 genes encoding by the ORF prediction.

2.CSRP3 the dna clone of gene and SNP scanning

(1) design of primers

Utilize the genomic dna of the pig CSRP3 gene DNA sequence comparison people CSRP3 gene that obtains, tentatively infer the structure of pig CSRP3 gene, design primer the 3rd to last exon, the primer sequence design is as shown in table 2.

Table 2: the primer that is used for CSRP3 gene DNA clone

(2) pcr amplification and SNP scanning

Utilize the rTaq archaeal dna polymerase of precious biotechnology (Dalian) company limited to carry out pcr amplification, reaction system is 20 μ l, comprise following component: 1 * PCR buffer, the dNTP of 75 μ mol/L, 0.3 μ mol/L primer, 0.9-1.5mmol/L Mg2+, 1 U Taq archaeal dna polymerase, 50ng pig genomic dna.The PCR response procedures is a Standard PC R amplification program, and annealing temperature is as shown in table 3, and the extension time is 1 minute 30 seconds.After the purification kit recovery of pcr amplification product with TIANGEN Biotech (Beijing) Co., Ltd., directly deliver Beijing AudioCodes Bioisystech Co., Ltd and finish order-checking.

In above-mentioned dna clone process, pcr amplification for each section sequence, utilize external pig landrace and place of china pig Tongcheng pig genomic dna as masterplate simultaneously, promptly in amplification procedure, for each to primer, increase respectively 8 landrace DNA and 8 Tongcheng pig DNAs reclaim the pcr amplification product in landrace and Tongcheng pig DNA source respectively, send Beijing AudioCodes Bioisystech Co., Ltd to finish order-checking; Utilize the Seqman program of DNAStar software to splice and sequence alignment, search SNP site wherein.

The dna clone of CSRP3 gene and SNP scanning result: stride the intron primer amplification for three pairs and obtained three dna fragmentations, be respectively 1951bp through its size of sequence verification, 2519bp, 1902bp.Splice above-mentioned sequencing sequence through Seqman software, obtained the dna sequence dna of 6293bp, covered the full sequence of pig CSRP3 gene the 3rd to the 6th exon.By comparative analysis, found to be positioned at a C-T base mutation at 1924bp place (the 4th exon).

The association analysis of embodiment 2 CSRP3 gene C 1924T TaqI PCR-RFLP genotype and meat proterties

1.TaqI the foundation of PCR-RFLP detection method

(1) primer sequence

CRP3-E4-S：5′GGTACTGTTCGCCAAGGAGA?3′

CRP3-E4-R：5′TCCAGGAAAGTGGGTGAAGA?3′

(2) pcr amplification condition

PCR reaction cumulative volume 20 μ l wherein comprise about 100ng pig genomic dna, contain 1 * PCR Buffer, 1.5mmol/L MgCl ₂, every kind of dNTP of 150 μ mol, every primer of 0.3 μ mol, 1 Taq of unit archaeal dna polymerase.The pcr amplification program is: 94 ℃ of 5min, and (94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 25s) circulation 35 times, 72 ℃ are extended 5min.The PCR reaction product detects with 2% agarose gel electrophoresis.

(3) TaqI RFLP gene type

PCR product endonuclease reaction volume is 10 μ l, 10 * TaqI Buffer, 1 μ l wherein, PCR product 3～5 μ l, restriction enzyme TaqI is 3U, is supplemented to 10 μ l with aqua sterilisa, with centrifugal behind the sample mixing, 65 ℃ of water-baths 4 hours, detect enzyme with 2% agarose gel electrophoresis and cut the result, the record genotype is taken pictures under ultraviolet lamp.

Utilize primer CRP3-E4-S and CRP3-E4-R pairing amplification, obtaining the amplified production size is 344 bp, and sequence as shown in Figure 2.Analyze and find that the C1924T that this fragment comprises can cause losing and reservation of TaqI restriction enzyme enzyme recognition site (5-T ˇ CGA-3), promptly when this site is C allelotrope, can not be cut by TaqI institute enzyme, and when this site is T allelotrope, can be cut by the TaqI enzyme.Therefore, the homozygous individuality of CC is not digested, form the fragment that size is 344bp, and the clip size that the homozygous individual enzyme of TT is cut generation is respectively 206bp and 138bp, and the CT heterozygous then forms the band of three kinds of sizes.Therefore, at first obtain the product of 344bp by pcr amplification, cut through enzyme and can distinguish three kinds of different genotype individualities, part electrophoresis detection result as shown in Figure 4.

2. mark property association analysis

Utilizing Tongcheng pig (Tongcheng pig is Tongcheng County, a Hubei Province local pig breed, is a local pig variety of openly applying) group of setting up to carry out the proterties association analysis, prepared 156 DNA samples and be used for genotype detection.The proterties of being analyzed has the part producing performance, part meat proterties.Set up following least square model:

Y _ijk＝μ+GENOTYPE _i+BATCH _j+COMBINATION _k+ε _ijk，

Wherein, Y _IjkBe the character observation value, μ is a population mean, GENOTYPE _iBe genotype effect, BATCH _jBe sex effect, COMBINATION _kBe the effect of combination, ε _IjkBe random error.

In Tongcheng pig experimental population CSRP3 gene the 4th exon TaqI PCR-RFLP pleomorphism site and part producing meat proterties are carried out association analysis, these meat proterties comprise muscle pH value, marble grain scoring, drip loss, shearing force, muscle color etc.In 156 individualities that detected, CC type individuality is 76, and CT type individuality is 70, and TT type individuality only is 10, wherein the individual shearing force of CC type significantly is lower than CT type individuality (P=0.0153), and the simple mean of proterties observed value and standard deviation analytical results are summarized in shown in the table 3 between genotype.

Table 3. pig CSRP3 gene SNP C1924T different genotype and proterties association analysis result

^*Representative reaches 0.05 conspicuous level.

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉a kind of and pig muscle correlation of attributes molecule marker CSRP3 clone and application

<130>

<141>2008-07-17

<160>3

<170>PatentIn?version?3.1

<210>1

<211>939

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>gene

<222>(1)..(939)

<223>

<220>

<221>3′UTR

<222>(689)..(939)

<223>

<220>

<221>5’UTR

<222>(1)..(103)

<223>

<220>

<221>CDS

<222>(104)..(688)

<223>

<400>1

ggtgacagtc?cccatatatt?taaggaggac?gtgagccccc?tgactcagct?gagccgacaa 60

agactgcaca?ggcagacttg?accttgatca?gagagtcttc?aag?atg?cca?aac?tgg 115

Met?Pro?Asn?Trp

1

ggc?gga?gga?gcg?aaa?tgc?gga?gcc?tgc?gac?aag?acc?gtc?tac?cac?gca 163

Gly?Gly?Gly?Ala?Lys?Cys?Gly?Ala?Cys?Asp?Lys?Thr?Val?Tyr?His?Ala

5 10 15 20

gaa?gaa?atc?cag?tgc?aat?gga?agg?agc?ttc?cac?aag?acc?tgt?ttc?cac 211

Glu?Glu?Ile?Gln?Cys?Asn?Gly?Arg?Ser?Phe?His?Lys?Thr?Cys?Phe?His

25 30 35

tgc?atg?gcc?tgc?agg?aag?gct?cta?gac?agc?acc?acg?gta?gca?gct?cac 259

Cys?Met?Ala?Cys?Arg?Lys?Ala?Leu?Asp?Ser?Thr?Thr?Val?Ala?Ala?His

40 45 50

gag?tca?gag?atc?tac?tgt?aag?gtc?tgc?tat?ggg?cgc?agg?tac?ggc?ccc 307

Glu?Ser?Glu?Ile?Tyr?Cys?Lys?Val?Cys?Tyr?Gly?Arg?Arg?Tyr?Gly?Pro

55 60 65

aag?ggg?atc?ggc?tat?gga?caa?ggt?gcc?ggc?tgc?ctc?agc?acg?gac?aca 355

Lys?Gly?Ile?Gly?Tyr?Gly?Gln?Gly?Ala?Gly?Cys?Leu?Ser?Thr?Asp?Thr

70 75 80

ggc?gag?cac?ctg?ggc?ctc?cag?ttc?caa?cag?tcc?cca?aag?cca?gca?cgc 403

Gly?Glu?His?Leu?Gly?Leu?Gln?Phe?Gln?Gln?Ser?Pro?Lys?Pro?Ala?Arg

85 90 95 100

tca?gcc?acc?acc?agc?aac?cct?tcc?aag?ttc?act?gca?aag?ttc?gga?gag 451

Ser?Ala?Thr?Thr?Ser?Asn?Pro?Ser?Lys?Phe?Thr?Ala?Lys?Phe?Gly?Glu

105 110 115

tcg?gag?aag?tgc?ccc?cga?tgt?gga?aag?tca?gtc?tat?gct?gct?gag?aag 499

Ser?Glu?Lys?Cys?Pro?Arg?Cys?Gly?Lys?Ser?Val?Tyr?Ala?Ala?Glu?Lys

120 125 130

gtg?atg?gga?ggt?ggc?aag?cct?tgg?cac?aag?acc?tgt?ttt?cgc?tgt?gcc 547

Val?Met?Gly?Gly?Gly?Lys?Pro?Trp?His?Lys?Thr?Cys?Phe?Arg?Cys?Ala

135 140 145

atc?tgt?ggg?aag?agt?cta?gaa?tcc?aca?aac?gtc?act?gac?aaa?gac?gga 595

Ile?Cys?Gly?Lys?Ser?Leu?Glu?Ser?Thr?Asn?Val?Thr?Asp?Lys?Asp?Gly

150 155 160

gaa?ctt?tat?tgc?aaa?gtt?tgc?tac?gcc?aaa?aat?ttt?ggc?cct?aca?ggt 643

Glu?Leu?Tyr?Cys?Lys?Val?Cys?Tyr?Ala?Lys?Asn?Phe?Gly?Pro?Thr?Gly

165 170 175 180

att?ggg?ttt?ggg?ggc?ctt?aca?cac?crg?gtg?gaa?aag?aaa?gag?tga 688

Ile?Gly?Phe?Gly?Gly?Leu?Thr?His?Xaa?Val?Glu?Lys?Lys?Glu

185 190

gaagtgcacc?acctctcaga?tctctcattg?gcctaaagca?ttagctgagt?aatcctgcct 748

gaaggaaacc?cctccccaca?caccctcttg?atggaagtat?ttcgcttcag?aagtgatccc 808

artctttacc?tgaagttaga?agagatcttt?ggaagaaaat?tattaaaagt?cagtaacaaa 868

tgctctacta?ttgatgatac?ctgggctggg?agaagccaaa?aataaaagc?tttagtggtaa 928

aaaaaaaaaa?a 939

<210>2

<211>194

<212>PRT

＜213〉pig (Sus scrofa)

<220>

<221>misc_feature

<222>(189)..(189)

<223>The’Xaa’at?location?189?stands?for?Arg，or?Gln.

<400>2

Met?Pro?Asn?Trp?Gly?Gly?Gly?Ala?Lys?Cys?Gly?Ala?Cys?Asp?Lys?Thr

1 5 10 15

Val?Tyr?His?Ala?Glu?Glu?Ile?Gln?Cys?Asn?Gly?Arg?Ser?Phe?His?Lys

20 25 30

Thr?Cys?Phe?His?Cys?Met?Ala?Cys?Arg?Lys?Ala?Leu?Asp?Ser?Thr?Thr

35 40 45

Val?Ala?Ala?His?Glu?Ser?Glu?Ile?Tyr?Cys?Lys?Val?Cys?Tyr?Gly?Arg

50 55 60

Arg?Tyr?Gly?Pro?Lys?Gly?Ile?Gly?Tyr?Gly?Gln?Gly?Ala?Gly?Cys?Leu

65 70 75 80

Ser?Thr?Asp?Thr?Gly?Glu?His?Leu?Gly?Leu?Gln?Phe?Gln?Gln?Ser?Pro

85 90 95

Lys?Pro?Ala?Arg?Ser?Ala?Thr?Thr?Ser?Asn?Pro?Ser?Lys?Phe?Thr?Ala

100 105 110

Lys?Phe?Gly?Glu?Ser?Glu?Lys?Cys?Pro?Arg?Cys?Gly?Lys?Ser?Val?Tyr

115 120 125

Ala?Ala?Glu?Lys?Val?Met?Gly?Gly?Gly?Lys?Pro?Trp?His?Lys?Thr?Cys

130 135 140

Phe?Arg?Cys?Ala?Ile?Cys?Gly?Lys?Ser?Leu?Glu?Ser?Thr?Asn?Val?Thr

145 150 155 160

Asp?Lys?Asp?Gly?Glu?Leu?Tyr?Cys?Lys?Val?Cys?Tyr?Ala?Lys?Asn?Phe

165 170 175

Gly?Pro?Thr?Gly?Ile?Gly?Phe?Gly?Gly?Leu?Thr?His?Xaa?Val?Glu?Lys

180 185 190

Lys?Glu

<210>3

<211>6231

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>gene

<222>(1)..(6231)

<223>

<220>

<221>mutation

<222>(1924)..(1924)

<223>

<220>

<221>exon

<222>(5943)..(6231)

<223>

<220>

<221>exon

<222>(4317)..(4410)

<223>

<220>

<221>exon

<222>(1843)..(1975)

<223>

<220>

<221>exon

<222>(1)..(134)

<223>

<400>3

gca?gct?cac?gag?tca?gag?atc?tac?tgt?aag?gtc?tgc?tat?ggg?cgc?agg 48

Ala?Ala?His?Glu?Ser?Glu?Ile?Tyr?Cys?Lys?Val?Cys?Tyr?Gly?Arg?Arg

1 5 10 15

tac?ggc?ccc?aag?ggg?atc?ggc?tat?gga?caa?ggt?gcc?ggc?tgc?ctc?agc 96

Tyr?Gly?Pro?Lys?Gly?Ile?Gly?Tyr?Gly?Gln?Gly?Ala?Gly?Cys?Leu?Ser

20 25 30

acg?gac?aca?ggc?gag?cac?ctg?ggc?ctc?cag?ttc?caa?ca gtgagttact 144

Thr?Asp?Thr?Gly?Glu?His?Leu?Gly?Leu?Gln?Phe?Gln?Gln

35 40

gccctgcttc?tcccagctgg?tagagcccca?gctatcagga?cagttcattc?tgttcccatg 204

gcaacgtttc?ctgaaagtag?gagaatggcc?tctattgttg?acttgccaac?aataggaata 264

ctcagtctgc?ccaagtcatc?tctctgaaga?ctctctttaa?attatctgcc?tttctaaagg 324

gcaattactt?taacaccatg?gctcttggtt?tgcatgtcaa?gagaaaaccc?agaatgtaca 384

gatgttctat?tgtttgacct?ttgcaaaact?gcatggagtc?tctcttcttc?ccctttgagc 444

atttctgtgt?aagtcacata?aatacggcag?ggacgcaatg?gccattctct?atgtgcattt 504

ccctgaaata?tttcttccct?tgggctggaa?gatgactaat?gtttgcatca?gagggggagt 564

gggtggggat?gggctatact?tcagaagcaa?acagtcaatt?atgacggttc?tgggagtctt 624

cctggccacc?tgttgccaaa?tacagtgttg?aggtttcccc?aacattatcc?taggaaagtt 684

gggatatcac?actctgccac?ctctagctac?cagtctgttc?tacttgatga?gcatgttgac 744

ctccagctca?aaactgagta?cagatggaca?gccactggcc?tgcagctgct?gtctagccag 804

ctggtacccg?ggctcagctc?tgcagcagga?atgcacagaa?aggcccagcc?caactgaggc 864

agggtccccc?agagaacagt?cagaccatct?gaagagtcat?ctggtccctt?ccaaagacag 924

cagcccacgg?cagagcctgg?aaaagtgtaa?ggatgtgtga?ttagtcattg?gaattttt?tt 984

ccttactcaa?ccccaactgg?acatgctgtt?taaggaagga?agatgatacc?agctgcgttc 1044

tctgcctggc?attacccaaa?actactctgc?tatgttaggg?ctttagggct?ttctatggtg 1104

ctgcacagag?aggaaaagag?tctggagacc?tgggtttcag?cccagttcca?ccaattatga 1164

gctgctgacc?ttgggcagtt?agccctctgg?ccttctctct?cctccagcta?gccctaccta 1224

ccttagaggg?ctcggatgat?aaatgtacaa?ggaaacacca?aaagatatgg?aaacacaggg 1284

ttattattgt?gcctctatct?taaacattgc?tctcaagagg?acaggtgacc?ttttgatgca 1344

ggttacaatt?agaattgtga?cacagaatgc?atcagatcat?tggactatgg?cttgtttaat 1404

atcaattgtc?aagatcccat?cttgccctgt?aatattttta?ctcattttgg?aaagtagacc 1464

tatggtttca?agatggtatc?aagaaaccta?aacaaaccat?tacagcaata?ataacaacac 1524

aacaataatc?atacaagcta?acatacatag?aacattggct?aagcgcttta?cagcagaaag 1584

gagagatgta?aataaactct?gattaacatt?cattagccct?tacaacacac?catgcaaagc 1644

actgttctaa?gtgcttgact?tgtgtgacct?catgtaacct?tctcaacaac?actgtgagga 1704

aggtaccatg?actatcccca?cttccccgat?gaagagactg?aggcacaaag?aagttaagta 1764

acttgctcaa?ggtcacacag?ctggtactgt?tcgccaagga?gagcctagag?gtttcatgca 1824

tttgtctctt?tcccccag?g?tcc?cca?aag?cca?gca?cgc?tca?gcc?acc?acc?agc 1876

Ser?Pro?Lys?Pro?Ala?Arg?Ser?Ala?Thr?Thr?Ser

50 55

aac?cct?tcc?aag?ttc?act?gca?aag?ttc?gga?gag?tcg?gag?aag?tgc?ccc 1924

Asn?Pro?Ser?Lys?Phe?Thr?Ala?Lys?Phe?Gly?Glu?Ser?Glu?Lys?Cys?Pro

60 65 70

cga?tgt?gga?aag?tca?gtc?tat?gct?gct?gag?aag?gtg?atg?gga?ggt?ggc 1972

Arg?Cys?Gly?Lys?Ser?Val?Tyr?Ala?Ala?Glu?Lys?Val?Met?Gly?Gly?Gly

75 80 85

aag?gtaaggactc?ctttatgaac?cagatgggat?gtactcacct?ccaccaggtc 2025

Lys

ccctgggagg?aatgagagaa?gtcggctgcg?ggtgcatggg?ggtcaaacca?tccttagtgc 2085

ccaggaacca?cttaggagcc?acccatcttc?acccactttc?ctggacagtc?atctgacagt 2145

ccttgggaaa?ctggaactgg?aggaattcaa?tgcaataagc?attaacccac?taggtggatg 2205

gcacccacct?gggcactctg?gagatacaaa?ggtacacagg?ctcccctgtg?ctcagtgtcc 2265

acaatcctta?cagaaaggtg?tcacctggga?gctgtcacca?ctgcatgact?cagcctgctg 2325

gtgcatcgca?gagcaaacac?ctcacagcct?cgagaagcat?ccttgctcac?aaatgtccag 2385

gcaatcagga?gagtcatcca?gtgcctgaga?cagtaacgca?cacttgccct?acaaattcca 2445

gtttcagttc?tcaagccagg?gtattcacca?aaggatgtgg?gcctgaagaa?agacaaaagt 2505

cctgtttata?ctaaatggga?gaagaaaggg?cttagagtgt?ctgacttcaa?aaataggggc 2565

catcttatct?caggaccggc?catttaaata?catatgagag?ggagttccca?tcgtggctca 2625

gcagtaacga?aactgactag?tatccatgag?gacgttggtt?cgatcttggg?ccttaaggat 2685

ccagcattgc?catgaactgt?ggtgtaggtc?acagacatgg?ctcagatccc?atgttgctgt 2745

ggctgtggtg?taggctggca?gctgcagctc?tgattatacc?cctagcctgg?gaacctccat 2805

atgccatggg?tgcagcccta?aaaagcaaaa?aaattaaaaa?tacatacata?catacataca 2865

tatgaggatg?ctgggctgtg?cctgggagac?atgcagatat?gcagaaagca?ggcaatcttc 2925

tgaatgatcc?aagccacaac?tctcttccat?caaaaataca?aggagaatat?caaaagactt 2985

tactagccaa?agtctggaag?ggtgtgaaaa?aatgggaacc?ctcttacagt?gttggtggga 3045

atgtaaattg?ataaggccac?tatggaaaac?agtatggagg?ttccttaaaa?aactaaacat 3105

agaactgcta?tgtaatccag?ccatcccact?cttgggcata?taaccagaaa?aggtgaaaac 3165

tctaatttgt?aaagatacat?gcaccccaat?gttcacagca?tcactattta?caacagtcaa 3225

gacatagaag?caacctaagt?gtccatcagc?agaggaacgg?ataaagatat?ggtgtatata 3285

tataatataa?aatggaatac?tgcaagttcc?catggggtgc?agcaggttaa?gatctggtgt 3345

tgccacagct?gtggtgcagg?tgactgtggc?gaggtttcga?tccctggccc?aggaatttct 3405

atatgccacg?agtgtgggga?aaaaatattt?tactcagcca?taaaaatgga?tgaaataatg 3465

ccatttgtgg?aaaccatgga?tggacctaga?gattatcata?ctaagtgagg?gaaaaaagtc 3525

agacagagaa?agacaaatat?cctatggcat?cacttataag?tggaatctaa?aaaaaaaaaa 3585

aaatgatcaa?atgacttatt?cacaaacaga?aacagactca?cagatataga?gaacaaactt 3645

atggttatca?aaggggaaag?ggaggctggg?ataaattagg?agttgaggtt?aatgatacac 3705

agtactatat?ataaaataga?taaccaataa?ggacctactg?catagcacag?ggaactataa 3765

ttcaatatct?tataataacc?tatagtggaa?aagaatttga?aaaagaatat?atatgtaact 3825

gaatcatttt?actatacacc?taaaattaac?cctttaaatt?aactatactt?caattaaaaa 3885

agagagagcg?agaaatacac?agagacttaa?aatgagattg?aaatctctgg?atgattgccc 3945

atttcttcac?cttttttctc?attttatatt?caatatgtca?cccactacat?caagcccccc 4005

ctccccagtg?tgttttttat?catctagaaa?ggggaagctt?ttttttggta?tttagtccct 4065

gttctgaagg?aatacatacg?gaaatcacct?tgataaattc?atttttaggg?tttctaagaa 4125

tcactggcca?agttcatagc?agctcatttt?gtccaaaccc?ctggaaaaat?gttctgaggg 4185

ccaattaggt?gggtgaatgg?ttaggacagg?gcccttcttt?atatgctgct?ggtcaaggga 4245

cttaacacgg?aaataaatgt?cctgcctgcc?ctactaaata?cccaattttc?ctgctctcct 4305

gtgccctgca?g?cct?tgg?cac?aag?acc?tgt?ttt?cgc?tgt?gcc?atc?tgt?ggg 4355

Pro?Trp?His?Lys?Thr?Cys?Phe?Arg?Cys?Ala?Ile?Cys?Gly

90 95 100

aag?agt?cta?gaa?tcc?aca?aac?gtc?act?gac?aaa?gac?gga?gaa?ctt?tat 4403

Lys?Ser?Leu?Glu?Ser?Thr?Asn?Val?Thr?Asp?Lys?Asp?Gly?Glu?Leu?Tyr

105 110 115

tgc?aaa?g?gtgagtggtc?ccagagcctc?tcttgagatg?tcttcccagg?gagggttctt 4460

Cys?Lys

120

gggaggggag?gcttgtgtct?gccaggaggc?acggcttctc?agcctaggct?gggtttgggc 4520

tcttgggatg?gggagcaaag?ccacctaagg?gaaaggaacc?tcctggctga?cccagctcta 4580

gtcctctcca?ttggggcatc?tgggaggact?ggatgcttgc?ggatgctcag?agatcagggc 4640

agctgggcac?ccaggggaga?aaagacaagg?acaaagcagt?atcctgactg?gccttggaat 4700

aggccttagg?tctggacaaa?aagctcacat?tcctttccaa?aagccgaacc?ctctgtctac 4760

tgactggca?gagagaggtg?acggggaggg?gatggggaga?tgaactccat?ctggcctctc 4820

ctgaatttat?caagacacat?ctacatcctt?cctcccctgc?attctctctt?ctttcccacc 4880

ttccttcccc?tcttgctttc?tccctccttc?ctttttgaca?ttctgtttct?gatgttgcac 4940

ttcgcttagt?gatcacaggg?agagaactga?caagctgcag?ggcctggtgg?tccttgcagc 5000

tctgcctcca?acaacctccc?ttcatcttgc?agagaggcaa?cagaggccta?gctcctgcct 5060

gatgccacca?ggaggaaggg?atgctttagt?gtcagggcta?tgtgtcctcg?ccctcagagc 5120

ctcctccagg?cctattctgt?ttctcagcag?ggtcctccca?ccctttcacg?caatgatgct 5180

gtctcaagat?ctccaaatgg?gggttagagt?gggggagagg?ggaaagggag?gccattacta 5240

atcaagacta?taggtggcca?tgcttcagct?aggatgaaag?tactgaaatt?gatgagcact 5300

cggaccaggg?ttgccttctc?ctggaagtag?aggaaacaga?gggtcctcag?cattcatagg 5360

ccataaagcc?ctcaaatgtt?gctgcagcca?gcgagagcac?cctgtggaga?attgcatccc 5420

caagtgccta?aacctctggt?agaagatggt?cacagtgcac?ggcccacaaa?gggacaagta 5480

atcagctagg?agtgttcgag?aaagcttaga?agagaagctt?ccgctgggcc?ttgaagggtg 5540

aatgtgggtt?tgggagggaa?ctttccagga?gcaagaagca?gtgagctgtg?aaggcaccaa 5600

agctggggca?tcaccgtggc?tcattccagg?aattacaagt?agttccgtgt?tcctagagcg 5660

cagggaggga?ggcggaggca?ggaggtggga?agggcaactg?gcagccagat?tacaatgact 5720

caaaagagaa?aaggtctctg?aacacagtga?agtgcaaaga?agtagacaca?gttttatcag 5780

cagatctaga?atatggttca?atgtattgaa?aagttacctt?gtaaatacat?gtatcaaaag 5840

gatgcttctc?ccaggtaaaa?ggaccatgtt?caaatggagg?aaactgaaat?aatggtgctg 5900

atctagccat?tcacttctgg?tcttcttctc?tctcgttcac?ag?tt?tgc?tac?gcc 5953

Val?Cys?Tyr?Ala

aaa?aat?ttt?ggc?cct?aca?ggt?att?ggg?ttt?ggg?ggc?ctt?aca?cac?cgg 6001

Lys?Asn?Phe?Gly?Pro?Thr?Gly?Ile?Gly?Phe?Gly?Gly?Leu?Thr?His?Arg

125 130 135 140

gtg?gaa?aag?aaa?gag?tga?gaa?gtg?cac?cac?ctc?tca?gat?ctc?tca?ttg 6049

Val?Glu?Lys?Lys?Glu Glu?Val?His?His?Leu?Ser?Asp?Leu?Ser?Leu

145 150 155

gcc?taa?agc?att?agc?tga?gta?atc?ctg?cct?gaa?gga?aac?ccc?tcc?cca 6097

Ala Ser?Ile?Ser Val?Ile?Leu?Pro?Glu?Gly?Asn?Pro?Ser?Pro

160 165

cac?acc?ctc?ttg?atg?gaa?gta?ttt?cgc?ttc?aga?agt?gat?ccc?aat?ctt 6145

His?Thr?Leu?Leu?Met?Glu?Val?Phe?Arg?Phe?Arg?Ser?Asp?Pro?Asn?Leu

170 175 180 185

tac?ctg?aag?tta?gaa?gag?atc?ttt?gga?aga?aaa?tta?tta?aaa?gtc?agt 6193

Tyr?Leu?Lys?Leu?Glu?Glu?Ile?Phe?Gly?Arg?Lys?Leu?Leu?Lys?Val?Ser

190 195 200

aac?aaa?tgc?tct?act?att?gat?gat?acc?tgg?gct?ggg?ag 6231

Asn?Lys?Cys?Ser?Thr?Ile?Asp?Asp?Thr?Trp?Ala?Gly

205 210

Claims (5)

1, a kind of clone's the molecule marker CSRP3 relevant with the pig muscle quality trait, its nucleotide sequence is as described in the sequence table SEQ ID NO:2.

2, nucleotide sequence according to claim 1 is characterized in that: the 1924bp place of sequence table SEQ ID NO:2 causes the TaqI-RFLP polymorphism for the base mutation of C1924-T1924.

3, it is as follows that test right requires the right dna sequence dna of the primer of 2 described base mutations:

Forward primer: 5 ' GGTACTGTTCGCCAAGGAGA 3 ',

Reverse primer: 5 ' TCCAGGAAAGTGGGTGAAGA 3 '.

4, claim 1 or 2 application of described molecule marker in the pig marker assisted selection.

5, a kind of preparation method who realizes claim 1 or 2 described molecule markers, its feature are according to following steps:

Personnel selection CSRP3 gene cDNA is a probe, does the homologous sequence screening, obtains the expressed sequence tag (EST) of homology more than 90%; Splice pig EST-contig then; According to EST-contig sequences Design primer, obtain as the described cDNA sequence of sequence table SEQ ID NO:1 by amplification; According to this cDNA sequences Design primer amplification Tongcheng pig and landrace genomic dna, obtain as the described dna sequence dna of sequence table SEQ ID NO:2, wherein comprise the C1924-T1924 sudden change.

Images