CN100554420C - Daily gain in pigs TEF-1 gene and the application in the pig molecule mark assisted Selection thereof - Google Patents

Abstract

The invention belongs to animal gene engineering technology field, be specifically related to clone and the application thereof of a kind of daily gain in pigs gene TEF-1.The present invention has cloned a kind of daily gain in pigs gene TEF-1, and its cDNA sequence is as described in the sequence table SEQ ID NO:1.There is the base mutation of an A93-G93 at the 93bp place of sequence table SEQ ID NO:1, causes BshN I-RFLP polymorphism.The invention also discloses preparation method, design of primers and the application in the pig molecule mark assisted Selection of daily gain in pigs TEF-1 gene.

Description

Daily gain in pigs TEF-1 gene and the application in the pig molecule mark assisted Selection thereof

Technical field

The invention belongs to animal gene engineering technology field, be specifically related to the clone and the application in the pig molecule mark assisted Selection thereof of daily gain in pigs TEF-1 gene.

Background technology

Pork is the main source of China urban and rural residents animal protein, and China's pork output and feeding live pig amount rank first in the world, and the development of pig industry has extremely important theory and practice meaning in China.In recent years, pork accounts for about 65% of meat gross output always.Especially along with the reform of China's economic system, peasant's merchandise consciousness progressively strengthens, and pig industry is just developed rapidly to specialization, mass-producing, intensification, batch production direction by traditional-family's sideline production.Therefore, the development of quickening genetic thremmatology is used to support that pig industry has very important effect.

In the past, the breeding objective of pig was simple, mainly was to improve growth rate and reduce the thickness of backfat, and along with the progress of breeding work, it is complicated that breeding objective becomes, and comprising: 1, improve the speed of growth and the efficiency of feed utilization of growing and fattening pigs, the main separation day weight gain.2, improve lean ratio and meat.3, improve breeding potential and incubation rate.

Along with the increase of people to the meat requirement, livestock industry must be shortened the cattle breeding phase, just improves the speed of growth of pig, and day weight gain is carried out seed selection, more provides meat product for people.Growth traits belongs to quantitative character, by controlled by multiple genes and there is key-gene (major gene) effect.The development of Protocols in Molecular Biology, make people can seek the key-gene or the molecule marker closely linked of control growing proterties at dna level with it, in breeding process, be used for marker assisted selection (marker assistedselection, MAS), select progress so that improve, improve the pig growth traits better, satisfy people's needs, obtain bigger economic benefit simultaneously.

By the candidate gene method, found some to influence the gene of the speed of growth of pig.(Growth Hormon, GH) coding is a kind of by pig pituitary frontal lobe eosinophil excretory single peptide chain protein parahormone, through confirming that GH has growth promoting function, therefore is referred to as tethelin to be positioned at growth hormone gene on No. 12 karyomit(e)s of pig.GH is the core of regulation and control animal growth, is a kind of somatomedin with extensive physiological function, and growth has regulating effect extremely widely with substance metabolism to the histocyte of animal.Porcine somatotropin can promote protein synthesis and fat to employ, and significantly improves the speed of growth, the price of deed and the lean ratio of pig, has tangible economic benefit and social benefit (Xing Jinwei, 2001; Xiong Wenzhong, 1998).

The rhIGF-1 (IGF2) that is positioned on No. 2 karyomit(e)s of pig is a small molecule single chain polypeptide (relative molecular mass 7471,67 amino-acid residues) growth to the embryo plays an important role, Owens P C etc. studies show that further IGF2 is the multi-functional cell proliferation regulatory factor of a class (The relationship between endogenous insulin-like growth factors andgrowth of pigs.Anim Sci, 1999,77 (8): 2098-2103). Liu Xin etc. detect its Nci I restriction enzyme site, the result shows at Du Luoke, long white, among the Da Bai, the AA genotype is faster than BB genotype growth speed, and the growth performance index is high by 4.06%～8.31%.

In addition, pork insulin like growth factor (IGF-1), the PIT1 gene, ob gene (LEP) etc. all is considered to relevant with the speed of growth of pig.Although the research of daily gain in pigs candidate gene has obtained some impressive progresses, but still exist not enough, the important economical trait that shows pig is quantitative character normally, the physiological and biochemical procedure that relates to is quite complicated, even same quantitative character, it also is subjected to the regulation and control of a plurality of genes, state its 1-2 controlled gene although taken off, the method that searching has the important physiological function gene is comprehensive inadequately, detect the limited amount of gene, efficient is not high, needs innovation, still have other new gene to remain to be discovered, so further seek extremely urgent with the work of pig important economical trait relative new gene with big effect.

TEF-1 is a member in the transcription factor TEAD family, has TEA DNA binding domains, and TEF-1 is positioned pig 2p14-2p17.S.S.Lee etc. have studied a QTL who influences daily gain in pigs on No. 2 karyomit(e)s of pig, and linkage analysis shows that TEF-1 is positioned on this QTL.TEF-1 just has expression in early days, just expressed in 6.5 days in the mouse pregastrulation at the placenta skin, 8.5 it is just expressed whole embryo, since 10.5 days, just in developmental cardiac muscle and skeletal muscle precursor cell, express (Patrick Jacquemin etc., A Novel Family of Developmentally Regulated Mammalian Transcription Factors Containing theTEA/ATTS DNA Binding Domain, THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol.271, No.36, Issue of September 6, pp.21775-21785,1996).TEF-1 almost appears at all tissues, particularly kidney, muscle, and lung and heart, expression amount is higher.The mutant mice of TEF-1 gene causes embryo's death in 11 to 12 days (Transcriptional enhancer factor 1 disruption by a retroviral gene trap leadsto heart defects and embryonic lethality in mice.Genes such as Z Chen because heart forms defective; Development.8 2293-2301), shows that the growth of TEF-1 gene pairs muscle plays a part important.

The TEF-1 transcription factor plays a part important in the muscle specific expression of gene, the TEA structural domain of TEF-1 can be not only can with the M-CAT element effect of muscle specific gene, can also regulate the expression of other muscle cdna with the MADS structural domain effect of other factors.Second and third a spiral of the TEA structural domain of TEF1 can both combine with the MADS structural domain of SRF transcription factor C-terminal with external in vivo, form stable complex body, regulate skeletal muscle a-actin gene promoter, can also with the effect of the MEF2MADS factor, control relies on the muscle specific expression of gene of MEF2.TEF-1 and bHLHZMax protein-interacting are attached to the expression of EM (E-box-M-CAT) the motif positive regulating gene of a-MHC (Myosin heavy-chain) gene.A-TM (tropomyosin) expression of gene needs the participation of the TEF1 factor.TEF-1 activation-myosin heavy chain gene is rich in the promotor of A/T element, show TEF-1 albumen except having keying action, be rich in the idiotype network of A/T element and MEF2 element regulation skeletal muscle, cardiac muscle and unstriated muscle probably by combination in conjunction with the MCAT element.By above data we can to draw the TEF-1 gene be the significant muscles genes involved that grows.Therefore this gene is used in the selection of molecule aid mark and has great importance.But it is up to the present, still blank to the research of pig TEF-1 gene both at home and abroad.The polymorphism of research mutational site in colony, and carry out the very strong means that the proterties association analysis is the research gene function.So the applicant has carried out polymorphic research and association analysis to the cDNA sequence of the part of this gene, in the hope of finding its function.

Summary of the invention

The objective of the invention is to clone pig day weight gain gene TEF-1, seek the mutational site of TEF-1 gene and, for the marker-assisted breeding of pig provides a kind of useful molecule marker as the detection method of daily gain in pigs gene pleiomorphism.

The present invention is achieved in that

A kind of daily gain in pigs gene TEF-1, its Partial cDNA Sequence is as described in the sequence table SEQ ID NO:1, there is alternative splicing in this gene, two spliceosomes are arranged, long transcript contains 1654bp, the open reading frame that comprises 1308bp, short transcript is 1591bp, the exon that lacks a 63bp, the open reading frame that comprises 1245bp, two transcripts all comprise the 5 ' non-translational region of 246bp and the 3 ' non-translational region of 100bp, wherein: the 93rd base site mutation of the 5 ' non-translational region in the TEF-1 gene cDNA sequence that obtains.

There is 1 93bp place shown in sequence table SEQ ID N0:1 that the base mutation of an A93-G93 is arranged in the TEF-1 gene cDNA sequence that is obtained, causes BshN I-RFLP polymorphism.

A kind of screening is applicable to the molecule marking method of daily gain in pigs, according to following steps:

Personnel selection TEF-1 gene cDNA is the information probe, does the homologous sequence screening, obtains the expressed sequence tag (EST) of similarity more than 85%; Splice pig EST-contig then; According to EST-contig design primer, primer is used for pcr amplification, to PCR product purification, clone and the order-checking that obtains, carries out sequential analysis, obtains as the described dna sequence dna of sequence table SEQ ID NO:1.

The applicant uses above-mentioned PCR-RFLP method the 93rd base mutation of pig TEF-1 gene 5 ' non-translational region is detected.

Below the invention will be further described:

1, the clone of the Partial cDNA Sequence of TEF-1 gene

(1) design of primers:

(the GenBank number of including: NM_021961) be the information probe of personnel selection TEF-1 gene cDNA, utilize the BLAST instrument among the NCBI in GenBank pig est database, to do the homologous sequence screening, obtain a series of similaritys and be the ESTs (fragment length is greater than 100bp) more than 85%, the number of including of these ESTs is inquired about corresponding sequence with ENTREZ (http://www.ncbi.nlm.nih.gov/Web/Search/index.html) in NCBI, use the SeqMan program construction pig EST-contig among the DNAStar then.According to EST splicing preface

Row design primer, sequence is as follows:

Table 1 is used for the primer sequence design of TEF-1 gene cDNA clone

(2) purifying of PCR product, clone and order-checking:

The purifying of PCR product: under ultraviolet lamp, contain the segmental gel of purpose from the cutting-out of low melting-point agarose gel, put into the 1.5mLEpendorff pipe, use PCR product purification test kit (available from Promega company) purified pcr product then, according to the operation of test kit specification sheets, concrete steps are: the S of 300 μ L in the gel of every 100mg ₁Liquid melts in 65 ℃ of incubation 10min to gel, fully with S ₁/ DNA mixture changes the recovery post over to, and the centrifugal 30s of 9200g makes slurries extrude by Minicolumn.Waste liquid in the following pipe is outwelled, added the W of 500 μ L again ₁Liquid is to pipe, and the centrifugal 15s of 9200g outwells the waste liquid in the pipe.The W that adds 500 μ L again ₁Liquid leaves standstill 1min, and the centrifugal 30s of 9200g takes off Minicolumn and packs in the 1.5ml Ependorff pipe, adds aqua sterilisa or the TE liquid of 25 μ L, leaves standstill after the 1min, and the centrifugal 1min of 9200g is stored in the Ependorff pipe with eluted dna.

Ligation: purified pcr product is connected with pGEM-T carrier (available from Promega company), the ligation cumulative volume is 5 μ l, comprising 2.5 μ l, 2 * buffer, 0.5 the T carrier of μ l, 0.5 the purified pcr product of μ l, 0.5 the T4 ligase enzyme of μ l adds 1 μ l aqua sterilisa at last and puts 4 ℃ of water-baths and spend the night.

The preparation of competent cell: the single colony inoculation of DH5 α of picking is in 2ml LB from 37 ℃ of fresh flat boards of having cultivated 16-20h, in 37 ℃ of shaking culture 3h, switching 1ml bacterium liquid is in the saline bottle that contains 30ml LB, continuation is at 37 ℃ of about 4h of shaking culture, treat that when OD600 reaches 0.3-0.4 saline bottle being put ice bath from the shaking table taking-up cools off 10-15min, then bacterium liquid is changed in the centrifuge tube in 4 ℃ 4, the centrifugal 10min of 000g is with collecting cell, centrifuge tube is inverted to abandon clean nutrient solution, with the resuspended precipitation of CaCl2 that 10ml ices the 0.1mol/L of precooling, ice bath 30min repeats 4 ℃ 4, the centrifugal 10min of 000g once ices the CaCl of the 0.1mol/L of precooling with 4ml ₂Resuspended precipitation, it is standby to put 4 ℃ of preservations.

Transform: get 100-120 μ l competent cell under the sterile state in 1.5ml Ependorff pipe, the connection product of 5 μ l is added mixing, place 30min on ice, 42 ℃ of heat shock 90s, do not shake the Ependorff pipe therebetween, take out back ice bath 3-4min, add the LB liquid nutrient medium of 400 μ l antibiotic-frees, 37 ℃ of shaking culture 45min.Get 100 μ l and coat in advance that 4h has been coated with on the agar plate of IPTG (Isopropylthio-β-D-galactoside, isopropylthio-) and X-gal, be inverted cultivation after keeping flat 1h for 37 ℃.

(3) the dna sequence dna homology search is identified:

By the American National biotechnology (NCBI of information center, National Center for BiotechnologyInformation, http://www.ncbi.nlm.nih.gov) BLAST of website (Basic Local Alignment SearchTool) software, the known physiological function gene of announcing in the dna sequence dna that order-checking back is obtained and the GenBank database carries out sequence homology relatively, with evaluation with obtain the function information of this dna sequence dna.

(4) physical positioning:

(1) primer sequence that is used for physical positioning is

TEF-1MF：5′CACACTCTCCATGATCCAAC3′

TEF-1MR：5′TCACGGTTCACCCTTCTG3′

This primer amplification fragment length is 234bp.

(2) be used for the experiment material of physical positioning

With pig * rodents somatic cell hybrid plate (Pig * rodent somatic cell hybrid panel, SCHP) carry out the chromosomal region location, with common pig radiation hybrid panel (the INRA-Minnesota porcineradiation hybrid panel that makes up of U.S. Minnesota university, IMpRH) carrying out karyomit(e) accurately locatees, above-mentioned two cover somatic cell hybrid plates are by by French Martin doctor Yerle (Laboratoire de G é n é tique Cellulaire, INRA, Castanet-Tolosan France) is so kind as to give.

Wherein SCHP comprises 27 individual cells hybrid cells systems, and 1-19 number is pig * hamster somatic cell hybrid clone, and 20-27 number is pig * mouse somatic cell hybrid clone, and with hamster, mouse and pig genomic dna as positive control.Identify that through cytogenetics this hybrid plate has kept whole 18 euchromosomes and the X chromosome except that Y chromosome of pig, wherein contain 127 non-overlapped chromosomal regions, pig karyomit(e) that is comprised in each clone and chromosome segment information can (http://www:toulouse:inra:fr/lgc/lgc:html/) obtain from the World Wide Web.

The radiation dose that IMpRH uses is 7,000-rad.IMpRH comprises 118 pigs * hamster radiation hybrid cell line, and hamster and pig genomic dna positive control, qualification result with 757 marks shows that the average mark rate of retaining among the IMpRH is 29:3%, include 128 linkage groups, 18 pairs of euchromosomes and X chromosome have been covered, be used to estimate that the kb/cR ratio of distance between mark is～70kb/cR (1Ray=100cR) that theoretical resolution is 145kb.

(3) PCR somatotype condition

Carrying out amplification PCR reaction cumulative volume is 10 μ l, and wherein template DNA is 20ng, contains 1 * buffer (Promega), 1.5mmol/L MgCl ₂, the dNTP final concentration is 150 μ mol/L, the primer final concentration is 0.4 μ mol/L, 2U Taq archaeal dna polymerase (available from Promega company).The pcr amplification program is: 94 ℃ of 3min, and the 94 ℃ of 30s that circulate 35 times, 62 ℃ of 30s, 72 ℃ of 30s then, last 72 ℃ are extended 5min.The PCR reaction product detects with 2% agarose gel electrophoresis.

3.PCR-RFLP diagnostic method is set up

(1) primer sequence

TEF-1F1：5′GGCAGGAGCAGTGCTAACAG3′

TEF-1SNPR：5′GCGAGTCCGAGGCAAACTTC3′

This primer amplification fragment length 118bp.

(2) pcr amplification condition

PCR reaction cumulative volume 20 μ l, wherein the about 100ng of pig genomic dna contains 1 * buffer (Promega), 1.5mmol/LMgCl2, the dNTP final concentration is 150 μ mol/L, and the primer final concentration is 0.2 μ mol/L, 2U Taq archaeal dna polymerase (available from Promega company).The pcr amplification program is: 94 ℃ of 4min, and the 94 ℃ of 30s that circulate 34 times, 63 ℃ of 30s, 72 ℃ of 20s, last 72 ℃ are extended 5min.The PCR reaction product detects with 3% agarose gel electrophoresis and takes pictures.

(3) RFLP testing conditions

PCR product endonuclease reaction volume is 5 μ l, 10 * buffer0.5 μ l wherein, and PCR product 2 μ l, restriction enzyme BshNI are 0.2 μ l (2U), H ₂O is 2.310 μ l, and with centrifugal behind the sample mixing, 37 ℃ of water-bath 4h detect enzyme with 3% agarose gel electrophoresis and cut the result, and the record genotype is taken pictures under ultraviolet lamp.

4. mark property association analysis: " Tongcheng pig " (this kind belongs to a kind of open place of china pig variety of raising) and the swinery of other blood relationships in animal molecular biology that utilizes the applicant place and the establishment of breeding laboratory are done the proterties association analysis, get about 200 DNA samples and are used for genotype detection.The proterties of being analyzed has part growth performance and part meat proterties.The applicant has set up following least square model for this reason:

y _ijk＝μ+GENOTYPE _i+SEX _j+COMBINATION _k+ε _ijk，

Wherein, y _IjkBe the character observation value, μ is a population mean, GENOTYPE _iBe genotype effect, SEX _jBe sex effect, COMBINATION _kBe the effect of combination, ε _IjkBe random error, suppose obey N (0, σ ²) distribute.

Effect of the present invention is:

1. the clone result of pig TEF-1 gene:

(a kind ofly has an external introduction pig variety of European blood relationship with the landrace of growing up, raise on a large scale in China) muscle tissue extract total RNA, cDNA is a template through the reverse transcription synthetic, carry out pcr amplification with the primer shown in the table 1 respectively, amplified production detects through 2% agarose gel electrophoresis, the result shows that one of them segment has two special bands.The PCR product is reclaimed the order-checking of purifying rear clone, and splice with the ASSEMBLY program in the GeneTool1.0 software, obtaining a length is two cDNA integration sequences (seeing shown in the sequence table SEQ ID NO:1) of a 1654bp and a 1591bp.Sequential analysis shows that this cDNA sequence has 1308bp (nt 247-1554) and two open reading frame of 1245bp, 435 and 414 amino acid whose two protein of encoding respectively.Gene coded sequence is carried out homology search in GenBank, this sequence of result for retrieval and people TEF-1 gene cDNA (the GenBank number of including: homology NM_021961) reaches 94%,

2. the positioning result of pig TEF-1 gene:

Somatotype result in SCHP shows with TEF-1MF and TEF-1MR primer, in 19 pig * Chinese hamster somatic cell hybrid clones (1-19 number), the purpose fragment that occurs the 95bp consistent for No. 6 with the amplification of pig genomic dna positive control, and in 8 pigs * mouse somatic cell hybrid clone (20-27 number), 21, No. 23 hybrid cell systems all increase and obtain the purpose fragment of 95bp.The PCR somatotype data of above-mentioned actual observation are submitted to HybWeb (http://www:toulouse:inra:fr/lgc/lgc:html/) carry out statistical study to obtain zone location information, the data analysis result be the TEF-1 assignment of genes gene mapping on No. 2 karyomit(e)s of pig, further the zone location result is SSC2p14-2p17.

With TEF-1MF and TEF-1MR primer be: 1,111,000,000 0,100,001,000 00,000,011,010,010,000,000 1,000,000,000 1,000,000,101 1,000,000,100 0,010,010,011 0,110,001,001 00,000,000,000,100,001,100 11000000 (wherein 0 and 1 explain respectively amplification negative and positive) in IMpRH somatotype result.Statistic analysis result, the SW1857 close linkage on No. 2 karyomit(e)s of TEF-1 gene and pig, the LOD value is 9.77, the RH map distance is 0.42Ray, confirms that further this gene is positioned on No. 2 karyomit(e)s of pig.

3.PCR-RFLP diagnostic method is set up

Found that according to sequencing result and the splicing of angling the est sequence of getting there is a base mutation in 5 ' non-translational region, the restriction enzyme site that has BshN I (G*G (C/T) is CC (G/A)), obtain 118bp specific amplified fragment with TEF-1F1 and TEF-1SNPR amplification pig genomic dna, enzyme is cut and is produced three kinds of genotype, genotype BB type has 93bp and 25bp two bands, the AA type has only the band of 118bp, and heterozygote AB type has 118bp, 93bp and 25bp three bands.

4. mark property association analysis

Pig TEF-1 gene 5 ' non-translational region BshN I-RFLP pleomorphism site and part trunk, meat, growth traits are carried out association analysis, genotype detection result shows that the GG genotype has 58 in 159 individualities, the GC genotype has 71, the CC genotype has 30, the omnidistance day weight gain of resultant relevant proterties.

As shown in Table 2, C allelotrope is the favourable mark of the omnidistance day weight gain of pig, and CC genotype mark can be used for improving the selective marker (molecule marker) of growth speed of pigs.

Table 2 TEF-1 gene pleiomorphism is to the influence of omnidistance day weight gain

Description of drawings

Sequence table SEQ ID NO:1 is the cDNA sequence of the present invention's daily gain in pigs TEF-1 gene of cloning;

Fig. 1: the schema that is daily gain in pigs TEF-1 gene preparation of the present invention;

Fig. 2: be that pig TEF-1 gene is used for the part dna fragmentation that PCR-RFLP detects among the present invention;

Fig. 3: three kinds of genotype (the GG GC CC) electrophoresis result that is the BshN I-RFLPs of daily gain in pigs TEF-1 gene 5 ' non-translational region among the present invention.

Embodiment

The detection of embodiment 1:PCR-BshN I-RFLP polymorphism in each pig variety used

Utilize PCR-BshN I-RFLP to detect five pig kinds: painted face in Beijing opera (place of china pig blood relationship), Tongcheng pig (place of china pig blood relationship), long white (the external pig of European blood relationship), Da Bai (the external pig of European blood relationship), duroc (the external pig of European blood relationship), the gene frequency of each pig kind is as shown in table 3, finds in several pig kinds it all is that allelotrope G preponderates.

Table 3 the present invention clone's daily gain in pigs TEF-1 gene BshN I polymorphism genotype frequency and gene frequency

Embodiment 2:

The applicating example of pig mark property association analysis

Daily gain in pigs TEF-1 gene 5 ' non-translational region BshN I-RFLP pleomorphism site and part trunk, meat proterties have been carried out the application of association analysis, genotype detection result shows that the GG genotype has 58 in 159 individualities, the GC genotype has 71 individualities, the CC genotype has 30, carrying out in the association analysis application with the part producing proterties, the proterties of being analyzed has part producing proterties and meat proterties, and the proterties of being analyzed is omnidistance day weight gain.The result is as shown in table 4.

Table 4 the present invention clone's daily gain in pigs TEF-1 gene pleiomorphism is to the influence of omnidistance day weight gain

Annotate: shoulder motes ^*Statement P＜0.05; Shoulder motes ^*Statement P＜0.01.

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉daily gain in pigs TEF-1 gene and the application in the pig molecule mark assisted Selection thereof

<130>

<141>2007-05-21

<160>2

<170>PatentIn?version?3.1

<210>1

<211>1654

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>gene

<222>(1)..(1654)

<223>

<220>

<221>mutation

<222>(93)..(93)

<223>

<220>

<221>CDS

<222>(247)..(1554)

<223>

<400>1

ggcaggagca?gtgctaacag?gggtggggtg?gcccagcccg?gggactggga?gccggggagg 60

gagccgggct?ccgagctgaa?agcgagggaa?gcrgcgccga?agtttgcctc?ggactcgccg 120

ggcgctgcgg?cggctccctt?cgccgaggtt?tattttcttg?aaaaggctcc?aggcttcggc 180

ttggaaaatc?cggccgccaa?aattgagccc?agcagctgga?gcggcagtga?gagccctgcc 240

gaaaat?atg?gaa?agg?atg?agt?gac?tct?gca?gat?aag?ccc?att?gac?aat 288

Met?Glu?Arg?Met?Ser?Asp?Ser?Ala?Asp?Lys?Pro?Ile?Asp?Asn

1 5 10

gat?gca?gaa?ggg?gtc?tgg?agc?ccc?gac?att?gag?cag?agc?ttt?cag?gaa 336

Asp?Ala?Glu?Gly?Val?Trp?Ser?Pro?Asp?Ile?Glu?Gln?Ser?Phe?Gln?Glu

15 20 25 30

gcc?ttg?gct?atc?tat?cca?cca?tgt?ggg?agg?agg?aaa?atc?atc?tta?tca 384

Ala?Leu?Ala?Ile?Tyr?Pro?Pro?Cys?Gly?Arg?Arg?Lys?Ile?Ile?Leu?Ser

35 40 45

gat?gaa?ggc?aag?atg?tat?ggt?agg?aat?gaa?tta?ata?gcc?aga?tac?atc 432

Asp?Glu?Gly?Lys?Met?Tyr?Gly?Arg?Asn?Glu?Leu?Ile?Ala?Arg?Tyr?Ile

50 55 60

aaa?ctc?agg?aca?ggg?aag?acg?agg?acc?aga?aaa?cag?gtg?tct?agt?cat 480

Lys?Leu?Arg?Thr?Gly?Lys?Thr?Arg?Thr?Arg?Lys?Gln?Val?Ser?Ser?His

65 70 75

ata?cag?gtc?ttg?cca?gaa?gga?aag?ttc?gag?aaa?ttc?aag?ccg?cca?tta 528

Ile?Gln?Val?Leu?Pro?Glu?Gly?Lys?Phe?Glu?Lys?Phe?Lys?Pro?Pro?Leu

80 85 90

agg?tgt?cta?gtc?aca?ttc?agg?ttc?ttg?cca?gaa?gga?aat?ctc?gtg?att 576

Arg?Cys?Leu?Val?Thr?Phe?Arg?Phe?Leu?Pro?Glu?Gly?Asn?Leu?Val?Ile

95 100 105 110

ttc?att?cca?agc?tta?agg?ttc?agc?atg?gat?cag?act?gcg?aag?gat?aag 624

Phe?Ile?Pro?Ser?Leu?Arg?Phe?Ser?Met?Asp?Gln?Thr?Ala?Lys?Asp?Lys

115 120 125

gcc?ctg?cag?cac?atg?gcc?gcc?atg?tca?tca?gcc?cag?atc?gtc?tcg?gcc 672

Ala?Leu?Gln?His?Met?Ala?Ala?Met?Ser?Ser?Ala?Gln?Ile?Val?Ser?Ala

130 135 140

act?gcc?att?cac?aac?aag?ctg?ggg?ctg?ccc?ggg?att?cca?cgc?ccc?acc 720

Thr?Ala?Ile?His?Asn?Lys?Leu?Gly?Leu?Pro?Gly?Ile?Pro?Arg?Pro?Thr

145 150 155

t?tccca?ggg?gcg?ccg?ggg?ttc?tgg?ccg?gga?atg?ata?caa?aca?ggg?cag 768

Phe?Pro?Gly?Ala?Pro?Gly?Phe?Trp?Pro?Gly?Met?Ile?Gln?Thr?Gly?Gln

160 165 170

cct?gga?tcc?tca?caa?gac?gtc?aag?ccc?ttc?gtg?cag?cag?gcc?tac?ccc 816

Pro?Gly?Ser?Ser?Gln?Asp?Val?Lys?Pro?Phe?Val?Gln?Gln?Ala?Tyr?Pro

175 180 185 190

atc?cag?cca?gcg?gtc?acg?gcc?ccc?att?cca?ggg?ttt?gag?cca?gcg?tca 864

Ile?Gln?Pro?Ala?Val?Thr?Ala?Pro?Ile?Pro?Gly?Phe?Glu?Pro?Ala?Ser

195 200 205

gcc?cca?gct?ccc?tcg?gtc?cca?gcc?tgg?cag?ggc?cgc?tcc?att?ggc?aca 912

Ala?Pro?Ala?Pro?Ser?Val?Pro?Ala?Trp?Gln?Gly?Arg?Ser?Ile?Gly?Thr

210 215 220

acc?aaa?ctt?cgc?ctg?gtg?gaa?ttc?tca?gct?ttc?ctc?gaa?cag?cag?cga 960

Thr?Lys?Leu?Arg?Leu?Val?Glu?Phe?Ser?Ala?Phe?Leu?Glu?Gln?Gln?Arg

225 230 235

gac?ccg?gac?tcg?tac?aac?aaa?cac?ctc?ttc?gtg?cac?att?ggg?cat?gcc 1008

Asp?Pro?Asp?Ser?Tyr?Asn?Lys?His?Leu?Phe?Val?His?Ile?Gly?His?Ala

240 245 250

aac?cat?tct?tac?agt?gac?cca?ttg?ctc?gag?tca?gtg?gac?att?cgt?cag 1056

Asn?His?Ser?Tyr?Ser?Asp?Pro?Leu?Leu?Glu?Ser?Val?Asp?Ile?Arg?Gln

255 260 265 270

att?tat?gac?aaa?ttt?cct?gaa?aag?aaa?ggt?ggc?tta?aag?gaa?ctg?ttt 1104

Ile?Tyr?Asp?Lys?Phe?Pro?Glu?Lys?Lys?Gly?Gly?Leu?Lys?Glu?Leu?Phe

275 280 285

gga?aag?ggc?cct?caa?aat?gcc?ttc?ttc?ctc?gta?aaa?ttc?tgg?gcc?gat 1152

Gly?Lys?Gly?Pro?Gln?Asn?Ala?Phe?Phe?Leu?Val?Lys?Phe?Trp?Ala?Asp

290 295 300

tta?aac?tgc?aat?att?caa?gat?gat?gcc?ggg?gct?ttt?tat?ggt?gta?acg 1200

Leu?Asn?Cys?Asn?Ile?Gln?Asp?Asp?Ala?Gly?Ala?Phe?Tyr?Gly?Val?Thr

305 310 315

agt?caa?tat?gag?agt?tct?gaa?aat?atg?aca?gtc?acg?tgt?tcc?acc?aaa 1248

Ser?Gln?Tyr?Glu?Ser?Ser?Glu?Asn?Met?Thr?Val?Thr?Cys?Ser?Thr?Lys

320 325 330

gtt?tgc?tcc?ttt?ggg?aag?caa?gta?gta?gaa?aaa?gta?gag?acg?gaa?tac 1296

Val?Cys?Ser?Phe?Gly?Lys?Gln?Val?Val?Glu?Lys?Val?Glu?Thr?Glu?Tyr

335 340 345 350

gcg?agg?ttt?gag?aat?ggc?cga?ttt?gta?tac?cga?ata?aac?cgc?tcc?ccg 1344

Ala?Arg?Phe?Glu?Asn?Gly?Arg?Phe?Val?Tyr?Arg?Ile?Asn?Arg?Ser?Pro

355 360 365

atg?tgt?gaa?tat?atg?atc?aac?ttc?atc?cac?aag?ctc?aaa?cac?tta?cca 1392

Met?Cys?Glu?Tyr?Met?Ile?Asn?Phe?Ile?His?Lys?Leu?Lys?His?Leu?Pro

370 375 380

gag?aaa?tat?atg?atg?aac?agt?gtt?ttg?gaa?aac?ttc?aca?att?tta?ttg 1440

Glu?Lys?Tyr?Met?Met?Asn?Ser?Val?Leu?Glu?Asn?Phe?Thr?Ile?Leu?Leu

385 390 395

gtg?gta?aca?aac?agg?gat?aca?caa?gaa?act?ctc?ctg?tgc?atg?gcc?tgt 1488

Val?Val?Thr?Asn?Arg?Asp?Thr?Gln?Glu?Thr?Leu?Leu?Cys?Met?Ala?Cys

400 405 410

gta?ttt?gaa?gtt?tca?aat?agt?gaa?cat?gga?gca?cag?cat?cac?att?tac 1536

Val?Phe?Glu?Val?Ser?Asn?Ser?Glu?His?Gly?Ala?Gln?His?His?Ile?Tyr

415 420 425 430

agg?ctt?gta?aag?gac?taa?ccatggttat?ttatatatat?agatatctgt 1584

Arg?Leu?Val?Lys?Asp

435

atatatacac?acacacatat?gtgcgcacac?acacacacac tctccatgat?ccaacgactg?1644

actgtaaacc 1654

<210>2

<211>435

<212>PRT

＜213〉pig (Sus scrofa)

<400>2

Met?Glu?Arg?Met?Ser?Asp?Ser?Ala?Asp?Lys?Pro?Ile?Asp?Asn?Asp?Ala

1 5 10 15

Glu?Gly?Val?Trp?Ser?Pro?Asp?Ile?Glu?Gln?Ser?Phe?Gln?Glu?Ala?Leu

20 25 30

Ala?Ile?Tyr?Pro?Pro?Cys?Gly?Arg?Arg?Lys?Ile?Ile?Leu?Ser?Asp?Glu

35 40 45

Gly?Lys?Met?Tyr?Gly?Arg?Asn?Glu?Leu?Ile?Ala?Arg?Tyr?Ile?Lys?Leu

50 55 60

Arg?Thr?Gly?Lys?Thr?Arg?Thr?Arg?Lys?Gln?Val?Ser?Ser?His?Ile?Gln

65 70 75 80

Val?Leu?Pro?Glu?Gly?Lys?Phe?Glu?Lys?Phe?Lys?Pro?Pro?Leu?Arg?Cys

85 90 95

Leu?Val?Thr?Phe?Arg?Phe?Leu?Pro?Glu?Gly?Asn?Leu?Val?Ile?Phe?Ile

100 105 110

Pro?Ser?Leu?Arg?Phe?Ser?Met?Asp?Gln?Thr?Ala?Lys?Asp?Lys?Ala?Leu

115 120 125

Gln?His?Met?Ala?Ala?Met?Ser?Ser?Ala?Gln?Ile?Val?Ser?Ala?Thr?Ala

130 135 140

Ile?His?Asn?Lys?Leu?Gly?Leu?Pro?Gly?Ile?Pro?Arg?Pro?Thr?Phe?Pro

145 150 155 160

Gly?Ala?Pro?Gly?Phe?Trp?Pro?Gly?Met?Ile?Gln?Thr?Gly?Gln?Pro?Gly

165 170 175

Ser?Ser?Gln?Asp?Val?Lys?Pro?Phe?Val?Gln?Gln?Ala?Tyr?Pro?Ile?Gln

180 185 190

Pro?Ala?Val?Thr?Ala?Pro?Ile?Pro?Gly?Phe?Glu?Pro?Ala?Ser?Ala?Pro

195 200 205

Ala?Pro?Ser?Val?Pro?Ala?Trp?Gln?Gly?Arg?Ser?Ile?Gly?Thr?Thr?Lys

210 215 220

Leu?Arg?Leu?Val?Glu?Phe?Ser?Ala?Phe?Leu?Glu?Gln?Gln?Arg?Asp?Pro

225 230 235 240

Asp?Ser?Tyr?Asn?Lys?His?Leu?Phe?Val?His?Ile?Gly?His?Ala?Asn?His

245 250 255

Ser?Tyr?Ser?Asp?Pro?Leu?Leu?Glu?Ser?Val?Asp?Ile?Arg?Gln?Ile?Tyr

260 265 270

Asp?Lys?Phe?Pro?Glu?Lys?Lys?Gly?Gly?Leu?Lys?Glu?Leu?Phe?Gly?Lys

275 280 285

Gly?Pro?Gln?Asn?Ala?Phe?Phe?Leu?Val?Lys?Phe?Trp?Ala?Asp?Leu?Asn

290 295 300

Cys?Asn?Ile?Gln?Asp?Asp?Ala?Gly?Ala?Phe?Tyr?Gly?Val?Thr?Ser?Gln

305 310 315 320

Tyr?Glu?Ser?Ser?Glu?Asn?Met?Thr?Val?Thr?Cys?Ser?Thr?Lys?Val?Cys

325 330 335

Ser?Phe?Gly?Lys?Gln?Val?Val?Glu?Lys?Val?Glu?Thr?Glu?Tyr?Ala?Arg

340 345 350

Phe?Glu?Asn?Gly?Arg?Phe?Val?Tyr?Arg?Ile?Asn?Arg?Ser?Pro?Met?Cys

355 360 365

Glu?Tyr?Met?Ile?Asn?Phe?Ile?His?Lys?Leu?Lys?His?Leu?Pro?Glu?Lys

370 375 380

Tyr?Met?Met?Asn?Ser?Val?Leu?Glu?Asn?Phe?Thr?Ile?Leu?Leu?Val?Val

385 390 395 400

Thr?Asn?Arg?Asp?Thr?Gln?Glu?Thr?Leu?Leu?Cys?Met?Ala?Cys?Val?Phe

405 410 415

Glu?Val?Ser?Asn?Ser?Glu?His?Gly?Ala?Gln?His?His?Ile?Tyr?Arg?Leu

420 425 430

Val?Lys?Asp

435

Claims (5)

1, a kind of daily gain in pigs TEF-1 gene, its cDNA sequence is as described in the sequence table SEQ ID NO:1.

2, daily gain in pigs TEF-1 gene according to claim 1 is characterized in that, there is the base mutation of an A93-G93 at the 93bp place of sequence table SEQ ID NO:1, causes BshN I-RFLP polymorphism.

3, daily gain in pigs TEF-1 gene according to claim 1, the dna sequence dna of wherein cloning the used primer of TEF-1 gene is as follows:

Forward: 5 ' GGCAGGAGCAGTGCTAACAG 3 ',

Oppositely: 5 ' GCGAGTCCGAGGCAAACTTC 3 '.

4, claim 1 or 2 application of described daily gain in pigs TEF-1 gene in the pig marker assisted selection.

5, the application of clone's primer in the pig marker assisted selection of the described daily gain in pigs TEF-1 of claim 3 gene.

Images