CN100591692C - Pig fat deposition related protein and encoding genes and use thereof - Google Patents

Abstract

The present invention discloses a protein relating to pig fat deposition and the coding gene as well as application of the protein. The pig fat deposition related protein is of one of the following amino acid residue sequences: 1) The No 1 sequence in the sequence table; 2) the No 1 amino acid residue sequence with one or more than one amino acid residue substituted or lost or added; The protein is related to pig fat deposition. The protein relating to pig fat deposition and the correspondent coding gene can be used to detect the body traits such as suet rate, inner-lipid rate, the back-fat thickness between the 6 to 7 inter-ribs and the average back-fat thickness of the pig that can reflect the fat deposition capability. Therefore, the present invention provided a new genetic marker for the pig molecule breeding, and plays an important role in the pig breeding.

Description

A kind of label of pig fat deposition description associated protein and encoding gene and application

Technical field

The present invention relates to a kind of label of pig fat deposition description associated protein and encoding gene and application, particularly a kind of label of pig fat deposition description associated protein and encoding gene thereof and utilize the single nucleotide polymorphism of this protein coding gene to detect the method for label of pig fat deposition description performance.

Background technology

GENERALIZATION OF MODERN BREEDING TECHNIQUE is significantly improved the production performance of pig, yet along with the improving constantly of people's living standard, pork consumption changes present lean meat species into from the past lard type.Adapt with it, the change from the scalar type to the mass type has also taken place in the production of commodity pig on scale.In current pork market, the commercial value of hot carcass weight and lean meat output decision hog on hook.The raise pigs grade scale of developed country of the world also is that (lean percentage in the carcass, difference CLP) is divided into different grades with hog on hook according to carcass lean meat percentage.Therefore improve lean ratio minimizing lipid content is the market pig producer, meat manager always, the breeding scholars are tireless pursues one's goal.

In real work, people attempt to seek the method that a kind of easy live body is evaluated carcass quality, butcher the financial loss of bringing with minimizing, and therefore big quantity research is devoted to seek the optimum prediction index that trunk is formed.The genetic correlation analytical results of live body proterties and carcass lean meat percentage shows, there are extremely strong negative correlation (rA=-0.5～-0.7) in the thickness of backfat and carcass lean meat percentage, and the live body thickness of backfat has higher heritability (h2=0.4～0.6) (Peng Zhong town etc.: " genetic improvement of pig ", Beijing, agricultural press, 1991).And the development and the application of dna molecular marker technology at present, for the direct selection of carcass lean meat percentage and the rapid evaluation of carcass quality have been opened up new way.

At present that studied and fatty deposits pig or relevant gene has: (Yu T P such as (1) Yu with the thickness of backfat, Tuggle C K, Schmitz C B, Rothschild M F.Association of PIT1 polymorphismswith growth and carcass traits in pigs.J Anim Sci, 1995,73:1282-1288.) contain at one and to detect the hypophysis transcription factor in China and the resource family of U.S.'s pig variety " blood " (PIT1) there is significant correlation in Pituitantranscription factor 1 with the average thickness of backfat.(2) (Hormone Lipase HSL), as the rate-limiting enzyme of fat acid decomposition, is responsible for the conversion of triglyceride to dialycerides to hormone-sensitive lipase in the lipid mobilization process.Along with its activity increases, the decomposition rate of triglyceride speeds, and the deposition of fat reduces, thereby reduces the lipid content of trunk.Therefore select its gene pairs lipid content that serves as a mark so long.Now with the HSL assignment of genes gene mapping on 6p1.1-1.2 on No. 6 karyomit(e)s of pig.(3) (Jeon J T such as Jeon, Carlborg O, Tornsten A, Giuffra E, Amarger V, Chardon P, Andersson-EklundL, Andersson K, Hansson I, Lundstrom K, Andersson L.A paternally expressedQTL affecting skeletal and muscle mass in pigs maps to the IGF2 locus.NatureGenetics, 1992,21:157-158.) use two familys of foundation with insulin-like growth factor 2 (Insulinlike growth factor II, IGF-II) be positioned on No. 2 karyomit(e)s of pig, and detect this gene and the thickness of backfat has significant correlation.(4) melanocyte cortical hormone receptor 4 (Melanocortin-4 receptor, MC4R), Kim and colleague thereof are with this assignment of genes gene mapping (Kim K S on No. 1 karyomit(e) of pig, Larsen N J, Rothschild M F.Linkage and physical mapping of the porcine melanocortin-4 receptor (MC4R) gene.J Anim Sci, 2000a, 78:791-792.), and in 5 pig commodity systems, detect variation of MC4R gene genetic and thickness of backfat significant correlation (Kim K S, Larsen N, Short T, Plastow G, RothschildM F.A missense variant of the porcine melanocortin-4 receptor (MC4R) geneis association with fatness, growth, and feed intake traits.Mamm Genome, 2000b, 11:131-135.).(5) candidate gene of studying relevant with carcass trait with the pig growth also comprises: with growth, leptin gene (the Leptin that the carcass trait possibility is relevant, LEP) be the ob gene and the myogenic factor 3 (myf3), with the thickness of backfat (the Cathepsin B of cathepsin B of significant correlation is arranged, CTSB) (RussoV such as gene, Fontanesi L, Davoli R, Nanni C L, Cagnazzo M, Buttazzoni L, Virgili R, Yerle M.Investigation of candidate genes for meat quality in dry-curedham production:the porcine cathepsin B (CTSB) and cystatin B (CSTB) genes.Anim Genet, 2002,33:123-131.).(6) Dirk J.de Koning and colleague thereof find when 127 microsatellite markers carry out full genome scanning by being distributed in amounting to of 18 euchromosomes of pig and X chromosome, pig 1,2,6, there is QTL (the Dirk J.de Koning that influences carcass traits such as the thickness of backfat on No. 7 karyomit(e)s, Luc L.G.Janss, Annemieke P.Rattink, Pieter A.M.van Oers et al., 1999, Detection of quantitative trait loci for backfat thinkness and intramuscularfat content in pigs (sus scrofa) .Genetics, 152:1679-1690).People's such as Andersson studies show that in addition, on No. 4 karyomit(e)s, also there is QTL (the Andersson L. that influences fatty deposits, C.S.Haley, H.Ellegren, S.A.Knott, M.Johansson et al., 1994, Genetic mappingof quantitative trait loci for growth and fatness in pigs.Science 263:1771-1774).

Some impressive progresses have been obtained although influence the research of the candidate gene of label of pig fat deposition description performance, but still exist not enough: the important economical trait of (1) pig is quantitative character normally, the physiological and biochemical procedure that relates to is quite complicated, even same quantitative character, although disclosed its 1-2 controlled gene, still had other new gene to remain to be discovered with big effect.(2) utilize mark to carry out the areal distribution situation that full genome scanning also can only reflect the gene of some effects proterties, can not find out all QTLs of a certain quantitative character of influence, and also do not reach at present and utilize QTL to carry out the position clone, to obtain the requirement of goal gene.(3) research of at present relevant quantitative character gene is to select for use single candidate gene to analyze basically, has ignored intergenic interaction.One of content of modern molecular breeding is the genome breeding, promptly according to the gene of individual ownership proterties and genotypic weave construction and functional effect carries out integral body or full genome is selected, apolegamy, protect kind and Heterosis Analysis utilization etc., its basis is that complete highdensity gene map is arranged, and fully understand the weave construction, function, expression regulation mechanism of all genes and related with proterties, yet the gene and the mark of hereditary location and physical positioning are still very limited in pig at present, and the work of this respect also needs further reinforcement.(4) it is comprehensive inadequately to seek the method with important physiological function gene, detects the limited amount of gene, and efficient is not high, needs innovation, further seeks with the work of pig important economical trait relative new gene extremely urgent.

Related between allelotrope and proterties can be found out manyly has related molecule marker with this proterties, thereby provides theoretical foundation for marker assisted selection (MAS) and even molecular breeding.Therefore current various countries' improvement of breed scholar comprises that the human diseases investigator thirsts for finding by this brief and effective means the molecular genetic marker in " world of putting and all accurate ".The carcass trait of pig can be directly except that the thickness of backfat be measured on live body in addition, other index as: dressing percentage, leg stern meat bone rate, lactones rate, eye muscle area etc. all need be measured butchering the back, thereby have postponed the seed selection progress.Molecular genetic marker then may overcome this shortcoming and earlier boar be selected, and therefore suitable genetic marker is accelerated genetic progress, and realized that finally molecular breeding is extremely important for carrying out marker assisted selection.In addition, the polymorphism of research mutational site in colony, and carry out the strong means that the proterties association analysis is the research gene function.In colony, seek the gene relevant, carry out the important and difficult task of of the molecular breeding person that is the breeding work all the time with the pig important economical trait by the proterties association analysis.

People's PNAS-4 gene is positioned at people's No. 1 karyomit(e) 1q44, genome total length 56, and 098bp, encoding one contains 194 amino acid whose albumen, belongs to the UPF0326 protein family.There is the unknown function structural domain DUF862 that eukaryote all has through this protein sequence of BlastP (NCBI ConservedDomain Search) analysis revealed.In GenBank, with apoptosis-related (the GenBank number of including: AF229834), and mention also that in some documents this gene may be relevant with apoptosis or disease of this gene is described mostly.For example, for detect when the human body long-term exposure in the phenol environment in its peripheral blood lymphocytes during the expression of gene situation, Forrest and colleague thereof discover by gene chip and real-time PCR method, the PNAS-4 gene is presented mileometer adjustment and is reached (Forrest M S etc., Discovery of novel biomarkers by microarray analysisof peripheral blood mononuclear cell gene expression in benzene-exposedworkers.Environ Health Perspect, 2005,113:801-807.).The same year, Cobbe etc. are in research human diseases generating process during the expression of gene situation, carry out genome scanning and discovery by Microarray Technique on T lymphocyte and white corpuscle, CGI-146 percentage composition in the T lymphocyte is than total white corpuscle height (Cobb J P etc., Application of genome-wide expression analysis to human healthand disease.Proc Natl Acad Sci U S A 2005,102:4801-4806.), and similar to PNAS-1 (apoptosis-related) gene.There is the investigator to find that PNAS-4 is the target gene of cancer suppressor gene p53 in addition, and relation conefficient is up to 0.85 (Daniel S.B., 2006, Modelling the p53Gene Regulatory Network, Ph.D.Dissertation, University of London).

Summary of the invention

The purpose of this invention is to provide a kind of label of pig fat deposition description associated protein and encoding gene and application.

Label of pig fat deposition description associated protein provided by the present invention, name is called CGI-146, derives from pig, is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have disease-resistant correlation function by (a) deutero-protein.

In order to make CGI-146 in (a) be secreted in cell pericentral siphon or the substratum or to make its function-stable, proteinic N end that can the amino acid residue sequence of sequence 1 is formed in by sequence table connects signal peptide sequence, for the CGI-146 in (a) is convenient to purifying, proteinic N end or C end that can the amino acid residue sequence of sequence 1 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1. label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	11	EQKLISEEDL

Above-mentioned (b) but in the CGI-146 synthetic, also can synthesize its encoding gene earlier, carry out biology according to following method again and express and to obtain.The encoding gene of CGI-146 in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna of sequence in the sequence table 2 or sequence 3, and/or carry out the missense mutation of one or several base pair, and/or at the encoding sequence of its 5 ' end attach signal peptide, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Wherein, the sequence in the sequence table 1 is made up of 194 amino-acid residues.

The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation are meant replacement and/or the disappearance and/or the interpolation of no more than ten amino-acid residues.

The encoding gene of above-mentioned label of pig fat deposition description associated protein (pig PNAS-4) also belongs to protection scope of the present invention.

The encoding gene of above-mentioned label of pig fat deposition description associated protein comprises second intron sequences of the genomic gene of the cDNA gene of label of pig fat deposition description associated protein and label of pig fat deposition description associated protein.Second intron sequences of its genomic gene has one of following nucleotide sequence:

1) the 74-3097 position Nucleotide from 5 ' end of sequence 3 in the sequence table;

2) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the sequence 3 74-3097 position Nucleotide in the sequence table.

Second exon of the genomic gene of label of pig fat deposition description associated protein has one of following nucleotide sequence:

1) the 1-73 position Nucleotide of 5 of the sequence in sequence table 3 ' end;

2) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the sequence 3 1-73 position Nucleotide in the sequence table.

The 3rd exon of the genomic gene of label of pig fat deposition description associated protein have following nucleotide sequence it:

1) the 3098-3191 position Nucleotide of 5 of the sequence in sequence table 3 ' end;

2) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with the 3098-3191 position Nucleotide of 5 of sequence 3 in the sequence table ' end.

Sequence 3 in the sequence table is made up of 3191 deoxynucleotides, and wherein, the 1407th at 5 of sequence 3 ' end is a polymorphic site in sequence table, and the 1407th at 5 of sequence 3 ' end is T or C in the sequence table.

Its cDNA gene can have one of following nucleotide sequence:

1) polynucleotide of sequence 2 in the sequence table;

2) DNA of sequence 1 protein sequence in the code sequence tabulation;

3) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with sequence in the sequence table 2.

The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.

Sequence 2 in the sequence table is made up of 4059 deoxynucleotides, classify 5 ' non-translational region (UTR) as from 5 ' end 1-168 position nucleotides sequence, classify 3 ' UTR as from 5 ' end 754-4059 position nucleotides sequence, nucleotides sequence from 5 ' end 821-826bp and 2307-2312bp place is classified the AATAAA tailing signal as, classifies the PolyA tail as from the nucleotides sequence at 5 ' end 4038-4059bp place.The 1812nd of sequence 2 the Nucleotide is pleomorphism site in sequence table, is A or C.

The recombinant vectors, transgenic cell line and the host bacterium that contain above-mentioned label of pig fat deposition description associated protein encoding gene all belong to protection scope of the present invention.

Second purpose of the present invention provides a kind of method that detects the label of pig fat deposition description proterties.

A kind of method that detects the label of pig fat deposition description proterties provided by the present invention, be detect the 1407th Nucleotide of 5 ' end of sequence 3 in sequence table or in sequence table the 212nd Nucleotide of 5 ' end of sequence 4 be C or T, perhaps detect 5 of in sequence table sequence 2 ' the 1812nd Nucleotide of end or in sequence table the 181st Nucleotide of 5 ' end of sequence 5 be C or A, determine the genotype of pig, determine the fatty deposits proterties by genotype then.

If in sequence table 5 of sequence 3 ' the 1407th Nucleotide of end or when the 212nd Nucleotide of 5 ' end of sequence 4 was C in sequence table, its homozygotic genotype was BB; In sequence table 5 of sequence 3 ' the 1407th Nucleotide of end or when the 212nd Nucleotide of 5 ' end of sequence 4 was T in sequence table, its homozygotic genotype was AA; Their heterozygote genotype is AB; If in sequence table 5 of sequence 2 ' the 1812nd Nucleotide of end or when the 181st Nucleotide of 5 ' end of sequence 5 was C in sequence table, its homozygotic genotype was BB; In sequence table 5 of sequence 2 ' the 1812nd Nucleotide of end or when the 181st Nucleotide of 5 ' end of sequence 5 was A in sequence table, its homozygotic genotype was AA; Their heterozygote genotype is AB.

In the described method, the 1407th Nucleotide of 5 ' end of described detection sequence 3 in sequence table or in sequence table the 212nd Nucleotide of 5 ' end of sequence 4 be that C still is that the method for T comprises that first pcr amplification contains the genomic fragment of the 1407th Nucleotide of 5 ' end of sequence 3 in sequence table, then amplified production is checked order or cuts amplified production with Sty I enzyme; The 1812nd Nucleotide of 5 ' end of described detection sequence 2 in sequence table or in sequence table the 181st Nucleotide of 5 ' end of sequence 5 be that C still is that the method for A comprises that first pcr amplification contains the genomic fragment of the 181st Nucleotide of 5 ' end of sequence 5 in sequence table, then amplified production is checked order or cuts amplified production with Msp I enzyme.

The described genomic fragment pcr amplification product that contains the 1407th Nucleotide of 5 ' end (T/C) of sequence 3 in sequence table can be the nucleotide fragments of sequence 4 described 762bp in sequence table; The StyI enzyme is cut described 762bpPCR amplified production, if obtain fragment of 762bp, its genotype is the AA homozygote; When if obtain 550bp and two fragments of 212bp, its genotype is the BB homozygote; If obtain 550bp, 212bp and three fragments of 762bp, its genotype is the AB heterozygote.

The described genomic fragment pcr amplification product that contains the 181st Nucleotide of 5 ' end (A/C) of sequence 5 in sequence table can be the nucleotide fragments of sequence 5 described 789bp in sequence table; The MspI enzyme is cut described 789bp pcr amplification product, if obtain the single fragment of 789bp, its genotype is the AA homozygote; If obtain 789bp, during three endonuclease bamhis of 608bp and 181bp, its genotype is the AB heterozygote; If when obtaining 608bp and two fragments of 181bp, genotype is the BB homozygote.

By to Tongcheng colony (the local purebred pig in Tongcheng, greatly enhance logical, grow up logical) the fatty deposits performance of each genotype colony assesses: the result shows that genotype be the leaf fat rate of colony of BB and lactones rate with genotype is to have significant difference (P＜0.05) between the individuality of AB or AA, and individual fatty deposits ability will be higher than afterwards both.Genotype is the individuality of BB in addition, and its 6-7 intercostal thickness of backfat is the individuality (P＜0.05) of AB greater than genotype significantly also.

When the fatty deposits performance of the purebred Large White of different genotype was assessed, genotype was that the individual average thickness of backfat and the genotype of AA is that the individuality of AB exists remarkable (P＜0.05) or even utmost point significant difference (P＜0.01).

In sum, label of pig fat deposition description associated protein of the present invention and encoding gene thereof can be used for detecting the carcass trait of the reflection fatty deposits abilities such as leaf fat rate, lactones rate, the 6-7 intercostal thickness of backfat and the average thickness of backfat of pig, thereby, and will in the breeding of pig, play a significant role for the molecular breeding of pig provides a new genetic marker.

Description of drawings

Fig. 1 is the schema of label of pig fat deposition description genes involved of the present invention (pig PNAS-4 gene) preparation and location and polymorphism analysis

Fig. 2 is label of pig fat deposition description genes involved (pig PNAS-4 gene) cDNA sequence and aminoacid sequence among the present invention

Fig. 3 is label of pig fat deposition description genes involved (pig PNAS-4 gene) partial dna sequence among the present invention, and respectively with capitalization and lowercase statement exon and intron zone, StyI-RFLP detects the primer and annotates with the square frame table among the figure.

Fig. 4 is three kinds of genotype (AA, AB, BB) electrophoresis result of pig PNAS-4 gene the 2nd intron StyI-RFLP among the present invention.

Fig. 5 is three kinds of genotype (AA, AB, BB) electrophoresis result of the MspI-RFLP of pig PNAS-4 gene 3 ' UTR among the present invention.M:DNA molecular weight standard (100-3000bp ladder)

Embodiment

The experimental technique of mentioning among the following embodiment is ordinary method if no special instructions.

The schema of label of pig fat deposition description genes involved of the present invention (pig PNAS-4 gene) preparation and location and polymorphism analysis as shown in Figure 1, concrete grammar is as described in the following embodiment.

The acquisition of embodiment 1, label of pig fat deposition description associated protein (CGI-146) and full-length cDNA gene thereof and genomic gene (pig PNAS-4 gene)

1, label of pig fat deposition description associated protein full-length cDNA gene obtains

Extract 55 days total RNA of embryo's skeletal muscle of Large White, after, Proteinase K synthetic and SfiI digestion and the cDNA fractional separation, with cDNA and the pBluescript II SK that obtains through purifying, the cDNA of mRNA ⁺Carrier connects, thereby makes up pig fetal skeletal muscle cDNA library (Zhu Zhengmao, Ph D dissertation, Hua Zhong Agriculture University, 2003).Picking clone carries out the commerce order-checking at random, the result who is obtained checking order is through (the NCBI of American National biotechnology information center, National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/BLAST/) Non-redundant data storehouse (nr) retrieves and obtains corresponding sequence bioinformation.And a pairing gene of clone subsequence is wherein arranged is pig PNAS-4 gene, and this sequence has the partial nucleotide sequence of SEQ ID No.2 in the sequence table.And with cDNA (the GenBank number of including: NM_016076) be the information probe of this sequence and people's homologous gene PNAS-4, utilize the BLAST instrument among the NCBI in GenBank pig est database, to do the homologous sequence screening, obtain a series of homologys and be the ESTs (fragment length is greater than 100bp) more than 80%, the number of including of these ESTs is inquired about corresponding sequence with ENTREZ (http://www.ncbi.nlm.nih.gov/Web/Search/index.html) in NCBI, use the EST contig of the Seqman program construction pig among the software DNAStar then, thereby obtain cDNA sequence except that 5 ' UTR.

With pig EST splicing sequence is the nested primer of stencil design 5 ' RACE, splicing pig PNAS-4 full length gene cDNA sequence, and concrete grammar is as described below:

1) the first chain cDNA's is synthetic: utilize TRIzoL test kit (American I nvitrogen company) to extract total RNA from the fragrant pig skeletal muscle tissue of growing up, concrete operations are carried out according to the test kit specification sheets.Total RNA is dissolved in the ultrapure water that the RACE test kit provides, and measures its concentration value with NanoDrop ND-1000 denier nucleic acid protein concentration determination instrument, and passes through its integrity of formaldehyde gel electrophoresis detection of 1.2%.Be template with the total RNA that is up to the standards then, synthetic cDNA first chain, concrete steps are: the reaction cumulative volume is 50 μ L, at first with total RNA of 10ul (2 μ g) and 5 μ L oligo d (T) ₁₁(1 μ mol/L) is mixed in the Ependorff pipe, and 70 ℃ of incubation 5min to be to remove the secondary structure of RNA, places cooled on ice avoiding regenerating of secondary structure immediately, through of short duration centrifugal after, add 20 μ L DEPC H ₂O, 10 μ L, 5 * PCR buffer, 500 μ mol/L dNTP, 40U RNAsin, 300UM-MLV rises to 95 ℃ of deactivation ThermoScript II with temperature behind 37 ℃ of incubation 1h, place-20 ℃ of preservations standby.

2) splicing of 5 ' RACE amplification and pig PNAS-4 full length gene cDNA sequence:

The first chain cDNA with above-mentioned acquisition is a template, with pig EST splicing sequence is that nested primer P4-5:5 ' GGAAGGGTATGCAGGAGCTGAAGTAGGC 3 ' and the P4-5N:5 ' AGGTGTACTCGTTCATCCAG 3 ' of stencil design 5 ' RACE is primer, carries out pcr amplification.The PCR reaction system is: the reaction cumulative volume is 20 μ L, dd H ₂O 13.2 μ L, 10 * PCR buffer, 2 μ L 10 *, MgCl ₂1.5mmol/L, primer 10 μ mol/L, dNTP 10mmol/L, TaqDNA polysaccharase 0.2 μ L (1U), cDNA 1 μ L (200ng).The pcr amplification program is 94 ℃ of 3min, 94 ℃ of 30s, and 58 ℃ of annealing 45s, 72 ℃ of 1min circulate 35 times, and last 72 ℃ are extended 5min.The PCR reaction product detects with 1.5% agarose gel electrophoresis.The result is indicated as the non-specific PCR product of PCR product.The PCR product gel is reclaimed the order-checking of purifying rear clone, and sequencing result shows that 5 ' RACE product length is 255bp.The above-mentioned EST contig that obtains and this RACE amplified production sequence are spliced with the Seqman program among the DNAStar, the cDNA integration sequence that to obtain a length be 4059bp, be the nucleotide sequence of sequence 2 in the sequence table, this sequence is label of pig fat deposition description associated protein full-length cDNA gene order of the present invention.

In order to verify that the cDNA that splicing obtains is a pig PNAS-4 full length gene cDNA sequence, design a pair of primer P4L ₂: 5 ' CTCCAAAGTCACACGCTCAGAAC 3 ' and P4R ₂: it is template that 5 ' ATAGTCCTACCCCACGAAGAAGC 3 ' extracts total RNA reverse transcription synthetic cDNA with the skeletal muscle tissue of above-mentioned acquisition, carries out pcr amplification, sequence verification.The PCR reaction system is: the reaction cumulative volume is 20 μ L, dd H ₂O 13.2 μ L, 10 * PCR buffer, 2 μ L10 *, MgCl ₂1.5mmol/L, primer 10 μ mol/L, dNTP 10mmol/L, TaqDNA polysaccharase 0.2 μ L (1U), the first chain cDNA, 1 μ L (200ng).The pcr amplification program is 94 ℃ of 3min, 94 ℃ of 30s, and 62 ℃ of annealing 45s, 72 ℃ of 1min circulate 35 times, and last 72 ℃ are extended 5min.Amplified production carries out agarose electrophoresis to be separated, and carries out purifying, clone and the order-checking of pcr amplification product then according to following method, and the result has obtained the fragment of 863bp, has in the sequence table sequence 2 from 5 ' end 758-1620 position Nucleotide.This section cDNA label of pig fat deposition description genes involved sequence is carried out homology with people PNAS-4 gene in GenBank detect, homology reaches 93% as a result, thereby confirmed to have obtained cDNA full length sequence (Fig. 2 of pig PNAS-4 gene by above-mentioned experiment, initiator codon and terminator codon mark with underscore among Fig. 2, tailing signal marks with double underline, the amino acid of deriving with one-letter symbol write on codon below, MspI-RFLP detects the primer and marks with square frame).

Obtain after the cDNA full length sequence of pig PNAS-4 gene, utilize open reading frame lookup tool ORF Finder (http://www.ncbi.nih.gov/gorf/gorf.html) to seek the open reading frame of this gene, the open reading frame of cDNA full length sequence that shows the PNAS-4 gene of this pig is 5 of sequence 2 in sequence table ' end 169-753 position Nucleotide, the amino acid residue sequence (pork fat associated protein (CGI-146) sequence) of sequence 1 in the code sequence tabulation, classify 5 ' non-translational region (UTR) as from 5 ' end 1-168 position nucleotides sequence, classify 3 ' UTR as from 5 ' end 754-4059 position nucleotides sequence, nucleotides sequence from 5 ' end 821-826bp and 2307-2312bp place is classified the AATAAA tailing signal as, classifies the PolyA tail as from the nucleotides sequence at 5 ' end 4038-4059bp place.The 1812nd of sequence 2 the Nucleotide is pleomorphism site in sequence table, is A or C.

2, the acquisition of pig PNAS-4 Gene Partial genome sequence

With the people C1orf121 genomic dna of pig PNAS-4 dna homolog (the GenBank number of including: NC_000001) be about 55.96kb, have 5 exons, 4 introns, wherein second intron is about 2.58kb.This gene cDNA full length sequence of pig is compared with it, find that this gene of pig also has 5 exons, so according to the cDNA sequences Design primer P4L of SEQ ID NO:2 in the sequence table ₃/ P4R ₃, and lay respectively at second exon and the 3rd exon of this gene, its primer sequence is as follows:

P4L ₃5 '-TGAACGAGTACACCTCATCCATC-3 ' (shown in sequence in the sequence table 12)

P4R ₃5 '-TCTCCTAGTTCAGAAGCATTTCCT-3 ' (shown in sequence in the sequence table 13)

Genomic dna with the Wuzhi Mountain pig of Institute of Animal Husbandry, China Academy of Agriculture Scinces is a template then, and according to homogenic second intron length (2.58kb) design of this of people response procedures, carry out pcr amplification: reaction system: 2.0 μ L10 * Buffer, 1.6 μ LMgCl ₂(2.5mmol/L), 1 μ L Former primer (10 μ mol/L), 1 μ L Reverse primer (10 μ mol/L), 0.4 μ LdNTPs (10mmol/L), 0.2 μ L Taqase, 1 μ L dna profiling, ddH ₂O is settled to 20 μ L.The pcr amplification program: 95 ℃ of 3min, 30 circulations (94 ℃ of 30s, 62.5 ℃ of 50s, 72 ℃ of 3min) are extended 3min at 72 ℃ at last.Amplified production is identified through 1.5% agarose gel electrophoresis.

Obtain the sequence of a long 3169bp at last, order-checking shows the nucleotide sequence (Fig. 3 with sequence 3 in the sequence table, explain exon and intron zone with capitalization and lowercase respectively among the figure, StyI-RFLP detects the primer and annotates with the square frame table), this sequence comprises encoding gene PNAS-4 second intron sequences of label of pig fat deposition description associated protein CGI-146 of the present invention.Sequence 3 is second exon of this genomic gene from the 1-73 position Nucleotide of 5 ' end in the sequence table, from 5 ' the 3098-3191 position Nucleotide of end be the 3rd exon of this genomic gene, from 5 ' the 74-3097 position Nucleotide held is second intron of this genomic gene.

Wherein, the 1407th at 5 of sequence 3 ' end is a polymorphic site in sequence table, and the 1407th at 5 of sequence 3 ' end is T or C in the sequence table.

Embodiment 2, the physical positioning of pig PNAS-4 gene:

1, is used for the acquisition of the experiment material of physical positioning

With pig * rodents somatic cell hybrid plate (Pig * rodent somatic cell hybrid panel, SCHP) carry out the chromosomal region location, with common pig radiation hybrid panel (the INRA-Minnesota porcine radiation hybrid panel that makes up of U.S. Minnesota university, IMpRH) carrying out karyomit(e) accurately locatees, the preparation methods of the two cover somatic cell hybrid plates document (Yerle etc. that see reference, A somatic cell hybridpanel for pig regional gene mapping characterized by molecular cytogenetics.Cytogenet Cell Genet.1996,73:194-202; Yerle etc., Construction of awhole-genome radiation hybrid panel for high-resolution gene mapping in pigs.Cytogenet Cell Genet.1998,82:182-188).

Wherein SCHP comprises 27 individual cells hybrid cells system, 1-19 number is pig * hamster somatic cell hybrid clone, 20-27 number is pig * mouse somatic cell hybrid clone, and with hamster, mouse and pig genomic dna as positive control (Yerle etc., A somatic cell hybrid panel for pig regional gene mappingcharacterized by molecular cytogenetics.Cytogenet Cell Genet.1996,73:194-202).Identify that through cytogenetics this hybrid plate has kept whole 18 euchromosomes and the X chromosome except that Y chromosome of pig, wherein contain 127 non-overlapped chromosomal regions, pig karyomit(e) that is comprised in each clone and chromosome segment information can obtain from Web (http://www.toulouse.inra.fr/lgc/lgc.html/).

The radiation dose that IMpRH uses is 7,000-rad.IMpRH comprises 118 pigs * hamster radiation hybrid cell line, and hamster and pig genomic dna positive control, qualification result with 757 marks shows that the average mark rate of retaining among the IMpRH is 29: 3%, include 128 linkage groups, 18 pairs of euchromosomes and X chromosome have been covered, be used to estimate that the kb/cR ratio of distance between mark is～70kb/cR (1Ray=100cR) that theoretical resolution is 145kb.

2, the locating effect of pig PNAS-4 gene

Be template with the DNA in SCHP and the IMpRH clone plate respectively, carry out pcr amplification reaction, primer is P4L ₁5 '-TGGCAGAGCGGTCGTCACTTAGGC-3 ' (sequence table sequence 6) P4R ₁5 '-GAGCAGAATCTCCTCCCACGCACCAT-3 ' (sequence table sequence 7), carrying out amplification PCR reaction cumulative volume is 15 μ L, wherein template DNA is 20ng, contains 1 * buffer (Promega), 1.5mmol/L MgCl ₂, the dNTP final concentration is 150 μ mol/L, the primer final concentration is 10 μ mol/L, 1U Taq archaeal dna polymerase (Promega).The pcr amplification program is: 94 ℃ of 3min, and the 94 ℃ of 30s that circulate 35 times, 61 ℃ of 30s, 72 ℃ of 30s then, last 72 ℃ are extended 5min.The PCR reaction product detects with 1.5% agarose gel electrophoresis.

Somatotype result in SCHP shows with PNAS-4 location primer, in 19 pig * Chinese hamster somatic cell hybrid clones (1-19 number), 1,3,7,8,10,11,18,19 the purpose fragment of the 817bp consistent with the amplification of pig genomic dna positive control occurs, and in 8 pigs * mouse somatic cell hybrid clone (20-27 number), 20 and No. 21 hybrid cell systems also increase and obtain the purpose fragment of 817bp.The PCR somatotype data of above-mentioned actual observation are submitted to HybWeb (http://www.toulouse.inra.fr/lgc/pig/pcr/pcr.htm) carry out statistical study to obtain zone location information, the data analysis result is that the PNAS-4 assignment of genes gene mapping is on No. 10 karyomit(e)s of pig (P=1.0), further the zone location result is SSC10 p11-16 (P=0.9998, and the relation conefficient between this zone marker is 0.8575, P＜0.1%).

Be 0,000,010,000 0,110,000,100 00,000,001,010,000,000,001 0,000,000,000 1,000,101,010 1,000,000,010 0,000,000,000 00,000,000,110,000,001,110 0,011,001,110 00010111 in the somatotype result of IMpRH (wherein 0 and 1 explain respectively amplification negative and positive) with PNAS-4 location primer.Statistic analysis result, the SW497 mark close linkage on No. 10 karyomit(e)s of PNAS-4 gene and pig, the LOD value is 13.69, the RH map distance is 0.28Ray.Confirm that further this gene is positioned on No. 10 karyomit(e)s of pig.

The single nucleotide polymorphism of the partial dna sequence of embodiment 3, pig PNAS-4 and RFLP polymorphism detect

1. the single nucleotide polymorphism of the partial dna sequence of pig PNAS-4 detects

1) single nucleotide polymorphism of pig PNAS-4 gene distributes

In order to reflect the single nucleotide polymorphism of pig PNAS-4 gene more preparatively, select for use in this experiment at a distance of two mutational sites of 20kb and detect.

The DNA sample that is used for the gene pleiomorphism detection sees Table 2 from 7 swinerys.It is standby in-20 ℃ of preservations to adopt ordinary method to extract behind its genomic dna.

Colony and sample number that table 2, SNPs detect

Breed combination	Sample number	Type	Product is sold unit
				Wuzhi Mountain pig Wuzhishan	43	The inbred lines miniature pig	Institute of Animal Husbandry, China Academy of Agriculture Scinces
Fragrant pig Xiang	42	The inbred lines miniature pig	Guizhou city farms producing good poultry and animal strains
				The fragrant pig Bamaxiangpig of crust horse	45	The inbred lines miniature pig	The center is bred in Guangxi University's fragrant pig inbreeding of crust horse
Greatly enhance logical LW * (LD * T)	35	Ternary hybrid	Tongcheng County, Hubei bureau of animal husbandry
				Logical LD * (LW * T) grows up	44	Ternary hybrid	Tongcheng County, Hubei bureau of animal husbandry
Tongcheng pig Tongcheng	44	Local purebred	Tongcheng County, Hubei bureau of animal husbandry
				Large White (Holland) Large White (Netherlands)	201	Da Bai is purebred	Holland's animal science and health institute

Annotate: LD=Landrace, LW=Larege White, T=Tongcheng

Genome with the described material of table 2 is a template, utilizes following primer amplification pig PNAS-4 Gene Partial sequence, and order-checking detects the single nucleotide polymorphism of pig PNAS-4 gene.

1. the dna sequence dna of StyI-RFLP primer (Fig. 3, StyI-RFLP detect the primer and annotate with the square frame table):

P4L ₄: 5 '-CTAGAACCACTCAAACCAAGCAGC-3 ' (sequence 8 in the sequence table)

P4R ₅: 5 '-ATCAGGCAGGTAAAAGGATAACGG-3 ' (sequence 9 in the sequence table)

This primer amplification fragment length is 762bp, is arranged in second intron, promptly holds the nucleotide fragments at 1196-1957bp place from 5 ' of sequence in the sequence 3 in the sequence table, also is the sequence 4 in the sequence table.

The sequencing results shows that in the dna fragmentation of this 762bp the 212nd Nucleotide of end of 5 ' in the sequence 4 in sequence table (the 1407th of sequence 3 the Nucleotide in the sequence table) locates to exist the sudden change of T-C.When the 212nd Nucleotide of the end of 5 ' in the sequence in the sequence table 4 is T, this gene is assumed to by A allelotrope and controls, when the 212nd Nucleotide of the end of 5 ' in the sequence in the sequence table 4 is C, this gene is assumed to by B allelotrope and controls, these two allelotrope can be formed three kinds of genotype: pure and mild body AA, AB, assorted and body BB.

When the 212nd Nucleotide place of the end of 5 ' in the sequence in the sequence table 4 is C, there is 1 StyI restriction enzyme site (C ↓ CWWGG), therefore above-mentioned amplified fragments is cut with the StyI enzyme and identified its genotype.When genotype was AA, amplified fragments had only fragment of 762bp after the StyI enzyme is cut; When genotype was BB, amplified fragments was two fragments of 550bp, 212bp after the StyI enzyme is cut; When genotype was AB, amplified fragments was 550bp, 212bp, three fragments of 762bp after the StyI enzyme is cut; Three kinds of genotypic enzymes are cut and are identified gel electrophoresis figure as shown in Figure 4, M:DNA molecular weight standard among Fig. 4 (100-1500bp ladder).

2. the dna sequence dna of MspI-RFLP primer (Fig. 2, MspI-RFLP detects the primer and marks with square frame among Fig. 2):

P4L ₅: 5 '-GCCTTCTGAGTAGCAGTATGAGTTG-3 ' (sequence 10 in the sequence table)

P4R ₅5 '-CCTGCGAGAACTGAGAATAATCC-3 ' (sequence 11 in the sequence table)

This primer amplification fragment length 789bp is positioned at the 3 ' UTR (3 ' non-translational region) of pig PNAS-4 gene, promptly in the sequence in the sequence table 2 from the nucleotide fragments at 5 ' end 1632-2420bp place of sequence, also be the sequence 5 in the sequence table.

The sequencing results shows in the dna fragmentation of this 789bp, locates to exist the sudden change of A-C in sequence table sequence 5 from 5 ' end the 181st (the 1812nd of sequence 2 the Nucleotide in sequence table).When in the sequence in the sequence table 5 from the 181st Nucleotide of 5 ' end when being A, this gene is assumed to by A allelotrope and controls, when in the sequence in the sequence table 5 from the 181st Nucleotide of 5 ' end when being C, this gene is assumed to by B allelotrope and controls, these two allelotrope can be formed three kinds of genotype: pure and mild body AA, AB, assorted and body BB.

Promptly when the 181st Nucleotide of the end of 5 ' in the sequence in the sequence table 5 is C, there is 1 MspI restriction enzyme site (C ↓ CGG), therefore above-mentioned amplified fragments is cut with the MspI enzyme and identified its genotype.When genotype was AA, amplified fragments had only fragment of 789bp after the MspI enzyme is cut; When genotype was BB, amplified fragments was two fragments of 608bp, 181bp after the MspI enzyme is cut; When genotype was AB, amplified fragments was 789bp, 608bp, three fragments of 181bp bp after the MspI enzyme is cut; Three kinds of genotypic enzymes are cut and are identified gel electrophoresis figure M:DNA molecular weight standard (100-3000bp ladder) among Fig. 5 as shown in Figure 5.

Wherein, the PCR of above-mentioned two kinds of pcr amplifications reaction cumulative volume 20 μ L, wherein the about 100ng of pig genomic dna contains 1 * buffer (Promega), 1: 5mmol/L MgCl ₂, the dNTP final concentration is 150 μ mol/L, the primer final concentration is 0:2 μ mol/L, 2U Taq archaeal dna polymerase (Promega).The pcr amplification program is: 94 ℃ of 4min, and the 94 ℃ of 45s that circulate 5 times, 62 ℃ of 45s, 72 ℃ of 1min, and then the 94 ℃ of 45s that circulate 30 times, 57 ℃ of 45s, 72 ℃ of 1min, last 72 ℃ are extended 5min.The PCR reaction product detects with 2% agarose gel electrophoresis and takes pictures.

Above-mentioned two kinds of PCR product endonuclease reaction volumes are 15 μ L, 1 * buffer, 1.5 μ L wherein, and PCR product 3-5 μ L, restriction enzyme is 0.5 μ L (5U), uses H ₂O supplies 15 μ L, and with centrifugal behind the sample mixing, 37 ℃ of water-bath 4h detect enzyme with 1.5% agarose gel electrophoresis and cut the result, and the record genotype is taken pictures under ultraviolet lamp.

In 7 swinerys analyzing, utilize two pairs of primers at different mutational sites (in sequence table the 1407th of sequence 3 the Nucleotide and in sequence table the 1812nd Nucleotide of sequence 2), detect by above-mentioned PCR-RFLP, the genotype in these two mutational sites and gene frequency statistics are as shown in table 3.The result shows, for these two mutational sites, in 7 pig varieties that detected, place of china swinery (the fragrant pig of Wuzhi Mountain pig, Guizhou, the fragrant pig of crust horse, Tongcheng pig) all is that B allelotrope is preponderated, and external swinery (Large White) or to be mixed with external pig blood hybrid swinery (grow up logical, greatly enhance logical) all be that A allelotrope is preponderated.Genotype that it should be noted that StyI-RFLP mutational site (the 1407th of sequence 3 the Nucleotide in sequence table) and MspI-RFLP mutational site (the 1812nd of sequence 2 the Nucleotide in sequence table) in addition the purebred pig in Tongcheng, greatly enhance logical, grow up pass to and Dutch purebred Large White group in have linkage relationship.

Table 3, the distribution of StyI (MspI)-RFLP polymorphism in 7 swinerys

2) T of the distributional difference of single nucleotide polymorphism in different varieties check

Be separated by two polymorphic site StyI-RFLP of 20kb and the distributional difference of gene frequency in different varieties of MspI-RFLP of pig PNAS-4 gene carried out the T check, and the significance of difference the results are shown in Table 4.The result shows between seven swinerys that each leisure detected of these two mutational sites (in sequence table the 1407th of sequence 3 the Nucleotide and in sequence table the 1812nd Nucleotide of sequence 2) and all has distributional difference largely.

Table 4, the test of difference result that StyI (MspI)-the RFLP pleomorphism site distributes in different varieties

Breed combination	Wuzhi Mountain pig	The fragrant pig in Guizhou	The fragrant pig of crust horse	Logical LD * (LW * T) grows up	Greatly enhance logical LW * (LD * T)	Tongcheng pig	Large White
								Wuzhi Mountain pig		4.953 **	3.812 **	8.513 **	10.360 **	3.705 **	15.695 **
The fragrant pig in Guizhou	0.365		1.553	4.522 **	6.797 **	1.684	11.579 **
								The fragrant pig of crust horse	6.398 **	6.106 **		6.012 **	8.152 **	0.146	13.390 **
Logical LD * (LW * T) grows up	2.888 **	3.227 **	8.668 **		2.807 **	6.091 **	5.625 **
								Greatly enhance logical LW * (LD * T)	5.361 **	5.651 **	10.525 **	2.807 **		8.212 **	1.128
Tongcheng pig	1.913	1.539	4.93457 **	4.743 **	7.013 **		13.43 **
								Large White Large White	9.584 **	9.977 **	15.9041 **	5.625 **	1.128	11.931 **

Annotate: shoulder motes * explains P＜0.05; Shoulder motes * * explains P＜0.01.Upper right triangle is the test of significance result of the distributional difference of gene frequency in different varieties of MspI-RFLP (the 1812nd of sequence 2 the Nucleotide in sequence table), and the lower-left triangle is the test of significance result of the distributional difference of StyI-RFLP (the 1407th of sequence 3 the Nucleotide in sequence table) in different varieties.

Mark property association analysis in embodiment 3, Tongcheng swinery body

Tongcheng swinery body material that is used for the proterties association analysis, comprise the local purebred pig in Tongcheng and grow up logical, greatly enhance logically, add up to 156 DNA samples.

At first set up following analytical model to eliminate sex, to make up and butcher batch a influence to phenotypic number:

Y _ijk＝μ+BATCH _i+SEX _j+COMBINATION _k+(BS) _ij+(BC) _ik+(SC) _jk+ε _ijk，

Wherein, Y _IjkBe the character observation value, μ is a population mean, BATCH _iBe a batch effect, SEX _jBe sex effect, COMBINATION _kBe combined effect, (BS) _IjFor batch and sex make effect mutually, (BC) _IkFor batch and combination make effect mutually, (SC) _JkMake effect, ε mutually for sex and combination _IjkBe random error, suppose obey N (0, σ ²) distribute.

Use this model and each proterties analyzed and obtained a new character value, promptly standardized residual values, then with the acquisition residual values as new character value, set up following analytical model again:

Y _ij＝μ+GENOTYPE _i+ε _ij

Y _IjBe new character value, μ is the population mean of new character value, GENOTYPE _iBe genotype effect, ε _IjBe random error, suppose obey N (0, σ ²) distribute.

So far this model systematic error of having eliminated sex, make up and having butchered batch.Using this model just can the genotypic effect of direct analysis, carries out comparing in twos between genotype simultaneously.

Test swinery genotype and economic characters association analysis are that the general linear model program of using in the SPSS software is finished.The MspI-RFLP genotype detection result that we obtain before utilizing, to three swinerys with part economic characters (grow up logical, greatly enhance logical and Tongcheng pig, amount to 156 parts) (there are linkage relationship in StyI-RFLP mutational site and MspI-RFLP mutational site genotype in these three swinerys to have carried out association analysis between genotype and fatty deposits correlated character (leaf fat rate, lactones rate, the 6-7 intercostal thickness of backfat), here select one of them mutational site (MspI-RFLP mutational site, i.e. the 181st of sequence 5 the Nucleotide in sequence table) to analyze).Eliminated kind, butcher batch and sex between difference after, the simple mean of fatty deposits correlated character and standard deviation analytical results are summarized in table 5 between genotype.The result shows, aspect leaf fat rate and lactones rate, all there is significant difference (P＜0.05) in the individuality that 37 genotype are BB (the 181st of sequence 5 the is the pure and mild body of C in sequence table) respectively and between 67 genotype individuality that is AA (the 181st of sequence 5 the Nucleotide is T in sequence table), 52 genotype individuality that is AB (the 181st Nucleotide of sequence 5 is the assorted and body of A and C in sequence table), and wherein there is utmost point significant difference (P＜0.01) in the leaf fat rate value of AA type and BB type.In addition, also there is significant difference (P＜0.05) in the genotypic pig of BB and AB between their the 6-7 intercostal thickness of backfat.Genotype is that the label of pig fat deposition description of AA is few, and fatty deposits correlated character such as leaf fat rate, lactones rate, the 6-7 intercostal thickness of backfat are that BB is much lower than genotype all.

The PNAS-4 gene M spI-RFLP mutational site genotype of table 5, pig and the related branch of Tongcheng colony fatty deposits correlated character

Analyse

Genotype	Number of individuals	The leaf fat rate	The lactones rate	The 6-7 intercostal thickness of backfat
					MspI-RFLP AA AB BB	67 52 37	2.794±1.31 3.259±1.17 5.261±1.44	5.010±2.29 5.928±2.6 933±2.96	3.257±0.93 3.199±0.71 4.262±0.93
P-value AA-AB AA-BB AB-BB		0.847 0.008** 0.017*	0.806 0.012* 0.028*	0.183 0.324 0.039*

Annotate: shoulder motes * explains P＜0.05; Shoulder motes * * explains P＜0.01.

Mark property association analysis among embodiment 4, the Large White group

Detect 209 Large White groups with embodiment 3 described gene diagnosis methods and (be divided into two strains of M and L, all available from Dutch animal science and health institute), analyzed pig PNAS-4 related between place, MspI-RFLP mutational site genotype and weaning weight, 170 age in days body weight and the thickness of backfat, its significance of difference the results are shown in table 8.

In this example, owing to only detect the pig of 1 routine BB type in the L system, when doing association analysis, we ignore the BB type in the L system, only the AA-AB type have been done the T check.The result is as shown in table 6, the result shows, the thickness of backfat of AA (the 181st Nucleotide of sequence 5 is the pure and mild body of A in sequence table) and AB type pig (the 181st Nucleotide of sequence 5 is the assorted and body of A and C in sequence table) is remarkable difference, is consistent with the result who draws previously.

The PNAS-4 gene M spI-RFLP genotype of table 6, pig and the association analysis of Large White colony Part Traits

Genotype	Weaning weight	170 age in days body weight	The average thickness of backfat
				P-value AA-AB	0.365	0.201	0.023*
M strain AA-BB AB-BB	0.347 0.496	0.271 0.306	0.291 0.343
				L strain AA-AB	0.356	0.157	0.007**

Annotate: shoulder motes * explains P＜0.05; Shoulder motes * * explains P＜0.01

Sequence table

<160>13

<210>1

<211>194

<212>PRT

＜213〉wild boar be born in the year of pig (Sus scrofa domestica Brisson)

<400>1

Met Gly Ala Asn Gln Leu Val Val Leu Asn Val Tyr Asp Met Tyr Trp

1 5 10 15

Met Asn Glu Tyr Thr Ser Ser Ile Gly Ile Gly Val Phe His Ser Gly

20 25 30

Ile Glu Val Tyr Gly Arg Glu Phe Ala Tyr Gly Gly Hi s Pro Tyr Pro

35 40 45

Phe Ser Gly Ile Phe Glu Ile Ser Pro Gly Asn Ala Ser Glu Leu Gly

50 55 60

Glu Thr Phe Lys Phe Lys Glu Ala Val Val Leu Gly Ser Thr Asp Phe

65 70 75 80

Leu Glu Asp Asp Ile Glu Lys Ile Val Glu Glu Leu Gly Lys Glu Tyr

85 90 95

Lys Gly Asn Ala Tyr His Leu Met His Lys Asn Cys Asn His Phe Ser

100 105 110

Ser Ala Leu Ser Glu Ile Leu Cys Gly Lys Glu Ile Pro Arg Trp Ile

115 120 125

Asn Arg Leu Ala Tyr Phe Ser Ser Cys Ile Pro Phe Leu Gln Ser Cys

130 135 140

Leu Pro Lys Glu Trp Leu Thr Pro Ala Ala Leu Gln Ser Ser Val Ser

145 150 155 160

Gln Glu Leu Gln Asp Glu Leu Glu Glu Ala Glu Asp Ala Ala Ala Ser

165 170 175

Ala Ser Met Gly Ser Ala Ser Ala Gly Ser Arg Pro Gly Arg His Thr

180 185 190

Lys Leu

<210>2

<211>4059

<212>DNA

＜213〉wild boar be born in the year of pig (Sus scrofa domestica Brisson)

<220>

<221>misc-feature

<222>(1812)

＜223〉n=a or c

<400>2

cccgggagcg gctcggctgc ccgatgcttc cgccccggct gccgcgggcc gggctgtacg 60

cttagtgccc ggctcaggcc ccctgaagcg cccgcggggg tgagagcggc ctccggcccc 120

gcggagacgg agcggcttga ggacgaggcg gcggccgcgg ggaggaggat gggggctaac 180

caattagtgg tgctcaacgt gtacgacatg tactggatga acgagtacac ctcatccatc 240

ggaattggag tttttcattc aggaattgaa gtatatggca gagagtttgc ttatggtggc 300

catccttacc ccttttctgg aatatttgaa atttccccag gaaatgcttc tgaactagga 360

gaaacattta aatttaaaga agctgttgtt ttggggagca ctgacttcct agaagatgat 420

atagaaaaaa ttgtagaaga attgggaaaa gaatacaaag gcaatgccta tcatttgatg 480

cataaaaact gcaatcattt ttcttcggct ttatcagaga ttctttgtgg gaaggagatt 540

cctcgctgga tcaatcgact ggcctacttc agctcctgca tacccttcct ccagagctgc 600

ctcccgaagg agtggctgac tcccgcggcc ctgcagtcca gcgtcagcca ggagctccag 660

gacgaactgg aggaggcaga ggatgcggcg gcctccgcct ccatgggcag cgcttcagca 720

ggctccaggc ctgggcgcca caccaaactc taggggtctc caaagtcaca cgctcagaac 780

tggccctggc agttgactat ccctagagaa aaagtcaaag aataaatgcc ctttggatat 840

tttgtatgca aagatggctc tcccccaaat cccaggtttt cagctcagga ttatatttgt 900

aatcaaaaaa caaaaacaat cacttggcgc aggagggagg actttgtatg aaactgccct 960

ctgttttttt tacccacttg tacacctgga tttcctcctt ctgttttgta caagctctgt 1020

taagttatgt ttacagtatt tcgtatcgct gtttacaaat ctcgcatgga cttcctgcca 1080

ccatgaaaga agaaagcctt cccgtcttca gcagcgaggc caggcctctc tgtgcacttc 1140

cgacagcggc cccagctgcg gcctgagcag taggcccgcg aggaggtgct cacgcactta 1200

gagtcaccac cacctgcctc acggttgtct tttaggcgcg ctggtcttcc ttaacacgtt 1260

ggcaccaggg tgcacagagg tgaaggagca cacgcagccc tgagtccgtg gtccgagtga 1320

gggtggcccc accccaggct gccttcctcc tcgcccaccc ccccaccccg ggcagcacat 1380

ctccggaggt ccccacccag cggttacttt cttcccaaat gtgtgtccac cctctcgagg 1440

tggcacaccc tggtgtctgc caggctttag cgcctctgat gctgtaggta gatgtttttg 1500

gttacagatc ctcttgatag taacggatga tgtttttgca catgggttgg gggggcttcc 1560

tttttatctt aatacgtact gatctccctg cacaggagct tcttcgtggg gtaggactat 1620

cctaagcggt agccttctga gtagcagtat gagttgacat tcaactgctt ttaactattc 1680

aagctacctt ttctactaca ccttgaaaac tagagtcttc aagtaacact ctccagaaag 1740

tcaatacttt gataatgtaa acgttttatg caccatagca gaaagagtat gttggaattg 1800

gttagtttct tncggtagtt tcacctccca atagaaagcc tcgcctcact gacctcttgt 1860

tggaaaatca cacgtacgcg tcttacaggt catcttttcc gttctctcag atgtatgtct 1920

cttacttaac tgactctaag aatgaagctg tcaccacaga tgagtcctca ctagcaggga 1980

gcctgtctgc tcaagtctac tcccagtttg acccttggat gtcagagccc cgtcattaca 2040

tgtcacattc agtgtttctg ccttaagagc gaatgtccta cacagagttt tggatgcagt 2100

gtataaatta tccaaggcag tgacttcagc gttagagata ttgttagctt taaagtcgtc 2160

tacgtttctt taaacgtctt cattgggttg tttgctgctg ttctttgtaa ggacccatat 2220

ccttcagtaa actacatttt ttaacttttc cataagctga ttttgattga tttttatcaa 2280

attaagcaca acctgttcat aggggaaata aactttgggt ttgacctgag gaaaatgaac 2340

ccacttaacc taatttatgc ttttggcggt tttgtttctg gagaggaaag ccttggtgga 2400

ttattctcag ttctcgcagg ggagagtggg ggcaggggac agagcacttg ttttaagaga 2460

tgagagagga aggaatatat catctttacg gcaagttgac ttggttcagg tctaaaaatg 2520

agatttagaa caaaatgcta aaaagactct tgactgactt ggttcactcc aagaagagtc 2580

ttagcaccaa aacccaggtt agtgaaaaaa acgtttgatg aagtttgctt gggttctttt 2640

taaaataatg tggattccag ttttttctaa tccattcaca tgtacatgat tttaaatctg 2700

tgctcctgac gcgcatggca gagcggtcgt cacttaggcg cgtggcgggg gggccccagg 2760

accctcccgc agttctccga gcccagcata caaatgactt tcgtgttact gtgttgtatt 2820

gacgttcatc cgcagcattt agagtttaga aatgacgtta aggaccctgg taaaaagaaa 2880

tagtggccta aggccatgga tcatacagta agataaccat tgttggacat gagattgctc 2940

gcaatcttaa tcccgctcga ggtcgagagc ttaaagtgtc ttttgcttta gaaattcccg 3000

tttaagttag tttgctcatt gcagttcaaa gctgagaagg aattaactaa catttagcca 3060

cctttccctc gcccttagag gaggagaatc tcgctctcag cctgagctct gttaagaaaa 3120

atcctctatc acagatgctg tcattaagat acctgtgaca tgatggcgtc agatgctctc 3180

tttgtggttg taaccaagtg aaacgcgttt ctcatgtggc tgagacagtc ggagagcttt 3240

gagggagtca gaagctcctg gtttctcctc tttgtttttg gggccgttgg gtttgctttt 3300

ggttttgttt tcaaccctaa gaagggggca ccggctttgg aaagcggagc ctgcggagtt 3360

gcaggaggca gcgatgcggt acaggaagcc tccactcgat ccctgaaatc cagccaacgg 3420

ttgctctgac ccacagcaat agcgcaggtt ctcaccacca gcatttgtac agagcaggga 3480

atcctggttt taagccgatg gctagcatgg tgcgtgggag gagattctgc tctatggcag 3540

ctgcaggacc ccacatctac agcctctttc cactgcaaga cggtagaaac acattcactg 3600

cttcagggtt cgaatctgtg tgtcttcttg cggctccatt tctatccagt atgctgtaat 3660

tttgatacat gctgtatttt ctttccgtga ctcagtttaa aaggcttggg ttttttgttc 3720

agcaagctgg ccatcctgcc gctgaatctc cttcccttct gtgaggtttt agagcgcagc 3780

ccagtcatta gactccctct gtctactcag tccacacaca tcttcatcgt ttgcaaggtc 3840

ttacggctgt taaagaatct ttatgaaccc gaagatgatt tctcgtgaag ttgaatgcaa 3900

atgtactgtc attcatagtg tttatattaa aaaaaaaaaa aaataccagg aatcttcact 3960

tttgctacct tgatatagca ttgggctatc atgttaacat tgaaatacat caatttatta 4020

aaaaatactt ttctaagaaa aaaaaaaaaa aaaaaaaaa 4059

<210>3

<211>3191

<212>DNA

＜213〉wild boar be born in the year of pig (Sus scrofa domestica Brisson)

<220>

<221>misc-feature

<222>(1407)

＜223〉n=t or c

<400>3

tactggatga acgagtacac ctcatccatc ggaattggag tttttcattc aggaattgaa 60

gtatatggca gaggtatgtg tacacacagt ctaaatgcat tttctgaaga tttttctcct 120

ttaaaaagag ttgtaaaatc atgaaaacag ctcttcctct tttttttaat gcactttcat 180

gctttattgt agaaagtaga tgaaaatctc cctgtatttg tttatatttg tatttcagaa 240

aaatgcccta aattaaatgt atttggggag agagtactca gagtacatgg gtatgcattg 300

atttggtttt cttttattct aaatactgtc ttaaaaaata ttttcctttt gagattgtta 360

taccatgacc atttcacttt tatatatatt gaccttccta agaaaccttg aacttcaaaa 420

aatagttccc gttgtggctc agcggaaacg aatctgacta gtatccacga ggacgtgggt 480

tcaatccctg gccttgctca gcgggttaag gatccacatt gccgtgagtt gtggtgtagg 540

tcgcagacgt ggctccgatg ctgtggctgt ggtgtaggcc ggcagctgca gttccaattc 600

cacccctagc ttgggaactt ccatatatca caggttcggc cctaaaaaag caaaaaataa 660

aaaataaaaa aaaagtaaag agttcccgtc atggctcagt ggttaacgaa tccgactagg 720

aaccatgagg ttgcaggttc aatccctggc cttgctcagt gggttaagga tccagcgatg 780

ccatgagctg ttgtgtaggt tgcagacacg gctcagatcc cgagttgctg tgtctctggc 840

ataggcctgt ggctacagct ccaattcgac ccctagcctg ggacctccgt atgct gcagg 900

agcagcccaa gaaatggcaa aaaaaaaaag agagagagaa atagtatgat aaaaacaatg 960

gttttggttg gaaaaggatt aatgctagag tgtcaaactt gtaataccaa tttcctgagg 1020

gaatttcagt aataaatttg tttttgtaga cctataagtg catagggata gttttaaaat 1080

atctctgagc aaatcctgcc tttgatgaca tctagctttt tgctcaggat tgatggccct 1140

tgtcattaac tcagcccttt ttattcttta ttacctttca ctatgataag cataactaga 1200

accactcaaa ccaagcagct gtgtttccac aacttttcct ttgttctcat tctctctcag 1260

tacaagataa tctgatcaag ttgtaggtag taatagtctg tgtaaaacag atgacatggc 1320

tcgtttcatc aaggttgtag taatatactc gtttgcatat aaactaccgt atagcaccaa 1380

tgcttctgtc tgcttcagct gggcagnctt ggtggcctct cagcctatgg cattgcacct 1440

tactcccagt tacccctgag gactacatac cagctttggc tgatacaaag aaaaggttca 1500

tttacttgaa tatgttagtg tggtgttttt ctatcccttt ttttataggc tgaattagct 1560

gcttctgggt gcagtgctgt aaagatctac catgttaagt tctgttgtac ttggaagact 1620

gcatctacca aataatcccc caaagcagtg aagttcccgc agaaagtttc agtggttaga 1680

gtattgatat gggtggcttt gctccctgtt tgacttggct tttgccacag ttggcgtata 1740

cattcctttt tacccgaatt tgtatgttgt gttacagttt ttaaaagtac caccaagttt 1800

tgtacgacat gaccatgccg gtctgaggta gatgggagca tttttcagat gaaactgaag 1860

ctcagacctg ctaaaagtgc tactgcgaat aattaacaga actaggacct gacccctagt 1920

gtcatatact aacccgttat ccttttacct gcctgatcat tgttcccatt cagaaaatga 1980

cttaggaata attagaaata tgtttcagaa cagcaaggcc agggccagat acattcctaa 2040

aagtgaattg tttctagaat agaagggcaa gtgggcctac actttccttg ctataattga 2100

gacattaaaa aatctaaata tgatcttgcc atggctatct aaccttatct acaatgtttt 2160

ataaaattct ccattaaaaa tttttaatgt atatttcaga atttaatgct gaacactttc 2220

ttattctaca ttttgcttct ttttctgaaa gatctgaatc agaagtaagg ttagaattgc 2280

cttattcttt cccatgtttt gttctaagac cttaaaagat tacatttaat aaattctaag 2340

tgatgagatt aatttaagca attgtttgga attctttaaa tctactaaga tttgccacct 2400

aaatatctaa gtatctcatg tcagaattgt agccagaaat tttagttcct tcctgatttg 2460

aaaccattct ccatttttgt gctggatgag agtttatatc tgatgagcct ggaaatacat 2520

tcactatagt tctcttctag cttaaagatg tgctgtggag tgtgtgtgtg tgtgttaatt 2580

ttgcagctta tcttttcttg aatgagagga attgaattca gtttttcagg tttgctaatg 2640

tttcactctt acccaaagat aagccaagaa tcttcatccc aggaaccatg aaaactcatg 2700

gttattaaac agtttttcca gtaaagttca agtttgaaat ttggtcattt gaagttagaa 2760

agtggcaaac cactgaagca cccacctact tacttgagca tgatcgataa acacgcggat 2820

ctttgagtgt tagtcactct cctccagcca gaataaataa atatacaaat caggatcacc 2880

tttgagtgtc ttttgttatt agagtttcaa gtctcttaca tcaactattc tattcaagta 2940

gtagaataaa atactaaatg aaatatttgt gaaagcatta aactgaaaaa tatttagatg 3000

gtatcattat tatcctcatc atttattaaa gctaattcag catactggtt aaattttatg 3060

tgataaatac taaaaatcat gagttttctc ttttcagagt ttgcttatgg tggccatcct 3120

tacccctttt ctggaatatt tgaaatttcc ccaggaaatg cttctgaact aggagaaaca 3180

tttaaattta a 3191

<210>4

<211>762

<212>DNA

＜213〉wild boar be born in the year of pig (Sus scrofa domestica Brisson)

<220>

<221>misc-feature

<222>(212)

＜223〉n=t or c

<400>4

ctagaaccac tcaaaccaag cagctgtgtt tccacaactt ttcctttgtt ctcattctct 60

ctcagtacaa gataatctga tcaagttgta ggtagtaata gtctgtgtaa aacagatgac 120

atggctcgtt tcatcaaggt tgtagtaata tactcgtttg catataaact accgtatagc 180

accaatgctt ctgtctgctt cagctgggca gncttggtgg cctctcagyc tatggcattg 240

caccttactc ccagttaccc ctgaggacta cataccagct ttggctgatr caaagaaaag 300

gytcatttac ttgaataygt tagtgtggtg tttttctatc ccttttttta taggctgaat 360

tagctgcttc tgggtgcagt gctgtaaaga tctaccatgt taagttctgt tgtacttgga 420

agactgcatc taccaaataa tcccccaaag cagtgaagtt cccgcagaaa gtttcagtgg 480

ttagagtatt gatatgggtg gctttgctcc ctgtttgact tggcttttgc cacagttggc 540

gtatacattc ctttttaccc gaatttgtat gttgtgttac agtttttaaa agtaccacca 600

agttttgtac gacatgacca tgccggtctg aggtagatgg gagcattttt cagatgaaac 660

tgaagctcag acctgctaaa agtgctactg cgaataatta acagaactag gacctgaccc 720

ctagtgtcat atactaaccc gttatccttt tacctgcctg at 762

<210>5

<211>789

<212>DNA

＜213〉wild boar be born in the year of pig (Sus scrofa domestica Brisson)

<220>

<221>misc-feature

<222>(181)

＜223〉n=a or c

<400>5

gccttctgag tagcagtatg agttgacatt caactgcttt taactattca agctaccttt 60

tctactacac cttgaaaact agagtcttca agtaacactc tccagaaagt caatactttg 120

ataatgtaaa cgttttatgc accatagcag aaagagtatg ttggaattgg ttagtttctt 180

ncggtagttt cacctcccaa tagaaagcct cgcctcactg acctcttgtt ggaaaatcac 240

acgtacgcgt cttacaggtc atcttttccg ttctctcaga tgtatgtctc ttacttaact 300

gactctaaga atgaagctgt caccacagat gagtcctcac tagcagggag cctgtctgct 360

caagtctact cccagtttga cccttggatg tcagagcccc gtcattacat gtcacattca 420

gtgtttctgc cttaagagcg aatgtcctac acagagtttt ggatgcagtg tataaattat 480

ccaaggcagt gacttcagcg ttagagatat tgttagcttt aaagtcgtct acgtttcttt 540

aaacgtcttc attgggttgt ttgctgctgt tctttgtaag gacccatatc cttcagtaaa 600

ctacattttt taacttttcc ataagctgat tttgattgat ttttatcaaa ttaagcacaa 660

cctgttcata ggggaaataa actttgggtt tgacctgagg aaaatgaacc cacttaacct 720

aatttatgct tttggcggtt ttgtttctgg agaggaaagc cttggtggat tattctcagt 780

tctcgcagg 789

<210>6

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>6

tggcagagcg gtcgtcactt aggc 24

<210>7

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>7

gagcagaatc tcctcccacg caccat 26

<210>8

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>8

ctagaaccac tcaaaccaag cagc 24

<210>9

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>9

atcaggcagg taaaaggata acgg 24

<210>10

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>10

gccttctgag tagcagtatg agttg 25

<210>11

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>11

cctgcgagaa ctgagaataa tcc 23

<210>12

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>12

tgaacgagta cacctcatcc atc 23

<210>13

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>13

tctcctagtt cagaagcatt tcct 24

Claims (3)

1, a kind of method that detects the label of pig fat deposition description proterties, be detect the 1812nd Nucleotide of 5 ' end of sequence 2 in sequence table or in sequence table the 181st Nucleotide of 5 ' end of sequence 5 be C or A, determine the genotype of pig, determine the fatty deposits proterties by genotype then;

The genotypic method of described definite pig is: if in sequence table 5 of sequence 2 ' the 1812nd Nucleotide of end or when the 181st Nucleotide of 5 ' end of sequence 5 was C in sequence table, its homozygotic genotype was BB; In sequence table 5 of sequence 2 ' the 1812nd Nucleotide of end or when the 181st Nucleotide of 5 ' end of sequence 5 was A in sequence table, its homozygotic genotype was AA; Their heterozygote genotype is AB;

The method of determining the fatty deposits proterties by genotype is: the genotypic label of pig fat deposition description of described AA is lower than the AB genotype, and the genotypic label of pig fat deposition description of AB is lower than the BB genotype.

2, method according to claim 1, it is characterized in that: the 1812nd Nucleotide of 5 ' end of described detection sequence 2 in sequence table or in sequence table the 181st Nucleotide of 5 ' end of sequence 5 be that C still is that A determines that genotypic method comprises that first pcr amplification contains the genomic fragment of the 181st Nucleotide of 5 ' end of sequence 5 in sequence table, then amplified production is checked order or cuts amplified production with Msp I enzyme;

The described genomic fragment pcr amplification product that contains the 181st Nucleotide of 5 ' end of sequence 5 in sequence table can be the nucleotide fragments of sequence 5 described 789bp in sequence table; The MspI enzyme is cut described 789bp pcr amplification product, if obtain the single fragment of 789bp, its genotype is the AA homozygote; If obtain 789bp, during three endonuclease bamhis of 608bp and 181bp, its genotype is the AB heterozygote; If when obtaining 608bp and two fragments of 181bp, genotype is the BB homozygote.

3, method according to claim 2 is characterized in that: described label of pig fat deposition description proterties is quantitative by detecting leaf fat rate and/or lactones rate and/or the thickness of backfat.

Images