CN101246119B - Optical fiber biological sensing system - Google Patents
Optical fiber biological sensing system Download PDFInfo
- Publication number
- CN101246119B CN101246119B CN 200810084403 CN200810084403A CN101246119B CN 101246119 B CN101246119 B CN 101246119B CN 200810084403 CN200810084403 CN 200810084403 CN 200810084403 A CN200810084403 A CN 200810084403A CN 101246119 B CN101246119 B CN 101246119B
- Authority
- CN
- China
- Prior art keywords
- fibre
- sample
- optical fiber
- optical
- biological
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
An optical fiber biological sensing system comprises the following components: (1) a light source and a transmission device, (2) an optical fiber sensing device, (3) a sample flow circuit and a reacting device, (4) a signal demodulating and analyzing system and (5) a control and data processing and analyzing system, the light source is connected with the input end of the optical fiber sensing device according to the transmission device, the optical fiber sensing device is packed in the flow circuit and the reacting device of the sample, the output end of the optical fiber sensing equipment is connected to the signal demodulating and analyzing system, and the latter is connected to the PC machine with the data collecting card/system which executes the processing and analyzing of the data. The invention has the following advantages: the optical fiber sensing device has the characters of simple structure, easy manufacturing, low cost and high sensitivity, the biological sensitive film has the characters of convenient preparing, strong stability, small different between batches, being able to reused sometimes, minimized detecting device, small volume of the detecting liquid, fast reacting rate, and being able to realize the high specificity, the high-sensitivity analyzing in-and-out the body and a plurality of combined detections and long-distance detection at the condition that the sample to be measured is not purified and the molecule to be measured is not marked.
Description
(1) technical field under:
The invention belongs to biotechnology-sensory field of optic fibre, relate to a kind of optical fiber biological sensing system.
(2) background technology:
Biology sensor (biosensors) is as the main function element with the biology assembly, can experience the measured object of regulation and convert thereof into the device or the device of discernible signal, generally form by biological identification element, conversion element and mechanical organ and electrical equipment according to certain rule.Biology sensor is typical multidisciplinary cross products; combine life science, analytical chemistry, physics and information science and correlation technique thereof; can carry out express-analysis and tracking to the material of required detection; at present clinical diagnosis, food security, biological anti-probably, aspect such as environmental monitoring plays an increasingly important role, and makes the development of biology sensor become very an active research and a field of engineering technology.The developing direction of biology sensor is to realize the high specific of measured matter, high sensitivity, simple and easy portable and on-the-spot detection fast, and high stability, high life, low cost, microminiaturization, intellectuality and the robotization of device, in addition, the remote remote measurement in field such as, environmental monitoring anti-probably at biology also is one of trend.In various types of sensors, Fibre Optical Sensor is strong with its anti-electromagnetic interference (EMI), size is little, highly sensitive, can realize that the plurality of advantages of suitable bioanalysiss such as multinomial joint-detection becomes the upstart in bio-sensing field.
Optical fiber biosensor refers to the biology sensor with light transmitting fiber and detecting device and biomolecule recognition component formation.Effect by sensing can be divided into two classes, a class be optical fiber only as the transmission medium of signal, the light signal that biological respinse is produced (luminous, fluorescence, phosphorescence, light absorption) transfers to the photoelectric commutator analytic system; Another kind of to be optical fiber itself participate in the identification and the transmission of signal as the ingredient of sensing, because of the mark that do not need biomolecule and can to realize monitoring in real time be an important directions of future development.In with the device of optical fiber as senser element, by specific optical fiber structure the light of specific wavelength is coupled into covering from fibre core, light is the decay rapidly owing to the loss of covering/air interface in covering, stay a string loss band, thereby cause the change of the optical signallings such as centre wavelength that resonate, the variation of optical signalling depends primarily on the refringence of core and covering, the latter is strained, temperature or the external refractive index change and the influence of any variation of producing, therefore pass through the situation of change of detection optical signal, just can obtain the information that external physical quantity changes, bag one deck bio-sensing layer just can be realized the sensing of biomass.The sensitivity of optical fiber biosensor is subjected to the influence of sensor construction, example reaction pool structure, biological identification element etc., and biological identification element is wherein the most primary and part most critical, and it is also determining specificity, the stability and repeated of sensor.Therefore, how to use various bioactive materials (comprising the molecule of biomacromolecules such as antibody, acceptor, cell, organelle, tissue and synthetic etc.) widely and combine with sensor, the transducer that research and development has recognition function is the research emphasis of biosensor technique.In addition, compare with physical sensors with various chemical sensors, as a rule, the stability of biology sensor is still very poor, usually need to nurse meticulously and demarcation continually, the cost of preparation is than higher, and this just requires sensor preparation technology simple and direct, the biological elements good stability, the repeatability that tool is good.
At present, antibody is widely used as recognition component owing to its specificity and sensitivity.But, utilize antibody certain limitation and shortcoming also to be arranged as the sensing recognition component, as: the orientation of commercialization antibody is difficult to fixedly realize that most of antibody lost efficacy with the Free Surface fixing means of standard even the active site that can cause discerning antigen; For not having immunogenic micromolecule and some toxin to prepare relatively difficulty of antibody; As essence is the antibody of albumen, be subjected to Effect of Environmental such as temperature easily and the sex change inactivation, aspects such as long-time stability, reliability, consistance are also undesirable, and service condition is relatively harsher, and this also is that all are the defective of the sensor of responsive recognition component with protein; Repeatability is relatively poor when using repeatedly in addition.
(3) summary of the invention:
The object of the present invention is to provide a kind of optical fiber biological sensing system, it belongs to the antibody engineering technical field, promptly adopt a kind of method of combinatorial chemistry, the oligonucleotide sequence that screening combines with the target material from the random oligonucleotide library, be nucleic acid aptamer (aptamer), utilize it and the target material is special, testing molecule is caught, discerned to binding ability efficiently; It utilizes novel optical fiber biological sensing system, under the prerequisite that guarantees sensitivity, simplify optical fiber sensing structure, improve the example reaction device, optimize biological identification element, make real-time, the accurate detection effect of field performance high specifics such as it is prevented probably at drug discovery, the diagnosis of disease vivo and vitro, food security, biology, environmental monitoring, high sensitivity, high stability, high duplication, strong anti-interference.
Technical scheme of the present invention: a kind of optical fiber biological sensing system, it is characterized in that critical piece comprises: (1) light source and transmitting device, (2) fibre-optical sensing device, (3) sample flow path and reaction unit, (4) signal demodulation and analytic system and (5) control and Data Management Analysis system, said light source connects the input end of fibre-optical sensing device according to transmitting device, fibre-optical sensing device is packaged in sample flow path and reaction unit, the output terminal of fibre-optical sensing device connects signal demodulation and analytic system, and the latter connects PC by the data collecting card/system that carries out Data Management Analysis.
Above-mentioned said light source and transmitting device comprise wideband light source and single mode input optical fibre, single mode output optical fibre or three end optical circulators; Said fibre-optical sensing device comprises single mode input optical fibre, single mode output optical fibre, coreless fiber and is solidificated in bio-sensing rete on the coreless fiber; Said sample flow path and reaction unit comprise sample export, sample inlet, stream, liquid pump, multiple tracks valve, sample cell, can arrange one and above Fibre Optical Sensor equally spacedly in three-dimensional ground in the sample cell; Said signal demodulation and analytic system comprise optical fiber wave spectrum analyzer and photodetector; Said control comprises that with the Data Management Analysis system signal of Signal Analysis System is connected PC by data collecting card/system, and data analysis system analysis, demonstration, testing process are by computer control.
Above-mentioned said by single mode input optical fibre, single mode output optical fibre, coreless fiber and be solidificated in the fibre-optical sensing device that the bio-sensing rete on the coreless fiber constitutes, its signal producing method comprises biological affinity type, metabolic pattern and catalytic type.
The coupling carrier that is solidificated in the bio-sensing rete on the coreless fiber in the above-mentioned said fibre-optical sensing device is directly or by thickness to be that polymolecular chain or the intermembranous activity functional groups that connects in succession of dendritic of 2nm-500nm (comprises amino on the silicon matrix bare fibre, carboxyl, aldehyde radical, sulfydryl, epoxy radicals etc.), or tool activity functional groups (amino, carboxyl, aldehyde radical, sulfydryl, epoxy radicals etc.) biomolecule is used for the coupling biological identification element.
The biological identification element that is solidificated in the bio-sensing rete on the coreless fiber in the above-mentioned said fibre-optical sensing device is at corresponding nucleic acid aptamer and the repeated use thereof of analyzing target.
The biological identification element that above-mentioned said coupling is solidificated on the optical fiber comprises at corresponding antibody, natural receptor or the part of analyzing target; At analyzing the affine polypeptide ligand that target screened; At the corresponding molecular engram thing of analyzing target.
Above-mentioned said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, can be three-dimensional in the sample cell ground sample flow path and the reaction unit of arranging one and above Fibre Optical Sensor equally spacedly form by the cavity of controllable temperature, the cavity two ends are used for optical fiber and pick out, and have the sample well that is used for application of sample, discharge opeing and processing and be communicated with optical fiber.
Above-mentioned said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, the sample flow path and the reaction unit that are connected to a Fibre Optical Sensor in the sample cell are made up of two sections teflon posts of glass bushing connection, glass bushing constitutes the reaction tank of controllable temperature, the teflon post is vertically penetrating, be used for optical fiber and pick out, side direction has the sample well that is used for application of sample, discharge opeing and processing and is communicated with optical fiber.
Above-mentioned said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, can be three-dimensional in the sample cell ground arrange the sample flow path of one and above Fibre Optical Sensor and reaction unit equally spacedly and constitute by two parts closure up and down, each several part adopts micro-processing technology Design and Machining microfluidic channel, forms the reaction part that comprises injection port, sample cell, stream, outlet etc.
The purposes of above-mentioned said optical fiber biological sensing system, it is characterized in that it comprises: survey multiple materials such as cell, bacterium, virus, biomacromolecule (albumen, nucleic acid), biological micromolecule (polypeptide, hormone), environmental contaminants, toxin, agricultural chemicals, be used for the diagnosis of disease vivo and vitro, food security, biological anti-probably, fields such as environmental monitoring, interaction of molecules research, combinatorial chemical library screening and drug discovery.
Technique effect of the present invention and superiority are (seeing Fig. 2-4): fibre-optical sensing device is simple in structure, be easy to make, cost is low, highly sensitive, bio-sensitive film is easy to prepare, stability is strong, differences between batches are little, reusable sometimes, pick-up unit microminiaturization, tracer liquid are long-pending little, reaction velocity is fast, can realize under sample to be checked need not situation that purifying, testing molecule need not mark that high specific, the high sensitivity inside and outside of biological sample analyze and multinomial joint-detection and remote remote measurement.
(4) description of drawings:
Fig. 1 is the composition and the structural representation of fibre-optical sensing device of the present invention.
Fig. 2 is the experimental result of optical fiber biological sensing system sensitivity test of the present invention.
Fig. 3 is the anti-interference experimental result of optical fiber biological sensing system of the present invention.
Fig. 4 measures the experimental result of protein concentration in the solution for using optical fiber biological sensing system of the present invention.
(5) embodiment:
Embodiment 1: a kind of optical fiber biological sensing system (see figure 1) is characterized in that critical piece comprises:
(1) light source and transmitting device: comprise wideband light source and single mode input optical fibre, single mode output optical fibre;
(2) fibre-optical sensing device: comprise single mode input optical fibre, single mode output optical fibre, coreless fiber and be solidificated in bio-sensing rete on the coreless fiber;
(3) sample flow path and reaction unit: comprise sample export, sample inlet, stream, liquid pump, multiple tracks valve, sample cell, be connected to a Fibre Optical Sensor in the sample cell;
(4) signal demodulation and analytic system: be the optical fiber wave spectrum analyzer;
(5) control and Data Management Analysis system: the signal that comprises Signal Analysis System is connected PC by data collecting card/system, and data analysis system analysis, demonstration, testing process are by computer control:
Said light source connects the input end of fibre-optical sensing device according to transmitting device, fibre-optical sensing device is packaged in sample flow path and reaction unit, the output terminal of fibre-optical sensing device connects signal demodulation and analytic system, and the latter connects PC by the data collecting card/system that carries out Data Management Analysis.
Above-mentioned said by single mode input optical fibre, single mode output optical fibre, coreless fiber and be solidificated in the fibre-optical sensing device that the bio-sensing rete on the coreless fiber constitutes, its signal producing method is biological affinity type.
The coupling carrier that is solidificated in the bio-sensing rete on the coreless fiber in the above-mentioned said fibre-optical sensing device is to connect the glucosan with active amino on the silicon matrix bare fibre, be used for the coupling biological identification element.
The biological identification element that above-mentioned said coupling is solidificated on the optical fiber is at albuminous nucleic acid aptamer.
Above-mentioned said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, can be three-dimensional in the sample cell ground sample flow path and the reaction unit of arranging a Fibre Optical Sensor equally spacedly form by the cavity of controllable temperature, the cavity two ends are used for optical fiber and pick out, and have the sample well that is used for application of sample, discharge opeing and processing and be communicated with optical fiber.
Above-mentioned said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, the sample flow path and the reaction unit that are connected to a Fibre Optical Sensor in the sample cell are made up of two sections teflon posts of glass bushing connection, glass bushing constitutes the reaction tank of controllable temperature, the teflon post is vertically penetrating, be used for optical fiber and pick out, side direction has the sample well that is used for application of sample, discharge opeing and processing and is communicated with optical fiber.
Operating process is: with optical fiber splicer two single-mode fibers and coreless fiber are welded together formation optical fiber multiple-mode interfence instrument.Washing coreless fiber 3 times is handled 30min with dense HCl and MeOH mixed solution (1: 1), washes 3 times again; Use dense H
2SO
4With 30%H
2O
2Mixed solution (7: 3) is handled 30min, washes 3 times, and absolute methanol cleans 3 times, and toluene cleans 3 times; Handle 5h with 10%APES, toluene cleans 3 times, and absolute methanol cleans 3 times, washes 5 times; Clean 1 time with 0.01mol/L PBS (pH7.0), 5% glutaraldehyde is handled 2h; The dextran solution that adds different pH values, reaction is spent the night, again with excessive albumin nucleic acid aptamer (sequence: 5 ' ATCCGCCTGATTAGCGATACTGGGACTGACTGATACGAAGGCATGATTGGGACACT ACTTGAGCAAAATCACCTGCAGGG 3 ') hatch, 4 ℃ are spent the night, and clean 5 times with 0.01mol/LPBS; With the NaBH that is dissolved in 0.1mol/L borate buffer (pH9.0)
4Handle 30min, water, 1mol/L NaCl, water, PBS clean successively.
The purposes of above-mentioned said optical fiber biological sensing system is characterized in that surveying albuminous concentration in the body fluid, is used for the diagnosis of diseases such as ephritis, infection.
Embodiment 2: a kind of optical fiber biological sensing system (see figure 1) is characterized in that critical piece comprises:
(1) light source and transmitting device: comprise wideband light source and single mode input optical fibre, single mode output optical fibre;
(2) fibre-optical sensing device: comprise single mode input optical fibre, single mode output optical fibre, coreless fiber and be solidificated in bio-sensing rete on the coreless fiber;
(3) sample flow path and reaction unit: comprise sample export, sample inlet, stream, liquid pump, multiple tracks valve, sample cell, be connected to a Fibre Optical Sensor in the sample cell;
(4) signal demodulation and analytic system: be the optical fiber wave spectrum analyzer;
(5) control and Data Management Analysis system: the signal that comprises Signal Analysis System is connected PC by data collecting card/system, and data analysis system analysis, demonstration, testing process are by computer control:
Said light source connects the input end of fibre-optical sensing device according to transmitting device, fibre-optical sensing device is packaged in sample flow path and reaction unit, the output terminal of fibre-optical sensing device connects signal demodulation and analytic system, and the latter connects PC by the data collecting card/system that carries out Data Management Analysis.
Above-mentioned said by single mode input optical fibre, single mode output optical fibre, coreless fiber and be solidificated in the fibre-optical sensing device that the bio-sensing rete on the coreless fiber constitutes, its signal producing method is biological affinity type.
The coupling carrier that is solidificated in the bio-sensing rete on the coreless fiber in the above-mentioned said fibre-optical sensing device is directly to connect active aldehyde radical on the silicon matrix bare fibre, be used for the coupling biological identification element.
The biological identification element that above-mentioned said coupling is solidificated on the optical fiber is at albuminous nucleic acid aptamer.
Above-mentioned said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, being connected to the sample flow path of a Fibre Optical Sensor and reaction unit in the sample cell is made of two parts closure up and down, each several part adopts micro-processing technology Design and Machining microfluidic channel, forms the reaction part that comprises injection port, sample cell, stream, outlet etc.
Operating process is: with optical fiber splicer two single-mode fibers and coreless fiber are welded together formation optical fiber multiple-mode interfence instrument.Washing coreless fiber 3 times is handled 30min with dense HCl and MeOH mixed solution (1: 1), washes 3 times again; Use dense H
2SO
4With 30%H
2O
2Mixed solution (7: 3) is handled 30min, washes 3 times, and absolute methanol cleans 3 times, and toluene cleans 3 times; Handle 5h with 10%APES, toluene cleans 3 times, and absolute methanol cleans 3 times, washes 5 times; Clean 1 time with 0.01mol/L PBS (pH7.0), 5% glutaraldehyde is handled 2h; (sequence: 5 ' ATCCGCCTGATTAGCGATACTGGGACTGACTGATACGAAGGCATGATTGGGACACT ACTTGAGCAAAATCACCTGCAGGG 3 '), 4 ℃ of overnight incubation are cleaned 5 times with 0.01mol/L PBS to add excessive albumin nucleic acid aptamer; With the NaBH that is dissolved in 0.1mol/L borate buffer (pH9.0)
4Handle 30min, water, 1mol/LNaCl, water, PBS clean successively.
The purposes of above-mentioned said optical fiber biological sensing system is characterized in that surveying albuminous concentration in the body fluid, is used for the diagnosis of diseases such as ephritis, infection.
Embodiment 3: the sensitivity test of optical fiber biological sensing system
The albumin solution sample of preparation series concentration.Adopting the output spectrum scope is the wideband light source of 1520-1565nm, sample is injected the example reaction pond that the optical fibre bio sensing device is installed through injection port, in sample cell and its capture molecules---the adaptive son effect of albumin specific nucleic acid 10min, adopt crest peak position probe method, by the fibre optic spectral analyzer dynamic monitoring and write down the wavelength of a peak valley correspondence on the transmission spectrum, can learn the response condition of optical fiber biological sensing system by the existence that detects the crest displacement.Experiment is finished under 25 ℃.
Embodiment 4: the anti-interference experiment of optical fiber biological sensing system
Experimentation substitutes albumin with embodiment 3 with rabbit IgG, observes crest displacement situation.Experiment is finished under 25 ℃.
Embodiment 5: use the protein concentration in the optical fiber biological sensing system mensuration solution
Experimentation is with embodiment 3, the crest displacement of record variable concentrations albumin standards is situation of change in time, draw concentration-crest displacement curve that the crest displacement reaches balance postalbumin titer, with crest displacement balance point calculation sample concentration after the typical curve standardization of liquid to be measured.Experiment is finished under 25 ℃.
Claims (9)
1. optical fiber biological sensing system, it is characterized in that critical piece comprises: (1) light source and transmitting device, (2) fibre-optical sensing device, (3) sample flow path and reaction unit, (4) signal demodulation and analytic system and (5) control and Data Management Analysis system, said light source connects the input end of fibre-optical sensing device according to transmitting device, fibre-optical sensing device is packaged in sample flow path and reaction unit, the output terminal of fibre-optical sensing device connects signal demodulation and analytic system, and the latter connects PC by the data collecting card/system that carries out Data Management Analysis; Wherein: said light source and transmitting device comprise wideband light source and single mode input optical fibre, single mode output optical fibre; Said fibre-optical sensing device comprises single mode input optical fibre, single mode output optical fibre, coreless fiber and is solidificated in bio-sensing rete on the coreless fiber; Said sample flow path and reaction unit comprise sample export, sample inlet, stream, liquid pump, multiple tracks valve, sample cell, and Fibre Optical Sensor of arrangement or three-dimensional are arranged an above Fibre Optical Sensor equally spacedly in the sample cell; Said signal demodulation and analytic system comprise optical fiber wave spectrum analyzer and photodetector; Said control comprises that with the Data Management Analysis system signal of signal demodulation and analytic system is connected PC by data collecting card/system, and Data Management Analysis systematic analysis, demonstration, testing process are by computer control.
2. optical fiber biological sensing system according to claim 1, it is characterized in that saidly by single mode input optical fibre, single mode output optical fibre, coreless fiber and be solidificated in the fibre-optical sensing device that the bio-sensing rete on the coreless fiber constitutes, its signal producing method comprises biological affinity type, metabolic pattern and catalytic type.
3. optical fiber biological sensing system according to claim 2, the coupling carrier that it is characterized in that being solidificated in the said fibre-optical sensing device bio-sensing rete on the coreless fiber is directly or by thickness to be polymolecular chain or the intermembranous activity functional groups that connects in succession of dendritic of 2nm-500nm on the silicon matrix bare fibre, or the biomolecule of tool activity functional groups, be used for the coupling biological identification element.
4. optical fiber biological sensing system according to claim 3, the biological identification element that it is characterized in that being solidificated in the said fibre-optical sensing device bio-sensing rete on the coreless fiber are at corresponding nucleic acid aptamer and the reusable nucleic acid aptamer of analyzing target.
5. optical fiber biological sensing system according to claim 3 is characterized in that the biological identification element that coupling is solidificated on the optical fiber comprises at corresponding antibody, natural receptor or the part of analyzing target; At analyzing the affine polypeptide ligand that target screened; At the corresponding molecular engram thing of analyzing target.
6. optical fiber biological sensing system according to claim 1, it is characterized in that said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, Fibre Optical Sensor of arrangement or three-dimensional sample flow path and the reaction unit of arranging an above Fibre Optical Sensor equally spacedly are made up of the cavity of controllable temperature in the sample cell, the cavity two ends are used for optical fiber and pick out, and have the sample well that is communicated with optical fiber, be used for application of sample, discharge opeing and processing.
7. optical fiber biological sensing system according to claim 6, it is characterized in that said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, the sample flow path and the reaction unit that are connected to a Fibre Optical Sensor in the sample cell are made up of two sections teflon posts of glass bushing connection, glass bushing constitutes the reaction tank of controllable temperature, the teflon post is vertically penetrating, being used for optical fiber picks out, side direction has the sample well that is communicated with optical fiber, is used for application of sample, discharge opeing and processing.
8. optical fiber biological sensing system according to claim 1, it is characterized in that said sample export, sample inlet, stream, liquid pump, multiple tracks valve, the sample cell of comprising, arranging a Fibre Optical Sensor or three-dimensional ground in the sample cell arranges the sample flow path of an above Fibre Optical Sensor and reaction unit equally spacedly and is made of two parts closure up and down, each several part adopts micro-processing technology Design and Machining microfluidic channel, forms the reaction part that comprises sample inlet, sample cell, stream, sample export.
9. the purposes of optical fiber biological sensing system according to claim 1 is characterized in that it comprises: survey cell, bacterium, virus, biomacromolecule, biological micromolecule, toxin, the multiple material of agricultural chemicals.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810084403 CN101246119B (en) | 2007-03-23 | 2008-03-21 | Optical fiber biological sensing system |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200710056987 | 2007-03-23 | ||
| CN200710056987.9 | 2007-03-23 | ||
| CN 200810084403 CN101246119B (en) | 2007-03-23 | 2008-03-21 | Optical fiber biological sensing system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101246119A CN101246119A (en) | 2008-08-20 |
| CN101246119B true CN101246119B (en) | 2011-06-08 |
Family
ID=39946696
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810084403 Expired - Fee Related CN101246119B (en) | 2007-03-23 | 2008-03-21 | Optical fiber biological sensing system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101246119B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101750483B (en) * | 2008-12-02 | 2013-12-25 | 浙江我武生物科技股份有限公司 | Optical fiber biosensor probe, preparation method and application thereof |
| CN104165841B (en) * | 2013-05-16 | 2016-12-28 | 上海交通大学 | The unmarked optical sensor of fiber end face and microfluid integrated morphology |
| CN103900993A (en) * | 2014-04-04 | 2014-07-02 | 哈尔滨工程大学 | Molecular imprinting microfluidics sensor based on double-annular-fiber-core optical fiber and double-annular-fiber-core optical fiber |
| CN104713660A (en) * | 2015-03-13 | 2015-06-17 | 天津大学 | Optical fiber sensor, manufacturing method and simultaneous measuring method for liquid temperature and refractive index |
| CN108931647A (en) * | 2018-07-06 | 2018-12-04 | 深圳信息职业技术学院 | The production method of Fiber imunosensor, detection device and Fiber imunosensor |
| CN109991193B (en) * | 2019-04-22 | 2021-07-13 | 重庆理工大学 | Method for manufacturing coreless multimode optical fiber hydrogen sulfide gas sensor, sensor thereof and method for detecting concentration of hydrogen sulfide gas |
| CN110031146A (en) * | 2019-05-10 | 2019-07-19 | 西安石油大学 | Based on capillary splice type fibre-optical microstructure transducer production method and measuring principle |
| CN110243793A (en) * | 2019-06-19 | 2019-09-17 | 中国人民大学 | A kind of chemiluminescence optical fiber biosensor |
| CN110554014B (en) * | 2019-08-30 | 2022-04-19 | 华南师范大学 | Molecular imprinting fluorescence optical fiber sensor, construction method thereof and fluorescence detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003087398A2 (en) * | 2002-04-04 | 2003-10-23 | Micap Plc | Electrochemical detector systems |
| CN1712929A (en) * | 2005-07-01 | 2005-12-28 | 重庆工学院 | MZ interference evanescent wave chemical and biological sensor and system with fibre-optical microstructure |
| EP1645865A1 (en) * | 2003-04-25 | 2006-04-12 | Yushan Tan | Optical fiber array biochip based on white-light reflectrometric interference spectroscopy |
| CN101008649A (en) * | 2007-01-26 | 2007-08-01 | 中国科学院上海光学精密机械研究所 | Multiprobe fiber optical evanescent wave biotester based on correlation detection |
| CN101126714A (en) * | 2007-07-19 | 2008-02-20 | 天津大学 | Optical fiber biosensor application method |
-
2008
- 2008-03-21 CN CN 200810084403 patent/CN101246119B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003087398A2 (en) * | 2002-04-04 | 2003-10-23 | Micap Plc | Electrochemical detector systems |
| EP1645865A1 (en) * | 2003-04-25 | 2006-04-12 | Yushan Tan | Optical fiber array biochip based on white-light reflectrometric interference spectroscopy |
| CN1712929A (en) * | 2005-07-01 | 2005-12-28 | 重庆工学院 | MZ interference evanescent wave chemical and biological sensor and system with fibre-optical microstructure |
| CN101008649A (en) * | 2007-01-26 | 2007-08-01 | 中国科学院上海光学精密机械研究所 | Multiprobe fiber optical evanescent wave biotester based on correlation detection |
| CN101126714A (en) * | 2007-07-19 | 2008-02-20 | 天津大学 | Optical fiber biosensor application method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101246119A (en) | 2008-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101246119B (en) | Optical fiber biological sensing system | |
| Potyrailo et al. | Optical waveguide sensors in analytical chemistry: today’s instrumentation, applications and trends for future development | |
| Lin | Recent development and applications of optical and fiber-optic pH sensors | |
| US4577109A (en) | Remote multi-position information gathering system and method | |
| CN108680505B (en) | Multichannel wavelength modulation type optical fiber SPR detection system | |
| Anderson et al. | Development of an evanescent wave fiber optic biosensor | |
| Lieberman | Recent progress in intrinsic fiber-optic chemical sensing II | |
| US20100248352A1 (en) | Sensor for biological detection | |
| CN106959370A (en) | A kind of biological sensor and detection method based on coupling grating | |
| CN108344866A (en) | A kind of fluidic chip detecting system and the method based on system progress sample detection | |
| CN106990086A (en) | A kind of multichannel Evanescent Wave All-fiber biology sensor | |
| CN108844922A (en) | The rapid detection method of drugs in a kind of hair | |
| CN108572141B (en) | Composite enhanced optical fiber biosensor and method for detecting concentration of biological protein molecules | |
| CN105424663A (en) | Method for detecting phthalic acid ester compound concentration based on optical fiber immunosense | |
| CN101871881B (en) | Method for detecting protein content in solution | |
| CN110243795A (en) | A kind of evanescent wave Two Colour Fluorescence all -fiber biosensor | |
| King et al. | Automated fiber optic biosensor for multiplexed immunoassays | |
| CN100565190C (en) | Biochemical substances method for sensing and biology sensor optical sensing structure | |
| Lu et al. | An online pH detection system based on a microfluidic chip | |
| CN104950111A (en) | Liquid chip kit for quantitatively detecting concentration of myeloperoxidase (MPO) in sample and preparation method of liquid chip kit | |
| CN208350613U (en) | A kind of multi-channel wavelength modulation type optical fiber detection system | |
| Anderson et al. | Water quality monitoring using an automated portable fiber optic biosensor: RAPTOR | |
| CN103454253A (en) | Organic phosphorus detection method based on surface plasmon resonance | |
| Golden et al. | A “do-it-yourself” array biosensor | |
| CN208459405U (en) | Fiber imunosensor and the detection device detected for immunity disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: TIANJIN YIJUN BIOTECHNOLOGY CO., LTD. Free format text: FORMER OWNER: CHINA NATIONAL ACADEMY NANOTECHNOLOGY + ENGINEERING Effective date: 20130106 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20130106 Address after: 300457, room four, building 80, building C5, Tian Da Science Park, No. fourth, 412 Avenue, Tianjin Development Zone, Tianjin Patentee after: Tianjin Wing Chun Biotechnology Co., Ltd. Address before: 300457 No. fourth, 80 Avenue, Tianjin economic and Technological Development Zone, Tianjin Patentee before: China National Academy Nanotechnology & Engineering |
|
| DD01 | Delivery of document by public notice |
Addressee: Tianjin Wing Chun Biotechnology Co., Ltd. Document name: Notification of Termination of Patent Right |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110608 Termination date: 20150321 |
|
| EXPY | Termination of patent right or utility model |