CN101245372A - S.nitidum (Vahl) Pers. testing primer and testing method - Google Patents
S.nitidum (Vahl) Pers. testing primer and testing method Download PDFInfo
- Publication number
- CN101245372A CN101245372A CNA2007100375765A CN200710037576A CN101245372A CN 101245372 A CN101245372 A CN 101245372A CN A2007100375765 A CNA2007100375765 A CN A2007100375765A CN 200710037576 A CN200710037576 A CN 200710037576A CN 101245372 A CN101245372 A CN 101245372A
- Authority
- CN
- China
- Prior art keywords
- primer
- chinese sorghum
- add
- detects
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a shining sorghum specific primer and a PCR detection method by utilizing the specific primer, which overcomes the difficulties in the methods that are related to the morphologic identification and the cell biology in the prior art and is applicable to the fields of port inspection and quarantine, agricultural production, plant protection, and so on. The PCR detection method includes the steps of 1) the obtainment of a seed DNA, 2) PCR amplification and 3) agarose gel electrophoresis.
Description
(1) technical field
The invention belongs to agricultural plants inspection and quarantine technical field; relate to a kind of detection primer that utilizes the molecular Biological Detection technology to detect the detection method of light Chinese sorghum rapidly and accurately and be used for this method particularly, be suitable for fields such as Check and Examination of Port quarantine, agriculture production, plant protection and use.
(2) background technology
Light Chinese sorghum (Sorghum.nitidum (Vahl) Pers) is the allied species of the false Chinese sorghums of the big malignant weeds in the world ten, and the light Chinese sorghum is found in West India the earliest, after propagate into states such as South East Asia, Indonesia, Australia.The light Chinese sorghum is perennial, and produces rhizome, and its form is similar to false Chinese sorghum with the karyomit(e) size.Y.Sun etc. (1994) thought once that the light Chinese sorghum belonged in Sorghum district group, and DeWet (1978), Guo (1996) etc. then advises it is incorporated among the Parasorghum, and the false Chinese sorghum of the accurate Rapid identification of port quarantine that exists for of allied species has increased difficulty.
In the real work, the external appearance characteristic of weed seeds such as the false Chinese sorghum that is mingled with in the agricultural-food tends to be worn and modification because of transportation, simultaneously owing to environment, weather, the influence of cultivation condition, the individual difference that does not cause on an equal basis of kernel maturing, more identification of morphology has increased difficulty, and cell biology method etc. not only need the long cycle, and only still are difficult to identify according to chromosomal form.
(3) summary of the invention
Technical problem
The objective of the invention is to overcome in the above-mentioned prior art difficulty that exists about identification of morphology and cell biology method, propose to adopt molecular biology method, Auele Specific Primer at rrna sequences Design light Chinese sorghum, set up light Chinese sorghum PCR detection method, quick and precisely detect the purpose of identifying to reach.
Technical scheme
At present, do not see that the PCR method that the light Chinese sorghum is arranged identifies report, this primer is at the internal transcribed spacer region sequence design of the rDNA of light Chinese sorghum.The internal transcribed spacer district ITS of 18S～26S nuclear rDNA (nrDNA) is divided into ITS1 and ITS2 two portions by 5.8S.The ITS district is the height multiple in the plant nucleus gene group.All nrDNA repeating unit comprises that 40,000 copies repeat (tandemrepeats) mode with series connection and appear at (Regers ﹠amp on one or more chromogenes site; Bendich 1987, and summary is seen Hamby ﹠amp; Zimmer1992).In angiosperm, the ITS district had not only had the height variability of nucleotide sequence but also conservative property on the length had been arranged, the sequence that these transcribed spacers are described is easy to sort between nearly edge monoid, and rich variations can solve botanical system growth problem in (as between belonging to, between kind) on the lower taxonomic category.Qu Lianggu and Chen Yueqin (1999) are by relatively drawing ITS sequence (from the biology database) of different biological groups: the difference between species value of the ITS sequence that the most of sections of angiosperm belong to is 1.2%～10.2%, belonging to the differences value is 9.6%～28.8%, and this all is more suitable scope concerning phylogeny research.
Emphasis of the present invention is to be used to detect the primer N3/N5 of light Chinese sorghum and the complete complementary strand of described primer sequence.At the specificity site difference of light Chinese sorghum ITS sequence, designed detection light Chinese sorghum primer N3/N5, set up the PCR detection technique of light sorghum seeds.
The detection method of light Chinese sorghum PCR comprises.
Testing process is as follows:
1 seed DNA obtains
Single seed grinds, and extracts according to following steps:
1) grind seed in the liquid nitrogen in the 1.5mL centrifuge tube, add 500 μ L TES, TES is by 100mM Tris (pH8.0), 10mM EDTA, and 2%SDS forms;
2) add 7 μ L Proteinase K mixings, place 55 ℃ of water-bath 60～120min, during mixing several times;
3) regulate salt concn to 1.4M, add 10% hexadecane trimethyl ammonium bromide of 1/10 volume, place 65 ℃ of water-bath 10min;
4) add isopyknic SEVGA mixing, SEVGA is a chloroform: primary isoamyl alcohol=24: 1, can not be too violent, and to guarantee the integrity of DNA, hatch 30min for 0 ℃;
5) 4 ℃ 13, the centrifugal 10min of 000r/min gets supernatant to the 1.5mL centrifuge tube;
6) add 225 μ L 5M ammonium acetate mixings, hatch more than the 30min for 0 ℃, 4 ℃ 13, the centrifugal 2min of 000r/min;
7) get supernatant, add 3 μ L ribonuclease As, 37 ℃ of water-bath 30min are to remove RNA;
8) add the pre-cold isopropanol of 0.55 volume, place more than the 30min for-20 ℃;
9) 4 ℃ 13, the centrifugal 15～20min of 000r/min abandons Virahol, and 70% ethanol is washed 2 times.Drying at room temperature, 50 μ LTE or distilled water dissolving, TE is 10mM Tris, 1mM EDTA (pH8.0).
The 2PCR amplification
Utilize primer N3 (5 '-GGCGTCAAGGAACACTTATA-3 ')/N5 (5 '-ACGTCCCTCCTCCCCTCT-3 '); Carry out pcr amplification, PCR reaction cumulative volume is 30 μ l, comprises: 10mmol/L trihydroxy-aminomethane hydrochloride Tris-HCl; 50mmol/L KCl (pH8.3); 1.5mmol/L MgCl2; DATP, dGTP, dCTP, dTTP concentration is 100 μ mol/L; Primer concentration 100nmol/L; 0.5U Taq archaeal dna polymerase (precious biotechnology company limited).Adding distilled water to final volume is 30 μ l, and mixing is centrifugal, places the PCR instrument to increase.Amplified reaction program: pre-95 ℃ of 3min of sex change; 94 ℃ of 30s then, 60 ℃ of 30s, 72 ℃ of 1min circulate 30 times.
3 agarose gel electrophoresis
Get amplified production 10 μ L, add 3 μ L sample-loading buffers [0.25% bromjophenol blue, 40% (W/V) aqueous sucrose solution], mixing, 1.5% agarose gel electrophoresis.Electrophoresis, the imaging deposit in the gel imaging instrument of EB dyeing back.
Beneficial effect
The evaluation of tradition light Chinese sorghum
Traditional authentication method is to utilize seed morphology to learn feature, cytobiology feature etc.Mode of appearance is identified as the surface that can distinguish different plants easily kindred plant is not classified and becomes one of important means of port quarantine weeds.But, owing in the agricultural-food of import because of come off, reason such as drying, accumulating, loading and unloading, the external appearance characteristic of the weed seed that is mingled with tends to so is worn and modification, owing to environment, weather, the influence of cultivation condition, the individual difference that does not cause on an equal basis of kernel maturing also are unavoidable, so just identify and brought difficulty simultaneously to appearance.And cell biology method etc. not only need the long cycle, and only still are difficult to identify according to chromosomal form.
The specific detection of light Chinese sorghum
The allied species of light Chinese sorghum comprises: black Chinese sorghum (Sorghum almum Parodi), plan Chinese sorghum (S.propinquum (Kunth.) Hitchc.), arabian cron (S.sudanense (Piper) Stapf), two look Chinese sorghums (S.bicolor (L.) Moench) and false Chinese sorghum (Sorghum halepense (L.) Pers).Their seed is very similar to the light Chinese sorghum, but has nothing in common with each other in its hazardness and quarantine status.Utilize primer specificity to distinguish the light Chinese sorghum.
One, validation test experiment content
The PCR of light Chinese sorghum identifies
Two, test material
1, PCR identifies material therefor:
1 of false Chinese sorghum, 1 of black Chinese sorghum, 10 of light Chinese sorghums are intended 1 of Chinese sorghum, 1 of two look Chinese sorghum, 1 of arabian cron (table 1).
Table 1, pcr amplification material therefor
Three, validation test experimental result
Universal primer detects the DNA extraction effect and sees Fig. 1.
The PCR special primer detects and to see Table 2 and Fig. 2.
Table 2PCR detects light Chinese sorghum and allied species result thereof
| Sample number into spectrum | Detected result | Sample number into spectrum | Detected |
| 1 | + | 9 | + |
| 2 | + | 10 | + |
| 3 | + | 11 | - |
| 4 | + | 12 | - |
| 5 | + | 13 | - |
| 6 | + | 14 | - |
| 7 | + | 15 | - |
| 8 | + |
"+": the positive; "-": feminine gender
Four, conclusion
1, detected result conforms to fully with experiment material.
2, shorten greatly detection time, can in 1 working days, finish detection;
3, single seeded detection, the sensitivity of detection improves greatly;
4, traditional conventional sense method can not be distinguished form wearing and tearing and the not enough seed of ripening degree, and the PCR method of foundation can be identified light Chinese sorghum and approximate species special, responsive, accurately and rapidly.
(4) description of drawings
Fig. 1, the ITS universal primer detects the DNA extraction effect
Illustrate: the dna marker of use is the DL2000 (2000bp that Takara produces; 1000bp; 750bp; 500bp; 250bp; 100bp)
1～10, light Chinese sorghum (S.nitidum); 11, false Chinese sorghum (S.halepense); 12, two look Chinese sorghums (S.bicolor); 13, intend Chinese sorghum (S.propinquum); 14, black Chinese sorghum (S.almum); 15, arabian cron (S.sudannese); 16, negative contrast (negative control)
Fig. 2, special primer N3/N5 test sample
Illustrate: the dna marker of use is the DL2000 (2000bp that Takara produces; 1000bp; 750bp; 500bp; 250bp; 100bp),
1～10, light Chinese sorghum (S.nitidum); 11, false Chinese sorghum (S.halepense); 12, two look Chinese sorghums (S.bicolor); 13, intend Chinese sorghum (S.propinquum); 14, black Chinese sorghum (S.almum); 15, arabian cron (S.sudannese); 16, negative contrast (negative control)
Fig. 3 is the detected result that special primer detects the light Chinese sorghum
M, and standard molecule mark DL2000 (2000,1000,750,500,250,100bp); 1～10, light Chinese sorghum (S.nitidum); 11, false Chinese sorghum (S.halepense); 12, two look Chinese sorghums (S.bicolor); 13, intend Chinese sorghum (S.propinquum); 14, black Chinese sorghum (S.almum); 15, arabian cron (S.sudannese); 16, negative contrast (negative control)
* the first half is an ITS special primer amplification among the figure; Lower Half is the amplification of ITS universal primer.
Fig. 4 is technological line figure of the present invention
Technological line of the present invention is that single seed is extracted DNA, utilizes primer N3/N5 to carry out pcr amplification, distinguishes S.nitidum and other sorghum seed with this, wherein
Upstream primer N35 '-GGCGTCAAGGAACACTTATA-3 ';
Downstream primer N55 '-ACGTCCCTCCTCCCCTCT-3 ';
(5) embodiment
1 seed DNA obtains
Single seed grinds, and extracts according to following steps:
1) grind seed in the liquid nitrogen in the 1.5mL centrifuge tube, add 500 μ L TES, TES is by 100mM Tris (pH8.0), 10mM EDTA, and 2%SDS forms;
2) add 7 μ L Proteinase K mixings, place 55 ℃ of water-bath 60～120min, during mixing several times;
3) regulate salt concn to 1.4M, add 10% hexadecane trimethyl ammonium bromide of 1/10 volume, place 65 ℃ of water-bath 10min;
4) add isopyknic SEVGA mixing, SEVGA is a chloroform: primary isoamyl alcohol=24: 1, can not be too violent, and to guarantee the integrity of DNA, hatch 30min for 0 ℃;
5) 4 ℃ 13, the centrifugal 10min of 000r/min gets supernatant to the 1.5mL centrifuge tube;
6) add 225 μ L 5M ammonium acetate mixings, hatch more than the 30min for 0 ℃, 4 ℃ 13, the centrifugal 2min of 000r/min;
7) get supernatant, add 3 μ L ribonuclease As, 37 ℃ of water-bath 30min are to remove RNA;
8) add the pre-cold isopropanol of 0.55 volume, place more than the 30min for-20 ℃;
9) 4 ℃ 13, the centrifugal 15～20min of 000r/min abandons Virahol, and 70% ethanol is washed 2 times.Drying at room temperature, 50 μ LTE or distilled water dissolving, TE is 10mM Tris, 1mM EDTA (pH8.0).
The 2PCR amplification
Utilize primer N3 (5 '-GGCGTCAAGGAACACTTATA-3 ')/N5 (5 '-ACGTCCCTCCTCCCCTCT-3 '); Carry out pcr amplification, PCR reaction cumulative volume is 30 μ l, comprises: 10mmol/L trihydroxy-aminomethane hydrochloride Tris-HCl; 50mmol/L KCl (pH8.3); 1.5mmol/L MgCl2; DATP, dGTP, dCTP, dTTP concentration is 100 μ mol/L; Primer concentration 100nmol/L; 0.5U Taq archaeal dna polymerase (precious biotechnology company limited).Adding distilled water to final volume is 30 μ l, and mixing is centrifugal, places the PCR instrument to increase.Amplified reaction program: pre-95 ℃ of 3min of sex change; 94 ℃ of 30s then, 60 ℃ of 30s, 72 ℃ of 1min circulate 30 times.
3 agarose gel electrophoresis
Get amplified production 10 μ L, add 3 μ L sample-loading buffers [0.25% bromjophenol blue, quality volumn concentration 40% (W/V) aqueous sucrose solution], mixing, 1.5% agarose gel electrophoresis.Electrophoresis, the imaging deposit in the gel imaging instrument of EB dyeing back.
Light Chinese sorghum ITS sequence:
Sorghum nitidum ribosomal DNA internal transcribed spacer：
001 TCGTGACCCT TAAACAAAAC AGACCGCGAA CGCGTCTCTC GTGCCGCCGGGCCTCGGCTC
061 GGCACACGGC CCCCGAGCCC TGTCATGGGG CGGAGGGGCC ACAAAAGAACCCACGGCGCC
121 TAAGGCGTCA AGGAACACTT ATATTGCCTT GCACGGCGGA GCGGTCGGCCTGCCTTCCGC
181 TCCCCGCGCA GCGATGATAT CTTAATCCAC ACGACTCTCG GCAACGGATATCTCGGCTCT
241 CGCATCGATG AAGAACGTAG CAAAATGCGA TACCTGGTGT GAATTGCAGAATCCCGCGAA
301 CCATCGAGTT TTTGAACGCA AGTTGCGCCC GAGGCCTTCT GGCCGAGGGCACGTCTGCCT
361 GGGCGTCACG CCAAAAGACA CTCCCAACCC ACCCAGAGGG GAGGAGGGACGTGGTGTTTG
421 GCCTCCCGTG CCTCGCGGCG CGGTGGGCCG AAGTTGGGGC TGCCGGCGAATCGTGTCGGG
481 CACAGCACGT GGTGGGCGAC ACCTTAGTTG TTCTCGGTGC AGCGCCTCGGCACGCGGCCG
541 GCGCATCGGC CCTAAGGACC CATGGAGCAC CGCAGCGCAT CGCCGCTCGGACCGCGACCC
601CA
Annotate: upstream primer N3 5 '-GGCGTCAAGGAACACTTATA-3 ';
Downstream primer N5 5 '-ACGTCCCTCCTCCCCTCT-3 ';
Claims (11)
1. one kind is used for the right upstream primer of Auele Specific Primer that the light Chinese sorghum detects, and its dna sequence dna is 5 '-GGCGTCAAGGAACACTTATA-3 '.
2. the complete complementary strand of primer sequence according to claim 1.
3. an Auele Specific Primer that is used for the detection of light Chinese sorghum is right, and it is characterized in that: this primer to dna sequence dna is: upstream primer N3:5 '-GGCGTCAAGGAACACTTATA-3 '; Downstream primer N5:5 '-ACGTCCCTCCTCCCCTCT-3 '.
4. a detection method of utilizing the PCR detection technique to detect the light sorghum seeds is characterized in that utilizing Auele Specific Primer as claimed in claim 3 to carry out pcr amplification.
5. a kind of detection method that the light Chinese sorghum detects that is used for as claimed in claim 4 is characterized in that testing process comprises the steps:
(1) seed DNA obtains; (2) pcr amplification; (3) agarose gel electrophoresis.
6. a kind of detection method that the light Chinese sorghum detects that is used for according to claim 5 is characterized in that PCR reaction cumulative volume is 30 μ l in the step (2), wherein comprises: Tri(Hydroxymethyl) Amino Methane Hydrochloride Tris-HCl, KCl, MgCl
2, dATP, dGTP, dCTP, dTTP, primer and Taq archaeal dna polymerase; Adding distilled water to final volume is 30 μ l, and mixing is centrifugal, places the PCR instrument to increase.
7. a kind of detection method that the light Chinese sorghum detects that is used for according to claim 5 is characterized in that getting in (3) in the step amplified production and adds damping fluid, and mixing carries out 1.5% agarose gel electrophoresis.
8. a kind of detection method that the light Chinese sorghum detects that is used for according to claim 7 is characterized in that amplified production is 10 μ L in the step (3), and damping fluid is 0.25% bromjophenol blue, quality volumn concentration 40% (W/V) aqueous sucrose solution.
9. one kind is used for the detection method that the light Chinese sorghum detects, and it is characterized in that testing process comprises the steps:
(1) seed DNA obtains
Single seed grinds, and extracts according to following steps:
(a) grind seed in the liquid nitrogen in the 1.5mL centrifuge tube, add 500 μ LTES, TES is by 100mM Tris, pH=8.0, and 10mM EDTA, 2%SDS forms;
(b) add 7 μ L Proteinase K mixings, place 55 ℃ of water-bath 60～120min, during mixing several times;
(c) regulate salt concn to 1.4M, add 10% hexadecane trimethyl ammonium bromide of 1/10 volume, place 65 ℃ of water-bath 10min;
(d) add isopyknic SEVGA mixing, SEVGA is a chloroform: primary isoamyl alcohol=24: 1, can not be too violent, and to guarantee the integrity of DNA, hatch 30min for 0 ℃;
(e) 4 ℃ 13, the centrifugal 10min of 000r/min gets supernatant to the 1.5mL centrifuge tube;
(f) add 225 μ L 5M ammonium acetate mixings, hatch more than the 30min for 0 ℃, 4 ℃ 13, the centrifugal 2min of 000r/min;
(g) get supernatant, add 3 μ L ribonuclease As, 37 ℃ of water-bath 30min are to remove RNA;
(h) add the pre-cold isopropanol of 0.55 volume, place more than the 30min for-20 ℃;
(i) 4 ℃ 13, the centrifugal 15～20min of 000r/min abandons Virahol, and 70% ethanol is washed 2 times, drying at room temperature, and 50 μ LTE or distilled water dissolving, TE is 10mM Tris, 1mM EDTA, pH=8.0;
(2) pcr amplification;
Utilize primer N3/N5:
Carry out pcr amplification, PCR reaction cumulative volume is 30 μ l, and comprise: 10mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride Tris-HCl, 50mmol/L and pH are 8.3 KCl, 1.5mmol/L MgCl
2, dATP, dGTP, dCTP, dTTP concentration is that 100 μ mol/L, primer concentration are 100nmol/L; The Taq archaeal dna polymerase is 0.5U; Adding distilled water to final volume is 30 μ l, and mixing is centrifugal, places the PCR instrument to increase; Amplified reaction program: pre-95 ℃ of 3min of sex change; 94 ℃ of 30s then, 60 ℃ of 30s, 72 ℃ of 1min circulate 30 times;
(3) agarose gel electrophoresis
Get amplified production 10 μ L, add 3 μ L sample-loading buffer mixings, 1.5% agarose gel electrophoresis, the imaging deposit in the gel imaging instrument of EB dyeing back, wherein damping fluid is 0.25% bromjophenol blue, quality volumn concentration 40% (W/V) aqueous sucrose solution.
10. be used for the purposes that the light Chinese sorghum detects according to any described primer of claim of claim 1-3.
11. be used for the purposes that the light Chinese sorghum detects according to any described detection method of claim of claim 4-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100375765A CN101245372A (en) | 2007-02-15 | 2007-02-15 | S.nitidum (Vahl) Pers. testing primer and testing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100375765A CN101245372A (en) | 2007-02-15 | 2007-02-15 | S.nitidum (Vahl) Pers. testing primer and testing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101245372A true CN101245372A (en) | 2008-08-20 |
Family
ID=39946052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007100375765A Pending CN101245372A (en) | 2007-02-15 | 2007-02-15 | S.nitidum (Vahl) Pers. testing primer and testing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101245372A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151578A (en) * | 2021-06-11 | 2021-07-23 | 兰州大学 | DNA barcode standard detection gene for distinguishing different elephant grass varieties and application thereof |
-
2007
- 2007-02-15 CN CNA2007100375765A patent/CN101245372A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151578A (en) * | 2021-06-11 | 2021-07-23 | 兰州大学 | DNA barcode standard detection gene for distinguishing different elephant grass varieties and application thereof |
| CN113151578B (en) * | 2021-06-11 | 2022-05-27 | 兰州大学 | DNA barcode standard detection gene for distinguishing different elephant grass varieties and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103060318B (en) | SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group | |
| CN103497996B (en) | A kind of for detecting the molecule marker InDel 587 of paddy plum No. 4 blast resistant genes Pigm (t) | |
| CN108977571B (en) | Fluorescent PCR detection kit for identifying four medicinal plants in Araceae and application thereof | |
| CN105483282A (en) | PCR specificity identifying primers and paris polyphylla identifying method adopting same | |
| CN104073550B (en) | A kind of SCAR molecular marker differentiating Fructus Momordicae sex | |
| CN104004845B (en) | Identify that whether kind to be measured is method and the primer special group thereof of CCRI 63 | |
| CN107164471A (en) | The method for identifying molecules of the muscardine true and false in a kind of quick discriminating Chinese medicine stiff silkworm | |
| CN102134602B (en) | Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof | |
| Kitani et al. | Genetic diversity of Ephedra plants in Mongolia inferred from internal transcribed spacer sequence of nuclear ribosomal DNA | |
| CN108251553A (en) | A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN101245372A (en) | S.nitidum (Vahl) Pers. testing primer and testing method | |
| CN109022606B (en) | A kind of passion fruit cultivar identification primer special and its cultivar identification method | |
| CN103773867A (en) | LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method | |
| CN104109715A (en) | Molecular marker for identifying soybean pubescence color and identification method by using same | |
| CN103276097B (en) | PCR detection method for identifying germplasms of four populations of Pelodiscus sinensis, primer group and kit | |
| CN101302565A (en) | Method for rapid detecting transgenic maize BT176 | |
| CN103555836A (en) | Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof | |
| CN102517391B (en) | Method for detecting leopard bone component in mixture and primer applied | |
| CN101988126B (en) | Nucleic acid composition for detecting Datura ferox and application thereof | |
| CN104561270B (en) | The molecular biology differentiating method of two kinds of rice leaf folder larvas | |
| CN104017875B (en) | For detecting the primer pair of lolium temulentum, probe and detection method thereof | |
| CN103966198A (en) | Plant DNA (Deoxyribose Nucleic Acid) rapid extraction method | |
| CN101748174A (en) | DNA rapid extraction method for single-seed of sorghum halepense and similar species | |
| CN105087800A (en) | PCR (polymerase chain reaction) detection primer and reagent kit for camellia root-knot nematode |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080820 |