CN103555836A - Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof - Google Patents
Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof Download PDFInfo
- Publication number
- CN103555836A CN103555836A CN201310513600.3A CN201310513600A CN103555836A CN 103555836 A CN103555836 A CN 103555836A CN 201310513600 A CN201310513600 A CN 201310513600A CN 103555836 A CN103555836 A CN 103555836A
- Authority
- CN
- China
- Prior art keywords
- primer pair
- sequence
- bands
- single strand
- banding pattern
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for authenticating whether a to-be-detected variety is Ruiza816 and a special primer group thereof. The method provided by the invention comprises the step of carrying out PCR (polymerase chain reaction) amplification by taking the gene group DNA of to-be-detected cotton as a template and by adopting a CS62 primer pair, an NAU1103 primer pair, an NAU1186 primer pair, an NAU1233 primer pair, an NAU2026 primer pair, an NAU2274 primer pair, a CIR062 primer pair, an NAU1071 primer pair, an NAU1085 primer pair, an NAU1102 primer pair, an NAU1196 primer pair, an NAU1255 primer pair, an NAU1369 primer pair, an NAU2173 primer pair and an NAU2277 primer pair, wherein if PCR amplification products meet the requirements of 13 items above from standard (1) to standard (15), the to-be-detected cotton is Ruiza816. According to the invention, the seed production quality of Ruiza816 is monitored, the quality of sold Ruiza816 seeds is ensured, counterfeit Ruiza816 seeds are controlled, the intellectual property of a breeding person is protected, and the variety right is protected.
Description
Technical field
The present invention relates to a kind ofly identify that whether kind to be measured is auspicious assorted 816 method and primer special group thereof.
Background technology
The hybrid vigour of cotton is obvious, and hybrid cotton kind has been applied for many years, and effect of increasing production is obvious, has obtained large-area applying.The hybrid seeding of cotton still be take artificial seed as main at present, and sterile lines seed making is not also promoted, and along with rising steadily of recruitment cost, hybrid seeding cost is more and more higher, and worse and worse, the hybrid cotton seed of selling on market rehearses seriously seed quality, has F
2substitute F
1, have the conventional cotton F of substituting
1, there are the phenomenons such as maternal doping, make cross-fertilize seed in popularization, not reach due effect of increasing production, affect the promotion effect of hybrid cotton.The conventional field test time is long, and the seed that can affect is then sold, and in Hainan, add generation while identifying due to affected by environment, identification result is ideal not bery also.
Auspicious assorted 816 participate in the hybridization cotton region examination in cotton region, the Huanghe valley in 2005-2006, within 2006, participated in production test simultaneously, Comprehensive Traits is good, yielding ability is good, fibrous quality is good, and disease resistance is good, within 2007, has passed through national authorization, within 2009, be proposed as the check variety of hybridization cotton region, Huanghe valley examination, application so far.
Summary of the invention
The object of this invention is to provide and a kind ofly identify that whether kind to be measured is auspicious assorted 816 method and primer special group thereof.
The invention provides a kind of identify or whether assistant identification cotton to be measured is auspicious assorted 816 method, comprise the steps:
The genomic dna of cotton to be measured of take is template, adopt respectively CS62 primer pair, NAU1103 primer pair, NAU1186 primer pair, NAU1233 primer pair, NAU2026 primer pair, NAU2274 primer pair, CIR062 primer pair, NAU1071 primer pair, NAU1085 primer pair, NAU1102 primer pair, NAU1196 primer pair, NAU1255 primer pair, NAU1369 primer pair, NAU2173 primer pair and NAU2277 primer pair carry out pcr amplification, if pcr amplification product meet standard (1) in standard (15) more than 13, cotton to be measured be auspicious assorted 816 or cotton to be measured be candidate auspicious assorted 816,
Described CS62 primer pair is comprised of the single strand dna shown in the sequence 2 of the single strand dna shown in the sequence 1 of sequence table and sequence table; Described NAU1103 primer pair is comprised of the single strand dna shown in the sequence 4 of the single strand dna shown in the sequence 3 of sequence table and sequence table; Described NAU1186 primer pair is comprised of the single strand dna shown in the sequence 6 of the single strand dna shown in the sequence 5 of sequence table and sequence table; Described NAU1233 primer pair is comprised of the single strand dna shown in the sequence 8 of the single strand dna shown in the sequence 7 of sequence table and sequence table; Described NAU2026 primer pair is comprised of the single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of sequence table and sequence table; Described NAU2274 primer pair is comprised of the single strand dna shown in the sequence 12 of the single strand dna shown in the sequence 11 of sequence table and sequence table; Described CIR062 primer pair is comprised of the single strand dna shown in the sequence 14 of the single strand dna shown in the sequence 13 of sequence table and sequence table; Shown in NAU1071 primer pair by the single strand dna shown in the sequence 16 of the single strand dna shown in the sequence 15 of sequence table and sequence table, formed; Described NAU1085 primer pair is comprised of the single strand dna shown in the sequence 18 of the single strand dna shown in the sequence 17 of sequence table and sequence table; Described NAU1102 primer pair is comprised of the single strand dna shown in the sequence 20 of the single strand dna shown in the sequence 19 of sequence table and sequence table; Described NAU1196 primer pair is comprised of the single strand dna shown in the sequence 22 of the single strand dna shown in the sequence 21 of sequence table and sequence table; Shown in NAU1255 primer pair by the single strand dna shown in the sequence 24 of the single strand dna shown in the sequence 23 of sequence table and sequence table, formed; Described NAU1369 primer pair is comprised of the single strand dna shown in the sequence 26 of the single strand dna shown in the sequence 25 of sequence table and sequence table; Described NAU2173 primer pair is comprised of the single strand dna shown in the sequence 28 of the single strand dna shown in the sequence 27 of sequence table and sequence table; Described NAU2277 primer pair is comprised of the single strand dna shown in the sequence 30 of the single strand dna shown in the sequence 29 of sequence table and sequence table;
Standard (1): while adopting CS62 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, thering are 2 bands between 404bp and 353bp, there are 3 bands between 242bp and 190bp;
Standard (2): while adopting NAU1103 primer pair, meet following banding pattern: there are 4 bands between 353bp and 242bp, thering is 1 band between 242bp and 190bp, there are 2 bands between 190bp and 147bp;
Standard (3): while adopting NAU1186 primer pair, meet following banding pattern: there are 3 bands between 404bp and 353bp, thering are 2 bands between 353bp and 242bp, there are 3 bands between 190bp and 147bp;
Standard (4): while adopting NAU1233 primer pair, meet following banding pattern: be greater than 501bp and there is 1 band, there is 1 band between 501bp and 489bp, thering are 2 bands between 489bp and 404bp, there are 2 bands between 353bp and 242bp;
Standard (5): while adopting NAU2026 primer pair, meet following banding pattern: there are 5 bands between 489bp and 353bp, thering is 1 band between 353bp and 242bp, thering are 2 bands between 242bp and 190bp, there is 1 band between 190bp and 147bp;
Standard (6): while adopting NAU2274 primer pair, meet following banding pattern: there are 3 bands between 190bp and 147bp, there are 5 bands between 147bp and 110bp;
Standard (7): while adopting CIR062 primer pair, meet following banding pattern: there are 2 bands between 404bp and 353bp, there are 3 bands between 242bp and 190bp;
Standard (8): while adopting NAU1071 primer pair, meet following banding pattern: there are 2 bands between 353bp and 242bp, there are 2 bands between 190bp and 147bp;
Standard (9): while adopting NAU1085 primer pair, meet following banding pattern: there is 1 band between 489bp and 404bp, there are 2 bands between 353bp and 242bp;
Standard (10): while adopting NAU1102 primer pair, meet following banding pattern: be greater than 501bp and there are 2 bands, there are 2 bands between 242bp and 190bp;
Standard (11): while adopting NAU1196 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, there are 2 bands between 242bp and 190bp;
Standard (12): while adopting NAU1255 primer pair, meet following banding pattern: there is 1 band between 404bp and 353bp, there are 2 bands between 242bp and 190bp;
Standard (13): while adopting NAU1369 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, there is 1 band between 242bp and 190bp;
Standard (14): while adopting NAU2173 primer pair, meet following banding pattern: there is 1 band between 242bp and 190bp;
Standard (15): while adopting NAU2277 primer pair, meet following banding pattern: there is 1 band between 242bp and 190bp, there is 1 band between 147bp and 110bp.
Above-mentioned banding pattern is specifically master tape banding pattern.
The response procedures of described pcr amplification specifically can be: 94 ℃ of denaturation 3min; 94 ℃ of sex change 30s, 56 ℃ of annealing 45s, 72 ℃ of extension 45s, 30 circulations; 94 ℃ of sex change 1min, 56 ℃ of annealing 45s, 72 ℃ of extension 2min.
For the identification of or assistant identification cotton to be measured be whether auspicious assorted 816 primer sets, by described CS62 primer pair, described NAU1103 primer pair, described NAU1186 primer pair, described NAU1233 primer pair, described NAU2026 primer pair, described NAU2274 primer pair, described CIR062 primer pair, described NAU1071 primer pair, described NAU1085 primer pair, described NAU1102 primer pair, described NAU1196 primer pair, described NAU1255 primer pair, described NAU1369 primer pair, described NAU2173 primer pair and described NAU2277 primer pair, formed.
The present invention also protects described primer sets for the preparation of identifying or whether assistant identification cotton to be measured is the application in auspicious assorted 816 test kit.
The present invention also protect a kind of for the identification of or assistant identification cotton to be measured be whether auspicious assorted 816 test kit, contain described primer sets.
Whether the present invention screens and has excavated 15 SSR primer pairs, can be auspicious assorted 816 for the identification of seed to be measured, and collection of illustrative plates is clear, speed is fast, and be not subject to the impact of environment, thereby can identify commercially available verity and the purity for auspicious assorted 816 seed of being known as, can the correct seed of judgement fast be applied.The present invention is for the quality of auspicious assorted 816 the production of hybrid seeds of monitoring, and can judgement seed purchase processing, guarantees the quality of auspicious assorted 816 seeds of sale, hits auspicious assorted 816 seeds of personation simultaneously, protects breeding people's intellecture property, and protection kind power has great value.
Accompanying drawing explanation
Fig. 1 to Figure 15 is the result collection of illustrative plates (in each electrophorogram, upper end is macromolecule, and lower end is small molecules amount) of embodiment 1.
Banding pattern enlarged view (in each electrophorogram, upper end is macromolecule, and lower end is small molecules amount) when Figure 16 to Figure 30 adopts primer pair for each.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.
Cotton variety " auspicious assorted 816 ": Jinan Xin Ruizhong industry Science and Technology Ltd..Auspicious assorted 816 male parent: Jinan Xin Ruizhong industry Science and Technology Ltd..Auspicious assorted 816 female parent: Jinan Xin Ruizhong industry Science and Technology Ltd..Cotton variety " in plant cotton No. 2 ": seed of forest industry company limited of Henan section.Cotton variety " Shandong cotton is ground No. 28 ": Shandong Cotton Research Center.
The structure of embodiment 1, auspicious assorted 816 DNA fingerprinting
One, the screening of SSR primer pair
Through a large amount of cotton SSR primer screenings, find that 15 SSR primer pairs (nucleotide sequence is in Table 1) can be for making auspicious assorted 816 DNA fingerprinting.
The nucleotide sequence of table 115 primer pair
| Sequence number | ? | Forward primer (5 ' → 3 ') | Reverse primer (5 ' → 3 ') |
| 1 | CS62 primer pair | GATGGCTACCTCCCTTTGTA(sequence 1) | CGTAAGGAAGCCTAGCAAAA(sequence 2) |
| 2 | NAU1103 primer pair | GGAGCCAGAAGTTGAGAAAA(sequence 3) | TTCGGCTTCTGCTTTTACTT(sequence 4) |
| 3 | NAU1186 primer pair | AATGGTCCTGCTCCAGATT(sequence 5) | AATCGTCGTCGTCGAATTAT(sequence 6) |
| 4 | NAU1233 primer pair | TTCGGGAAAGTTAGAGGAGA(sequence 7) | TCCTCAGAGCTCGGAATAGT(sequence 8) |
| 5 | NAU2026 primer pair | GAATCTCGAAAACCCCATCT(sequence 9) | ATTTGGAAGCGAAGTACCAG(sequence 10) |
| 6 | NAU2274 primer pair | TCCTCGGATTATCAAAACCT(sequence 11) | TGAAGAGGACATTGATGACG(sequence 12) |
| 7 | CIR062 primer pair | TTTAGAGGAGAAGTTTAGG(sequence 13) | CAGTCTCTTGTAGTTTCATT(sequence 14) |
| 8 | NAU1071 primer pair | ACCAACAATGGTGACCTCTT(sequence 15) | CCCTCCATAACCAAAAGTTG(sequence 16) |
| 9 | NAU1085 primer pair | AGTCGCCCCTTCTCTAATTT(sequence 17) | TGTAAACCGAACTCGTTGTG(sequence 18) |
| 10 | NAU1102 primer pair | ATCTCTCTGTCTCCCCCTTC(sequence 19) | GCATATCTGGCGGGTATAAT(sequence 20) |
| 11 | NAU1196 primer pair | ATCTGTTTCCGTACCCTCAA(sequence 21) | ATGGTTGCCCAAACAATACT(sequence 22) |
| 12 | NAU1255 primer pair | CATGCAAATCCATGCTAGAG(sequence 23) | GGTTTCTTTGGTGGTGAAAC(sequence 24) |
| 13 | NAU1369 primer pair | TGGCAGAGATGAATGTAAGC(sequence 25) | GGTAACGGATGGAAAATCAC(sequence 26) |
| 14 | NAU2173 primer pair | GCCAAATAGGTCACACACAA(sequence 27) | AGCGAGAAGGAGACAGAAAA(sequence 28) |
| 15 | NAU2277 primer pair | GAACTAGCCACATGATGCAC(sequence 29) | TTGTTGAGGCATTAGTTTGC(sequence 30) |
Two, the making of DNA fingerprinting
The genomic dna of auspicious assorted 816 male parent (10 repeated sample) of take is respectively template, carries out PCR evaluation respectively with 15 SSR primer pairs, then carries out 8% polyacrylamide gel electrophoresis silver and dyes colour developing.The genomic dna of auspicious assorted 816 female parent (10 repeated sample) of take is respectively template, carries out PCR evaluation respectively with 15 SSR primer pairs, then carries out 8% polyacrylamide gel electrophoresis silver and dyes colour developing.Auspicious assorted 816 male parent and auspicious assorted 816 female parent are hybridized, obtain F
1for seed, F
1the plant forming for cultivating seeds is F
1for plant, (from large Tanaka, choose at random 24 strain F
1for plant, called after plant 1 is to plant 24 successively; F
1for plant, be auspicious assorted 816 in theory, but conventionally because crossover process operant level is limit,, there is the phenomenon of adulterating in more difficult 100% the purity that realizes).Respectively with F
1for plant 1 to the genomic dna of the blade of plant 24, be template, with 15 SSR primer pairs, carry out PCR evaluation respectively, then carry out 8% polyacrylamide gel electrophoresis silver and dye colour developing.
PCR system is 10.0 μ L, and containing 0.5U Taq enzyme, the concentration of forward primer and reverse primer is 0.5 μ M.
PCR response procedures: 94 ℃ of denaturation 3min; 94 ℃ of sex change 30s, 56 ℃ of annealing 45s, 72 ℃ of extension 45s, 30 circulations; 94 ℃ of sex change 1min, 56 ℃ of annealing 45s, 72 ℃ of extension 2min, 4 ℃ of preservations.
The parameter of polyacrylamide gel electrophoresis is as follows: the point sample amount in every hole is 1.8 μ L; 200v voltage, 50min.
Adopt the collection of illustrative plates of CS62 primer pair to see Fig. 1.The banding pattern of 10 auspicious male parents of assorted 816 is all consistent, represents the banding pattern (banding pattern enlarged view is shown in Figure 16) of auspicious assorted 816 male parent with " 1 ".10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent auspicious assorted 816 maternal banding pattern (banding pattern enlarged view is shown in Figure 16).With " 3 ", represent auspicious assorted 816 male parent and auspicious assorted 816 maternal codominance banding pattern (banding pattern enlarged view is shown in Figure 16).The banding pattern of plant 4 and plant 22 is " 2 ", all the other 22 strain F
1banding pattern for plant is " 3 ".
Adopt the collection of illustrative plates of NAU1103 primer pair to see Fig. 2.The banding pattern of 10 auspicious male parents of assorted 816 is all consistent, represents the banding pattern (banding pattern enlarged view is shown in Figure 17) of auspicious assorted 816 male parent with " 2 ".10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 1 ", represent auspicious assorted 816 maternal banding pattern (banding pattern enlarged view is shown in Figure 17).With " 3 ", represent auspicious assorted 816 male parent and auspicious assorted 816 maternal codominance banding pattern (banding pattern enlarged view is shown in Figure 17).The banding pattern of plant 4 and plant 22 is " 1 ", all the other 22 strain F
1banding pattern for plant is " 3 ".
Adopt the collection of illustrative plates of NAU1186 primer pair to see Fig. 3.The banding pattern of 10 auspicious male parents of assorted 816 is all consistent, represents the banding pattern (banding pattern enlarged view is shown in Figure 18) of auspicious assorted 816 male parent with " 2 ".10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 1 ", represent auspicious assorted 816 maternal banding pattern (banding pattern enlarged view is shown in Figure 18).With " 3 ", represent auspicious assorted 816 male parent and auspicious assorted 816 maternal codominance banding pattern (banding pattern enlarged view is shown in Figure 18).The banding pattern of plant 22 is " 1 ", all the other 23 strain F
1banding pattern for plant is " 3 ".
Adopt the collection of illustrative plates of NAU1233 primer pair to see Fig. 4.The banding pattern of 10 auspicious male parents of assorted 816 is all consistent, represents the banding pattern (banding pattern enlarged view is shown in Figure 19) of auspicious assorted 816 male parent with " 1 ".10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent auspicious assorted 816 maternal banding pattern (banding pattern enlarged view is shown in Figure 19).With " 3 ", represent auspicious assorted 816 male parent and auspicious assorted 816 maternal codominance banding pattern (banding pattern enlarged view is shown in Figure 19).The banding pattern of plant 4 and plant 22 is " 2 ", all the other 22 strain F
1banding pattern for plant is " 3 ".
Adopt the collection of illustrative plates of NAU2026 primer pair to see Fig. 5.The banding pattern of 10 auspicious male parents of assorted 816 is all consistent, represents the banding pattern (banding pattern enlarged view is shown in Figure 20) of auspicious assorted 816 male parent with " 2 ".10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 1 ", represent auspicious assorted 816 maternal banding pattern (banding pattern enlarged view is shown in Figure 20).With " 3 ", represent auspicious assorted 816 male parent and auspicious assorted 816 maternal codominance banding pattern (banding pattern enlarged view is shown in Figure 20).The banding pattern of plant 22 is " 1 ", all the other 23 strain F
1banding pattern for plant is " 3 ".
Adopt the collection of illustrative plates of NAU2274 primer pair to see Fig. 6.The banding pattern of 10 auspicious male parents of assorted 816 is all consistent, represents the banding pattern (banding pattern enlarged view is shown in Figure 21) of auspicious assorted 816 male parent with " 1 ".10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent auspicious assorted 816 maternal banding pattern (banding pattern enlarged view is shown in Figure 21).With " 3 ", represent auspicious assorted 816 male parent and auspicious assorted 816 maternal codominance banding pattern (banding pattern enlarged view is shown in Figure 21).The banding pattern of plant 4 and plant 22 is " 2 ", all the other 22 strain F
1banding pattern for plant is " 3 ".
Adopt the collection of illustrative plates of CIR062 primer pair to see Fig. 7.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 1 ", represent (banding pattern enlarged view is shown in Figure 22).The banding pattern of plant 4 and male parent and maternal banding pattern be inconsistent (with " 3 ", representing) (banding pattern enlarged view is shown in Figure 22) all, all the other 23 strain F
1banding pattern for plant is " 1 ".
Adopt the collection of illustrative plates of NAU1071 primer pair to see Fig. 8.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent (banding pattern enlarged view is shown in Figure 23).The banding pattern of plant 4 and male parent and maternal banding pattern be inconsistent (with " 3 ", representing) (banding pattern enlarged view is shown in Figure 23) all, all the other 23 strain F
1banding pattern for plant is " 2 ".
Adopt the collection of illustrative plates of NAU1085 primer pair to see Fig. 9.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent (banding pattern enlarged view is shown in Figure 24).The banding pattern of 24 strain F1 generation plant is " 2 ".
Adopt the collection of illustrative plates of NAU1102 primer pair to see Figure 10.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent (banding pattern enlarged view is shown in Figure 25).The banding pattern of plant 4 and male parent and maternal banding pattern be inconsistent (with " 3 ", representing) (banding pattern enlarged view is shown in Figure 25) all, all the other 23 strain F
1banding pattern for plant is " 2 ".
Adopt the collection of illustrative plates of NAU1196 primer pair to see Figure 11.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent (banding pattern enlarged view is shown in Figure 26).24 strain F
1banding pattern for plant is " 2 ".
Adopt the collection of illustrative plates of NAU1255 primer pair to see Figure 12.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 1 ", represent (banding pattern enlarged view is shown in Figure 27).The banding pattern of plant 4 and male parent and maternal banding pattern be inconsistent (with " 3 ", representing) (banding pattern enlarged view is shown in Figure 27) all, all the other 23 strain F
1banding pattern for plant is " 1 ".
Adopt the collection of illustrative plates of NAU1369 primer pair to see Figure 13.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent (banding pattern enlarged view is shown in Figure 28).The banding pattern of plant 4 and male parent and maternal banding pattern be inconsistent (with " 3 ", representing) (banding pattern enlarged view is shown in Figure 28) all, all the other 23 strain F
1banding pattern for plant is " 2 ".
Adopt the collection of illustrative plates of NAU2173 primer pair to see Figure 14.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 1 ", represent (banding pattern enlarged view is shown in Figure 29).24 strain F
1banding pattern for plant is " 1 ".
Adopt the collection of illustrative plates of NAU2277 primer pair to see Figure 15.10 auspicious male parents of assorted 816 and 10 auspicious maternal banding patterns of assorted 816 are all consistent, with " 2 ", represent (banding pattern enlarged view is shown in Figure 30).The banding pattern of plant 4 and male parent and maternal banding pattern be inconsistent (with " 3 ", representing) (banding pattern enlarged view is shown in Figure 30) all, all the other 23 strain F
1banding pattern for plant is " 2 ".
In Fig. 1 to Figure 15, swimming lane 1 to 10 is 10 male parent samples, and swimming lane 11 to 20 is 10 maternal samples, and swimming lane 21 to 44 is 24 strain F
1for plant (being followed successively by plant 1 sample to plant 24 samples).
Fig. 1 to Figure 15 the results are shown in Table 2.
The result of table 2 Fig. 1 to Figure 15 (banding pattern)
To above-mentioned 24 strain F
1for plant, carry out field shape observation, plant 4 cane fine hair are obviously more, blade is fold comparatively, plant 22 is consistent with auspicious assorted 816 maternal phenotype (should be auspicious assorted 816 maternal selfed seed, formerly fail all to remove stamen when being the production of hybrid seeds), it is as follows that remaining 22 strain plant is auspicious assorted 816(phenotype: cane fine hair is rare, and blade is comparatively smooth, and cotton boll is larger).
Based on the above results, can draw the conclusion shown in table 3.
The conclusion that table 3 draws based on table 2 (banding pattern)
Concrete judgment criteria is as follows:
Standard (1): while adopting CS62 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, thering are 2 bands between 404bp and 353bp, there are 3 bands between 242bp and 190bp;
Standard (2): while adopting NAU1103 primer pair, meet following banding pattern: there are 4 bands between 353bp and 242bp, thering is 1 band between 242bp and 190bp, there are 2 bands between 190bp and 147bp;
Standard (3): while adopting NAU1186 primer pair, meet following banding pattern: there are 3 bands between 404bp and 353bp, thering are 2 bands between 353bp and 242bp, there are 3 bands between 190bp and 147bp;
Standard (4): while adopting NAU1233 primer pair, meet following banding pattern: be greater than 501bp and there is 1 band, there is 1 band between 501bp and 489bp, thering are 2 bands between 489bp and 404bp, there are 2 bands between 353bp and 242bp;
Standard (5): while adopting NAU2026 primer pair, meet following banding pattern: there are 5 bands between 489bp and 353bp, thering is 1 band between 353bp and 242bp, thering are 2 bands between 242bp and 190bp, there is 1 band between 190bp and 147bp;
Standard (6): while adopting NAU2274 primer pair, meet following banding pattern: there are 3 bands between 190bp and 147bp, there are 5 bands between 147bp and 110bp;
Standard (7): while adopting CIR062 primer pair, meet following banding pattern: there are 2 bands between 404bp and 353bp, there are 3 bands between 242bp and 190bp;
Standard (8): while adopting NAU1071 primer pair, meet following banding pattern: there are 2 bands between 353bp and 242bp, there are 2 bands between 190bp and 147bp;
Standard (9): while adopting NAU1085 primer pair, meet following banding pattern: there is 1 band between 489bp and 404bp, there are 2 bands between 353bp and 242bp;
Standard (10): while adopting NAU1102 primer pair, meet following banding pattern: be greater than 501bp and there are 2 bands, there are 2 bands between 242bp and 190bp;
Standard (11): while adopting NAU1196 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, there are 2 bands between 242bp and 190bp;
Standard (12): while adopting NAU1255 primer pair, meet following banding pattern: there is 1 band between 404bp and 353bp, there are 2 bands between 242bp and 190bp;
Standard (13): while adopting NAU1369 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, there is 1 band between 242bp and 190bp;
Standard (14): while adopting NAU2173 primer pair, meet following banding pattern: there is 1 band between 242bp and 190bp;
Standard (15): while adopting NAU2277 primer pair, meet following banding pattern: there is 1 band between 242bp and 190bp, there is 1 band between 147bp and 110bp.
The genome of individual plant to be measured of take is template, adopts respectively above-mentioned 15 pairs of primers to carry out pcr amplification, if the banding pattern of pcr amplification product meets 13 above (comprising 13) in above 15 standards, judges that individual plant to be measured is auspicious assorted 816.The SSR mark purity that to be judged as per-cent that auspicious assorted 816 strain number accounts for total strain number to be measured be plant to be measured.
24 F
1for there being 22 plant to meet above-mentioned banding pattern judging criterion in plant, the 4th and the 22nd strain does not meet standard, is decided to be hybrid strain, and SSR mark purity is 91.7%.F
1sSR mark purity for two parents of plant is 100%.
The application of embodiment 2, auspicious assorted 816 DNA fingerprinting
Take respectively auspicious assorted 816, in plant cotton No. 2 or Shandong cotton to grind the genomic dna of No. 28 be template, with 15 SSR primer pairs, carry out PCR evaluation respectively, then carry out 8% polyacrylamide gel electrophoresis silver and dye colour developing.
PCR system is 10.0 μ L, and containing 0.5U Taq enzyme, the concentration of forward primer and reverse primer is 0.5 μ M.
PCR response procedures: 94 ℃ of denaturation 3min; 94 ℃ of sex change 30s, 56 ℃ of annealing 45s, 72 ℃ of extension 45s, 30 circulations; 94 ℃ of sex change 1min, 56 ℃ of annealing 45s, 72 ℃ of extension 2min, 4 ℃ of preservations.
The parameter of polyacrylamide gel electrophoresis is as follows: the point sample amount in every hole is 1.8 μ L; 200v voltage, 50min.
The results are shown in Table 4.
The result of table 4 the present embodiment (banding pattern)
Adopt CS62 primer pair, auspicious assorted 816 banding pattern be " 3 ", in plant and cottonly grind the banding pattern of No. 28 with Shandong cotton No. 2 and be " 2 ".
Adopt NAU1103 primer pair, auspicious assorted 816 banding pattern be " 3 ", in plant and cottonly grind the banding pattern of No. 28 with Shandong cotton No. 2 and be " 1 ".
Adopt NAU1186 primer pair, auspicious assorted 816 banding pattern be " 3 ", in plant and cottonly grind the banding pattern of No. 28 with Shandong cotton No. 2 and be " 2 ".
Adopt NAU1233 primer pair, auspicious assorted 816 banding pattern be " 3 ", in plant and cottonly grind the banding pattern of No. 28 with Shandong cotton No. 2 and be " 2 ".
Adopt NAU2026 primer pair, auspicious assorted 816 banding pattern be " 3 ", in to plant the banding pattern of cotton No. 2 be " 2 ", it is " 1 " that Shandong cotton is ground the banding pattern of No. 28.
Adopt NAU2274 primer pair, auspicious assorted 816 banding pattern be " 3 ", in plant and cottonly grind the banding pattern of No. 28 with Shandong cotton No. 2 and be " 2 ".
Adopt CIR062 primer pair, auspicious assorted 816 banding pattern be " 1 ", in plant and cottonly grind the banding pattern of No. 28 with Shandong cotton No. 2 and be " 2 " (banding pattern enlarged view is shown in Figure 22).
Adopt NAU1071 primer pair, auspicious assorted 816 banding pattern be " 2 ", in plant cotton No. 2 and Shandong cotton grind No. 28 banding pattern all from auspicious mix that 816 is different but these both banding patterns are identical, with " 1 " expression (banding pattern enlarged view is shown in Figure 23).
Adopt NAU1085 primer pair, auspicious assorted 816, in plant cotton No. 2 and Shandong cotton and grind the banding pattern of No. 28 and be " 2 ".
Adopt NAU1102 primer pair, auspicious assorted 816 banding pattern be " 2 ", in plant cotton No. 2 and Shandong cotton grind No. 28 banding pattern all from auspicious mix that 816 is different but these both banding patterns are identical, with " 1 " expression (banding pattern enlarged view is shown in Figure 25).
Adopt NAU1196 primer pair, auspicious assorted 816 banding pattern and in plant the banding pattern of cotton No. 2 and be " 2 ", Shandong cotton grind No. 28 banding pattern with auspicious assorted 816 different, with " 1 " expression (banding pattern enlarged view is shown in Figure 26).
Adopt NAU1255 primer pair, auspicious assorted 816, in plant cotton No. 2 and Shandong cotton and grind the banding pattern of No. 28 and be " 1 ".
Adopt NAU1369 primer pair, auspicious assorted 816 banding pattern and in plant the banding pattern of cotton No. 2 and be " 2 ", Shandong cotton grind No. 28 banding pattern with auspicious assorted 816 different, with " 1 " expression (banding pattern enlarged view is shown in Figure 28).
Adopt NAU2173 primer pair, auspicious assorted 816, in plant cotton No. 2 and Shandong cotton and grind the banding pattern of No. 28 and be " 1 ".
Adopt NAU2277 primer pair, auspicious assorted 816, in plant cotton No. 2 and Shandong cotton and grind the banding pattern of No. 28 and be " 2 ".
Claims (4)
1. identify or whether assistant identification cotton to be measured is an auspicious method of assorted 816, comprise the steps:
The genomic dna of cotton to be measured of take is template, adopt respectively CS62 primer pair, NAU1103 primer pair, NAU1186 primer pair, NAU1233 primer pair, NAU2026 primer pair, NAU2274 primer pair, CIR062 primer pair, NAU1071 primer pair, NAU1085 primer pair, NAU1102 primer pair, NAU1196 primer pair, NAU1255 primer pair, NAU1369 primer pair, NAU2173 primer pair and NAU2277 primer pair carry out pcr amplification, if pcr amplification product meet standard (1) in standard (15) more than 13, cotton to be measured be auspicious assorted 816 or cotton to be measured be candidate auspicious assorted 816,
Described CS62 primer pair is comprised of the single strand dna shown in the sequence 2 of the single strand dna shown in the sequence 1 of sequence table and sequence table; Described NAU1103 primer pair is comprised of the single strand dna shown in the sequence 4 of the single strand dna shown in the sequence 3 of sequence table and sequence table; Described NAU1186 primer pair is comprised of the single strand dna shown in the sequence 6 of the single strand dna shown in the sequence 5 of sequence table and sequence table; Described NAU1233 primer pair is comprised of the single strand dna shown in the sequence 8 of the single strand dna shown in the sequence 7 of sequence table and sequence table; Described NAU2026 primer pair is comprised of the single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of sequence table and sequence table; Described NAU2274 primer pair is comprised of the single strand dna shown in the sequence 12 of the single strand dna shown in the sequence 11 of sequence table and sequence table; Described CIR062 primer pair is comprised of the single strand dna shown in the sequence 14 of the single strand dna shown in the sequence 13 of sequence table and sequence table; Shown in NAU1071 primer pair by the single strand dna shown in the sequence 16 of the single strand dna shown in the sequence 15 of sequence table and sequence table, formed; Described NAU1085 primer pair is comprised of the single strand dna shown in the sequence 18 of the single strand dna shown in the sequence 17 of sequence table and sequence table; Described NAU1102 primer pair is comprised of the single strand dna shown in the sequence 20 of the single strand dna shown in the sequence 19 of sequence table and sequence table; Described NAU1196 primer pair is comprised of the single strand dna shown in the sequence 22 of the single strand dna shown in the sequence 21 of sequence table and sequence table; Shown in NAU1255 primer pair by the single strand dna shown in the sequence 24 of the single strand dna shown in the sequence 23 of sequence table and sequence table, formed; Described NAU1369 primer pair is comprised of the single strand dna shown in the sequence 26 of the single strand dna shown in the sequence 25 of sequence table and sequence table; Described NAU2173 primer pair is comprised of the single strand dna shown in the sequence 28 of the single strand dna shown in the sequence 27 of sequence table and sequence table; Described NAU2277 primer pair is comprised of the single strand dna shown in the sequence 30 of the single strand dna shown in the sequence 29 of sequence table and sequence table;
Standard (1): while adopting CS62 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, thering are 2 bands between 404bp and 353bp, there are 3 bands between 242bp and 190bp;
Standard (2): while adopting NAU1103 primer pair, meet following banding pattern: there are 4 bands between 353bp and 242bp, thering is 1 band between 242bp and 190bp, there are 2 bands between 190bp and 147bp;
Standard (3): while adopting NAU1186 primer pair, meet following banding pattern: there are 3 bands between 404bp and 353bp, thering are 2 bands between 353bp and 242bp, there are 3 bands between 190bp and 147bp;
Standard (4): while adopting NAU1233 primer pair, meet following banding pattern: be greater than 501bp and there is 1 band, there is 1 band between 501bp and 489bp, thering are 2 bands between 489bp and 404bp, there are 2 bands between 353bp and 242bp;
Standard (5): while adopting NAU2026 primer pair, meet following banding pattern: there are 5 bands between 489bp and 353bp, thering is 1 band between 353bp and 242bp, thering are 2 bands between 242bp and 190bp, there is 1 band between 190bp and 147bp;
Standard (6): while adopting NAU2274 primer pair, meet following banding pattern: there are 3 bands between 190bp and 147bp, there are 5 bands between 147bp and 110bp;
Standard (7): while adopting CIR062 primer pair, meet following banding pattern: there are 2 bands between 404bp and 353bp, there are 3 bands between 242bp and 190bp;
Standard (8): while adopting NAU1071 primer pair, meet following banding pattern: there are 2 bands between 353bp and 242bp, there are 2 bands between 190bp and 147bp;
Standard (9): while adopting NAU1085 primer pair, meet following banding pattern: there is 1 band between 489bp and 404bp, there are 2 bands between 353bp and 242bp;
Standard (10): while adopting NAU1102 primer pair, meet following banding pattern: be greater than 501bp and there are 2 bands, there are 2 bands between 242bp and 190bp;
Standard (11): while adopting NAU1196 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, there are 2 bands between 242bp and 190bp;
Standard (12): while adopting NAU1255 primer pair, meet following banding pattern: there is 1 band between 404bp and 353bp, there are 2 bands between 242bp and 190bp;
Standard (13): while adopting NAU1369 primer pair, meet following banding pattern: there are 2 bands between 489bp and 404bp, there is 1 band between 242bp and 190bp;
Standard (14): while adopting NAU2173 primer pair, meet following banding pattern: there is 1 band between 242bp and 190bp;
Standard (15): while adopting NAU2277 primer pair, meet following banding pattern: there is 1 band between 242bp and 190bp, there is 1 band between 147bp and 110bp.
For the identification of or assistant identification cotton to be measured be whether auspicious assorted 816 primer sets, by the described CS62 primer pair in claim 1, described NAU1103 primer pair, described NAU1186 primer pair, described NAU1233 primer pair, described NAU2026 primer pair, described NAU2274 primer pair, described CIR062 primer pair, described NAU1071 primer pair, described NAU1085 primer pair, described NAU1102 primer pair, described NAU1196 primer pair, described NAU1255 primer pair, described NAU1369 primer pair, described NAU2173 primer pair and described NAU2277 primer pair form.
Described in claim 2 primer sets for the preparation of identifying or whether assistant identification cotton to be measured is the application in auspicious assorted 816 test kit.
For the identification of or assistant identification cotton to be measured be whether an auspicious test kit of assorted 816, contain primer sets described in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310513600.3A CN103555836B (en) | 2013-10-25 | 2013-10-25 | Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310513600.3A CN103555836B (en) | 2013-10-25 | 2013-10-25 | Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103555836A true CN103555836A (en) | 2014-02-05 |
| CN103555836B CN103555836B (en) | 2014-12-10 |
Family
ID=50010179
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310513600.3A Active CN103555836B (en) | 2013-10-25 | 2013-10-25 | Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103555836B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004845A (en) * | 2014-06-04 | 2014-08-27 | 中国农业科学院棉花研究所 | Method and special primer set for identifying facticity to-be-tested variety belonging to CCRI 63 |
| CN108504763A (en) * | 2018-05-24 | 2018-09-07 | 中国农业科学院棉花研究所 | Identify primer sets and its application of cotton variety YM111 authenticities and seed purity |
| CN109880932A (en) * | 2019-04-25 | 2019-06-14 | 中国农业科学院棉花研究所 | SSR primer pair for identifying cotton 1279 in hybrid cotton varieties and products thereof and discrimination method |
| CN110055349A (en) * | 2019-05-24 | 2019-07-26 | 中国农业科学院棉花研究所 | Primer sets for identifying normal conon nakamise 99001 and products thereof and detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101429541A (en) * | 2007-11-09 | 2009-05-13 | 中国农业科学院棉花研究所 | SSR numerator fingerprint identification method |
| CN101696450A (en) * | 2009-09-29 | 2010-04-21 | 中国农业科学院棉花研究所 | Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof |
| CN101921866A (en) * | 2010-09-03 | 2010-12-22 | 山东农业大学 | Method for identifying cotton variety by utilizing SSR core primers |
-
2013
- 2013-10-25 CN CN201310513600.3A patent/CN103555836B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101429541A (en) * | 2007-11-09 | 2009-05-13 | 中国农业科学院棉花研究所 | SSR numerator fingerprint identification method |
| CN101696450A (en) * | 2009-09-29 | 2010-04-21 | 中国农业科学院棉花研究所 | Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof |
| CN101921866A (en) * | 2010-09-03 | 2010-12-22 | 山东农业大学 | Method for identifying cotton variety by utilizing SSR core primers |
Non-Patent Citations (3)
| Title |
|---|
| 付小琼: "2011年黄河流域棉花区试对照种的SSR指纹图谱", 《中国棉花》 * |
| 刘峰等: "适合棉花品种鉴定的SSR 核心引物的筛选", 《分子植物育种》 * |
| 孙宁等: "国家棉花区试新品种的SSR指纹图谱分析", 《棉花学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004845A (en) * | 2014-06-04 | 2014-08-27 | 中国农业科学院棉花研究所 | Method and special primer set for identifying facticity to-be-tested variety belonging to CCRI 63 |
| CN104004845B (en) * | 2014-06-04 | 2016-06-22 | 中国农业科学院棉花研究所 | Identify that whether kind to be measured is method and the primer special group thereof of CCRI 63 |
| CN108504763A (en) * | 2018-05-24 | 2018-09-07 | 中国农业科学院棉花研究所 | Identify primer sets and its application of cotton variety YM111 authenticities and seed purity |
| CN109880932A (en) * | 2019-04-25 | 2019-06-14 | 中国农业科学院棉花研究所 | SSR primer pair for identifying cotton 1279 in hybrid cotton varieties and products thereof and discrimination method |
| CN110055349A (en) * | 2019-05-24 | 2019-07-26 | 中国农业科学院棉花研究所 | Primer sets for identifying normal conon nakamise 99001 and products thereof and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103555836B (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103555836B (en) | Method for authenticating whether to-be-detected variety is Ruiza816 and special primer group thereof | |
| CN113430300B (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| CN103361425B (en) | Primer and method for identifying purity of cucumber 'Yuexiu No.3' hybrid seed | |
| CN107557362A (en) | A kind of authentication method of masson pine cpSSR polymorphism primers and its pine tree sibling species | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| Esfandani Bozchaloyi et al. | Species delimitation in Geranium Sect. Batrachioidea: morphological and molecular | |
| CN104004845B (en) | Identify that whether kind to be measured is method and the primer special group thereof of CCRI 63 | |
| CN105002272B (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN105132570B (en) | A kind of primer sets of assistantly screening anti-stripe rust wheat and its application | |
| CN106521004A (en) | Indel marker in linkage with carrot genic male sterility gene and application of Indel marker | |
| CN106591460A (en) | Method for identifying variety of 'Chinese Tea 302' tea tree by adopting SSR molecular marker and applications of SSR molecular marker | |
| CN103667464A (en) | Method for identifying haplotypes of wheat grain heavy gene TaGW2-6B promoter region and special mark of haplotypes | |
| CN105821154A (en) | SSR primers and method for purity identification of luffa hybrid seeds | |
| CN106755465A (en) | The molecular labeling of QTL QFll.sicau 2D close linkage long with wheat flag leaf and application | |
| CN101824479B (en) | SCAR markerer of sorghum head smut resistance germ No. 3 physiological strain | |
| Chaveerach et al. | Molecular identification and barcodes for the genus Nymphaea | |
| Bianchi et al. | Microsatellite markers for identification of Prunus spp. rootstocks | |
| Figliuolo et al. | Is single bulb producing garlic Allium sativum or Allium ampeloprasum? | |
| Zhang et al. | Classification and phylogenetic relationship of 10 fig varieties by RAPD and SSR molecular markers | |
| Chikkaswamy et al. | Molecular distinction of algae using molecular marker | |
| Suprun et al. | GENETIC DIVERSITY STUDY OF MODERN RUSSIAN APPLE (Malus ½ domestica Borkh.) CULTIVARS BY THE SSR LOCI ANALYSIS | |
| CN105063213B (en) | It can indicate and identify the molecule labelling method and its primer pair of sheep wool crimping degree | |
| CN103589799B (en) | A kind ofly detect the method whether having selfed seed in cotton crossbreed prepared by seeding farmer to be measured | |
| Reyes-Alemán et al. | A genetic diversity study of Persea | |
| Apostolova et al. | Genetic variability of chosen Bulgarian Mentha species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |