CN103276097B - PCR detection method for identifying germplasms of four populations of Pelodiscus sinensis, primer group and kit - Google Patents

Abstract

The invention discloses a PCR detection method for identifying germplasms of four populations of Pelodiscus sinensis, a primer group and a kit. The primer group comprises primers of SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6. The kit comprises a 2*TaqPCR premixed liquid, a 5U/mul enzyme BglI and 10*digestion buffer liquid A, a 5U/mul HpaII and 10*digestion buffer liquid B, a 5U/mul ClaI and 10*digestion buffer liquid C, 10mg/ml BSA, a contrast DNA template and a 10pM amplimer. The method comprises the following steps: carrying out PCR amplification of extracted DNA through using the primer group, digesting to obtain a digestion product, carrying out agarose gel electrophoresis, and comparing the obtained electrophoresis result with a standard electrophoretogram to obtain a result. The detection method has the advantages of simplicity, good reaction stability and repeatability, and cost saving.

Description

Trionyx sinensis (Wiegmann) four population Idioplasm identification PCR detection methods, primer sets and test kits

Technical field

The invention belongs to aquatic products kind quality detection field, relate to Trionyx sinensis (Wiegmann) four population Idioplasm identification PCR detection method, primer sets and test kit, be specifically related to a kind of Trionyx sinensis (Wiegmann) Taihu Lake population, Taiwan population, the method for quick of the Yellow River population and Trionyx sinensis (Wiegmann) Japanese strain new variety Idioplasm identification and primer sets thereof and test kit.

Background technology

Trionyx sinensis (Wiegmann) ( pelodiscus sinensis), be commonly called as the soft-shelled turtle, soft-shelled turtle etc., be under the jurisdiction of reptilia Chelonia Trionychidae soft-shelled turtle and belong to, be distributed widely in China various places, now develop into the special aquaculture kind of the important name of China.According to statistics, within 2012, national Trionyx sinensis (Wiegmann) cultured output reaches more than 33 ten thousand tons, and the output value exceedes 20,000,000,000 yuan, seed stocking rate about 1,000,000,000, and seed wherein over half relies on and overseas inputs.The kind of current China Trionyx sinensis (Wiegmann) cultivation mainly comprises Trionyx sinensis (Wiegmann) Taihu Lake population, Taiwan population, the Yellow River population and Trionyx sinensis (Wiegmann) Japanese strain etc., and the Trionyx sinensis (Wiegmann) speed of growth of different population differs greatly, and soft-shelled turtle seedling market value also changes greatly.As the soft-shelled turtle seedling price 2 ~ 3 yuan/only of Trionyx sinensis (Wiegmann) Taihu Lake populations in 2012 and the Yellow River population, the soft-shelled turtle seedling price 1 ~ 2 yuan of Taiwan population/only, Trionyx sinensis (Wiegmann) Japanese strain seedling valency 4 ~ 6 yuan/only.For meeting breeding production needs, various places increase introducing a fine variety of Trionyx sinensis (Wiegmann) and expand numerous, and incident is mixing of Trionyx sinensis (Wiegmann) kind matter, has a strong impact on the work of Trionyx sinensis (Wiegmann) plasm resource protection.Meanwhile, because high-quality soft-shelled turtle seedling market value is high, profit is large, and market has occurred some illegal retailers pretend to be the high-quality soft-shelled turtle seedlings such as Trionyx sinensis (Wiegmann) Japanese strain to seek the phenomenon of illegal sudden huge profits with soft-shelled turtle seedling inferior, provisions soft-shelled turtle person causes great financial loss.Therefore, accurately differentiate the germplasm origin of Trionyx sinensis (Wiegmann), become one of primary work of China's Trionyx sinensis (Wiegmann) plasm resource protection and breeding research.

According to existing Trionyx sinensis (Wiegmann) variety standard GB21044-2007 requirement, mainly adopt the methods such as formalness, internal structure, biochemical isozyme, karyotype to carry out Idioplasm identification, but this standard cannot carry out difference qualification to the Trionyx sinensis (Wiegmann) of different population.The discrimination method of conventional sense Trionyx sinensis (Wiegmann) different population has morphological markers discriminating, isoenzyme mark discriminating and mtDNA mtDNA sequence differential method etc., but formalness mark differential method affects comparatively large by Trionyx sinensis (Wiegmann) breeding environment, easily occur erroneous judgement; Isoenzyme mark has tissue specificity and individual difference, and is subject to the impact of soil individual development, thus cannot reach higher accuracy requirement; RAPD method poor repeatability and to template require high, thus the reliability of qualification result is also restricted; Although mtDNA mtDNA sequence differential method is accurate, need to have come by large-scale sequenator, most laboratory often could not be purchased because instrument price is expensive, thus carries out spe cies identification after can only sending the sample increased outside order-checking again, ageingly can not ensure.Through domestic and foreign literature inquiry, there is not yet the relevant report of stable, reliable, easy Trionyx sinensis (Wiegmann) four kinds of different population spe cies identification.

Summary of the invention

The Idioplasm identification PCR that an object of the present invention is to provide Trionyx sinensis (Wiegmann) four populations detects primer, and they are 3 couples of amplimer SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6:

SEQ No.1:5 '-GAACCCCTATCACGAAAACG-3 ', concentration is 10pM;

SEQ No.2:5 '-TACAATATTACTCACAGACCGAAAC-3 ', concentration is 10pM;

SEQ No.3:5 '-ATAGGACAACCACGATTTCAGC-3 ', concentration is 10pM;

SEQ No.4:5 '-GCTATTTTTACGGCGGTTTTTG-3 ', concentration is 10pM;

SEQ No.5:5 '-TGGGTAGTCAGAATAGCGTCGT-3 ', concentration is 10pM;

SEQ No.6:5 '-TATTAGTGTAGCTTCTGGTCCCTC-3 ', concentration is 10pM.

Another object of the present invention there is provided the Idioplasm identification PCR detection kit of Trionyx sinensis (Wiegmann) four populations.

Described test kit composition comprise pH value be 8.3 2 × Taq PCR premixed liquid, concentration be the restriction enzyme of 5U/ μ l bgl10 × enzyme cutting buffering liquid A of I and correspondence, concentration are the restriction enzyme of 5U/ μ l hpa10 × enzyme cutting buffering liquid B of II and correspondence, concentration are the restriction enzyme of 5U/ μ l cla3 pairs of amplimers that 10 × enzyme cutting buffering liquid C of I and correspondence, concentration are the bovine serum albumin BSA of 10mg/ml, the contrast DNA profiling of 4 kinds of known source Trionyx sinensis (Wiegmann) and concentration are 10pM.

Described 2 × Taq PCR premixed liquid is the mixed solution of 0.1U/ μ l Taq enzyme, 500uM dNTP, 2 × PCR damping fluid;

Described 10 × enzyme cutting buffering liquid A is 1M , 500mM , 100mM, 10mM mixed solution, pH value is 7.9;

Described 10 × enzyme cutting buffering liquid B is 100mM , 100mM , 10mM mixed solution, pH value is 7.0;

Described 10 × enzyme cutting buffering liquid C is 500mM , 200mM , 100mM , 10mM mixed solution.

Another object of the present invention there is provided the Idioplasm identification PCR detection method of Trionyx sinensis (Wiegmann) four populations.

Step (1). the extraction of STb gene:

Conventionally extract the DNA of testing sample, then the DNA extracted is diluted to 50 ~ 150ng/ μ l, is stored in-20 DEG C;

This DNA extraction method can get STb gene with reference to Takara total DNA extraction kit box.

Step (2) .PCR increases:

The DNA extracted with step (1) is for template, carry out pcr amplification with 3 couples of amplimer SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6 respectively, also pcr amplification is carried out to known Trionyx sinensis (Wiegmann) Taihu Lake population, Taiwan population, the Yellow River population and Trionyx sinensis (Wiegmann) Japanese strain new variety contrast DNA profiling simultaneously.

Described pcr amplification reaction system is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer, downstream primer, 1 μ l template and surplus that 1 μ l is corresponding ₂o forms.

Wherein, the upstream primer of amplimer SEQ No.1/SEQ No.4 is SEQ No.1, and corresponding downstream primer is SEQ No.4; The upstream primer of amplimer SEQ No.2/ SEQ No.5 is SEQ No.2, and corresponding downstream primer is SEQ No.5; The upstream primer of amplimer SEQ No.3/ SEQ No.6 is SEQ No.3, and corresponding downstream primer is SEQ No.6.

Described 2 × Taq PCR premixed liquid is the mixed solution of 0.1U/ μ l Taq enzyme, 500uM dNTP, 2 × PCR damping fluid.

Described pcr amplification reaction condition is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 55 ~ 57 DEG C of annealing 30s, and 72 DEG C extend 1min, and 35 circulations are carried out in reaction, and last 72 DEG C extend 10min.

Step (3). endonuclease reaction:

The amplified production of amplimer SEQ No.1/SEQ No.4 is carried out bgli enzyme is cut, and enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid A; The amplified production of amplimer SEQ No.2/SEQ No.5 is carried out hpaiI enzyme is cut, and enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid B; The amplified production of amplimer SEQ No.3/SEQ No.6 is carried out clai enzyme is cut, and enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid C.

The ddH of described endonuclease reaction system to be 25 μ l by 15 μ l step (2) a certain amplimers or contrast DNA profiling the increase amplified production, 2.5 μ l 10 × enzyme cutting buffering liquids, 0.25 μ l BSA, 5U restriction enzyme and the surplus that obtain ₂o forms.

Described endonuclease reaction condition is that endonuclease reaction system hatches more than 4 hours at 37 DEG C.

Step (4). the foundation of standard electrophoretogram:

The digestion products of the amplified production obtained of increase by contrast DNA profiling carries out 1.5 ﹪ agarose gel electrophoresis detections, builds the Standard PC R-RFLP collection of illustrative plates of often kind of Trionyx sinensis (Wiegmann).

Step (5). the germplasm origin qualification of testing sample:

The enzyme of the amplified production obtained of being increased by three of testing sample kinds of amplimers is cut result and is carried out agarose gel electrophoresis, the amplified production warp of primer pair SEQ No.1/SEQ No.4 bglafter I enzyme is cut, in the population of the Yellow River, occur that length is a band of 1450bp, and in other populations, occur two bands of 618bp and 832bp; The amplified production warp of primer pair SEQ No.2/SEQ No.5 hpaafter II enzyme is cut, in the Yellow River population and Taiwan population, occur that length is a band of 715bp, in Japanese strain new variety and Taihu Lake population, occur two bands of 330bp and 385bp; The amplified production warp of SEQ No.3/SEQ No.6 claafter I enzyme is cut, in Japanese strain new variety, occur that length is a band of 980, in other populations, occur that length is two bands of 481bp and 499bp.Electrophoresis result and standard electrophoretogram are compared, obtains a result.

Described contrast DNA profiling is the Trionyx sinensis (Wiegmann) DNA that known Taihu Lake population, Taiwan population, the Yellow River population and Japanese strain these 4 kinds are known.

Compared with the germplasm identification method of existing Trionyx sinensis (Wiegmann), the present invention has the following advantages:

(1) PCR-based-RFLP basis is identified the kind matter of Trionyx sinensis (Wiegmann) in the present invention, less demanding to the template of PCR reaction, reaction stability and reproducible;

(2) operation steps of the present invention mainly comprises pcr amplification, enzyme cuts and electrophoresis detection, easy and simple to handle, visual result, accurate, sensitive, reliable;

(3) the present invention carries out Idioplasm identification to Trionyx sinensis (Wiegmann) and only digestion products need be carried out agarose gel electrophoresis detection, and contrasts with standard species matter collection of illustrative plates, without the need to order-checking, greatly saves detection time and testing cost.

Accompanying drawing explanation

Fig. 1 is the Standard PC R-RFLP collection of illustrative plates of four kinds of Trionyx sinensis (Wiegmann) populations of known germplasm origin, wherein swimming lane 1 ~ 3 is Taihu Lake population, swimming lane 4 ~ 6 is Taiwan population, swimming lane 7 ~ 9 is Japanese strain new variety, swimming lane 10 ~ 12 is the Yellow River population, swimming lane 13 ~ 15 is the three kinds of amplified production bands of a spectrum cutting process without enzyme, and wherein three swimming lanes of each colony are followed successively by the restriction enzyme digestion and electrophoresis result of the amplified production of SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6 from left to right;

Fig. 2 is the amplified production warp of SEQ No.1/SEQ No.4 bgli enzyme cut after electrophoresis result, wherein M:DNA Maker; Swimming lane 1 ~ 5: 5 individualities of Taihu Lake population; Swimming lane 6 ~ 10: 5 individualities of Taiwan population; Swimming lane 11 ~ 15: 5 individualities of Japanese strain new variety; Swimming lane 16 ~ 20: 5 individualities of the Yellow River population;

Fig. 3 is the amplified production warp of SEQ No.3/SEQ No.6 clai enzyme cut after electrophoresis result, wherein M:DNA Maker; Swimming lane 1 ~ 5: 5 individualities of Taihu Lake population; Swimming lane 6 ~ 10: 5 individualities of Taiwan population; Swimming lane 11 ~ 15: 5 individualities of Japanese strain new variety; Swimming lane 16 ~ 20: 5 individualities of the Yellow River population;

Fig. 4 is the amplified production warp of SEQ No.2/SEQ No.5 hpaiI enzyme cut after electrophoresis result, wherein M:DNA Maker; Swimming lane 1 ~ 5: 5 individualities of Taihu Lake population; Swimming lane 6 ~ 10: 5 individualities of Taiwan population; Swimming lane 11 ~ 15: 5 individualities of Japanese strain new variety; Swimming lane 16 ~ 20: 5 individualities of the Yellow River population.

Embodiment

Below in conjunction with accompanying drawing, the present invention is further analyzed.

If without specified otherwise, below embodiment PCR related reagent used all from sky root (TianGen) company; Restriction enzyme related reagent used is all from New England Biolab (NEB); Agarose, SYBR Green nucleic acid dye are all from the raw work in Shanghai.

As shown in Figure 1, swimming lane 1 ~ 3 is Taihu Lake population, swimming lane 4 ~ 6 is Taiwan population, swimming lane 7 ~ 9 is Japanese strain new variety, swimming lane 10 ~ 12 is the Yellow River population, swimming lane 13 ~ 15 is the three kinds of amplified production bands of a spectrum cutting process without enzyme, and wherein three swimming lanes of each colony are followed successively by the restriction enzyme digestion and electrophoresis result of the amplified production of SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6 from left to right, and correct standard diagram should be consistent with the stripe size in Fig. 1.

The structure of embodiment 1: four kind of different population Trionyx sinensis (Wiegmann) Standard PC R-RFLP collection of illustrative plates:

(1) extraction of STb gene: get and treat test sample Trionyx sinensis (Wiegmann) tissue sample, gets STb gene (also can extract with other test kits) with reference to sky root total DNA extraction kit box, the DNA of extraction is diluted to 50 ~ 150ng/ul, is stored in-20 DEG C;

(2) pcr amplification: with the STb gene extracted for template, carries out pcr amplification with 3 couples of amplimer SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6 respectively, also carries out pcr amplification to contrast template DNA simultaneously,

Pcr amplification reaction system used is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer, downstream primer, 1 μ l template and surplus that 1 μ l is corresponding ₂o forms.

Pcr amplification reaction condition used is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 55 ~ 57 DEG C of annealing 30s, and 72 DEG C extend 1min, and 35 circulations are carried out in reaction, and last 72 DEG C extend 10min;

(3) endonuclease reaction: the amplified production of amplimer SEQ No.1/SEQ No.4 is carried out bgli enzyme is cut, and enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid A, carries out the amplified production of amplimer SEQ No.2/SEQ No.5 hpaiI enzyme is cut, and enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid B, carries out the amplified production of amplimer SEQ No.3/SEQ No.6 clai enzyme is cut, and enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid C;

To be 25 μ l contrast DNA profilings by 15 μ l steps (2) to endonuclease reaction system used increases the ddH of the amplified production, 2.5 μ l 10 × enzyme cutting buffering liquids, 0.25 μ l BSA, 5U restriction enzyme and the surplus that obtain ₂o forms.Endonuclease reaction system hatches more than 4 hours at 37 DEG C;

(4) foundation of standard electrophoretogram: the digestion products of the pcr amplification product of contrast DNA profiling is carried out 1.5 ﹪ agarose gel electrophoresis and detects, swimming lane puts in order as shown in Figure 1, wherein swimming lane 1 ~ 3 is Taihu Lake strain, swimming lane 4 ~ 6 is Taiwan strain, swimming lane 7 ~ 9 is Japanese strain, swimming lane 10 ~ 12 is the Yellow River strain, swimming lane 13 ~ 15 is three kinds of amplified productions cut process band without enzyme, wherein three swimming lanes of each colony are followed successively by SEQ No.1/SEQ No.4 from left to right, the restriction enzyme digestion and electrophoresis result of the amplified production of SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6, correct standard diagram should be consistent with the stripe size in Fig. 1.

Embodiment 2: the Idioplasm identification of Trionyx sinensis (Wiegmann) the Yellow River population:

(1) extraction of STb gene: get Trionyx sinensis (Wiegmann) tissue to be measured, extracts STb gene according to the method in embodiment 1;

Pcr amplification: with the STb gene extracted for template, carries out pcr amplification with primer pair SEQ No.1/SEQ No.4;

Pcr amplification reaction system used is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer SEQ No.1, downstream primer SEQ No.4,1 μ l template and surplus that 1 μ l is corresponding ₂o forms, and pcr amplification reaction condition is identical with embodiment 1;

(2) endonuclease reaction: use restriction enzyme bgli obtains amplified production to step (2) to carry out enzyme and cuts;

Endonuclease reaction system used is that 25 μ l obtain amplified production, 2.5 μ l 10 × enzyme cutting buffering liquid A, 0.25 μ l BSA, 5U restriction enzyme by 15 μ l steps (2) bglthe ddH of I and surplus ₂o forms.Endonuclease reaction system hatches more than 4 hours at 37 DEG C;

(3) the germplasm origin qualification of testing sample: as shown in Figure 2, M:DNA Maker; Swimming lane 1 ~ 5: Taihu Lake population; Swimming lane 6 ~ 10: Taiwan population; Swimming lane 11 ~ 15: Japanese strain new variety; Swimming lane 16 ~ 20: the Yellow River population.The digestion products that step (3) obtains is carried out 1.5 ﹪ agarose gel electrophoresis to detect, if electrophoretic band is a band of about 1400bp, being then the Yellow River population, if there are two bands of about 600bp and 800bp, is not then the Yellow River population;

(4) stability of reacting and repeatability: as shown in Figure 2,5 individualities of each colony all show consistent result, illustrate this reaction repeatability and have good stability.

Embodiment 3: the Idioplasm identification of Japanese strain new variety:

(1) extraction of STb gene: the extracting method of STb gene is identical with embodiment 1;

(2) pcr amplification: with the STb gene extracted for template, carries out pcr amplification with primer pair SEQ No.3/SEQ No.6;

Pcr amplification reaction system used is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer SEQ No.3, downstream primer SEQ No.6,1 μ l template and surplus that 1 μ l is corresponding ₂o forms, and pcr amplification reaction condition is identical with embodiment 1;

(3) endonuclease reaction: use restriction enzyme clai obtains amplified production to step (2) to carry out enzyme and cuts,

Endonuclease reaction system used is that 25 μ l obtain amplified production, 2.5 μ l 10 × enzyme cutting buffering liquid C, 0.25 μ l BSA, 5U restriction enzyme by 15 μ l steps (2) clathe ddH of I and surplus ₂o forms.Endonuclease reaction system hatches more than 4 hours at 37 DEG C;

(4) the germplasm origin qualification of testing sample: as shown in Figure 3, M:DNA Maker; Swimming lane 1 ~ 5: Taihu Lake population; Swimming lane 6 ~ 10: Taiwan population; Swimming lane 11 ~ 15: Japanese strain new variety; Swimming lane 16 ~ 20: the Yellow River population.The digestion products that step (3) obtains is carried out 1.5 ﹪ agarose gel electrophoresis to detect, if electrophoretic band is a band of about 1000bp, being then Japanese strain new variety, if there is a band of about 500bp, is not then Japanese strain new variety.

(5) the stability repeatability of reacting: as shown in Figure 3,5 individualities of each colony all show consistent result, illustrates this reaction repeatability and has good stability.

Embodiment 4: the Idioplasm identification of Taiwan population:

(1) extraction of STb gene: the extracting method of STb gene is identical with embodiment 1;

(2) pcr amplification: with the STb gene extracted for template, carries out pcr amplification to amplimer SEQ No.1/SEQ No.4 and SEQ No.2/SEQ No.5 respectively,

Amplification to SEQ No.1/SEQ No.4: pcr amplification reaction system used is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer SEQ No.1, downstream primer SEQ No.4,1 μ l template and surplus that 1 μ l is corresponding ₂o forms, and pcr amplification reaction condition is identical with embodiment 1;

Amplification to SEQ No.2/SEQ No.5: pcr amplification reaction system used is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer SEQ No.2, downstream primer SEQ No.5,1 μ l template and surplus that 1 μ l is corresponding ₂o forms, and pcr amplification reaction condition is identical with embodiment 1;

(3) endonuclease reaction: carry out enzyme with the amplified production of restriction enzyme Bgl I to SEQ No.1/SEQ No.4 and cut, endonuclease reaction system is identical with the step (3) in embodiment 2 with condition.Use restriction enzyme hpathe amplified production of II to SEQ No.2/SEQ No.5 carries out enzyme and cuts, and endonuclease reaction system used is that 25 μ l are by 15 μ l SEQ No.2/SEQ No.5 amplified productions, 2.5 μ l 10 × enzyme cutting buffering liquid B, 0.25 μ l BSA, 5U restriction enzyme hpathe ddH of II and surplus ₂o forms.Endonuclease reaction system hatches more than 4 hours at 37 DEG C;

(4) the germplasm origin qualification of testing sample: the digestion products that step (3) obtains is carried out 1.5 ﹪ agarose gel electrophoresis and detect, if the amplified production warp of SEQ No.1/SEQ No.4 bgli enzyme cuts rear two bands (as shown in Figure 2) occurring about 600bp and 800bp, and the amplified production warp of SEQ No.2/SEQ No.5 hpaa band (as shown in Figure 4, the M:DNA Maker of II enzyme still for about 700bp after cutting; Swimming lane 1 ~ 5: Taihu Lake population; Swimming lane 6-10: Taiwan population; Swimming lane 11-15: Japanese strain new variety; Swimming lane 16 ~ 20: the Yellow River population), be then Taiwan population, otherwise be other populations.

(5) the stability repeatability of reacting: as shown in Figure 2, Figure 4 shows, 5 individualities of each colony all show consistent result, illustrates this reaction repeatability and has good stability.

Embodiment 5: the Idioplasm identification of any one Trionyx sinensis (Wiegmann) population:

(1) extraction of STb gene: get Trionyx sinensis (Wiegmann) tissue to be measured, extracts STb gene according to the method in embodiment 1;

(2) pcr amplification: with the STb gene extracted for template, carries out pcr amplification with 3 couples of amplimer SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 and SEQ No.3/SEQ No.6 respectively, also carries out pcr amplification to contrast DNA profiling simultaneously;

Pcr amplification reaction system used is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream, downstream primer, 1 μ l template and surplus that 1 μ l is corresponding ₂o forms.

Pcr amplification reaction condition used is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 55 ~ 57 DEG C of annealing 30s, and 72 DEG C extend 1min, and 35 circulations are carried out in reaction, and last 72 DEG C extend 10min;

(3) endonuclease reaction: the amplified production of amplimer SEQ No.1/SEQ No.4 is carried out bgli enzyme is cut (corresponding enzyme cutting buffering liquid is 10 × enzyme cutting buffering liquid A), carries out the amplified production of amplimer SEQ No.2/SEQ No.5 hpaiI enzyme is cut (corresponding enzyme cutting buffering liquid is 10 × enzyme cutting buffering liquid B), carries out the amplified production of amplimer SEQ No.3/SEQ No.6 clai enzyme is cut, and (corresponding enzyme cutting buffering liquid is 10 × enzyme cutting buffering liquid C;

Endonuclease reaction system used is that 25 μ l are increased by a certain amplimer of 15 μ l step (2) ddH of the amplified production, 2.5 μ l 10 × enzyme cutting buffering liquids, 0.25 μ l BSA, 5U restriction enzyme and the surplus that obtain ₂o forms.Endonuclease reaction system hatches more than 4 hours at 37 DEG C;

(4) qualification of germplasm origin: three kinds of digestion products are carried out 1.5 ﹪ agarose gel electrophoresis respectively, by comparison in electrophoresis result and embodiment 1 Plays PCR-RFLP collection of illustrative plates (Fig. 1), if coincide, can regard as same germplasm origin.

Above-described embodiment contrast DNA profiling used is the Trionyx sinensis (Wiegmann) DNA that known Taihu Lake population, Taiwan population, the Yellow River population and Japanese strain these 4 kinds are known.

Above-described embodiment 2 × Taq PCR premixed liquid used is the mixed solution of 0.1U/ μ l Taq enzyme, 500uM dNTP, 2 × PCR damping fluid; 10 × enzyme cutting buffering liquid A is 1M , 500mM , 100mM , 10mM mixed solution, pH value is 7.9; 10 × enzyme cutting buffering liquid B is 100mM , 100mM , 10mM mixed solution, pH value is 7.0; 10 × enzyme cutting buffering liquid C is 500mM , 200mM , 100mM , 10mM mixed solution.

3 couples of amplimer SEQ No.1/SEQ No.4, SEQ No.2/SEQ No.5 mentioned by above-described embodiment and SEQ No.3/SEQ No.6 are 6 primers, concrete as table 1:

Table 16 primer sequences

Primer	Primer sequence (5 '-3 ')	Concentration
			SEQ No.1	GAACCCCTATCACGAAAACG	10pM
SEQ No.2	TACAATATTACTCACAGACCGAAAC	10pM
			SEQ No.3	ATAGGACAACCACGATTTCAGC	10pM
SEQ No.4	GCTATTTTTACGGCGGTTTTTG	10pM
			SEQ No.5	TGGGTAGTCAGAATAGCGTCGT	10pM
SEQ No.6	TATTAGTGTAGCTTCTGGTCCCTC	10pM

Above-described embodiment is not that the present invention is not limited only to above-described embodiment for restriction of the present invention, as long as meet application claims, all belongs to protection scope of the present invention.

SEQUENCE LISTING

 

<110> Zhejiang Fisheries Technology Extension Station

 

<120> Trionyx sinensis (Wiegmann) four population Idioplasm identification PCR detection methods, primer sets and test kits

 

<130> 1

 

<160> 6

 

<170> PatentIn version 3.3

 

<210> 1

<211> 20

<212> DNA

<213> synthetic

 

<400> 1

gaacccctat cacgaaaacg 20

 

 

<210> 2

<211> 25

<212> DNA

<213> synthetic

 

<400> 2

tacaatatta ctcacagacc gaaac 25

 

 

<210> 3

<211> 22

<212> DNA

<213> synthetic

 

<400> 3

ataggacaac cacgatttca gc 22

 

 

<210> 4

<211> 22

<212> DNA

<213> synthetic

 

<400> 4

gctattttta cggcggtttt tg 22

 

 

<210> 5

<211> 22

<212> DNA

<213> synthetic

 

<400> 5

tgggtagtca gaatagcgtc gt 22

 

 

<210> 6

<211> 24

<212> DNA

<213> synthetic

 

<400> 6

tattagtgta gcttctggtc cctc 24

Claims (3)

1. the Idioplasm identification PCR detection method of Trionyx sinensis (Wiegmann) four populations, its characteristic is that the method comprises the following steps:

Step (1). the extraction of STb gene:

Conventionally extract the DNA of testing sample, then the DNA extracted is diluted to 50 ~ 150ng/ μ l, is stored in-20 DEG C;

Step (2) .PCR increases:

The DNA extracted with step (1) is for template, carry out pcr amplification with 3 couples of amplimer SEQ ID No.1/SEQ ID No.4, SEQ ID No.2/SEQ ID No.5 and SEQ ID No.3/SEQ ID No.6 respectively, also pcr amplification is carried out to known Trionyx sinensis (Wiegmann) Taihu Lake population, Taiwan population, the Yellow River population and Trionyx sinensis (Wiegmann) Japanese strain new variety contrast DNA profiling simultaneously;

Described pcr amplification reaction system is 50ul by the ddH of 2 × Taq PCR premixed liquid of 25 μ l, 1 μ l upstream primer, downstream primer, 1 μ l template and surplus that 1 μ l is corresponding ₂o forms;

Described 2 × Taq PCR premixed liquid is the mixed solution of 0.1U/ μ l Taq enzyme, 500uM dNTP, 2 × PCR damping fluid;

Described pcr amplification reaction condition is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 55 ~ 57 DEG C of annealing 30s, and 72 DEG C extend 1min, and 35 circulations are carried out in reaction, and last 72 DEG C extend 10min;

Step (3). endonuclease reaction:

Carry out Bgl I enzyme to the amplified production of amplimer SEQ ID No.1/SEQ ID No.4 to cut, enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid A; Carry out Hpa II enzyme to the amplified production of amplimer SEQ ID No.2/SEQ ID No.5 to cut, enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid B; Carry out Cla I enzyme to the amplified production of amplimer SEQ ID No.3/SEQ ID No.6 to cut, enzyme cutting buffering liquid used is 10 × enzyme cutting buffering liquid C;

To be 25 μ l to be increased the ddH of the amplified production, 2.5 μ l 10 × enzyme cutting buffering liquids, 0.25 μ l BSA, 5U restriction enzyme and the surplus that obtain by increase amplified production that DNA to be measured obtains or contrast DNA profiling of 15 μ l step (2) a certain amplimers described endonuclease reaction system ₂o forms;

Described endonuclease reaction condition is that endonuclease reaction system hatches more than 4 hours at 37 DEG C;

Described 10 × enzyme cutting buffering liquid A is 1M NaCl, 500mM Tris-HCl, 100mM MgCl ₂, 10mM DTT mixed solution, pH value is 7.9;

Described 10 × enzyme cutting buffering liquid B is 100mM Bis Tris Propane-HCl, 100mM MgCl ₂, 10mM DTT mixed solution, pH value is 7.0;

Described 10 × enzyme cutting buffering liquid C is 500mM KAc, 200mM Tris-Ac, 100mM Mg (Ac) ₂, 10mM DTT mixed solution;

Step (4). the foundation of standard electrophoretogram:

The digestion products of the amplified production obtained of increase by contrast DNA profiling carries out 1.5 ﹪ agarose gel electrophoresis detections, builds the Standard PC R-RFLP collection of illustrative plates of often kind of Trionyx sinensis (Wiegmann);

Step (5). the germplasm origin qualification of testing sample:

The enzyme of the amplified production obtained of being increased by three of testing sample kinds of amplimers is cut result and is carried out agarose gel electrophoresis, the amplified production of primer pair SEQ ID No.1/SEQ ID No.4 is after Bgl I enzyme is cut, in the population of the Yellow River, occur that length is a band of 1450bp, and in other populations, occur two bands of 618bp and 832bp; The amplified production of primer pair SEQ ID No.2/SEQ ID No.5, after Hpa II enzyme is cut, occurs that in the Yellow River population and Taiwan population length is a band of 715bp, occurs two bands of 330bp and 385bp in Japanese strain new variety and Taihu Lake population; The amplified production of SEQ ID No.3/SEQ ID No.6, after Cla I enzyme is cut, occurs that in Japanese strain new variety length is a band of 980, occurs that length is two bands of 481bp and 499bp in other populations; Electrophoresis result and standard electrophoretogram are compared, obtains a result.

2. the primer sets that the Idioplasm identification PCR detection method of Trionyx sinensis (Wiegmann) four populations as claimed in claim 1 is used, it is characterized in that this primer sets comprises 3 couples of amplimer SEQ ID No.1/SEQ ID No.4, SEQ ID No.2/SEQ ID No.5 and SEQ ID No.3/SEQ ID No.6, specifically:

SEQ ID No.1:5 '-GAACCCCTATCACGAAAACG-3 ', concentration is 10pM;

SEQ ID No.2:5 '-TACAATATTACTCACAGACCGAAAC-3 ', concentration is 10pM;

SEQ ID No.3:5 '-ATAGGACAACCACGATTTCAGC-3 ', concentration is 10pM;

SEQ ID No.4:5 '-GCTATTTTTACGGCGGTTTTTG-3 ', concentration is 10pM;

SEQ ID No.5:5 '-TGGGTAGTCAGAATAGCGTCGT-3 ', concentration is 10pM;

SEQ ID No.6:5 '-TATTAGTGTAGCTTCTGGTCCCTC-3 ', concentration is 10pM.

3. the test kit that the Idioplasm identification PCR detection method of Trionyx sinensis (Wiegmann) four populations as claimed in claim 1 is used, it is characterized in that this test kit comprises 2 × Taq PCR premixed liquid that pH value is 8.3, concentration is the restriction enzyme Bgl I of 5U/ μ l and 10 × enzyme cutting buffering liquid A of correspondence, concentration is the restriction enzyme Hpa II of 5U/ μ l and 10 × enzyme cutting buffering liquid B of correspondence, concentration is the restriction enzyme Cla I of 5U/ μ l and 10 × enzyme cutting buffering liquid C of correspondence, concentration is the bovine serum albumin BSA of 10mg/ml, the contrast DNA profiling of 4 kinds of known source Trionyx sinensis (Wiegmann) and concentration are 3 pairs of amplimers of 10pM,

Described 2 × Taq PCR premixed liquid is the mixed solution of 0.1U/ μ l Taq enzyme, 500uM dNTP, 2 × PCR damping fluid;

Described 10 × enzyme cutting buffering liquid A is 1M NaCl, 500mM Tris-HCl, 100mM MgCl ₂, 10mM DTT mixed solution, pH value is 7.9;

Described 10 × enzyme cutting buffering liquid B is 100mM Bis Tris Propane-HCl, 100mM MgCl ₂, 10mM DTT mixed solution, pH value is 7.0;

Described 10 × enzyme cutting buffering liquid C is 500mM KAc, 200mM Tris-Ac, 100mM Mg (Ac) ₂, 10mM DTT mixed solution;

3 pairs of described amplimers are respectively shown in SEQ ID No.1/SEQ ID No.4, SEQ ID No.2/SEQ ID No.5 and SEQ ID No.3/SEQ ID No.6.