CN101220372A - Recombined bifidobacteria -hRV/VP7 expression vector and oral administration vaccine thereof - Google Patents
Recombined bifidobacteria -hRV/VP7 expression vector and oral administration vaccine thereof Download PDFInfo
- Publication number
- CN101220372A CN101220372A CNA2008103001814A CN200810300181A CN101220372A CN 101220372 A CN101220372 A CN 101220372A CN A2008103001814 A CNA2008103001814 A CN A2008103001814A CN 200810300181 A CN200810300181 A CN 200810300181A CN 101220372 A CN101220372 A CN 101220372A
- Authority
- CN
- China
- Prior art keywords
- hrv
- expression vector
- vaccine
- oral
- bifidus bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a recombinant bifidobacterium hRV-VP7 expression vector and the oral vaccine. The invention pertains to the field of genetic engineering. The technical problem to be solved is to construct a new bifidobacterium expression vector of hRV virus VP7 protein. The recombinant bifidobacterium hRV-VP7 expression vector of the invention is loaded with a virus protein VP7 coding gene sequence of a human group A rotavirus. The expression vector of the invention can be transfected into the bifidobacterium and can be further prepared into an hRV/VP7 transgenic bifidobacterium-hRV-VP7 recombinant vector oral live vaccine preparation after fermentation culture. The invention is mainly used for the prevention and adjuvant treatment of infantile diarrhea which is caused by human rotavirus, thus having great market prospect.
Description
Technical field
The invention belongs to the genetically engineered field, be specifically related to a kind of recombined bifidobacteria hRV-VP7 expression vector and oral vaccine thereof.
Background technology
People A group rotavirus (human rotavirus, hRV) be to cause the cacatory main pathogens of newborn infant, about 60% serious diarrhoea is caused that by RV the whole world has about 500,000 infant dead because of infecting RV every year, therefore, WHO is placed on the position of first developing with the research of RV vaccine
[1]
At present, the direction of whole world RV vaccine research mainly is the oral living vaccine of artificial reprovision attenuation, wherein the most influential is the oral vaccine that Wyeth-Ayerst company produces, are (commodity called Rotashield but because safety problem withdraws from market very soon?, intussusception Recall voluntarily occur because of the inoculator in June, 1999
[1]).Nearly 2 years RIX4414
[12-13]And RotaTeq
[14]Carried out the report of clinical 3 phases test in succession.In China, has only the sheep rotavirus strain PG10 of Lanzhou institute of Biological Products at present
[8]Got permission production application in 1998
[1], this is China's unique RV vaccine that obtains state approval at present, but according to clinical reflection, immune effect is unsatisfactory.Therefore, the development work of hRV vaccine is still shouldered heavy responsibilities.
Research of Animal Model for Study shows with dna vaccination or the virus-like particle muscle immune mouse of VP7, though produce the virus-specific neutralizing antibody in the blood, mouse is not had provide protection, has only the RV vaccine by the mucomembranous immune system inoculation that immanoprotection action is just arranged
[1-6]Therefore, the most effective RV vaccine must be to have the ability to stimulate enteron aisle to produce the vaccine of digestive tube local immunity.The most preferred dosage form that has determined the RV vaccine thus is the oral vaccine that causes mucosal immunity.
The engineering carrier vaccine is to utilize carrier system to express a kind of pattern that viral protective antigen makes up new generation vaccine; its advantage is a toxic side effect of having avoided viral body; shortcoming is to be difficult to find ideal carrier bacterium (expression system), even expression is arranged, immunogenicity also a little less than.The main protection antigen of HRV is viral protein (Virus Protein) VP4 and viral protein VP7.VP7 is that molecular weight is the shell glycoprotein of 34 kD, and encoding gene is decided with the different types of virus, has been found that at present (G1～G14), wherein common infection baby's RV is the G1-G4 type to 14 VP7 serotypes.Studies confirm that, the total length VP7 polypeptide non-immunogenicity that prokaryotic system is expressed, the shortcoming of doing candidate antigens with it is not have cross protection between the antibody that produces of the virus of different G serotypes, therefore protection domain clinically is narrower.But the proteic content of VP7 is very high in natural virus, through removing the partial sequence of 3 ends, the VP7 that prokaryotic system is expressed still can have immunogenicity [15,19], therefore, VP7 still can be as one of candidate antigen of gene engineered subunit living vaccine research.In PubMed, retrieve separately VP7 is reported [16] as expressing of subunit's candidate vaccine antigen in adenovirus hominis, can excite protective immunological reaction behind the intranasal inoculation immune mouse.Choi NW etc. then utilizes transgene tobacco to give expression to immunogenic VP7 fusion rotein [17].At home, Li Jintao etc. has expressed hRV VP7 albumen [18] with transgenic Rhizoma Solani tuber osi.But the used carrier system efficiency is not high enough, and all fails to enter the practical stage.According to statistics, the main RV of popular has in population of China: G1 (P1A[8]) accounts for 72.7%, G2 (P1B[4]) 12.1%, G3 (P1A[8]) 14.2% and G4 (P1A[8]) 2.5%, and as seen, the hRV epidemic strain is based on G1 genotype [11].
The intestinal mucosa immunity system is to carry out the first line of defence of digestive tube immunity.Because the infection of RV and duplicating only is confined in the intestinal epithelial cell, therefore, the intestinal mucosa immunity is preventing that RV from having very important effect in infecting.Bifidus bacillus (Bifidobacterium sp. hereinafter is abbreviated as B) belongs to gram-positive microorganism
[8]It is human intestine's normal microflora, can be adsorbed on by the teichoic acid of cell surface on the acceptor on intestinal epithelial cell surface, itself can not removed by enteron aisle, can in enteron aisle, stablize field planting, also harmless to body, have very high security, bifidus bacillus also may be brought into play mucosal immunity synergistic agent and assisting therapy effect.The work of Qiao etc. proves
[7]With monkey RV (RRV) infecting mouse after 5 days, experimental group (B+RRV) a certain amount of bifidus bacillus of feeding every day behind virus infection, the feed salt solution of equivalent of control group (RRV), negative control is infective virus not, does not also give bifidus bacillus, the salt solution of the equivalent of only feeding, found that RRV specific IgG and IgA in experimental group serum and the ight soil are higher than control group.The phase of recovering of experimental group also shifts to an earlier date to some extent than control group.
Has only the research report that bifidus bacillus is used for the gene transfer system of human solid tumor's gene therapy at present
[9], there is no report at home and abroad but bifidus bacillus is used for preparation reorganization RV viral protein living vaccine.
Summary of the invention
First technical problem to be solved by this invention provides a kind of recombined bifidobacteria hRV-VP7 expression vector.
Recombined bifidobacteria hRV-VP7 expression vector of the present invention is mounted with the coding gene sequence of the viral protein VP7 of people A group rotavirus.
Wherein, above-mentioned bifidus bacillus expression vector is intestinal bacteria-bifidus bacillus shuttle expression carrier.
Wherein, above-mentioned intestinal bacteria-bifidus bacillus shuttle expression carrier has the nucleotide sequence shown in the SEQ ID NO.1.
Wherein, above-mentioned people A group rotavirus VP7 subunit has the nucleotide sequence shown in the SEQ ID NO.2.
Further, above-mentioned recombined bifidobacteria hRV-VP7 expression vector has the nucleotide sequence shown in the SEQ ID NO.3.
Second technical problem to be solved by this invention provides a kind of host cell that contains above-mentioned recombined bifidobacteria hRV-VP7 expression vector.
Further, above-mentioned host cell is a bifidus bacillus.
The 3rd technical problem to be solved by this invention provides above-mentioned recombined bifidobacteria-hRV/VP7 expression vector or the above-mentioned host cell purposes in the mucosal adjuvant of the oral vaccine of the disease that preparation prevention or treatment people A group rotavirus cause or oral vaccine.
The 4th technical problem to be solved by this invention provides a kind of the prevention or the oral vaccine of the disease that treatment people A group rotavirus causes or the mucosal adjuvant of oral vaccine.The mucosal adjuvant of this oral vaccine or oral vaccine is to be prepared from by above-mentioned host cell interpolation acceptable accessories or complementary composition.
Further, the formulation of the mucosal adjuvant of above-mentioned oral vaccine or oral vaccine is oral liquid, oral liquid, tablet or capsule.
As influenza virus; the nature rotavirus is genome segment reprovision between the homophyletic and the inner very high variation of protective antigen generation that suddenlys change and cause RV of gene not; cause vaccine research to lag behind the variation of popular virus clinically greatly, bring very big difficulty to vaccine research
[10], therefore, the rule of simulated virus nature reprovision (reassortant) development RV vaccine is the most reasonable and efficient strategy.But the structure of RV reassortant and screening operation difficulty are very big, cost is big, length consuming time, and the finished product have the essential live virus composition of a large amount of non-immunity, certain side effect such as heating, diarrhoea, intussusception etc. are arranged after the inoculation propagation unavoidably, and the failure of Rotashield is exactly best example.But the vaccine thinking of development and the comparatively ideal immune protective effect of the natural reprovision mode of manual simulation's virus have indicated direction for the research of RV vaccine undoubtedly.But concrete simulation and reorganization scheme will have brand-new thinking.With the old road of viral naturally reprovision development attenuated live vaccine, be difficult to overcome the regressive safety issue of attenuated live vaccine virulence, and attenuation RV is to immune deficiency patients' such as HIV the infected fatal risk.Also can't avoid simultaneously the infant and inoculate side effects such as intussusception that back vaccine propagation causes, heating, diarrhoea, vomiting, and be difficult in time to obtain to meet the new variant vaccine of clinical prevention requirement.
The present invention comes out to carry out express recombinant with protective antigen composition independent " peeling off ", explores the road of a new RV research of recombinant vaccines.The natural variation of technical solution of the present invention simulated virus, development " protective antigen reorganization " vaccine, this scheme makes vaccine development work can in time change the recombination form of vaccine antigen according to the antigenic variation of clinical epidemic strain, reaches the active effect of coping with shifting events by changing.Therefore, use the antigen of the VP7 of G1 type as recombiant vaccine, just can prevent the RV more than 72% to infect, if make live recombined vaccines with the VP7 of G1, G2 and G3 three types, its protection domain reaches epidemic strain more than 97.5%, and its potential applicability in clinical practice is boundless.
The existing nucleotide sequence that relates to use among the present invention all can be retrieved in this area academic journals delivered and GenBank and get, and those of ordinary skills all can finish molecular biology and the cytobiology test that the present invention relates on the basis of reference this area textbook or test handbook.
Beneficial effect of the present invention is:
1. safe multiple-effect.Bifidus bacillus has no side effect, can in enteron aisle, stablize field planting, also harmless to body, has very high security, do the expression system of live recombined vaccines with it, do not exist carrier bacterium to produce potential pathogenic risk such as extracellular toxin, no pyrogeneous substance and virulence reversion, help directly antigen presentation being identified and offering at the mucous membrane lymphocytic cell surface, also help the treatment of RV and the recovery of intestinal microecology by the microecology effect of carrier bacterium; This vaccine safety height, antigen expressed peptide subunit does not have infectivity, can also bring into play mucosal immunity synergistic agent and assisting therapy effect.
2. quick reorganization.This scheme makes vaccine development work can in time change the recombination form of vaccine antigen according to the antigenic variation of clinical epidemic strain, reach the active effect of coping with shifting events by changing, with existing gene clone and sequencing technologies, one week just can be finished the structure work of carrier, was the ideal scheme of the oral living vaccine development of hRV recombinant vectors.
3. modularization development, modular combination.Can be in different bifidus bacilluss with the VP7 gene clone of the hRV epidemic strain of different serotypes; build up the VP7 subunit vaccine storehouse of hRV epidemic strain; when occurring different hRV epidemic strains clinically; can be according to practical situation; from strain library, transfer the bifidus bacillus vaccine of corresponding VP7 subunit; at any time be combined into the vaccine that can successfully manage clinical needs; make the development of hRV subunit vaccine move towards the modularization road for development, thoroughly change present hRV vaccine development cycle length, big, the narrow unfavorable situation of protection domain of cost.
4. economical and practical, convenient oral.Compare with recombined attenuated live vaccine, living vaccine of the present invention invention has economic and practical characteristics, and leavened prod does not need further purifying, its development cost is not enough the former 1/10th.And formulation can be formulations such as lactic fermentation product or capsule, is convenient to children taking.
In sum, compare with the scheme of prior art, the oral recombinant vectors living vaccine of bifidus bacillus human rotavirus VP 7 of the present invention is effective, high safety, and easy to use, cost is low, has good application prospects.
Description of drawings
Fig. 1 is pBEX-VP7, and pAymO wherein represents promotor, and VP7 represents the VP7 gene, and RepB represents the bifidus bacillus replicon, and bla represents ampicillin resistance gene.
Fig. 2 is the PCR result of VP7 gene, and 1-2 wherein represents the band of VP7 gene, 3 expression DNA Marker.
Fig. 3 is the SDS-PAGE figure of VP7, and 1 expression pBEX wherein transforms the blank of bifidus bacillus, 2 expression protein Marker, and 3-5 represents the expression of pBEX-hRV/VP7 at different time.
Fig. 4 is the building process synoptic diagram of pBEX-hRV/VP7 expression vector of the present invention.
Fig. 5 is the building process synoptic diagram of bifidobacteria-bacillus coli shuttle expression vector of the present invention.
Embodiment
Below by specific description of embodiments of the present invention the explanation but do not limit the present invention.
The structure of embodiment one bifidobacteria-bacillus coli shuttle expression vector of the present invention
One. with the promotor AmyO of α-Dian Fenmei (amylase) gene (GenBank No:AY240946) of bifidus bacillus (position: 599-690nt) replace Ptac promotor (183932) on the pGEX-5x-1, simultaneously with the LacIq fragment (position: 3301-4420nt) on the PCR method deletion pGEX-5x-1.
Concrete steps are as follows:
1. get earnestly by 110 base pairs of the synthetic alpha-amylase gene AmyO of Shanghai biotechnology company (promotor) sequence with BamHI and SacII enzyme, its 5 ' end has added M13 reverse sequencing primer sequence (taaaacgacggccagt) (SEQ IDNO.4) so that order-checking.
It is as follows that it makes up route:
(1) promoter sequence of bifidus bacillus alpha-amylase gene: 599 ta aaataaacag catacgttcgcaatagtgca aacgctatca aagaagatga acccccgtta aagggattga agaaaaggaa taaaggagcc690 (SEQ ID NO.5)
(2)
Gtaaaacgacggccagt (SEQ ID NO.6) is M13 sequencing primer sequence (the ash end) and SacII restriction enzyme site (rolling off the production line) and the protection base (square frame) that is added in before 599;
(3) after No. 690 bases, add Bam restriction enzyme site and protection base sequence
Therefore, the promoter sequence of last synthetic alpha-amylase gene is:
tcgaccgcggtaaaacgacggccagttaaaataaacagcatacgttcgcaatagtgcaaacgctatcaaagaagatgaacccccgttaaagggattgaagaaaaggaataaaggagccggatccatc(127bp)?(SEQ?ID?NO.7)
(as not having special mark, the direction that the acquiescence ways of writing of nucleotide sequence is all served as reasons and held 3 ' end from 5 ' in the specification sheets among the present invention).
2. be template with the pGEX-5x-1 plasmid, obtain the carrier basic framework by pcr amplification with high-fidelity Taq archaeal dna polymerase.
The PCR primers F is multiple clone site (MCS) sequence on the pGEX-5x-1, and primer R is the LacIq upstream sequence.Be deletion pGEX-5x-1 go up LacIq primer sequence.
Primer sequence is as follows: pF1:
Ccgattcccg (SEQ ID NO.8) (position: pGEX-5x-1934-949 contains the BamHI restriction enzyme site);
PR1:
Attcaccaccctgaattgac (SEQ ID NO.9) (position: pGEX-5x-13320-3301 adds the SacII restriction enzyme site);
Pcr amplification condition: 95 ℃ of 4min, (95 ℃ of 40Sec, 52 ℃ of 30Sec, 72 ℃ of 1min) * 30 circulations.
Result: the skeleton fragment (the process synoptic diagram is seen accompanying drawing 5) that comprises ampicillin resistance gene and intestinal bacteria replication origin on the pGEX-5x-1 of acquisition 2387bp.
The PCR product is connected conversion with cutting product with the AmyO enzyme behind BamHI and the SacII double digestion, picking mono-clonal on the amicillin resistance flat board, plasmid is identified with electrophoresis, name pGEX-pAymO, the plasmid that this house of correction gets is obviously than little more than 1000 base pairs of the resulting plasmid pGEX-5x-1 of the first step, and order-checking is cut standby with Aat II enzyme after confirming.
Two. (sequence is shown in SEQID NO.12 for the replication protein B sequence of synthetic bifidus longum bb KJ36 plasmid (GenBank No:AF139129); add Aat II restriction enzyme site and protection base at two ends); it is synthetic that sequence fragment is given birth to the worker by Shanghai, and order-checking is confirmed errorless.With PCR this sequence that increases in a large number,
Forward primer is: pR1:gcgacgtctacttagtacaaaagggga (SEQ ID NO.10) (1-20nt adds Aat II restriction enzyme site).
Reverse primer is: pR2:gcgacgtcatgatgttcgcggttgcg (SEQ ID NO.11) (1020-1002nt adds Aat II restriction enzyme site).
The pcr amplification condition is: 95 ℃ of 3min, 30 times through 95 ℃ of 50Sec, 54 ℃ of 40Sec, 72 ℃ of 1min circulate again.
PKJ36 reproduction element (rep B) sequence is shown in SEQ ID NO.12, and wherein the 5th～1018 bit base sequence is the sequence that is written into bifidobacteria-bacillus coli shuttle expression vector of the present invention.
The PCR product is connected to the Aat II restriction enzyme site of the plasmid correspondence of the first step gained after Aat II enzyme is cut.Connect, transform, picking mono-clonal on the amicillin resistance flat board, plasmid with electrophoresis detection after order-checking confirm called after pBEX.
So far, bifidobacteria-bacillus coli shuttle expression vector of the present invention successfully constructs, called after pBEX.(3 segmental Nucleotide sums should be 120+1014+2387=3521bp to total length 3509bp in the accompanying drawing 5, because of there being 2 restriction enzyme sites to repeat,, promptly deduct 12 bases so should deduct the restriction enzyme site of double counting, indicate hereby), nucleotide sequence is shown in SEQ IDNO.1.Do 1 with sacII restriction enzyme site sequence note, the feature of this sequence is as follows:
(1) 1-108bp is the promoter sequence district of M13 sequencing primer and alpha-amylase gene.
(2) 114-150bp is a multiple clone site, and BamHI is arranged successively, EcoRI, SmaI, SalI, five single endonuclease digestion sites of XhoI and NotI.
(3) 1569-2429bp is the encoding sequence of beta-lactamase (bla, penbritin enzyme).
(4) 559-1410bp is the encoding sequence of the RepB (replication protein B) of bifidus longum bb.
Embodiment two makes up pBEX-hRV/VP7 expression vector (the building process synoptic diagram is seen accompanying drawing 4)
The structure of pBEX-hRV/VP7:
1, earlier with RT-PCR method amplicon virus albumen VP7 gene (hRV Wa strain, coding region: 49...1029, the VP7 gene that uses among the present invention is shown in SEQ IDNO.2 for GENBANK NO.M21843, VP7) from the genome of hRVWa strain.
Primer is:
VP7F:atcggatccatgtatggtattgaatatac (SEQ ID NO.13) (adding the BamHI site).
VP7R:acggtcgacctatacctctataataaaaagctg (SEQ ID NO.14) (adding the SalI site).
Method is: the RNA 10 μ l that get extraction, 100 ℃ were heated 2 minutes, make the double-stranded RNA sex change, ice bath is instantaneous centrifugal after 2 minutes, adds 5 * AMV Bufer, 4 μ l again, dNTPs 2 μ l, downstream primer 1 μ l (30 μ M/ μ l), RNasin 1 μ l, ThermoScript II AMV 2 μ l add the reaction system of ddH20 polishing 25 μ l.42 ℃ of reverse transcriptions 1 hour.
Get the PCR pipe of a clean sterilization then, in 50 μ l reaction systems, add the people: 10 * PCR Bufer, 5 μ l, dNTPs (2.5mM) 4 μ l, upstream primer 1 μ l, downstream primer 1 μ l, cDNA 2 μ l, Taq enzyme 0.2 μ l, ddH2036.8 μ l increases.Reaction conditions is: 94 ℃ of 5min, (94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 90s) * 30 circulations, 72 ℃ of 7min.
Get 3 μ l PCR products after reaction finishes and carry out electrophoresis on 1% sepharose, the PCR product of purifying carries out T-A with pEASY-T1 and is connected, and the errorless postscript that checks order is made pEASY-hVP7 and preserved standby.
2, cut the pBEX of pEASY-hVP7 and embodiment 1 preparation with BamHI and SalI while enzyme, reclaim VP7 fragment and pBEX fragment after the gel electrophoresis, connect by 2: 1 volume ratios, transformed into escherichia coli DH5 α, picking mono-clonal on amicillin resistance LB flat board, extract plasmid after shaking bacterium, carry out PCR with the VP7 primer and identify (seeing accompanying drawing 2), positive colony order-checking back called after pBEXhRV VP7 (sequence is shown in SEQ ID NO.3).
The pBEX-hRV/VP7 that present embodiment makes up, can in intestinal bacteria-bifidus bacillus, shuttle back and forth and carry out plasmid replication, and can make it and on the MRS substratum that contains 50 μ g/ml penbritins, to grow, and express the antigen of hRV/VP7 protein as oral vaccine by transforming bifidus bacillus.Obviously to can be used as that expression vector that foreign gene expresses in bifidus bacillus is used for the bifidus bacillus be the expression of all types of VP7 of recipient bacterium and the production of gene engineering product thereof to pBEX-hRV/VP7.
Embodiment three the present invention contain the preparation of the bifidobacterium species atcc daughter bacteria of pBEX-hRV/VP7 recombinant vectors
1, the bifidus bacillus of screening OD value 0.6 is a recipient bacterium, behind sterilization 10% glycerin treatment of deionized water preparation, is transformed in the recipient bacterium with the pBEX-hRV/VP7 recombinant plasmid vector of electrotransformation with embodiment two preparations.Conversion condition is: 15KV, 200 Ω, 25 μ F.
2, with the recovery 60-120min in the MRS of no antibiotic liquid nutrient medium of the elder generation of the bifidus bacillus after the conversion processing, on the MRS solid medium that contains 50 μ g/ml penbritins, cultivate then, select the resistance bacterium colony, thereby obtain to change the bifidus bacillus of ETEC CFA/I gene, the positive colony after PCR and SDS-PAGE identify is the bifidobacterium species atcc daughter bacteria that contains the pBEX-hRV/VP7 recombinant vectors.
Embodiment four the present invention plant the mass liquid inoculation amplification cultivation of daughter bacteria
Embodiment three is coated on the bifidus bacillus MRS substratum that contains 50 μ g/ml penbritins anaerobism after the bifidus bacillus after transgenosis conversion processing recovery cultivated 48-72 hour, the single resistance bacterium colony of picking increases the bacterium cultivation in resistance bifidus bacillus liquid nutrient medium then, confirming through PCR that the single bacterium colony of VP7 male bifidus bacillus is coated with once more is inoculated on the resistance culture medium flat plate that contains penbritin anaerobism and cultivated 48-72 hour, and then the single bacterium colony of picking is cultivated in the conventional liq substratum, when so inoculation culture to succeeding transfer culture was not less than for 15 generations repeatedly PCR detect confirm VP7 still the male clone can be used as the kind daughter bacteria that kind of daughter bacteria is used for mass liquid inoculation amplification cultivation, preservation is stand-by.
The preparation of embodiment five bifidus bacilluss of the present invention-oral living vaccine preparation of hRV/VP7 recombinant vectors and drug effect checking
Bifidus bacillus of the present invention-concrete preparation process of the oral living vaccine of hRV-VP7 recombinant vectors is as follows:
A) prescription: fresh milk 52%, white sugar 7.8%, SODIUM PHOSPHATE, MONOBASIC 0.2%, water 40%, kantlex 0.005%; Earlier with hot water dissolving's white sugar and SODIUM PHOSPHATE, MONOBASIC, stir during operation, mix with fresh milk subsequently, enter centrifugal milk clarifier, remove impurity by duplex strainer.
B) 120 ℃ of instantaneous sterilizations, 10 seconds time, for keeping the nutrient of milk to greatest extent, material enters compensating cylinder, through the centrifugal sanitary pump plate-type heat exchanger of making a gift to someone, through preheating, High Temperature Sterilization, insulation, cooling, reaches germ-resistant purpose.
C) carry out homogeneous in high pressure homogenizer, twice homogeneous all adopts two sections homogeneous.One section homogenization pressure is 70kgf/cm2, and two sections homogenization pressures are 30kgf/cm2.
D) inoculation and fermentation: at first inoculate 5% and transform the bifidobacterium fermentation strain liquid, cultivated about 9 hours for 37 ℃, termination acidity is 800T.
E) canned: it is canned to carry out the glass ampere by the 5mL specification, vacuum seal, 4 ℃ of preservations.
The oral living vaccine microbiological indicator of above-mentioned bifidus bacillus-hRV-VP7 recombinant vectors: living bifidobacteria number 〉=10
7Cfu/mL, coliform group count＜30cfu/100mL, pathogenic bacterium must not detect.
2, the drug effect of oral living vaccine checking
1) test grouping (30 of the male Kunming of 20 ages in days rats are divided into following 3 groups at random):
The bifidus bacillus control group of vaccine immunity group, no recombinant vectors and PBS control group.
2) Kunming rat oral gavage immunity test (4.0 * 10
9Bacterium/only):
The bifidus bacillus control group of no recombinant vectors: irritate stomach with the bifidus bacillus that the pBEX that does not contain VP7 transforms, at 0d, 7d, 14d and 21d irritate stomach totally 4 times;
The PBS control group: irritate stomach respectively with PBS, at 0d, 7d, 14d and 21d irritate stomach totally 4 times;
The vaccine immunity group: irritate stomach with the oral living vaccine of above-mentioned bifidus bacillus-hRV-VP7 recombinant vectors, at 0d, 7d, 14d and 21d irritate stomach totally 4 times;
Detect the special antibody of VP7 behind the 28d.
3) test-results:
The antibody titers of 10 rats of vaccine immunity group is 1: 256, and the bifidus bacillus control group and the PBS control group that do not have recombinant vectors then do not have specific antibody to produce.Proof the present invention recombinates, and infection has stronger immunological effect to oral living vaccine to hRV.
Reference:
1. Li Zhongming is edited. contemporary novel vaccine. and Beijing: Higher Education Publishing House, 2000,475-486.
2.Choi?AH，Basu?M，Rae?MN，et?al.Particle-bombardment-mediated?DNAvaccination?with?rotavirus?VP7?or?VP7?induces?high?levels?of?serum?rotavirus?IgGbut?fails?to?protect?mice?against?challenge.1998.Virology?250.230-240
3.Hermann?JE，Chen?SC，Jines?DH，et?al.Immune?responses?and?protectionobtained?by?oral?immunization?with?rotavirus?VP7?and?VP7?DNA?vaccinesencapsulated?in?microparticles.Virology.1999，259(1)：148-53.
4.Coste?A，Sirard?JC，Johensen?K，et?al.Nasal?immunization?of?mice?withvirus-like?particles?protects?offspring?against?rotavirus?diarrhea.J?Virol.2000，74(19)：8966-8971.
5.Wu?YZ，Li?JT，Mou?ZR，et?al.Oral?immunization?with?rotavirus?VP7expressed?in?transgenic?potatoes?induced?high?titers?of?mucosal?neutralizingIgA.Virology.2003Sep?1；313(2)：337-42.
6.Subbotina?MD，Timchenko?VN，Vorobyov?MM，et?al.Effect?of?oraladministration?of?tormentil?root?extract(Potentilla?tormentilla)on?rotavirusdiarrhea?in?children：a?randomized，double?blind，controlled?trial.PediatrInfect?Dis?J.2003，22(8)：706-11.
7.Qiao?HP，Duffy，LC，Griffiths，E，et?al.Immune?responses?in?Rhesusrotavirus-challenged?Balb/c?mice?treated?with?Bifidobacteria?and?prebioticsupplements.Pediatr?Res.2002，51(6)：750-755.
8. the Li Lanjuan chief editor infects little ecology. Beijing: People's Medical Officer Press, 2002.p740.
9.Fujimori?M，Amano?J?&?Taniguchi?S.The?genus?Bifidobacterium?for?cancergene?therapy.Curr?Opin?Drug?Discov?Devel.2002Mar；5(2)：200-3.
10. the side starts the third of the twelve Earthly Branches, Qi Jin, and Yang Hui, etc. the somatotype research of China 1998-1999 popular infantile diarrhea rotavirus. viral journal, 2001,17 (1): 17-22.
11.Ciarlet?M，Conner?ME，Finegold?MJ，et?al.Group?A?rotavirus?infection?andage-dependent?diarrheal?disease?in?rats：a?new?animal?model?to?study?thepathophysiology?of?rotavirus?infection.J?Virol.2002，76(1)：41-57.
12.Ruiz-palacios，G?M，prez-Schael?I，velazquez?FR，et?al.Evaluation?ofsafety，immunogenicity?and?efficacy?of?an?attenuated?rotavirus?vaccine.N?Engl?JMed.2006，354(1)：11-22.
13.Bernstein?DI，Ward?RL.RIX4414：A?randomized，placebo-controlled?trialin?Latin?American?infants.Pediatr?Ann.2006，35(1)：38-43.
14.Offit?PA.Clark?HF.RotaTeq：a?pentavalent?bovine--human?reassortantrotavirus?vaccine.Pediatr?Ann.2006，35(1)：29-34.
15. the Wang Ming loyalty, Zhu advances, the prokaryotic expression of the local strain coat protein of people A group rotavirus VP7,2004,14 (1): 6-7
16. Liu Xin, Sun Maosheng, the prokaryotic expression of rotavirus vp7 gene, protein purification and animal immune test, animal medicine progress, 2006,27 (12): 88-90
17. grandson is luxuriant, Zan Yunhong, and Ma Yanbing, Zhang Guangming, Du Qiujiang, Dai Changbai, recombinant adenovirus express rotavirus SA11 strain VP7 albumen and glycosylation thereof, Chinese medical courses in general institute journal, 2000,22 (1): 52-56
18. Liu Xin, Zhang Guangming, Li Hongzhao, Xie Tianhong, Sun Maosheng expresses the passive immunization provide protection of the antigenic recombinant adenovirus of rotavirus VP 7 to newborn mice, and the Chinese biological goods are learned magazine, 2007,20 (1): 33-36
19. hole China, Guo Anping, Guo Yunling, Liu Enping, Zhang Xiaoyun, He Lika, the research of rotavirus shell antigen protein VP7 gene transformation ramie, Anhui agricultural sciences, 2006,24 (24): 6460-6462,6464
SEQUENCE?LISTING
＜110〉Medical University Of Chongqing
＜120〉recombined bifidobacteria-hRV/VP7 expression vector and oral vaccine thereof
<130>A080011K
<160>14
<170>PatentIn?version?3.4
<210>1
<211>3509
<212>DNA
<213>artificial
<220>
<223>artificial
<400>1
ccgcggtaaa?acgacggcca?gttaaaataa?acagcatacg?ttcgcaatag?tgcaaacgct 60
atcaaagaag?atgaaccccc?gttaaaggga?ttgaagaaaa?ggaataaagg?agccggatcc 120
ccgaattccc?gggtcgactc?gagcggccgc?atcgtgactg?actgacgatc?tgcctcgcgc 180
gtttcggtga?tgacggtgaa?aacctctgac?acatgcagct?cccggagacg?gtcacagctt 240
gtctgtaagc?ggatgccggg?agcagacaag?cccgtcaggg?cgcgtcagcg?ggtgttggcg 300
ggtgtcgggg?cgcagccatg?acccagtcac?gtagcgatag?cggagtgtat?aattcttgaa 360
gacgaaaggg?cctcgtgata?cgcctatttt?tataggttaa?tgtcatgata?ataatggttt 420
cttagacgtc?gtacttagta?caaaagggga?gcgaacttag?tacaaaaggg?gagcgaactt 480
agtacaaaag?gggagcgaac?ttagtacaaa?aggggagcga?acttagtaaa?taaataaact 540
ttgtactagt?atggagtcat?gtccaatgag?atcgtgaagt?tcagcaacca?gttcaacaac 600
gtcgcgctga?agaagttcga?cgccgtgcac?ctggacgtgc?tcatggcgat?cgcttcaagg 660
gtgagggaga?agggcacggc?cacggtggag?ttctcgttcg?aggagctgcg?cggcctcatg 720
cgattgagga?agaacctgac?caacaagcag?ctggccgaca?agatcgtgca?gacgaacgcg 780
cgcctgctgg?cgctgaacta?catgttcgag?gattcgggca?agatcatcca?gttcgcgctg 840
ttcacgaagt?tcgtcaccga?cccgcaggag?gcgactctcg?cggttggggt?caacgaggag 900
ttcgcgttcc?tgctcaacga?cctgaccagc?cagttcacgc?gcttcgagct?ggccgagttc 960
gccgacctca?agagcaagta?cgccaaggag?ttctacaggc?gcgccaagca?gtaccgcagc 1020
tcgggaatct?ggaagatcag?ccgcgatgag?ttctgccgac?tgcttggcgt?atccgattcc 1080
acggcaaaat?ccaccgccaa?cctgaacagg?gtcgtgctga?agacgatcgc?cgaagagtgt 1140
gggcctctcc?ttggcctgaa?gatcgagcgc?cagtacgtga?aacgcaggct?gtcgggcttc 1200
gtgttcacgt?tcgcccgcga?gacccctccg?gtgatcgacg?ccaggcccgt?ggaggcgagg 1260
aagacggacg?gcgacggcaa?gggccattgg?acgagcgtgg?cggggtacgg?cgaggtgttc 1320
acgaccacgg?agctgttcga?cgtgacggcc?gcgcgtgacc?acttcgacgg?caccgtggag 1380
gccggggaat?gccgtttcct?gcgcgtttga?cgcgcgcaac?cgcgaacatc?atgacgtcag 1440
gtggcacttt?tcggggaaat?gtgcgcggaa?cccctatttg?tttatttttc?taaatacatt 1500
caaatatgta?tccgctcatg?agacaataac?cctgataaat?gcttcaataa?tattgaaaaa 1560
ggaagagtat?gagtattcaa?catttccgtg?tcgcccttat?tccctttttt?gcggcatttt 1620
gccttcctgt?ttttgctcac?ccagaaacgc?tggtgaaagt?aaaagatgct?gaagatcagt 1680
tgggtgcacg?agtgggttac?atcgaactgg?atctcaacag?cggtaagatc?cttgagagtt 1740
ttcgccccga?agaacgtttt?ccaatgatga?gcacttttaa?agttctgcta?tgtggcgcgg 1800
tattatcccg?tgttgacgcc?gggcaagagc?aactcggtcg?ccgcatacac?tattctcaga 1860
atgacttggt?tgagtactca?ccagtcacag?aaaagcatct?tacggatggc?atgacagtaa 1920
gagaattatg?cagtgctgcc?ataaccatga?gtgataacac?tgcggccaac?ttacttctga 1980
caacgatcgg?aggaccgaag?gagctaaccg?cttttttgca?caacatgggg?gatcatgtaa 2040
ctcgccttga?tcgttgggaa?ccggagctga?atgaagccat?accaaacgac?gagcgtgaca 2100
ccacgatgcc?tgcagcaatg?gcaacaacgt?tgcgcaaact?attaactggc?gaactactta 2160
ctctagcttc?ccggcaacaa?ttaatagact?ggatggaggc?ggataaagtt?gcaggaccac 2220
ttctgcgctc?ggcccttccg?gctggctggt?ttattgctga?taaatctgga?gccggtgagc 2280
gtgggtctcg?cggtatcatt?gcagcactgg?ggccagatgg?taagccctcc?cgtatcgtag 2340
ttatctacac?gacggggagt?caggcaacta?tggatgaacg?aaatagacag?atcgctgaga 2400
taggtgcctc?actgattaag?cattggtaac?tgtcagacca?agtttactca?tatatacttt 2460
agattgattt?aaaacttcat?ttttaattta?aaaggatcta?ggtgaagatc?ctttttgata 2520
atctcatgac?caaaatccct?taacgtgagt?tttcgttcca?ctgagcgtca?gaccccgtag 2580
aaaagatcaa?aggatcttct?tgagatcctt?tttttctgcg?cgtaatctgc?tgcttgcaaa 2640
caaaaaaacc?accgctacca?gcggtggttt?gtttgccgga?tcaagagcta?ccaactcttt 2700
ttccgaaggt?aactggcttc?agcagagcgc?agataccaaa?tactgtcctt?ctagtgtagc 2760
cgtagttagg?ccaccacttc?aagaactctg?tagcaccgcc?tacatacctc?gctctgctaa 2820
tcctgttacc?agtggctgct?gccagtggcg?ataagtcgtg?tcttaccggg?ttggactcaa 2880
gacgatagtt?accggataag?gcgcagcggt?cgggctgaac?ggggggttcg?tgcacacagc 2940
ccagcttgga?gcgaacgacc?tacaccgaac?tgagatacct?acagcgtgag?ctatgagaaa 3000
gcgccacgct?tcccgaaggg?agaaaggcgg?acaggtatcc?ggtaagcggc?agggtcggaa 3060
caggagagcg?cacgagggag?cttccagggg?gaaacgcctg?gtatctttat?agtcctgtcg 3120
ggtttcgcca?cctctgactt?gagcgtcgat?ttttgtgatg?ctcgtcaggg?gggcggagcc 3180
tatggaaaaa?cgccagcaac?gcggcctttt?tacggttcct?ggccttttgc?tggccttttg 3240
ctcacatgtt?ctttcctgcg?ttatcccctg?attctgtgga?taaccgtatt?accgcctttg 3300
agtgagctga?taccgctcgc?cgcagccgaa?cgaccgagcg?cagcgagtca?gtgagcgagg 3360
aagcggaaga?gcgcctgatg?cggtattttc?tccttacgca?tctgtgcggt?atttcacacc 3420
gcataaattc?cgacaccatc?gaatggtgca?aaacctttcg?cggtatggca?tgatagcgcc 3480
cggaagagag?tcaattcagg?gtggtgaat 3509
<210>2
<211>981
<212>DNA
<213>Human?rotavirus
<400>2
atgtatggta?ttgaatatac?cacaattcta?atctttttga?tatcaatcat?tctactcaac 60
tatatattaa?aatcagtgac?tcgaataatg?gactacatta?tatatagatt?tttgttgatt 120
actgtagcat?tatttgcttt?gacaagagct?cagaattatg?gacttaactt?accaataaca 180
ggatcaatgg?acgctgtata?tactaactct?actcaagaag?aagtgtttct?aacttctacg 240
ttatgtctgt?attatccaac?tgaagcaagt?actcaaatca?atgatggtga?ctggaaagac 300
tcattgtcgc?aaatgtttct?tacaaagggt?tggccaacag?gatctgttta?ctttaaagag 360
tactcaaata?ttgttgattt?ttctgttgac?ccacagctgt?attgtgacta?taatttagta 420
cttatgaaat?atgaccaaag?tcttaaatta?gatatgtcag?agttagctga?tttaatattg 480
aatgaatggt?tatgtaaccc?aatggatgta?acattatact?attatcaaca?atcgggagaa 540
tcaaataagt?ggatatcgat?gggatcatca?tgtaccgtga?aagtgtgtcc?gctaaataca 600
caaacgttag?ggataggttg?tcaaacaaca?aacgtagact?catttgaaat?gattgctgag 660
aatgagaaat?tagctatagt?ggatgtcgtt?gatgggataa?atcataaaat?aaatttaaca 720
actacgacat?gtactattcg?aaattgtaag?aaattaggtc?caagagaaaa?tgtagctgta 780
atacaagttg?gtggttctaa?tgtgttagac?ataacagcag?atccaacaac?taatccacaa 840
actgagagaa?tgatgagagt?gaattggaaa?aagtggtggc?aagtatttta?tactatagta 900
gattatatta?atcaaattgt?acaggtaatg?tccaaaagat?caagatcatt?aaattctgca 960
gctttttatt?atagagtata?g 981
<210>3
<211>4478
<212>DNA
<213>artificial
<220>
<223>artificial
<400>3
ccgcggtaaa?acgacggcca?gttaaaataa?acagcatacg?ttcgcaatag?tgcaaacgct 60
atcaaagaag?atgaaccccc?gttaaaggga?ttgaagaaaa?ggaataaagg?agccggatcc 120
atgtatggta?ttgaatatac?cacaattcta?atctttttga?tatcaatcat?tctactcaac 180
tatatattaa?aatcagtgac?tcgaataatg?gactacatta?tatatagatt?tttgttgatt 240
actgtagcat?tatttgcttt?gacaagagct?cagaattatg?gacttaactt?accaataaca 300
ggatcaatgg?acgctgtata?tactaactct?actcaagaag?aagtgtttct?aacttctacg 360
ttatgtctgt?attatccaac?tgaagcaagt?actcaaatca?atgatggtga?ctggaaagac 420
tcattgtcgc?aaatgtttct?tacaaagggt?tggccaacag?gatctgttta?ctttaaagag 480
tactcaaata?ttgttgattt?ttctgttgac?ccacagctgt?attgtgacta?taatttagta 540
cttatgaaat?atgaccaaag?tcttaaatta?gatatgtcag?agttagctga?tttaatattg 600
aatgaatggt?tatgtaaccc?aatggatgta?acattatact?attatcaaca?atcgggagaa 660
tcaaataagt?ggatatcgat?gggatcatca?tgtaccgtga?aagtgtgtcc?gctaaataca 720
caaacgttag?ggataggttg?tcaaacaaca?aacgtagact?catttgaaat?gattgctgag 780
aatgagaaat?tagctatagt?ggatgtcgtt?gatgggataa?atcataaaat?aaatttaaca 840
actacgacat?gtactattcg?aaattgtaag?aaattaggtc?caagagaaaa?tgtagctgta 900
atacaagttg?gtggttctaa?tgtgttagac?ataacagcag?atccaacaac?taatccacaa 960
actgagagaa?tgatgagagt?gaattggaaa?aagtggtggc?aagtatttta?tactatagta 1020
gattatatta?atcaaattgt?acaggtaatg?tccaaaagat?caagatcatt?aaattctgca 1080
gctttttatt?atagagtata?ggtcgactcg?agcggccgca?tcgtgactga?ctgacgatct 1140
gcctcgcgcg?tttcggtgat?gacggtgaaa?acctctgaca?catgcagctc?ccggagacgg 1200
tcacagcttg?tctgtaagcg?gatgccggga?gcagacaagc?ccgtcagggc?gcgtcagcgg 1260
gtgttggcgg?gtgtcggggc?gcagccatga?cccagtcacg?tagcgatagc?ggagtgtata 1320
attcttgaag?acgaaagggc?ctcgtgatac?gcctattttt?ataggttaat?gtcatgataa 1380
taatggtttc?ttagacgtcg?tacttagtac?aaaaggggag?cgaacttagt?acaaaagggg 1440
agcgaactta?gtacaaaagg?ggagcgaact?tagtacaaaa?ggggagcgaa?cttagtaaat 1500
aaataaactt?tgtactagta?tggagtcatg?tccaatgaga?tcgtgaagtt?cagcaaccag 1560
ttcaacaacg?tcgcgctgaa?gaagttcgac?gccgtgcacc?tggacgtgct?catggcgatc 1620
gcttcaaggg?tgagggagaa?gggcacggcc?acggtggagt?tctcgttcga?ggagctgcgc 1680
ggcctcatgc?gattgaggaa?gaacctgacc?aacaagcagc?tggccgacaa?gatcgtgcag 1740
acgaacgcgc?gcctgctggc?gctgaactac?atgttcgagg?attcgggcaa?gatcatccag 1800
ttcgcgctgt?tcacgaagtt?cgtcaccgac?ccgcaggagg?cgactctcgc?ggttggggtc 1860
aacgaggagt?tcgcgttcct?gctcaacgac?ctgaccagcc?agttcacgcg?cttcgagctg 1920
gccgagttcg?ccgacctcaa?gagcaagtac?gccaaggagt?tctacaggcg?cgccaagcag 1980
taccgcagct?cgggaatctg?gaagatcagc?cgcgatgagt?tctgccgact?gcttggcgta 2040
tccgattcca?cggcaaaatc?caccgccaac?ctgaacaggg?tcgtgctgaa?gacgatcgcc 2100
gaagagtgtg?ggcctctcct?tggcctgaag?atcgagcgcc?agtacgtgaa?acgcaggctg 2160
tcgggcttcg?tgttcacgtt?cgcccgcgag?acccctccgg?tgatcgacgc?caggcccgtg 2220
gaggcgagga?agacggacgg?cgacggcaag?ggccattgga?cgagcgtggc?ggggtacggc 2280
gaggtgttca?cgaccacgga?gctgttcgac?gtgacggccg?cgcgtgacca?cttcgacggc 2340
accgtggagg?ccggggaatg?ccgtttcctg?cgcgtttgac?gcgcgcaacc?gcgaacatca 2400
tgacgtcagg?tggcactttt?cggggaaatg?tgcgcggaac?ccctatttgt?ttatttttct 2460
aaatacattc?aaatatgtat?ccgctcatga?gacaataacc?ctgataaatg?cttcaataat 2520
attgaaaaag?gaagagtatg?agtattcaac?atttccgtgt?cgcccttatt?cccttttttg 2580
cggcattttg?ccttcctgtt?tttgctcacc?cagaaacgct?ggtgaaagta?aaagatgctg 2640
aagatcagtt?gggtgcacga?gtgggttaca?tcgaactgga?tctcaacagc?ggtaagatcc 2700
ttgagagttt?tcgccccgaa?gaacgttttc?caatgatgag?cacttttaaa?gttctgctat 2760
gtggcgcggt?attatcccgt?gttgacgccg?ggcaagagca?actcggtcgc?cgcatacact 2820
attctcagaa?tgacttggtt?gagtactcac?cagtcacaga?aaagcatctt?acggatggca 2880
tgacagtaag?agaattatgc?agtgctgcca?taaccatgag?tgataacact?gcggccaact 2940
tacttctgac?aacgatcgga?ggaccgaagg?agctaaccgc?ttttttgcac?aacatggggg 3000
atcatgtaac?tcgccttgat?cgttgggaac?cggagctgaa?tgaagccata?ccaaacgacg 3060
agcgtgacac?cacgatgcct?gcagcaatgg?caacaacgtt?gcgcaaacta?ttaactggcg 3120
aactacttac?tctagcttcc?cggcaacaat?taatagactg?gatggaggcg?gataaagttg 3180
caggaccact?tctgcgctcg?gcccttccgg?ctggctggtt?tattgctgat?aaatctggag 3240
ccggtgagcg?tgggtctcgc?ggtatcattg?cagcactggg?gccagatggt?aagccctccc 3300
gtatcgtagt?tatctacacg?acggggagtc?aggcaactat?ggatgaacga?aatagacaga 3360
tcgctgagat?aggtgcctca?ctgattaagc?attggtaact?gtcagaccaa?gtttactcat 3420
atatacttta?gattgattta?aaacttcatt?tttaatttaa?aaggatctag?gtgaagatcc 3480
tttttgataa?tctcatgacc?aaaatccctt?aacgtgagtt?ttcgttccac?tgagcgtcag 3540
accccgtaga?aaagatcaaa?ggatcttctt?gagatccttt?ttttctgcgc?gtaatctgct 3600
gcttgcaaac?aaaaaaacca?ccgctaccag?cggtggtttg?tttgccggat?caagagctac 3660
caactctttt?tccgaaggta?actggcttca?gcagagcgca?gataccaaat?actgtccttc 3720
tagtgtagcc?gtagttaggc?caccacttca?agaactctgt?agcaccgcct?acatacctcg 3780
ctctgctaat?cctgttacca?gtggctgctg?ccagtggcga?taagtcgtgt?cttaccgggt 3840
tggactcaag?acgatagtta?ccggataagg?cgcagcggtc?gggctgaacg?gggggttcgt 3900
gcacacagcc?cagcttggag?cgaacgacct?acaccgaact?gagataccta?cagcgtgagc 3960
tatgagaaag?cgccacgctt?cccgaaggga?gaaaggcgga?caggtatccg?gtaagcggca 4020
gggtcggaac?aggagagcgc?acgagggagc?ttccaggggg?aaacgcctgg?tatctttata 4080
gtcctgtcgg?gtttcgccac?ctctgacttg?agcgtcgatt?tttgtgatgc?tcgtcagggg 4140
ggcggagcct?atggaaaaac?gccagcaacg?cggccttttt?acggttcctg?gccttttgct 4200
ggccttttgc?tcacatgttc?tttcctgcgt?tatcccctga?ttctgtggat?aaccgtatta 4260
ccgcctttga?gtgagctgat?accgctcgcc?gcagccgaac?gaccgagcgc?agcgagtcag 4320
tgagcgagga?agcggaagag?cgcctgatgc?ggtattttct?ccttacgcat?ctgtgcggta 4380
tttcacaccg?cataaattcc?gacaccatcg?aatggtgcaa?aacctttcgc?ggtatggcat 4440
gatagcgccc?ggaagagagt?caattcaggg?tggtgaat 4478
<210>4
<211>16
<212>DNA
<213>artificial
<220>
<223>artificial
<400>4
taaaacgacg?gccagt 16
<210>5
<211>92
<212>DNA
<213>artificial
<220>
<223>artificial
<400>5
taaaataaac?agcatacgtt?cgcaatagtg?caaacgctat?caaagaagat gaacccccgt 60
taaagggatt?gaagaaaagg?aataaaggag?cc 92
<210>6
<211>26
<212>DNA
<213>artificial
<220>
<223>artificial
<400>6
tcgaccgcgg?taaaacgacg?gccagt 26
<210>7
<211>127
<212>DNA
<213>artificial
<220>
<223>artificial
<400>7
tcgaccgcgg?taaaacgacg?gccagttaaa?ataaacagca?tacgttcgca?atagtgcaaa 60
cgctatcaaa?gaagatgaac?ccccgttaaa?gggattgaag?aaaaggaata?aaggagccgg 120
atccatc 127
<210>8
<211>21
<212>DNA
<213>artificial
<220>
<223>artificial
<400>8
attaggatcc ccgaattccc g 21
<210>9
<211>30
<212>DNA
<213>artificial
<220>
<223>artificial
<400>9
tcgaccgcgg?attcaccacc ctgaattgac 30
<210>10
<211>28
<212>DNA
<213>artificial
<220>
<223>artificial
<400>10
gcgacgtcgt?acttagtaca?aaagggga 28
<210>11
<211>26
<212>DNA
<213>artificial
<220>
<223>artificial
<400>11
gcgacgtcat?gatgttcgcg?gttgcg 26
<210>12
<211>1020
<212>DNA
<213>artificial
<220>
＜223〉the 5th～1018 bit base sequence is the sequence that is written into bifidobacteria-bacillus coli shuttle expression vector of the present invention
<400>12
ggccgacgtc?gtacttagta?caaaagggga?gcgaacttag?tacaaaaggg?gagcgaactt 60
agtacaaaag?gggagcgaac?ttagtacaaa?aggggagcga?acttagtaaa?taaataaact 120
ttgtactagt?atggagtcat?gtccaatgag?atcgtgaagt?tcagcaacca?gttcaacaac 180
gtcgcgctga?agaagttcga?cgccgtgcac?ctggacgtgc?tcatggcgat?cgcttcaagg 240
gtgagggaga?agggcacggc?cacggtggag?ttctcgttcg?aggagctgcg?cggcctcatg 300
cgattgagga?agaacctgac?caacaagcag?ctggccgaca?agatcgtgca?gacgaacgcg 360
cgcctgctgg?cgctgaacta?catgttcgag?gattcgggca?agatcatcca?gttcgcgctg 420
ttcacgaagt?tcgtcaccga?cccgcaggag?gcgactctcg?cggttggggt?caacgaggag 480
ttcgcgttcc?tgctcaacga?cctgaccagc?cagttcacgc?gcttcgagct?ggccgagttc 540
gccgacctca?agagcaagta?cgccaaggag?ttctacaggc?gcgccaagca?gtaccgcagc 600
tcgggaatct?ggaagatcag?ccgcgatgag?ttctgccgac?tgcttggcgt?atccgattcc 660
acggcaaaat?ccaccgccaa?cctgaacagg?gtcgtgctga?agacgatcgc?cgaagagtgt 720
gggcctctcc?ttggcctgaa?gatcgagcgc?cagtacgtga?aacgcaggct?gtcgggcttc 780
gtgttcacgt?tcgcccgcga?gacccctccg?gtgatcgacg?ccaggcccgt?ggaggcgagg 840
aagacggacg?gcgacggcaa?gggccattgg?acgagcgtgg?cggggtacgg?cgaggtgttc 900
acgaccacgg?agctgttcga?cgtgacggcc?gcgcgtgacc?acttcgacgg?caccgtggag 960
gccggggaat?gccgtttcct?gcgcgtttga?cgcgcgcaac?cgcgaacatc?atgacgtcgc 1020
<210>13
<211>29
<212>DNA
<213>artificial
<220>
<223>artificial
<400>13
atcggatcca?tgtatggtat?tgaatatac 29
<210>14
<211>33
<212>DNA
<213>artificial
<220>
<223>artificial
<400>14
acggtcgacc?tatacctcta?taataaaaag?ctg 33
Claims (10)
1. a recombined bifidobacteria hRV-VP7 expression vector is characterized in that: the coding gene sequence that is mounted with the viral protein VP7 of people A group rotavirus.
2. recombined bifidobacteria hRV-VP7 expression vector according to claim 1 is characterized in that: described bifidus bacillus expression vector is intestinal bacteria-bifidus bacillus shuttle expression carrier.
3. recombined bifidobacteria hRV-VP7 expression vector according to claim 2 is characterized in that: described intestinal bacteria-bifidus bacillus shuttle expression carrier has the nucleotide sequence shown in the SEQ ID NO.1.
4. recombined bifidobacteria hRV-VP7 expression vector according to claim 1 is characterized in that: the viral protein VP7 of described people A group rotavirus has the nucleotide sequence shown in the SEQ ID NO.2.
5. according to the described recombined bifidobacteria hRV-VP7 of claim 1 expression vector, it is characterized in that: have the nucleotide sequence shown in the SEQ ID NO.3.
6. the host cell that contains each described recombined bifidobacteria hRV-VP7 expression vector of claim 1～5.
7. host cell according to claim 6 is characterized in that: described host cell is a bifidus bacillus.
8. each described recombined bifidobacteria hRV-VP7 expression vector of claim 1～5 or claim 6 or the 7 described host cells purposes in the mucosal adjuvant of the oral vaccine of the disease that preparation prevention or treatment people A group rotavirus cause or oral vaccine.
9. the oral vaccine of the disease that causes of prevention or treatment people A group rotavirus or the mucosal adjuvant of oral vaccine is characterized in that by claim 6 or 7 described host cells add acceptable accessories or complementary composition is prepared from.
10. the mucosal adjuvant of oral vaccine according to claim 9 or oral vaccine is characterized in that: the formulation of the mucosal adjuvant of described oral vaccine or oral vaccine is oral liquid, oral liquid, tablet or capsule.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008103001814A CN101220372B (en) | 2008-01-22 | 2008-01-22 | Recombined bifidobacteria -hRV/VP7 expression vector and oral vaccine thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008103001814A CN101220372B (en) | 2008-01-22 | 2008-01-22 | Recombined bifidobacteria -hRV/VP7 expression vector and oral vaccine thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101220372A true CN101220372A (en) | 2008-07-16 |
| CN101220372B CN101220372B (en) | 2011-08-24 |
Family
ID=39630448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008103001814A Expired - Fee Related CN101220372B (en) | 2008-01-22 | 2008-01-22 | Recombined bifidobacteria -hRV/VP7 expression vector and oral vaccine thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101220372B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110042076A (en) * | 2019-04-11 | 2019-07-23 | 黑龙江八一农垦大学 | A kind of building and its application of the recombination lactobacillus paracasei of surface display porcine rotavirus VP7 albumen |
| CN111635910A (en) * | 2020-06-09 | 2020-09-08 | 成都大熊猫繁育研究基地 | Panda rotavirus CH-1 strain VP7 positive plasmid and construction method and application thereof |
| CN114478714A (en) * | 2022-02-04 | 2022-05-13 | 通化师范学院 | Method for analyzing expression and immunogenicity of recombinant human rotavirus VP7 protein |
-
2008
- 2008-01-22 CN CN2008103001814A patent/CN101220372B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110042076A (en) * | 2019-04-11 | 2019-07-23 | 黑龙江八一农垦大学 | A kind of building and its application of the recombination lactobacillus paracasei of surface display porcine rotavirus VP7 albumen |
| CN111635910A (en) * | 2020-06-09 | 2020-09-08 | 成都大熊猫繁育研究基地 | Panda rotavirus CH-1 strain VP7 positive plasmid and construction method and application thereof |
| CN114478714A (en) * | 2022-02-04 | 2022-05-13 | 通化师范学院 | Method for analyzing expression and immunogenicity of recombinant human rotavirus VP7 protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101220372B (en) | 2011-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2005336206A (en) | Recombinant racoon poxvirus and its use as effective vaccine against feline infectious peritonitis virus disease | |
| EA034564B1 (en) | Rotavirus subunit vaccine, method of making and use thereof | |
| CN106591344A (en) | Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof | |
| CN102719471B (en) | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium | |
| CN101220372B (en) | Recombined bifidobacteria -hRV/VP7 expression vector and oral vaccine thereof | |
| CN106011133B (en) | A kind of small DNA molecular amount reference substance, reference substance plasmid and preparation method thereof | |
| CN112226451A (en) | Bacillus subtilis expression system and method for producing alpha-L-AFs by using same | |
| CN108714210B (en) | Application of recombinant attenuated listeria in preparation of mesothelin high-expression cancer therapeutic vaccine | |
| CN112501139B (en) | Recombinant Newcastle disease virus strain and preparation method and application thereof | |
| CN113736676A (en) | Preparation and application of oral recombinant saccharomyces cerevisiae for expressing porcine epidemic diarrhea virus S protein | |
| CN113073102B (en) | Application of autophagy gene ATG9 in rice breeding and/or rice grain type mechanism research | |
| PT91520A (en) | PROCESS FOR THE PREPARATION OF PROTEINS BY EXPRESSION OF HOMOLOGICAL AND HETEROLOGICAL PROTEINS FUNCTIONAL FROM THE EXTERNAL MEMBRANE OF E. COLI AND OTHER GRAM-NEGATIVE BACTERIA | |
| CN104328136B (en) | The preparation of Newcastle disease poison strain rClone30 fliC and its application in Newcastle disease prevention | |
| CN104357409B (en) | Express chicken IL2 recombinant Newcastle disease virus and its application in vaccine | |
| CN113061620A (en) | T4 phage capsid inner cavity target protein packaging system and construction method and application thereof | |
| CN109628487A (en) | A method of growth factor of human nerve is prepared using transgene pig salivary gland | |
| CN104789583A (en) | Human enterotoxigenic Excherichia coli flagellin 2FliC fusion protein and application thereof | |
| KR102655938B1 (en) | Composition for producing ginsenoside compound K comprising thermo satble alpha-L-arabinofuranosidase enzyme and preparation method of ginsenoside compound K | |
| CN113862207B (en) | Modified strain, application thereof in preparation of intestinal motility promoting preparation and product | |
| CN111748034A (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
| CN108704126A (en) | Mesothelin height based on recombinant attenuated Listeria monocytogenes expresses cancer therapeutic vaccine | |
| CN101220371B (en) | Recombined bifidobacteria hRV-VP4 expression vector and oral vaccine thereof | |
| CN112272565A (en) | In vivo gene therapy using delivery of lentiviral gene constructs | |
| CN102382844B (en) | Neisseria gonorrhoeae immune repression mutant gene delta rmp and mutant method | |
| CN109321601B (en) | AQP5 recombinant overexpression vector and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110824 Termination date: 20200122 |