CN102382844B - Neisseria gonorrhoeae immune repression mutant gene delta rmp and mutant method - Google Patents

Abstract

The invention relates to the field of medical microbiology, in particular to a neisseria gonorrhoeae immune repression mutant gene delta rmp and a mutant method. The neisseria gonorrhoeae immune repression mutant gene delta rmp has a nucleotide sequence shown as SEQ ID NO.10. The mutant gene is obtained by the following methods that: neisseria gonorrhoeae genomic deoxyribonucleic acid (DNA) is used as a template for carrying out polymerase chain reaction (PCR) amplification on the rmp gene, in addition, the rmp gene is connected into a T arrier pMD19, a connecting product pMD19rmp is used as a template for amplifying linear DNA fragments including the rmp gene downstream side wing region, pMD19 carrier framework and rmp gene upstream side wing region, the gene is connected with a kanamycin resistance gene Kanr subject to the same macrorestriction treatment, and the mutant gene delta rmp is obtained.

Description

Mutator gene Δ rmp and mutation method are checked in a kind of NEISSERIA GONORRHOEAE immunity

Technical field

The present invention relates to the medical microbiology field, be specifically related to a kind of NEISSERIA GONORRHOEAE immunity repressor gene mutation method.

Background technology

NEISSERIA GONORRHOEAE ( Neisseriagonorrhoeae) natural host be human, cause the sexually transmitted disease (STD) gonorrhoea after the infection, can cause a series of pathologies, comprise local infection (like urethritis, epididymis inflammation, cervicitis, salpingitis etc.) and whole body disseminated infections.The pathology at position such as uterine tube, pelvic cavity can cause serious sequela such as Infertility or ectopic pregnancy.Gonorrhoea patient has also increased the morbidity chance of AIDS greatly.Incidence of Gonorrhea is high, global annual new cases about 6,200 ten thousand.Treatment has brought increasing difficulty to more and more serious NEISSERIA GONORRHOEAE resistance phenomenon to gonorrhoea.Therefore, developing effective vaccine is one of emphasis direction in the anti-system work of gonorrhoea.

It is difficult that the NEISSERIA GONORRHOEAE vaccine development is gone through, and the nineteen seventies human trial of whole-cell vaccines meets with failure, and the emphasis of research begins to turn to new generation vaccines such as subunit vaccine and gene vaccine.Pili be first by the NEISSERIA GONORRHOEAE subunit composition of purifying, although the pili behind the purifying can stimulate body to produce higher titer antibody, because some epi-position degrees of variation of pili surface are high, these antibody do not have significant immanoprotection action.Same owing to highly make a variation, another kind of important adhesion factor Opa albumen also is restricted in the gonorrhoea vaccine development.Porin is the I type outer membrane protein of continuous expression on the NEISSERIA GONORRHOEAE surface, has characteristics such as immunogenicity is strong, antigen is conservative relatively.The initial stage nineties was once carried out the animal immune experiment with the porin vaccine that covers most serotypes, and effect is not very good.Analyze its reason; Polluted a large amount of Rmp albumen in the porin vaccine that discovery is extracted from the NEISSERIA GONORRHOEAE cell, the latter is good immunogen, and its immunogenicity is higher than porin; Can stimulate body to produce complement fixation antibody; But these antibody not only do not have anti-microbial effect, can produce antagonistic action to the anti-microbial activity of porin antibody on the contrary, even can strengthen the infectivity of NEISSERIA GONORRHOEAE.Along with developing rapidly of genetic engineering technique, express the important directions that NEISSERIA GONORRHOEAE antigen becomes development gonorrhoea vaccine with genetic engineering technique.People successful expression multiple NEISSERIA GONORRHOEAE antigen; Like Porin, NspA, TbpA, TbpB, LOS etc.; Carry out purifying and renaturation with the protein correlation technique, cooperate certain adjuvant immunity mouse, finding all can inducing producing specificity protection antibody in the mouse body.

From the present Research analysis of present NEISSERIA GONORRHOEAE vaccine, it is very difficult preventing infection due to Neisseria gonorrhoeae fully with single a kind of antigenic NEISSERIA GONORRHOEAE vaccine.Although this vaccine can produce certain protection power,, if this inoculation just makes infection due to Neisseria gonorrhoeae transfer asymptomatic type to, the infected thereby do not seek medical advice, that can increase the propagation of NEISSERIA GONORRHOEAE on the contrary.Therefore, containing vaccine more even all NEISSERIA GONORRHOEAE protective antigens is optimal gonorrhoea vaccine candidate.

Summary of the invention

Contain immune repressor gene in the wild-type NEISSERIA GONORRHOEAE Rmp, the product albumen Rmp of this gene can induce create antagonism harmful antibody of protection antibody of body.In order to solve the problems of the technologies described above, the invention provides a kind of sudden change Rmp, and a kind of NEISSERIA GONORRHOEAE immunity repressor gene mutation method, thereby the effective ways of avoiding harmful antibody to produce have solved the bottleneck problem of developing the NEISSERIA GONORRHOEAE whole-cell vaccines.

The immune repressor gene Δ of sudden change of the present invention Rmp,Its nucleotide sequence is shown in SEQ ID NO.10.

The immune repressor gene Δ of sudden change of the present invention RmpObtain through following method: be to be template with the NEISSERIA GONORRHOEAE genomic dna, pcr amplification RmpGene, and be connected among the T carrier pMD19, to connect product pMD19 RmpBe template, amplification comprises RmpPterion, gene downstream side, pMD19 carrier framework and RmpThe linear DNA fragment of upstream region of gene flanking region, the kalamycin resistance gene Kanr that cuts processing with same enzyme is connected, the mutator gene Δ that obtains Rmp

Mutation method according to the invention comprises that step is following:

(1) RmpThe clone of gene: with the NEISSERIA GONORRHOEAE genomic dna is template, is that primer goes out the NEISSERIA GONORRHOEAE of sequence shown in SEQ ID NO.3 through pcr amplification with the sequence of SEQ ID NO.1 and SEQ ID NO.2 RmpGene;

(2) RmpThe amplification of upstream and downstream both sides flanking region: with what increase in above-mentioned (1) RmpGene and pMD19-T carrier be connected product pMD19 RmpBe template, amplification comprises RmpThe linear fragment of gene both sides flanking region; Amplification comprises RmpForward and reverse primer sequence of gene both sides flanking region linear fragment is respectively shown in SEQ ID NO.4 and SEQ ID NO.5, and amplification obtains sequence comprising shown in SEQ ID NO.6 RmpThe linear fragment of gene both sides flanking region;

(3) be template with plasmid pET-28a (+), amplification Kanr gene order

Wherein primer sequence is shown in SEQ ID NO.7 and the SEQ ID NO.8, and the Kanr gene order that obtains through pcr amplification is shown in SEQ ID NO.9;

(4) RmpThe insertion sudden change of gene

Carry what step (2) obtained RmpGene both sides flanking region linear fragment is used MluI with XhoThe I double digestion is handled; The Kanr gene amplification product that step (3) obtains is with same double digestion digestion; The two connects with the T4 ligase enzyme after reclaiming purifying respectively; Connect product pMD19 Δ RmpBe the NEISSERIA GONORRHOEAE immunity outside the middle carrier framework and check the mutator gene Δ Rmp, its sequence is shown in SEQ ID NO.10.

With said mutation gene Δ RmpBe cloned into suicide plasmid pGMB151, the electrotransformation suicide plasmid of will recombinating changes the NEISSERIA GONORRHOEAE cell over to.The SacB gene that suicide plasmid has can induce bacterium to slough plasmid and and wild-type RmpHomologous recombination takes place, thereby obtains Rmp-mutant strain.

Adopting single antigen or 2 kinds of antigen group cooperations in the NEISSERIA GONORRHOEAE vaccine development at present is vaccine; The antigen limited amount that contains; And NEISSERIA GONORRHOEAE is a kind of thousands of kinds of proteic bacteriums that contain, and the vaccine that limited quantity antigen is made is difficult to stimulate body to produce enough immunoprotections.Method provided by the invention; Because of mutant strain can not be expressed NEISSERIA GONORRHOEAE immunity repressor gene; Having removed NEISSERIA GONORRHOEAE induces body to produce the possibility of harmful antibody; Thereby can prepare the whole-cell vaccines that only stimulate body to produce favourable antibody, for the development of gonorrhoea new generation vaccine brings new breakthrough.

Description of drawings

Fig. 1 is RmpThe agarose gel electrophoresis analysis of gene amplification product.

Fig. 2 comprises RmpPterion, gene downstream side, pMD19 carrier framework and RmpUpstream region of gene flanking region linear DNA fragment agarose gel electrophoresis is analyzed.

Fig. 3 comprises RmpPterion, gene downstream side, pMD19 carrier framework and RmpThe structural representation of upstream region of gene flanking region linear DNA fragment.

Fig. 4. be the analysis of Kanr gene amplification product agarose gel electrophoresis.

Fig. 5 is a NEISSERIA GONORRHOEAE RmpThe PCR screening of-mutant strain, wherein 1 negative contrast; 2-3 does RmpGot into cell but replaced normal as yet RmpThe bacterial strain of gene can amplify simultaneously RmpWith RmpGene; 4 is wild strain, can only amplify RmpGene; 5 is mutant strain, can only amplify RmpGene.

Fig. 6 is a NEISSERIA GONORRHOEAE RmpThe Western blotting of-mutant strain identifies that wherein 1 is wild strain, still expresses Rmp albumen; 2 is mutant strain, does not express Rmp albumen.

Embodiment

With PCR with in the NEISSERIA GONORRHOEAE genome RmpAmplification is come out, and one section of the centre of this gene with the Kanr resistant gene replacement from pET28a, is obtained being inserted into the mutator gene of inactivation Rmp, the latter is connected in the suicide vector, carries RmpThe reorganization suicide vector be placed in the intestinal bacteria, intestinal bacteria and NEISSERIA GONORRHOEAE hatch altogether, and suicide vector is transformed in the wild-type NEISSERIA GONORRHOEAE bacterial strain, screen then and identify after the homologous recombination wild RmpQuilt RmpThe mutant strain of replacement.

Embodiment one:

(1) RmpThe amplification of the clone of gene and both sides flanking region thereof

1, RmpThe clone of gene

With the NEISSERIA GONORRHOEAE genomic dna is template,

With F:5 ' CG GGATCCATGACCAAACAGCTGAAATTAAG 3 ' ( Bam HI) (SEQ ID NO.1) and R:5 ' CCC GGATCCTTAGTGTTGGTGATGATTGCGT 3 ' ( BamH I) sequence of (SEQ ID NO.2) is that primer goes out in the NEISSERIA GONORRHOEAE genome through pcr amplification RmpGene (Fig. 1), amplified production is through order-checking, and sequence is shown in SEQ ID NO.3:

Among the SEQ ID NO.3,267-466 will be partly for will (being made by the replacement of Kanr resistant gene RmpThe insertion inactivation) part, two ends line capitalization partly does Bam HThe I recognition site.

2. RmpThe amplification of upstream and downstream both sides flanking region

With above-mentioned RmpGene amplification product is connected with T carrier pMD-19T, and is that template amplification comprises to connect product RmpA linear fragment of gene both sides flanking region, the agarose gel electrophoresis analysis 2 of this linear fragment, this linear fragment structural representation such as Fig. 3.

Amplification comprises RmpForward and reverse primer of gene both sides flanking region linear fragment is respectively:

F：5’TGC CTCGAGTAGTGGCAAACAACCTGGTC?3?’?( Xho?I)?（SEQ?ID?NO.4）

R:5 ' GTC ACGCGT TTATCTACTCAACATATTGAGGAGCCTGC 3 ' ( MluI) (SEQ ID NO.5), wherein TTATCTACTCABe terminator sequence.

The amplification obtain comprise the pMD-19 carrier with Rmp(front end does the sequence of the linear fragment of gene both sides flanking region shown in SEQ ID NO.6 XhoThe I recognition site; 258-2968bp partly is the pMD-19 skeleton; End does MluThe I recognition site; Wherein 7-257bp partly does RmpGene DownstreamFlanking region, 2969-3228bp partly do RmpGene The upper reachesFlanking region).

(2) be template amplification Kanr gene order with plasmid pET-28a (+)

Primer sequence is:

F：5’TCG ACGCGTGCTCAGTGGAACGAAAACTC 3?’?（? Mlu?I）（SEQ?ID?NO.7）

R：5’GCG CTCGAG CTTAGAAAAACTCATCGAGCAT 3?’?（ Xho?I）（SEQ?ID?NO.8）

With after pMD-19T is connected, make this carrier obtain kalamycin resistance through Kanr gene amplification product (Fig. 4) that pcr amplification obtains, show that the dna fragmentation of amplification has activity; Product is through order-checking, and (two ends are respectively sequence shown in SEQ ID NO.9 MluI with XhoThe I recognition site).

(3) RmpThe insertion sudden change of gene

With SEQ ID NO.6 ( RmpPterion, gene downstream side, pMD19 carrier framework and RmpThe linear DNA fragment of upstream region of gene flanking region) and the dna fragmentation of SEQ ID NO.9 (Kanr gene) use respectively MluI with XhoThe I double digestion, and reclaim purifying; The two connects with the T4 ligase enzyme, promptly contains in the annular DNA fragment of acquisition RmpThe gene middle portion is by the mutator gene Δ of activated Kanr gene replacement RmpWith the pMP-19 carrier framework, called after pMD19 Δ Rmp, Δ wherein RmpSequence is shown in SEQ ID NO.10.

Embodiment two:

To comprise the mutator gene Δ RmpRecombinant vectors pMD19 Δ RmpWith suicide vector pGMB151 (X. X Huang, L. V. Phung, S. Dejsirilert, et al., " Cloning and characterization of the gene encoding the z66 antigen of Salmonella entericaSerovar Typhi, " FEMS Microbiology Letters, 2006,234 (2): 239 – 246) use respectively Bam HThe I enzymic digestion, the latter two connect with the T4 ligase enzyme to reclaim purifying, and the connection product of acquisition transforms through electricity and imports host e. coli SPY372 λ pir, and the intestinal bacteria and the wild-type NEISSERIA GONORRHOEAE of carrying the reorganization suicide vector hatch altogether.The dead cracking of intestinal bacteria in the process that goes down to posterity, the reorganization suicide vector of release gets into NEISSERIA GONORRHOEAE, and with the NEISSERIA GONORRHOEAE wild-type RmpHomologous recombination takes place, and makes wild RmpSuddenlyd change RmpReplace, lose the suicide vector framework simultaneously.Show as mutant strain and have the kana resistance, but lost amp and the sm resistance on the carrier.Isolating NEISSERIA GONORRHOEAE bacterium colony after extraction is gone down to posterity extracts genomic dna and makes template, uses RmpPrimer carries out PCR, only filters out to amplify RmpBacterial strain, be Rmp-mutant strain, (Fig. 5); Show Rmp protein expression disappearance (Fig. 6) in this mutant strain with Western blotting evaluation.

SEQUENCE?LISTING

 

< 110>Yangzhou University

 

< 120>mutator gene Δ rmp and mutation method are checked in a kind of NEISSERIA GONORRHOEAE immunity

 

<130>

 

<160> 10

 

<170> PatentIn?version?3.3

 

<210> 1

<211> 31

<212> DNA

< 213>artificial sequence

 

<400> 1

cgggatccat?gaccaaacag?ctgaaattaa?g 31

 

 

<210> 2

<211> 31

<212> DNA

< 213>artificial sequence

 

<400> 2

cccggatcct?tagtgttggt?gatgattgcg?t 31

 

 

<210> 3

<211> 723

<212> DNA

< 213>NEISSERIA GONORRHOEAE

 

<400> 3

ggatccatga?ccaaacagct?gaaattaagc?gcattattcg?ttgcattgct?cgcttccggc 60

 

actgctgttg?cgggcgaggc?gtccgttcag?ggttacaccg?taagcggcca?gtcgaacgaa 120

 

atcgtacgca?acaactatgg?agaatgctgg?aaaaacgcct?actttgataa?agcaagccaa 180

 

ggtcgcgtag?aatgcggcga?tgcggttgcc?gtccccgagc?ccgaacccgc?gcctgtcgcc 240

 

gttgtggagc?aggctcctca?atatgttgat?gaaaccattt?ccctgtctgc?caaaaccctg 300

 

ttcggtttcg?ataaggattc?attgcgcgcc?gaagctcaag?acaacctgaa?agtattggcg 360

 

caacgcctga?gtcgaaccaa?tgtccaatct?gtccgcgtcg?aaggccatac?cgactttatg 420

 

ggttctgaaa?aatacaatca?ggctctgtcc?gaacgccgcg?catacgtagt?ggcaaacaac 480

 

ctggtcagca?acggcgtacc?tgcttctaga?atttctgctg?tcggcttggg?cgaatctcaa 540

 

gcgcaaatga?ctcaagtttg?tcaagccgaa?gttgccaaac?tgggtgcgaa?agcctctaaa 600

 

gccaaaaaac?gtgaggctct?gattgcatgt?atcgaacctg?accgccgcgt?agatgtgaaa 660

 

atccgcagca?tcgtaacccg?tcaggttgtg?ccggcacgca?atcatcacca?acactaagga 720

 

tcc 723

 

 

<210> 4

<211> 29

<212> DNA

< 213>artificial sequence

 

<400> 4

tgcctcgagt?agtggcaaac?aacctggtc 29

 

 

<210> 5

<211> 38

<212> DNA

< 213>artificial sequence

 

<400> 5

gtcacgcgtt?tatctactca?acatattgag?gagcctgc 38

 

 

<210> 6

<211> 3245

<212> DNA

< 213>artificial sequence

 

<400> 6

ctcgagtagt?ggcaaacaac?ctggtcagca?acggcgtacc?tgcttctaga?atttctgctg 60

 

tcggcttggg?cgaatctcaa?gcgcaaatga?ctcaagtttg?tcaagccgaa?gttgccaaac 120

 

tgggtgcgaa?agcctctaaa?gccaaaaaac?gtgaggctct?gattgcatgt?atcgaacctg 180

 

accgccgcgt?agatgtgaaa?atccgcagca?tcgtaacccg?tcaggttgtg?ccggcacgca 240

 

atcatcacca?acactaagga?tccgggaatc?tctagaggat?ccccgggtac?cgagctcgaa 300

 

ttcactggcc?gtcgttttac?aacgtcgtga?ctgggaaaac?cctggcgtta?cccaacttaa 360

 

tcgccttgca?gcacatcccc?ctttcgccag?ctggcgtaat?agcgaagagg?cccgcaccga 420

 

tcgcccttcc?caacagttgc?gcagcctgaa?tggcgaatgg?cgcctgatgc?ggtattttct 480

 

ccttacgcat?ctgtgcggta?tttcacaccg?catatggtgc?actctcagta?caatctgctc 540

 

tgatgccgca?tagttaagcc?agccccgaca?cccgccaaca?cccgctgacg?cgccctgacg 600

 

ggcttgtctg?ctcccggcat?ccgcttacag?acaagctgtg?accgtctccg?ggagctgcat 660

 

gtgtcagagg?ttttcaccgt?catcaccgaa?acgcgcgaga?cgaaagggcc?tcgtgatacg 720

 

cctattttta?taggttaatg?tcatgataat?aatggtttct?tagacgtcag?gtggcacttt 780

 

tcggggaaat?gtgcgcggaa?cccctatttg?tttatttttc?taaatacatt?caaatatgta 840

 

tccgctcatg?agacaataac?cctgataaat?gcttcaataa?tattgaaaaa?ggaagagtat 900

 

gagtattcaa?catttccgtg?tcgcccttat?tccctttttt?gcggcatttt?gccttcctgt 960

 

ttttgctcac?ccagaaacgc?tggtgaaagt?aaaagatgct?gaagatcagt?tgggtgcacg 1020

 

agtgggttac?atcgaactgg?atctcaacag?cggtaagatc?cttgagagtt?ttcgccccga 1080

 

agaacgtttt?ccaatgatga?gcacttttaa?agttctgcta?tgtggcgcgg?tattatcccg 1140

 

tattgacgcc?gggcaagagc?aactcggtcg?ccgcatacac?tattctcaga?atgacttggt 1200

 

tgagtactca?ccagtcacag?aaaagcatct?tacggatggc?atgacagtaa?gagaattatg 1260

 

cagtgctgcc?ataaccatga?gtgataacac?tgcggccaac?ttacttctga?caacgatcgg 1320

 

aggaccgaag?gagctaaccg?cttttttgca?caacatgggg?gatcatgtaa?ctcgccttga 1380

 

tcgttgggaa?ccggagctga?atgaagccat?accaaacgac?gagcgtgaca?ccacgatgcc 1440

 

tgtagcaatg?gcaacaacgt?tgcgcaaact?attaactggc?gaactactta?ctctagcttc 1500

 

ccggcaacaa?ttaatagact?ggatggaggc?ggataaagtt?gcaggaccac?ttctgcgctc 1560

 

ggcccttccg?gctggctggt?ttattgctga?taaatctgga?gccggtgagc?gtgggtctcg 1620

 

cggtatcatt?gcagcactgg?ggccagatgg?taagccctcc?cgtatcgtag?ttatctacac 1680

 

gacggggagt?caggcaacta?tggatgaacg?aaatagacag?atcgctgaga?taggtgcctc 1740

 

actgattaag?cattggtaac?tgtcagacca?agtttactca?tatatacttt?agattgattt 1800

 

aaaacttcat?ttttaattta?aaaggatcta?ggtgaagatc?ctttttgata?atctcatgac 1860

 

caaaatccct?taacgtgagt?tttcgttcca?ctgagcgtca?gaccccgtag?aaaagatcaa 1920

 

aggatcttct?tgagatcctt?tttttctgcg?cgtaatctgc?tgcttgcaaa?caaaaaaacc 1980

 

accgctacca?gcggtggttt?gtttgccgga?tcaagagcta?ccaactcttt?ttccgaaggt 2040

 

aactggcttc?agcagagcgc?agataccaaa?tactgttctt?ctagtgtagc?cgtagttagg 2100

 

ccaccacttc?aagaactctg?tagcaccgcc?tacatacctc?gctctgctaa?tcctgttacc 2160

 

agtggctgct?gccagtggcg?ataagtcgtg?tcttaccggg?ttggactcaa?gacgatagtt 2220

 

accggataag?gcgcagcggt?cgggctgaac?ggggggttcg?tgcacacagc?ccagcttgga 2280

 

gcgaacgacc?tacaccgaac?tgagatacct?acagcgtgag?ctatgagaaa?gcgccacgct 2340

 

tcccgaaggg?agaaaggcgg?acaggtatcc?ggtaagcggc?agggtcggaa?caggagagcg 2400

 

cacgagggag?cttccagggg?gaaacgcctg?gtatctttat?agtcctgtcg?ggtttcgcca 2460

 

cctctgactt?gagcgtcgat?ttttgtgatg?ctcgtcaggg?gggcggagcc?tatggaaaaa 2520

 

cgccagcaac?gcggcctttt?tacggttcct?ggccttttgc?tggccttttg?ctcacatgtt 2580

 

ctttcctgcg?ttatcccctg?attctgtgga?taaccgtatt?accgcctttg?agtgagctga 2640

 

taccgctcgc?cgcagccgaa?cgaccgagcg?cagcgagtca?gtgagcgagg?aagcggaaga 2700

 

gcgcccaata?cgcaaaccgc?ctctccccgc?gcgttggccg?attcattaat?gcagctggca 2760

 

cgacaggttt?cccgactgga?aagcgggcag?tgagcgcaac?gcaattaatg?tgagttagct 2820

 

cactcattag?gcaccccagg?ctttacactt?tatgcttccg?gctcgtatgt?tgtgtggaat 2880

 

tgtgagcgga?taacaatttc?acacaggaaa?cagctatgac?catgattacg?ccaagcttgc 2940

 

atgcctgcag?gtcgacgatt?cgggatccat?gaccaaacag?ctgaaattaa?gcgcattatt 3000

 

cgttgcattg?ctcgcttccg?gcactgctgt?tgcgggcgag?gcgtccgttc?agggttacac 3060

 

cgtaagcggc?cagtcgaacg?aaatcgtacg?caacaactat?ggagaatgct?ggaaaaacgc 3120

 

ctactttgat?aaagcaagcc?aaggtcgcgt?agaatgcggc?gatgcggttg?ccgtccccga 3180

 

gcccgaaccc?gcgcctgtcg?ccgttgtgga?gcaggctcct?caatatgttg?agtagataaa 3240

 

cgcgt 3245

 

 

<210> 7

<211> 29

<212> DNA

< 213>artificial sequence

 

<400> 7

tcgacgcgtg?ctcagtggaa?cgaaaactc 29

 

 

<210> 8

<211> 31

<212> DNA

< 213>artificial sequence

 

<400> 8

gcgctcgagc?ttagaaaaac?tcatcgagca?t 31

 

 

<210> 9

<211> 917

<212> DNA

< 213>artificial sequence

 

<400> 9

acgcgtgctc?agtggaacga?aaactcacgt?taagggattt?tggtcatgaa?caataaaact 60

 

gtctgcttac?ataaacagta?atacaagggg?tgttatgagc?catattcaac?gggaaacgtc 120

 

ttgctctagg?ccgcgattaa?attccaacat?ggatgctgat?ttatatgggt?ataaatgggc 180

 

tcgcgataat?gtcgggcaat?caggtgcgac?aatctatcga?ttgtatggga?agcccgatgc 240

 

gccagagttg?tttctgaaac?atggcaaagg?tagcgttgcc?aatgatgtta?cagatgagat 300

 

ggtcagacta?aactggctga?cggaatttat?gcctcttccg?accatcaagc?attttatccg 360

 

tactcctgat?gatgcatggt?tactcaccac?tgcgatcccc?gggaaaacag?cattccaggt 420

 

attagaagaa?tatcctgatt?caggtgaaaa?tattgttgat?gcgctggcag?tgttcctgcg 480

 

ccggttgcat?tcgattcctg?tttgtaattg?tccttttaac?agcgatcgcg?tatttcgtct 540

 

cgctcaggcg?caatcacgaa?tgaataacgg?tttggttgat?gcgagtgatt?ttgatgacga 600

 

gcgtaatggc?tggcctgttg?aacaagtctg?gaaagaaatg?cataaacttt?tgccattctc 660

 

accggattca?gtcgtcactc?atggtgattt?ctcacttgat?aaccttattt?ttgacgaggg 720

 

gaaattaata?ggttgtattg?atgttggacg?agtcggaatc?gcagaccgat?accaggatct 780

 

tgccatccta?tggaactgcc?tcggtgagtt?ttctccttca?ttacagaaac?ggctttttca 840

 

aaaatatggt?attgataatc?ctgatatgaa?taaattgcag?tttcatttga?tgctcgatga 900

 

gtttttctaa?gctcgag 917

 

 

<210> 10

<211> 1451

<212> DNA

< 213>artificial sequence

 

<400> 10

ggatccatga?ccaaacagct?gaaattaagc?gcattattcg?ttgcattgct?cgcttccggc 60

 

actgctgttg?cgggcgaggc?gtccgttcag?ggttacaccg?taagcggcca?gtcgaacgaa 120

 

atcgtacgca?acaactatgg?agaatgctgg?aaaaacgcct?actttgataa?agcaagccaa 180

 

ggtcgcgtag?aatgcggcga?tgcggttgcc?gtccccgagc?ccgaacccgc?gcctgtcgcc 240

 

gttgtggagc?aggctcctca?atatgttgag?tagataaacg?cgtgctcagt?ggaacgaaaa 300

 

ctcacgttaa?gggattttgg?tcatgaacaa?taaaactgtc?tgcttacata?aacagtaata 360

 

caaggggtgt?tatgagccat?attcaacggg?aaacgtcttg?ctctaggccg?cgattaaatt 420

 

ccaacatgga?tgctgattta?tatgggtata?aatgggctcg?cgataatgtc?gggcaatcag 480

 

gtgcgacaat?ctatcgattg?tatgggaagc?ccgatgcgcc?agagttgttt?ctgaaacatg 540

 

gcaaaggtag?cgttgccaat?gatgttacag?atgagatggt?cagactaaac?tggctgacgg 600

 

aatttatgcc?tcttccgacc?atcaagcatt?ttatccgtac?tcctgatgat?gcatggttac 660

 

tcaccactgc?gatccccggg?aaaacagcat?tccaggtatt?agaagaatat?cctgattcag 720

 

gtgaaaatat?tgttgatgcg?ctggcagtgt?tcctgcgccg?gttgcattcg?attcctgttt 780

 

gtaattgtcc?ttttaacagc?gatcgcgtat?ttcgtctcgc?tcaggcgcaa?tcacgaatga 840

 

ataacggttt?ggttgatgcg?agtgattttg?atgacgagcg?taatggctgg?cctgttgaac 900

 

aagtctggaa?agaaatgcat?aaacttttgc?cattctcacc?ggattcagtc?gtcactcatg 960

 

gtgatttctc?acttgataac?cttatttttg?acgaggggaa?attaataggt?tgtattgatg 1020

 

ttggacgagt?cggaatcgca?gaccgatacc?aggatcttgc?catcctatgg?aactgcctcg 1080

 

gtgagttttc?tccttcatta?cagaaacggc?tttttcaaaa?atatggtatt?gataatcctg 1140

 

atatgaataa?attgcagttt?catttgatgc?tcatgaggtt?tttctaagct?cgagtagtgg 1200

 

caaacaacct?ggtcagcaac?ggcgtacctg?cttctagaat?ttctgctgtc?ggcttgggcg 1260

 

aatctcaagc?gcaaatgact?caagtttgtc?aagccgaagt?tgccaaactg?ggtgcgaaag 1320

 

cctctaaagc?caaaaaacgt?gaggctctga?ttgcatgtat?cgaacctgac?cgccgcgtag 1380

 

atgtgaaaat?ccgcagcatc?gtaacccgtc?aggttgtgcc?ggcacgcaat?catcaccaac 1440

 

actaaggatc?c 1451

 

 

Claims (2)

1. A NEISSERIA GONORRHOEAE ( Neisseriagonorrhoeae) immunity checks the mutator gene Δ Rmp,Its nucleotide sequence is shown in SEQ ID NO.10.
2. 2. the mutator gene Δ is checked in a NEISSERIA GONORRHOEAE immunity RmpMutation method, it is characterized in that, be to be template with the NEISSERIA GONORRHOEAE genomic dna, pcr amplification RmpGene, and be connected among the T carrier pMD19, to connect product pMD19 RmpBe template, amplification comprises RmpPterion, gene downstream side, pMD19 carrier framework and RmpThe linear DNA fragment of upstream region of gene flanking region is with identical MluI with XhoThe kalamycin resistance gene Kanr that the I double digestion is handled connects, the mutator gene Δ that obtains RmpConcrete steps are following:

   (1) RmpThe clone of gene: with the NEISSERIA GONORRHOEAE genomic dna is template, is that primer goes out the NEISSERIA GONORRHOEAE of sequence shown in SEQ ID NO.3 through pcr amplification with the sequence of SEQ ID NO.1 and SEQ ID NO.2 RmpGene;

   (2) RmpThe amplification of upstream and downstream both sides flanking region: with what increase in above-mentioned (1) RmpGene and pMD19-T carrier be connected product pMD19 RmpBe template, amplification comprises RmpThe linear fragment of gene both sides flanking region; Amplification comprises RmpForward and reverse primer sequence of gene both sides flanking region linear fragment is respectively shown in SEQ ID NO.4 and SEQ ID NO.5, and amplification obtains sequence comprising shown in SEQ ID NO.6 RmpThe linear fragment of gene both sides flanking region;

   (3) be template with plasmid pET-28a (+), amplification Kanr gene order

   Wherein primer sequence is shown in SEQ ID NO.7 and the SEQ ID NO.8, and the Kanr gene order that obtains through pcr amplification is shown in SEQ ID NO.9;

   (4) RmpThe insertion sudden change of gene

   Carry what step (2) obtained RmpGene both sides flanking region linear fragment is used MluI with XhoThe I double digestion is handled; The Kanr gene amplification product that step (3) obtains is with same double digestion digestion; The two connects with the T4 ligase enzyme after reclaiming purifying respectively; Connect product pMD19 Δ RmpBe the NEISSERIA GONORRHOEAE immunity outside the middle carrier framework and check the mutator gene Δ Rmp, its sequence is shown in SEQ ID NO.10.

Images