CN101130776A - Pig carcass character GFAT1 gene clone and its application - Google Patents

Abstract

The invention discloses a pig carcass deseription GFAT1 gene clone and polymorphism detection to mark auxiliary breeding in the animal genetic engineering technical domain, which is characterized by the following: the cDNA sequence of the pig carcass deseription GFAT1 gene is displayed as SEQ ID NO: 1 and the DNA sequence is depicted as SEQ ID NO: 2; the G101-A101 base at 101st position in the SEQ ID NO: 2 are mutated, which leads MvaI-RFLP polymorphism. The invention also provides a primer of 8th introne of the cloned GFAT1 gene and augumented GFAT1 to detect the polymorphism, which is a new genetic mark and method of polymorphism of the pig carcass deseription GFAT1 gene.

Description

The clone of pig carcass character GFAT 1 gene and application

Technical field

The invention belongs to animal gene engineering technology field, the clone and the polymorphism that relate in particular to a kind of pig carcass character GFAT 1 gene of the genetic marker that is used for the pig marker-assisted breeding detect.

Background technology

Along with people to the continuous growth of animal proteinum food demand and the development of commodity economy, carcass quality evaluation has become the problem that heredity, breeding scholar, the producer, meat manager, human consumer generally are concerned about.Along with the development of the commodity market of domestic and international live hog and pork product and the raising of scientific and technological level, it is popular that the stdn of carcass quality evaluation, normalization etc. have been become research, the carcass quality deliberated index of generally acknowledging in the world specifically has at present: carcass lean meat percentage (lean percentage in the carcass, CLP), cutability (lean content in the carcass, CLC) maybe can sell lean meat block ratio (lean cuts ratio, LCR).In real work, people attempt to seek the method that a kind of easy live body is evaluated carcass quality, butcher the financial loss of bringing with minimizing, and therefore big quantity research is devoted to seek the optimum prediction index that trunk is formed.Trunk is a comprehensive proterties, and it comprises a series of evaluation index.In the breeding of pig, the leading indicator of tolerance carcass trait comprises following content: trunk long (trunk directly length, trunk is tiltedly long), the thickness of backfat, gluteus medius muscle midpoint fat thickness (stern fat thickness), eye muscle area, leaf fat ratio, fat ratio, back leg ratio, bone rate, skin rate, lean ratio etc.The genetic behavior of carcass trait is not isolated, often exists relevant in phenotype and the heredity between the carcass trait yet.

In recent years, molecular genetics and molecular biotechnology have had the development of advancing by leaps and bounds, and utilize genome scanning and candidate gene strategy in different resource familys, have differentiated that some influence the major gene and the candidate gene of pig growth and carcass trait.For example: (Geldermann H etc. such as (1) Geldermann, Mapping of quantitative traits loci by means of marker genes in F2 generationsof wild boar, Pietrian and Meishan pigs.J Anim Breed Genet, 1996,113:381-387), (KnorrC etc., Association of GH gene variants with performance traits in F such as Knorr ₂Generations of Europesan wildboar, Pietrain and Meishan pigs.Ainm Genet, 1997,28:124-128) discover that (Growth hormore, GH) gene haplotype is formed proterties with several trunks has remarkable related tethelin different on No. 12 karyomit(e)s of pig.(2) (the Major histocompatibility complex of main histocompatibility complex that reports on No. 7 karyomit(e)s of pig is arranged, MHC) relevant (the Peng Zhong town etc. of gene haplotype with proterties such as birth weight, weaning weight, the speed of growth, the thickness of backfats, quantitative character gene and the mark research evolution thereof of pig, external livestock technology, 1999,26 (10): 28-32).(3) (Yu T P etc. such as Yu, Association of PIT1 polymorphisms with growth and carcasstraits in pigs.J Anim Sci, 1995,73:1282-1288) contain at one and detect the hypophysis transcription factor in China and the resource family of U.S.'s pig variety " blood " (PIT1) there is significant correlation in Pituitan transcription factor 1 with the average thickness of backfat.(4) (Joen J T etc. such as Jeon, A paternally expressed QTL affecting skeletal and muscle mass in pigs maps tothe IGF2locus.Nature Genetics, 1992,21:157-158) and (Nezer C etc. such as Nezer, An imprinted QTL withmajor effect on muscle mass and fat deposition maps to the IGF2locus in pigs.Nature Genetics, 1992,21:155-156) use two family insulin-like growth factors 2 (Insulin like growth factor II respectively, IGF-II) be positioned on No. 2 karyomit(e)s of pig, and detect this gene and the thickness of backfat has significant correlation.(5) (tePas M F etc. such as tePas, Messengerribonucleic acid expression of the MyoD gene family in mucle tissue at slaughter in relationto selection for porcine growth rate.J Anim Sci, 2000,78:69-77) important member's myogenin (Myogenin) gene of having analyzed the MyoD gene family in the hybridization colony of Large White and growth, carcass trait may exist relevantly, and the myogenin gene is positioned on No. 9 karyomit(e)s of pig.(6) melanocyte cortical hormone receptor 4 (Melanocortin-4receptor, MC4R) be positioned at (Kim K S etc. on No. 1 karyomit(e) of pig, Linkage and physical mapping of the porcine melanocortin-4receptor (MC4R) gene.JAnim Sci, 2000a, 78:791-792), (Kim K S etc. such as Kim, A missense variant of the porcinemelanocortin-4 receptor (MC4R) gene is association with fatness, growth, and feed intake traits.Mamm Genome, 2000b 11:131-135) detects variation of MC4R gene genetic and thickness of backfat significant correlation in 5 pig commodity systems.(7) candidate gene of studying relevant with carcass trait with the pig growth also has: with growth, the relevant leptin gene (Leptin of carcass trait possibility, LEP) be ob gene and the myogenic factor 3 (myf3) (Kim K S etc., A missense variant of the porcine melanocortin-4receptor (MC4R) gene is association with fatness, growth, and feed intake traits.Mamm Genome, 2000b, 11:131-135).Myostatin (the Myostatin that the growth of skeletal muscle is had the negative regulation effect, MSTN) gene, this gene claims GDF-8 (Growth differentiation factor 8 again, growth and differentiation factor 8) (Mcpherron A C etc., Double musclingin cattle due to mutation in the myostatin gene.Proc Natl Acad Sci, 1997,94 (23): 12457-12461), with the thickness of backfat (the Cathepsin B of cathepsin B of significant correlation is arranged, CTSB) gene (Russo V etc., Investigation ofcandidate genes for meat quality in dry-cured ham production:the porcine cathepsin B (CTSB) and cystatin B (CSTB) genes.Anim Genet, 2002,33:123-131), pig CACNB1 gene can be used as and influences pig flesh characters, candidate gene (the Li Jianhua etc. of reproductive trait and growth traits, the pig CACNB1 assignment of genes gene mapping reaches the potential impact assessment to the production traits. Chinese herding magazine, 2007,43 (7): 6-8) etc.

GFAT1 (glutamine:fructose-6-phosphate amidotransferase) glutaminate: fructose-6-phosphate transaminase, GFAT1 is the rate-limiting enzyme of hexosamine synthesis path (HBP), it also is first enzyme in this path, control hexosamine synthesis path is played an important role in glucose toxicity and Regular Insulin resistance.The proteic quantity regulation and control of GFAT1 glucose is by the flow of HBP, increase the GFAT1 protein level, directly activate the hexosamine synthesis path, transmission ofenergy and Regular Insulin that this path relates to energy metabolism resist (Clara et al., TheCellular Fate of Glucose and Its Relevance in Type 2 Diabetes.Endocrine Reviews, 2004,25 (5): 807-830).

In eukaryotic cell, the GFAT1 activity is subject to the UDP-GlcNAc feedback inhibition and regulates, and also can be suppressed by glutamine analogue (azaserine etc.).Bacterium, mould and the human cDNA that expresses GFAT1 are cloned at present, and studied structure and the function of GFAT1.Found that, the GFAT1 activity is dynamic change in the mould, in the mould-growth phase, need UDP-GlcNAc during cell walls is synthetic, the GFAT1 activity is not suppressed, and the spore phase, the GFAT1 activity then is subjected to press down, and with phosphorylation (Zhou et al. a kind of and the active proteins associated matter of GFAT1, Human glutamine:fructose-6-phosphate amidotransferase:characterization of mRNA and chromosomal assignment to2p13.Hum Genet, 1995,96:99-101).In vitro study finds that cAMP deopendent protein kinase (PKA) can bring out similar feedback inhibition process.Discover that further human GFAT1 activity is mediated by cAMP dependency path also.Human GFAT1 hinge region has two same PKA phosphorylation position: NH2 ends, COOH end to be respectively the action site of amino hydroxylase and aldose reductase, in case phosphorylation, then the GFAT1 activity is subjected to suppress (Hou Weikai, hexosamine and insulin resistance. foreign medical science. the incretology fascicle, 1997,4:21-23).

(McKnight etc. such as McKnight, Molecular cloning, cDNA sequence, and bacterial expression of humanglutamine:fructose-6-phosphate amidotransferase.J Biol Chem, 1992,267:25208-25212) cloned people GFAT1 gene, the mRNA total length of this gene is 3090bp, having encoded one contains 681 amino acid whose protein, and protein molecular weight is 77kDa.At present, the cDNA total length of people, mouse and rat GFAT1 gene is cloned and is checked order.(DeHaven et al. such as DeHaven, Anovel variant of glutamine:fructose-6-phosphate amidotransferase-1 (GFAT1) mRNA is selectivelyexpressed in striated muscle.Diabetes, 2001,50 (11): 2419-2424) studies show that, the GFAT1 gene of mouse in skeletal muscle and cardiac muscle and people's skeletal muscle two different transcripts are arranged, two transcripts differ 54bp, only have a transcript at its hetero-organization.People's GFAT1 is located in 2pl3, and the genome total length is 61,919bp; The GFAT1 assignment of genes gene mapping of mouse is in No. 6 karyomit(e)s, and the cDNA total length is 2408bp, 681 amino acid of encoding; The GFAT1 assignment of genes gene mapping of rat is in 4q34, and the cDNA total length is 2285bp, 681 amino acid of encoding.At present, someone studies, in the pig of conjugated linolic acid daily ration of feeding, the GFAT1 expression of gene significantly increases (Meadus et al., Prolongeddietary treatment with conjugated linoleic acid stimulates porcine muscle peroxisomeproliferator activated receptor gamma and glutamine-fructose aminotransferase gene expressionin vivo.J Mol Endocrinol, 2002,28 (2): 79-8).

Although the research of hog on hook proterties candidate gene has obtained some impressive progresses, but still exist not enough: the new gene dosage that (1) is identified out at present is limited, and the gene that can be applied to actual production seldom.(2) important economical trait of pig quantitative character normally, the physiological and biochemical procedure that relates to are quite complicated, even same quantitative character is stated its 1-2 controlled gene although taken off, still have other new gene with big effect to remain to be discovered.(3) research of at present relevant quantitative character gene is to select for use single candidate gene to analyze basically, has ignored intergenic interaction.One of content of modern molecular breeding is the genome breeding, promptly according to the gene of individual ownership proterties and genotypic weave construction and functional effect carries out integral body or full genome is selected, apolegamy, protect kind and Heterosis Analysis utilization etc., its basis is that complete highdensity gene map is arranged, and fully understand the weave construction, functional expression Regulation Mechanism of all genes and related with proterties, yet the gene and the mark of hereditary location and physical positioning are still very limited in pig at present, and the work of this respect also needs further reinforcement.(3) it is comprehensive inadequately to seek the method with important physiological function gene, and efficient is not high, needs innovation, is necessary further searching, the new gene that excavation is relevant with the pig important economical trait.

Summary of the invention

The objective of the invention is to clone pig GFAT1 gene, seek the mutational site of this GFAT1 gene and the detection method of gene pleiomorphism, by the application of proterties association analysis, for the marker-assisted breeding of pig provides a kind of useful molecule marker.

The present invention realizes by following technology:

Applicant clone obtains a kind of pig carcass character GFAT 1 gene, and its cDNA sequence is as described in the sequence table SEQ ID NO:1.Its dna sequence dna is as described in the sequence table SEQ ID NO:2.There is the base mutation of a G101-A101 at the 101bp place of sequence table SEQ ID NO:2, causes the MvaI-RFLP polymorphism.

The applicant has designed the primer of four pairs of clone's pig carcass character GFAT 1 genes, and described sequence is shown in SEQ ID NO:1.

Meanwhile the applicant has cloned the used primer of amplification GFAT1 gene the 8th intron, and the sequence of this primer is shown in SEQ ID NO:2.

A kind of screening hog on hook character gene GFAT1 molecule marking method prepares according to following steps:

The first step

Personnel selection GFAT1 gene cDNA is the information probe, does the homologous sequence screening, obtains the expressed sequence tag of homology more than 85%; Splice pig expressed sequence tag-contig then; According to expressed sequence tag-four pairs of primers of contig design, amplification obtains the purpose fragment; The black total RNA of pig muscle tissue extraction is a template with the west place in Hubei of growing up, and does the RT-PCR amplification, and PCR product purification and cloning and sequencing carry out sequential analysis, obtains as the described cDNA sequence of sequence table SEQ ID NO:1;

Second step

Extract DNA from the pig blood genome, with pig GFAT1 gene cDNA sequence is template design primer, carries out pcr amplification, PCR product purification and cloning and sequencing, acquisition is used the polymorphism that the PCR-RFLP method detects pig GFAT1 gene as dna sequence dna as described in the sequence table SEQ ID NO:2.

More detailed technical scheme sees also " description of drawings " and the embodiment in " embodiment " of specification sheets.

Effect of the present invention is:

1. the clone result of pig GFAT1 gene

Extracting total RNA reverse transcription synthetic cDNA with the kind of growing up for the muscle tissue of " west place in Hubei is deceived pig " is template, uses four couples of listed primer GF-A of table 3 respectively ₁And GF-B ₁, GF-A ₂And GF-B ₂, GF-A ₃And GF-B ₃, and GF-A ₄And GF-B ₄Carry out pcr amplification, amplified production is special PCR product (as described in Figure 4) through the demonstration of 2% agarose gel electrophoresis detected result.The PCR product is reclaimed the order-checking of purifying rear clone, and sequencing result shows A ₁B ₁Fragment length is 547bp, A ₂B ₂Fragment length is 398bp, A ₃B ₃And A ₄B ₄Clip size is respectively 716bp and 1038bp.

With four Segment A ₁B ₁, A ₂B ₂, A ₃B ₃And A ₄B ₄Splice the cDNA integration sequence (shown in Figure 2) that to obtain a length be 2345bp with the ASSEMBLY program in GeneTool 1.0 softwares.This section cDNA sequence is carried out homology search in GenBank, (the GenBank number of including: homology NM_002056) reaches 96% for this sequence of result for retrieval and people GFAT1 gene cDNA, sequential analysis shows that this cDNA sequence has the open reading frame of 2100bp (nt 41-2140), the protein of being made up of 681 amino acid of encoding.

2. the positioning result of pig GFAT1 gene

Somatotype result in SCHP shows with the GFAT1-P primer, in 19 pig * Chinese hamster somatic cell hybrid clones (1-19 number), 1,6-10,16, No. 19 occur and the increase purpose fragment of consistent 490bp of pig genomic dna positive control, and in 8 pigs * mouse somatic cell hybrid clone (20-27 number), the amplification of No. 23 hybrid cell systems obtains the purpose fragment of 490bp.The PCR somatotype data of above-mentioned actual observation are submitted to HybWeb (http://www.toulouse.inra.fr/lgc/lgc.html/) carry out statistical study to obtain zone location information, the data analysis result is that the GFAT1 assignment of genes gene mapping is on No. 3 karyomit(e)s of pig (P=1.000), further the zone location result is SSC3q21-q27 (P=0.8091, and the relation conefficient between this zone marker is 1.000, P＜0.1%).

00001000 with the GFAT1-P primer in IMpRH somatotype result? 0 1,110,010,110 0,000,000,000 0,000,000,101 00? 0,100,001,010,000,000 0,000,000,011 0,011,101,001 0,000,000,010 0001010? 0? 1,110,011,101 00010011 (wherein 0 and 1 to explain amplification respectively negative and positive,? represent uncertain result).Statistic analysis result, the SW828 close linkage on No. 3 karyomit(e)s of GFAT1 gene and pig, the LOD value is 12.39, the RH map distance is 0.29Ray.Confirm that further this gene is positioned on No. 3 karyomit(e)s of pig.

3.PCR-RFLP diagnostic method is set up

Obtain 310bp specific amplified fragment with GFAT1-PL1 and GFAT1-PR1 amplification pig genomic dna, comprise part exon 8,9, and the sequence of intron 8 (seeing Fig. 3 for details).Found that in this 310bp fragment of order-checking found a G-A conversion for the 101st, is arranged in intron 8, causes a MvaI restriction enzyme site (CC ^WGG), wherein the 98bp place is the polymorphism point of contact, GFAT1 gene acquisition length with GFAT1-PL1 and GFAT1-PR1 amplification pig is the PCR product of 310bp, enzyme is cut and is produced three kinds of genotype, the frequency of genotypes AA type has the 310bp-band, and the GG type has 212bp and 98bp two bands, and heterozygote GA type has 310bp, three bands of 212bp and 98bp, as described in Figure 5.

4. mark property association analysis

(1) pig GFAT1 gene the 8th intron MvaI-RFLP pleomorphism site and part trunk, meat proterties are carried out association analysis, genotype detection result shows that the AA genotype has 80 in 124 individualities, the AG genotype has 38, the GG genotype has 6 (because indivedual data disappearances of measuring proterties, therefore the actual value that obtains is as shown in table 1), resultant relevant proterties is that trunk is directly long, gluteus medius muscle midpoint fat thickness (stern fat thickness).

As seen from table, G allelotrope is that trunk is directly long, the favourable mark of gluteus medius muscle midpoint fat thickness (trunk length, stern fat approach), the selective marker that GG genotype mark can be used for improving body length simultaneously and reduces gluteus medius muscle midpoint fat thickness.

The association analysis of the different GFAT1 gene M of table 1 vaI-RFLP genotype and part producing proterties

Genotype	Number of individuals	Trunk is directly grown (cm)	Gluteus medius muscle midpoint fat thickness (mm)
				AA	51	92.298±0.450 ab	2.178±0.087 ab
AG	38	93.311±0.507 a	2.289±0.098 a
				GG	6	90.372±1.284 b	1.691±0.248 b

Annotate: same column contains same letter represents that difference is not remarkable, and different lowercases, expression significant difference (P＜0.05), different capitalizations are represented difference very significantly (P＜0.01)

(2) pig GFAT1 gene the 8th intron MvaI-RFLP pleomorphism site and part producing proterties are carried out association analysis, genotype detection result shows that the AA genotype has 161 in 298 individualities, the AG genotype has 114, the GG genotype has 23 (because indivedual data disappearances of measuring proterties, therefore the actual value that obtains is as shown in table 2), resultant relevant proterties is lean ratio, the correction thickness of backfat.

As seen from table, G allelotrope is lean ratio, the advantage allelotrope of proofreading and correct the thickness of backfat (lean ratio height, correction back fat thickness), and GG genotype mark can be used for improving simultaneously lean ratio and reduces the selective marker of proofreading and correct the thickness of backfat.

The association analysis of the different GFAT1 gene M of table 2 VaI-RFLP genotype and part producing proterties

Genotype	Number of individuals	Lean ratio (%)	Proofread and correct the thickness of backfat (mm)
				AA	161	63.2023664±0.1756344 a	14.3928255±0.1779203 a
GA	114	63.6662577±0.2195804 ab	13.9189154±0.2224382 ab
				GG	23	64.1059016±0.4253155 b	13.3915863±0.4308509 b

Annotate: same column contains same letter represents that difference is not remarkable, and different lowercases, expression significant difference (P＜0.05), different capitalizations are represented difference very significantly (P＜0.01).

Description of drawings

Sequence table SEQ ID NO:1 is the cDNA sequence of the present invention's pig GFAT1 gene of cloning;

Sequence table SEQ ID NO:2 is the dna sequence dna of the present invention's pig GFAT1 gene of cloning;

Fig. 1: be the schema of the present invention about the preparation of GFAT1 gene;

Fig. 2: be pig GFAT1 gene cDNA sequence among the present invention, initiator codon and terminator codon are explained with the tilted letter that indicates underscore, primer GF-A ₁And GF-B ₁, GF-A ₂And GF-B ₂, GF-A ₃And GF-B ₃, and GF-A ₄And GF-B ₄Sequence show with shade and state.

Fig. 3: be pig GFAT1 gene DNA sequence among the present invention, mark the exon of supposition among the figure with underscore, all the other sequences are the intron zone, two conservative Nucleotide (GT/AG) of 5 ' and 3 ' splicing site mark with frame, the mutational site marks with overstriking and italic, and primer sequence shows with shade to be stated.

Fig. 4: be four segmental RT-PCR amplifications of pig GFAT1 gene coding region among the present invention, agarose gel concentration is 2%.M swimming lane: dna molecular amount mark (100-1000bp ladder); 1 swimming lane: A ₁B ₁Fragment, fragment length 547bp; 2 swimming lanes: A ₂B ₂Fragment, fragment length 398bp; 3 swimming lanes: A ₃B ₃Fragment, fragment length 716bp; 4 swimming lanes: A ₄B ₄Fragment, fragment length 1038bp.

Fig. 5: three kinds of genotype (the AA GA GG) electrophoresis result that is the MvaI-RFLP of pig GFAT1 gene the 8th intron among the present invention.M:DNA molecular weight standard (100bp ladder)

Embodiment

Embodiment 1

1.GFAT1 the clone of gene:

(1) design of primers:

(the GenBank number of including: NM_002056) be the information probe of personnel selection GFAT1 gene cDNA, utilize the BLAST instrument among the NCBI in GenBank pig est database, to do the homologous sequence screening, obtain a series of homologys and be the ESTs (fragment length is greater than 100bp) more than 85%, the number of including of these ESTs is inquired about corresponding sequence with ENTREZ (http://www.ncbi.nlm.nih.gov/Web/Search/index.html) in NCBI, use the ASSEMBLY program construction pig EST-contig among the GeneTool then.According to four couples of primer GF-A of EST splicing sequences Design ₁And GF-B ₁, GF-A ₂And GF-B ₂, GF-A ₃And GF-B ₃, and GF-A ₄And GF-B ₄Amplification obtains four bar segment A ₁B ₁A ₂B ₂A ₃B ₃And A ₄B ₄(as shown in table 3).The PCR product is reclaimed the order-checking of purifying rear clone, and sequence assembly obtains the complete coding region sequence and the part non-translational region sequence of pig GFAT1 gene.

Table 3 is used for the primer sequence of GFAT1 gene cDNA clone

The primer label	Primer sequence (5 '-3 ')	Annealing temperature	Expection PCR product length (bp)	The sequence of design of primers institute foundation
					GF-A 1 GF-B 1	GCCACTCGCTGTTTCCTGT GCTGGTATCTTGACTTTCCCG	62℃	About 547	The EST contig

GF-A 2 GF-B 2	CGCATAATGGAATCATCACC GCTTCCTTTCTTATCCTTGC	58℃	About 398	The EST contig
					GF-A 3 GF-B 3	GCGAGGATAAGAAAGGAAGC GCCCAGCATTGATGTGAACT	62℃	About 716	The EST contig
GF-A 4 GF-B 4	TACTGTAAGGAGAGAGGAGC TCAGATTCAAGTAGAGGACC	60℃	About 1038	The EST contig

(2) reverse transcription PCR amplified reaction:

Utilize TRIzoL test kit (available from U.S. GIBCO company) to extract total RNA from " west place in Hubei is deceived pig " (a kind of local pig breed with place of china pig blood relationship) muscle tissue of growing up, the method for concrete operation method reference reagent box specification sheets is carried out.

CDNA first chain synthetic: the reaction cumulative volume is 50 μ l, at first with total RNA of 2 μ g and oligod (T) ₁₁Be mixed in the Ependorff pipe, 70 ℃ of incubation 5min are to remove the secondary structure of RNA, place cooled on ice to avoid regenerating of secondary structure immediately, add all the other components according to the application of sample condition of table 4 through of short duration after centrifugal, behind 37 ℃ of incubation 1h, temperature is risen to 95 ℃ of deactivation ThermoScript II, place-20 ℃ of preservations standby.

The PCR reaction: the reaction cumulative volume is 20 μ l, and the application of sample volume and the final concentration of each component are as described in Table 5.The pcr amplification program is 94 ℃ of 3min, 94 ℃ of 30s, and annealing 45s, 72 ℃ of 1min circulate 35 times, and last 72 ℃ are extended 5min, and annealing temperature sees Table 3.The PCR reaction product detects with 2% agarose gel electrophoresis.

Table 4 reverse transcription reaction system

Component	Volume	Final concentration
			Total RNA oligo d (T) 11 DEPC?H 2O 5 * PCR buffer DNTP RNAsin M-MLV cumulative volume	10μl 5μl 20μl 10μl 2.5μl 1μl 1.5μl 50μl	2μg 1μmol/L - 5× 500μmol/L 40U 300U

Table 5 PCR reaction system

Component	Volume	Final concentration
			dd?H 2O 10×PCR?buffer MgCl 2Upstream primer downstream primer DNTP TaqDNA polysaccharase CDNA cumulative volume	15.3μl 2μ1 1.2μl 0.4μl 0.4μl 0.3μl 0.4μl 1μ?l 20μl	- 10× 1.5mmol/L 0.2μmol/L 0.2μmol/L 150μmol/L 2U ＞100ng

(3) purifying of PCR product, clone and order-checking

Under ultraviolet lamp, contain the segmental gel of purpose from the cutting-out of low melting-point agarose gel, put into 1.5ml Ependorff pipe, being incubated to gel in 70 ℃ melts fully, use PCR product purification test kit (available from Promega company) purified pcr product then, according to the operation of test kit specification sheets, concrete steps are to add 1ml Resin, mixing 20s in the gel that per 300 μ l melt, with the Resin/DNA mixture syringe of packing into, slurries are extruded by Minicolumn.In syringe, add 80% Virahol 2ml again, touching piston makes Virahol extrude by Minicolumn, take off Minicolumn and pack in the 1.5ml Ependorff pipe, 10, the centrifugal 2min of 000g is with dry Resin, Minicolumn is packed in another clean 1.5ml Ependorff pipe, add 30-50 μ l aqua sterilisa, leave standstill 1min, 10, the centrifugal 20s of 000g is stored in the Ependorff pipe with eluted dna.

With being connected of purified pcr product and pGEM-T carrier (available from Promega company), the ligation cumulative volume is 5 μ l, comprising 2.5 μ l, 2 * buffer, the T carrier of 0.5 μ l, the purified pcr product of 0.5 μ l, the T of 0.5 μ l ₄Ligase enzyme adds 1 μ l aqua sterilisa at last and puts 4 ℃ of water-baths and spend the night.

The preparation of competent cell be from 37 ℃ of fresh flat boards of having cultivated 16～20h the single colony inoculation of DH5 α of picking in 2ml LB, in 37 ℃ of shaking culture 3h, switching 1ml bacterium liquid is in the saline bottle that contains 30ml LB, continuation is at 37 ℃ of about 4h of shaking culture, treat that OD600 reaches at 0.3～0.4 o'clock saline bottle is put ice bath cooling 10～15min from the shaking table taking-up, then bacterium liquid is changed in the centrifuge tube in 4 ℃ 4, the centrifugal 10min of 000g is with collecting cell, centrifuge tube is inverted to abandon clean nutrient solution, is iced the CaCl of the 0.1mol/L of precooling with 10ml ₂Resuspended precipitation, ice bath 30min repeats 4 ℃ 4, and the centrifugal 10min of 000g once ices the CaCl of the 0.1mol/L of precooling with 4ml ₂Resuspended precipitation, it is standby to put 4 ℃ of preservations.

Get 100～120 μ l competent cells under the sterile state in 1.5ml Ependorff pipe, the connection product of 5 μ l is added mixing, place 30min on ice, 42 ℃ of heat shock 90s, do not shake the Ependorff pipe therebetween, take out back ice bath 3～4min, add the LB liquid nutrient medium of 400 μ l antibiotic-frees, 37 ℃ of shaking culture 45min.Get 100 μ l and coat in advance that 4h has been coated with IPTG (Isopropylthio-β-D-galactoside, isopropylthio-β-D one galactoside) and on the agar plate of 5-bromo-4-chloro-3-indoles-β-D-galactoside (X-gal), 37 ℃ keep flat to be inverted behind the 1h and cultivate.

The sequencing strategy is that each fragment all adopts PCR product directly order-checking and two kinds of methods of cloning and sequencing simultaneously.Cloning and sequencing is that single clone's of picking is used for order-checking, and sequencing is finished by Shanghai Bo Ya biotech company, and each gene fragment is surveyed two clone's at least.

(4) the dna sequence dna homology search is identified:

By the American National biotechnology (NCBI of information center, National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov) BLAST of website (Basic Local Alignment Search Tool) software, the known physiological function gene of announcing in the dna sequence dna that order-checking back is obtained and the GenBank database carries out sequence homology relatively, with evaluation with obtain the function information of this dna sequence dna.

2. physical positioning:

(1) primer sequence that is used for physical positioning is

GFAT1-P：PL 5′-TGACTTAGAGACCTGGCACAC-3′

PR 5′-CTGACGGGCATCAACTTATC-3′

This primer amplification fragment length is 490bp.

(2) be used for the experiment material of physical positioning

With pig * rodents somatic cell hybrid plate (Pig * rodent somatic cell hybrid panel, SCHP) carry out the chromosomal region location, with common pig radiation hybrid panel (the INRA-Minnesota porcine radiation hybrid panel that makes up of U.S. Minnesota university, IMpRH) carrying out karyomit(e) accurately locatees, two cover somatic cell hybrid plates are by French Martin doctor Yerle (Laboratoire de G é n é tiqueCellulaire, INRA, Castanet-Tolosan France) is so kind as to give.

Wherein SCHP comprises 27 individual cells hybrid cells systems, and 1-19 number is pig * hamster somatic cell hybrid clone, and 20-27 number is pig * mouse somatic cell hybrid clone, and with hamster, mouse and pig genomic dna as positive control.Identify that through cytogenetics this hybrid plate has kept whole 18 euchromosomes and the X chromosome except that Y chromosome of pig, wherein contain 127 non-overlapped chromosomal regions, pig karyomit(e) that is comprised in each clone and chromosome segment information can obtain from (http://www.toulouse.inra.fr/lgc/lgc.html/).

The radiation dose that IMpRH uses is 7,000-rad.IMpRH comprises 118 pigs * hamster radiation hybrid cell line, and hamster and pig genomic dna positive control, qualification result with 757 marks shows that the average mark rate of retaining among the IMpRH is 29.3%, include 128 linkage groups, 18 pairs of euchromosomes and X chromosome have been covered, be used to estimate that the kb/cR ratio of distance between mark is～70kb/cR (1Ray=100cR) that theoretical resolution is 145kb.

(3) PCR somatotype condition

Carrying out amplification PCR reaction cumulative volume is 15 μ l, and wherein template DNA is 20ng, contains 1 * buffer (available from Promega company), 1.5mmol/L MgCl ₂, the dNTP final concentration is 150 μ mol/L, the primer final concentration is 0.4 μ mol/L, 2U Taq archaeal dna polymerase (Promega).The pcr amplification program is: 94 ℃ of 4min, and the 94 ℃ of 30s that circulate 35 times, 62 ℃ of 30s, 72 ℃ of 25s then, last 72 ℃ are extended 5min.The PCR reaction product detects with 2% agarose gel electrophoresis.

3.PCR-RFLP diagnostic method is set up

(1) primer sequence

GFAT1：PL 5′-AGCCCTCTGTTGATTGGTGT-3′

PR 5′-CCCACCGTGTGAATTTTGAT-3′

This primer amplification fragment length 310bp.

(2) pcr amplification condition

PCR reaction cumulative volume 20 μ l, wherein the about 100ng of pig genomic dna contains 1 * buffer (available from Promega company), 1.5mmol/LMgCl ₂, the dNTP final concentration is 150 μ mol/L, the primer final concentration is 0.2 μ mol/L, 2U Taq archaeal dna polymerase (Promega).The pcr amplification program is: 94 ℃ of 4min, and the 94 ℃ of 30s that circulate 34 times, 58 ℃ of 30s, 72 ℃ of 25s, last 72 ℃ are extended 5min.The PCR reaction product detects with 2% agarose gel electrophoresis and takes pictures.

(3) RFLP testing conditions

PCR product endonuclease reaction volume is 10 μ l, 1 * buffer, 1 μ l wherein, PCR product 3 ~ 5 μ l, restriction enzyme MvaI is 0.5 μ l (5U), supplies 10 μ l with distilled water, with centrifugal behind the sample mixing, 37 ℃ of water-bath 4h, detect enzyme with 2% agarose gel electrophoresis and cut the result, the record genotype is taken pictures under ultraviolet lamp.

3. the application of mark property association analysis

(1) the purebred colony of " Tongcheng " (a pig kind), the Da Bai (foreign blood relationship) purebred, long white (foreign blood relationship) in the test swinery set up of the agricultural animal genetic breeding that utilizes the applicant place and key lab of the breeding the Ministry of Education, Tongcheng County, Hubei Province bureau of animal husbandry and the stud farm cooperation of Tongcheng County, Hubei Province with place of china pig blood relationship purebred, grow up logical (China and foreign countries' Hybrid) and greatly enhance the application that logical (Hybrid at home and abroad) does the proterties association analysis, get 124 DNA samples and make genotype detection.The proterties of analyzing has the part producing performance, the part carcass trait.The GLM program is by the association analysis of carrying out with drag between genotype and proterties in the utilization SAS Vergion8.1 software.Analysis has two steps, sets up earlier and rejects all systemic effects as drag:

y _ijkl＝μ+S _j+C _k+ε _ijkl，

Wherein, y _IjklBe the character observation value, μ is a population mean, S _jBe sex effect, C _kBe combined effect, ε _IjklBe random error, suppose independent and obey N (0, σ ²) distribute.Obtain each individual residual error with the least square analysis, further carry out the check of genotypic one-way analysis of variance and multiple comparisons as new character value with residual error.

y _ij＝μ+GENOTYPE _i+e _ij

Wherein, y _IjBe the character observation value, μ is a population mean, GENOTYPE _iBe genotype effect, e _IjBe random error.

(2) utilize Qingyuan City of Guangdong Hua Nongwenshi herding limited-liability company and length that two original seed pig farms of water platform provide white (external blood relationship) and Da Bai (blood relationship abroad) swinery to do the proterties association analysis, have 112 and 186 DNA samples to be used for genotype detection respectively.The proterties of being analyzed has the part producing performance, the part carcass trait.The GLM program is carried out the association analysis between genotype and proterties in utilization SAS Vergion 8.1 softwares.Concrete model is as follows:

y _ijklm＝μ+L _j+L(B) _k+G _l+S _k+ε _ijklm，

Wherein, y _IjklmBe the character observation value, μ is a population mean, L _jBe effect between the field, L (B) _kBe kind or strain effect in the same field, G _lBe genotype effect, S _kBe sex effect, ε _IjklmBe random error, suppose independent and obey N (0, σ ²) distribute.

The distribution situation of embodiment 2 PCR-RFLP-MvaI polymorphisms in each pig variety

Utilize PCR-MvaI-RFLP to detect five swinerys: Tongcheng purebred (place of china pig blood relationship) colony, Da Bai purebred (foreign blood relationship), long purebred in vain (foreign pig blood relationship), to grow up logical (China and foreign countries' hybridized pig blood relationship) and greatly enhance logical (hybridized pig blood relationship at home and abroad), the gene frequency of each swinery is as shown in table 6, each genotype of GFAT1 gene long white, greatly enhance logical pig kind distribution all arranged, do not detect the GG homozygous genotype in the Da Bai and the logical pig that grows up, in the pig of Tongcheng, have only the AA homozygous genotype.

Table 6 GFAT1 gene PCR product genotype frequency and gene frequency

Kind	Number of individuals	Genotype			Gene frequency
							AA	GA	GG	A	G
		Greatly enhance elongated big logical	23 22	5 8	13 14	5 0						0.5 0.6818	0.5 0.3182
The big Bai Changbai in Tongcheng amounts to	29 26 24 124						29 23 15 80	0 3 8 38	0 0 1 6	1.0 0.9423 0.7917	0 0.0577 0.2083

The application of embodiment 3 pig mark property association analysiss

In Tongcheng swinery pig GFAT1 gene the 8th intron MvaI-RFLP pleomorphism site and part producing proterties are carried out association analysis, the proterties of being analyzed is the directly long and gluteus medius muscle midpoint fat thickness of trunk.Analytical results shows that the genotypic trunk of GA and GG directly grows and gluteus medius muscle midpoint fat thickness is significant difference (P＜0.05) (table 7)

As shown in Table 7, G allelotrope is that trunk is directly long, the favourable mark of gluteus medius muscle midpoint fat thickness (trunk length, stern fat approach), the selective marker that GG genotype mark can be used for improving body length simultaneously and reduces gluteus medius muscle midpoint fat thickness.

The association analysis of the different GFAT1 gene M of table 7 vaI-RFLP genotype and part producing proterties

Genotype	Number of individuals	Trunk is directly grown (cm)	Gluteus medius muscle midpoint fat thickness (mm)
				AA	51	92.298±0.450 ab	2.178±0.087 ab
GA	38	93.311±0.507 a	2.289±0.098 a
				GG	6	90.372±1.284 b	1.691±0.248 b

Annotate: same column contains same letter represents that difference is not remarkable, and different lowercases, expression significant difference (P＜0.05), different capitalizations are represented difference very significantly (P＜0.01)

Embodiment 4 PCR-RFLP-MvaI polymorphisms are in Qingyuan City and the Da Bai on two original seed pig farms of water platform and the distribution situation among the landrace group of Guangdong Hua Nongwenshi herding limited-liability company

Utilize PCR-MvaI-RFLP to detect the Da Bai and the landrace group on the original seed pig farm, Qingyuan City, Guangdong and the water platform original seed pig farm of Guangdong Hua Nongwenshi herding limited-liability company respectively, the gene frequency of each swinery is as shown in table 8, each genotype of GFAT1 gene all has distribution in Da Bai (Qingyuan City), Da Bai (water platform), long white (water platform) pig kind, does not detect the GG homozygous genotype in long white (Qingyuan City) pig.

Table 8 GFAT1 gene PCR product genotype frequency and gene frequency

Kind	Number of individuals	Genotype			Gene frequency
							AA	GA	GG	A	G
		Da Bai (Qingyuan City) long white (Qingyuan City)	67 45	49 34	17 11	1 0						0.858 0.878	0.142 0.122

Da Bai (water platform) long white (water platform)

113 73

53 25

46 40

14 8

0.673 0.616

0.327 0.384

The application of embodiment 5 pig mark property association analysiss

In the Da Bai on the original seed pig farm, Qingyuan City, Guangdong of Guangdong Hua Nongwenshi herding limited-liability company and water platform original seed pig farm and landrace group pig GFAT1 gene the 8th intron MvaI-RFLP pleomorphism site and part producing proterties are carried out association analysis, the proterties of being analyzed is body length, height, lean ratio, the correction thickness of backfat, 0-100kg day weight gain, 30-100kg day weight gain and reaches 100kg age in days body weight.Because purebred pig source, these two kind pig farms is different, strain characteristics difference is bigger.The purebred pig on water platform original seed pig farm all is long white, the Large Whites of the genealogy of law, and the purebred pig on original seed pig farm, Qingyuan City to mainly contain U.S. system and add be long white, Da Bai, so not only will consider the effect between kind or strain during analysis, also to consider two effects between the field.Analytical results shows that the genotypic lean ratio of AA and GG and the correction thickness of backfat are significant difference (P＜0.05) (table 9).

As seen from table, G allelotrope is lean ratio, the advantage allelotrope of proofreading and correct the thickness of backfat (lean ratio height, correction back fat thickness), and GG genotype mark can be used for improving simultaneously lean ratio and reduces the selective marker of proofreading and correct the thickness of backfat.

The association analysis of the different GFAT1 gene M of table 9 VaI-RFLP genotype and part producing proterties

Genotype	Number of individuals	Lean ratio (cm)	Proofread and correct the thickness of backfat (mm)
				AA	161	63.2023664±0.1756344 a	14.3928255±0.1779203 a
GA	114	63.6662577±0.2195804 ab	13.9189154±0.2224382 ab
				GG	23	64.1059016±0.4253155 b	13.3915863±0.4308509 b

Annotate: same column contains same letter represents that difference is not remarkable, and different lowercases, expression significant difference (P＜0.05), different capitalizations are represented difference very significantly (P＜0.01).

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉clone of pig carcass character GFAT 1 gene and application

<130>

<141>2007-07-18

<160>2

<170>PatentIn?version?3.1

<210>1

<211>2434

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>gene

<222>(1)..(2434)

<223>

<220>

<221>CDS

<222>(41)..(2140)

<223>

<220>

<221>exon

<222>(1)..(2434)

<223>

<220>

<221>primer_bind

<222>(2415)..(2434)

<223>

<220>

<221>primer_bind

<222>(1397)..(1416)

<223>

<220>

<221>primer_bind

<222>(1477)..(1496)

<223>

<220>

<221>primer_bind

<222>(780)..(799)

<223>

<220>

<221>primer_bind

<222>(404)..(421)

<223>

<220>

<221>primer_bind

<222>(527)..(547)

<223>

<220>

<221>primer_bind

<222>(1)..(19)

<223>

<400>1

gcc?act?cgc?tgt?ttc?ctg?tgc?cga?ccg?tgc?ctc?ctg?cat?cat?gtg?cgg 48

Ala?Thr?Arg?Cys?Phe?Leu?Cys?Arg?Pro?Cys?Leu?Leu?His?His?Val?Arg

1 5 10 15

tat?att?tgc?tta?ctt?aaa?cta?cca?tgt?tcc?tcg?cac?aag?acg?aga?aat 96

Tyr?Ile?Cys?Leu?Leu?Lys?Leu?Pro?Cys?Ser?Ser?His?Lys?Thr?Arg?Asn

20 25 30

ctt?gga?gac?cct?aat?caa?agg?cct?tca?gag?act?gga?gta?cag?agg?ata 144

Leu?Gly?Asp?Pro?Asn?Gln?Arg?Pro?Ser?Glu?Thr?Gly?Val?Gln?Arg?Ile

35 40 45

tga?ttc?tgc?tgg?tgt?ggg?agt?tga?tgg?agg?caa?tga?caa?aga?ttg?gga 192

Phe?Cys?Trp?Cys?Gly?Ser Trp?Arg?Gln Gln?Arg?Leu?Gly

50 55 60

agc?caa?tgc?ctg?caa?aat?cca?act?cat?taa?gaa?gaa?ggg?aaa?agt?taa 240

Ser?Gln?Cys?Leu?Gln?Asn?Pro?Thr?His Glu?Glu?Gly?Lys?Ser

65 70 75

ggc?act?gga?tga?aga?agt?tca?caa?aca?aca?aga?tat?gga?ttt?gga?tat 288

Gly?Thr?Gly Arg?Ser?Ser?Gln?Thr?Thr?Arg?Tyr?Gly?Phe?Gly?Tyr

80 85 90

aga?att?tga?tgt?aca?cct?tgg?gat?agc?tca?tac?ccg?ttg?ggc?aac?gca 336

Arg?Ile Cys?Thr?Pro?Trp?Asp?Ser?Ser?Tyr?Pro?Leu?Gly?Asn?Ala

95 100 105

tgg?aga?acc?caa?tcc?tgt?caa?tag?cca?tcc?cca?gcg?ctc?tga?taa?aaa 384

Trp?Arg?Thr?Gln?Ser?Cys?Gln Pro?Ser?Pro?Ala?Leu Lys

110 115

taa?tga?att?tat?tgt?tat?tca?taa?tgg?aat?cat?cac?caa?cta?taa?aga 432

Ile?Tyr?Cys?Tyr?Ser Trp?Asn?His?His?Gln?Leu Arg

120 125 130

ctt?gaa?aaa?gtt?ttt?gga?aag?caa?agg?cta?tga?ctt?tga?gtc?tga?aac 480

Leu?Glu?Lys?Val?Phe?Gly?Lys?Gln?Arg?Leu Leu Val Asn

135 140

aga?cac?aga?gac?aat?tgc?caa?gct?tgt?taa?ata?cat?gta?tga?caa?tcg 528

Arg?His?Arg?Asp?Asn?Cys?Gln?Ala?Cys Ile?His?Val Gln?Ser

145 150 155

gga?aag?tca?aga?tac?cag?ttt?tac?tac?ctt?ggt?gga?gag?agt?cat?cca 576

Gly?Lys?Ser?Arg?Tyr?Gln?Phe?Tyr?Tyr?Leu?Gly?Gly?Glu?Ser?His?Pro

160 165 170

aca?att?gga?agg?tgc?ttt?tgc?act?tgt?att?taa?aag?tgt?tca?ttt?tcc 624

Thr?Ile?Gly?Arg?Cys?Phe?Cys?Thr?Cys?Ile Lys?Cys?Ser?Phe?Ser

175 180 185

tgg?cca?agc?agt?tgg?cac?aag?act?agg?tag?ccc?tct?atc?gat?tgg?tgt 672

Trp?Pro?Ser?Ser?Trp?His?Lys?Thr?Arg Pro?Ser?Ile?Asp?Trp?Cys

190 195 200

acg?aag?tga?aca?taa?gct?ctc?tac?tga?tca?cat?tcc?aat?act?cta?cag 720

Thr?Lys Thr Ala?Leu?Tyr Ser?His?Ser?Asn?Thr?Leu?Gln

205 210 215

aac?agc?tag?gac?tca?gat?tgg?atc?aaa?att?cac?acg?gtg?ggg?atc?aca 768

Asn?Ser Asp?Ser?Asp?Trp?Ile?Lys?Ile?His?Thr?Val?Gly?Ile?Thr

220 225 230

ggg?aga?aag?agg?caa?gga?taa?gaa?agg?aag?ctg?caa?tct?ctc?tcg?tgt 816

Gly?Arg?Lys?Arg?Gln?Gly Glu?Arg?Lys?Leu?Gln?Ser?Leu?Ser?Cys

235 240 245

gga?cag?cac?aac?ttg?tct?ttt?ccc?tgt?tga?aga?aaa?agc?agt?gga?gta 864

Gly?Gln?His?Asn?Leu?Ser?Phe?Pro?Cys Arg?Lys?Ser?Ser?Gly?Val

250 255 260

tta?ctt?tgc?ttc?tga?tgc?atg?tgc?tgt?cat?aga?aca?tac?caa?tcg?cgt 912

Leu?Leu?Cys?Phe Cys?Met?Cys?Cys?His?Arg?Thr?Tyr?Gln?Ser?Arg

265 270 275

cat?ctt?tct?tga?aga?cga?tga?tgt?cgc?agc?agt?ggt?aga?cgg?ccg?tct 960

His?Leu?Ser Arg?Arg Cys?Arg?Ser?Ser?Gly?Arg?Arg?Pro?Ser

280 285 290

ttc?tat?cca?tcg?aat?taa?acg?gac?tgc?ggg?aga?tca?ccc?tgg?acg?tgc 1008

Phe?Tyr?Pro?Ser?Asn Thr?Asp?Cys?Gly?Arg?Ser?Pro?Trp?Thr?Cys

295 300 305

tgt?gca?gac?cct?cca?gat?gga?gct?gca?gca?gat?cat?gaa?ggg?caa?ctt 1056

Cys?Ala?Asp?Pro?Pro?Asp?Gly?Ala?Ala?Ala?Asp?His?Glu?Gly?Gln?Leu

310 315 320

cag?ttc?gtt?tat?gca?gaa?gga?aat?ttt?tga?gca?gcc?tga?gtc?agt?tgt 1104

Gln?Phe?Val?Tyr?Ala?Glu?Gly?Asn?Phe Ala?Ala Val?Ser?Cys

325 330 335

gaa?cac?aat?gag?agg?aag?agt?caa?ctt?tga?tga?tta?tac?tgt?gaa?ttt 1152

Glu?His?Asn?Glu?Arg?Lys?Ser?Gln?Leu Leu?Tyr?Cys?Glu?Phe

340 345

ggg?agg?ttt?gaa?gga?tca?cat?taa?gga?aat?cca?gag?gtg?tcg?gcg?ctt 1200

Gly?Arg?Phe?Glu?Gly?Ser?His Gly?Asn?Pro?Glu?Val?Ser?Ala?Leu

350 355 360

aat?cct?tat?tgc?ttg?cgg?aac?aag?tta?tca?tgc?tgg?tgt?agc?gac?gcg 1248

Asn?Pro?Tyr?Cys?Leu?Arg?Asn?Lys?Leu?Ser?Cys?Trp?Cys?Ser?Asp?Ala

365 370 375 380

tca?agt?tct?tga?aga?gct?gac?tga?gct?gcc?tgt?tat?ggt?gga?gct?agc 1296

Ser?Ser?Ser Arg?Ala?Asp Ala?Ala?Cys?Tyr?Gly?Gly?Ala?Ser

385 390

cag?tga?ttt?cct?gga?tag?aaa?tac?acc?agt?ttt?tcg?aga?tga?tgt?ttg 1344

Gln Phe?Pro?Gly Lys?Tyr?Thr?Ser?Phe?Ser?Arg Cys?Leu

395 400 405

ctt?ttt?cat?tag?tca?atc?agg?tga?gac?agc?aga?tac?cct?gat?ggg?tct 1392

Leu?Phe?His Ser?Ile?Arg Asp?Ser?Arg?Tyr?Pro?Asp?Gly?Ser

410 415 420

ccg?gta?ctg?taa?gga?gag?agg?agc?ttt?aac?tgt?ggg?gat?cac?aaa?cac 1440

Pro?Val?Leu Gly?Glu?Arg?Ser?Phe?Asn?Cys?Gly?Asp?His?Lys?His

425 430 435

agt?cgg?cag?ttc?cat?atc?aag?aga?gac?aga?ctg?tgg?agt?tca?cat?caa 1488

Ser?Arg?Gln?Phe?His?Ile?Lys?Arg?Asp?Arg?Leu?Trp?Ser?Ser?His?Gln

440 445 450

tgc?tgg?gcc?gga?gat?tgg?cgt?ggc?cag?cac?aaa?ggc?ata?cac?cag?cca 1536

Cys?Trp?Ala?Gly?Asp?Trp?Arg?Gly?Gln?His?Lys?Gly?Ile?His?Gln?Pro

455 460 465

gtt?tgt?gtc?cct?tgt?gat?gtt?tgc?cct?tat?gat?gtg?tga?tga?cag?gat 1584

Val?Cys?Val?Pro?Cys?Asp?Val?Cys?Pro?Tyr?Asp?Val Gln?Asp

470 475 480

ctc?cat?gca?gga?gag?acg?caa?aga?gat?cat?gct?tgg?att?gaa?gcg?gct 1632

Leu?His?Ala?Gly?Glu?Thr?Gln?Arg?Asp?His?Ala?Trp?Ile?Glu?Ala?Ala

485 490 495

gcc?tga?ttt?gat?taa?gga?agt?ttt?gag?cac?gga?tga?tga?aat?tca?aaa 1680

Ala Phe?Asp Gly?Ser?Phe?Glu?His?Gly Asn?Ser?Lys

500 505 510

act?ggc?aac?aga?act?tta?tca?tca?gaa?gtc?ggt?ctt?gat?aat?ggg?acg 1728

Thr?Gly?Asn?Arg?Thr?Leu?Ser?Ser?Glu?Val?Gly?Leu?Asp?Asn?Gly?Thr

515 520 525

tgg?cta?tca?tta?tgc?tac?ttg?tct?tga?agg?ggc?cct?gaa?aat?caa?aga 1776

Trp?Leu?Ser?Leu?Cys?Tyr?Leu?Ser Arg?Gly?Pro?Glu?Asn?Gln?Arg

530 535 540

aat?cac?tta?cat?gca?ctc?tga?agg?tat?cct?tgc?tgg?tga?gtt?gaa?gca 1824

Asn?His?Leu?His?Ala?Leu Arg?Tyr?Pro?Cys?Trp Val?Glu?Ala

545 550 555

cgg?ccc?cct?ggc?ttt?ggt?gga?taa?gtt?gat?gcc?cgt?cat?cat?gat?cat 1872

Arg?Pro?Pro?Gly?Phe?Gly?Gly Val?Asp?Ala?Arg?His?His?Asp?His

560 565 570

cat?gag?aga?tca?cac?cta?cgc?caa?gtg?cca?gaa?tgc?tct?tca?gca?ggt 1920

His?Glu?Arg?Ser?His?Leu?Arg?Gln?Val?Pro?Glu?Cys?Ser?Ser?Ala?Gly

575 580 585

ggt?tgc?tag?gca?ggg?aag?gcc?agt?ggt?gat?ctg?tga?taa?gga?aga?cac 1968

Gly?Cys Ala?Gly?Lys?Ala?Ser?Gly?Asp?Leu Gly?Arg?His

590 595

tga?gac?cat?taa?gaa?cac?caa?acg?aac?aat?caa?ggt?gcc?cca?ctc?ggt 2016

Asp?His Glu?His?Gln?Thr?Asn?Asn?Gln?Gly?Ala?Pro?Leu?Gly

600 605 610

gga?ctg?cct?gca?ggg?cat?tct?cag?cgt?cat?ccc?gct?aca?gtt?gct?ggc 2064

Gly?Leu?Pro?Ala?Gly?His?Ser?Gln?Arg?His?Pro?Ala?Thr?Val?Ala?Gly

615 620 625

ctt?cca?cct?ggc?tgt?gct?cag?agg?cta?tga?tgt?tga?ttt?ccc?ccg?gaa 2112

Leu?Pro?Pro?Gly?Cys?Ala?Gln?Arg?Leu Cys Phe?Pro?Pro?Glu

630 635 640

tct?tgc?caa?atc?ggt?aac?cgt?aga?ata?agg?agc?atc?tga?gat?tgg?gcg 2160

Ser?Cys?Gln?Ile?Gly?Asn?Arg?Arg?Ile?Arg?Ser?Ile Asp?Trp?Ala

645 650 655

att?aag?caa?cac?aag?aca?cct?ttt?gta?ttt?aaa?acc?ttg?att?taa?aat 2208

Ile?Lys?Gln?His?Lys?Thr?Pro?Phe?Val?Phe?Lys?Thr?Leu?Ile Asn

660 665 670

atc?acc?cct?cta?agc?ctt?ttt?taa?gta?aat?cct?tat?tta?tat?atc?agt 2256

Ile?Thr?Pro?Leu?Ser?Leu?Phe Val?Asn?Pro?Tyr?Leu?Tyr?Ile?Ser

675 680 685

aat?aat?tat?tcc?att?caa?ttt?gtg?act?ttt?gtg?aaa?tta?cct?cct?att 2304

Asn?Asn?Tyr?Ser?Ile?Gln?Phe?Val?Thr?Phe?Val?Lys?Leu?Pro?Pro?Ile

690 695 700

ttt?cca?gta?agt?tgt?gag?gga?gtt?taa?ata?atg?caa?tct?ata?ttg?gta 2352

Phe?Pro?Val?Ser?Cys?Glu?Gly?Val Ile?Met?Gln?Ser?Ile?Leu?Val

705 710 715

ttg?gta?tca?gaa?aga?gat?tta?gct?ctc?att?ttc?ttt?aaa?cga?tgc?tga 2400

Leu?Val?Ser?Glu?Arg?Asp?Leu?Ala?Leu?Ile?Phe?Phe?Lys?Arg?Cys

720 725 730

gta?ttg?gat?tta?tgg?gtc?ctc?tac?ttg?aat?ctg?a 2434

Val?Leu?Asp?Leu?Trp?Val?Leu?Tyr?Leu?Asn?Leu

735 740 745

<210>2

<211>310

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>gene

<222>(1)..(310)

<223>

<220>

<221>primer_bind

<222>(291)..(310)

<223>

<220>

<221>primer_bind

<222>(1)..(20)

<223>

<220>

<221>exon

<222>(275)..(310)

<223>

<220>

<221>exon

<222>(1)..(73)

<223>

<220>

<221>Intron

<222>(74)..(274)

<223>

<220>

<221>mutation

<222>(101)..(101)

<223>

<400>2

agc?cct?cta?ttg?att?ggt?gta?cga?agt?gaa?cat?aag?ctc?tct?act?gat 48

Ser?Pro?Leu?Leu?Ile?Gly?Val?Arg?Ser?Glu?His?Lys?Leu?Ser?Thr?Asp

1 5 10 15

cac?att?cca?ata?ctc?tac?aga?aca?g?gtaaaaacta?ttcctacatc 93

His?Ile?Pro?Ile?Leu?Tyr?Arg?Thr

20

atgccagggg?gaaaatgtat?catttgaatg?caggaggtct?aaagaattgt?tttccctaaa 153

ttgaataaat?gcccctttgg?tcagatccac?tcatatatat?atagttctgt?ctagatatga 213

aaaggatttg?tttttgtgat?ttctctgacg?agtagaattt?tcttctgttg?tatatcctta 273

g?ct?agg?act?cag?att?gga?tca?aaa?ttc?aca?cgg?tgg?g 310

Ala?Arg?Thr?Gln?Ile?Gly?Ser?Lys?Phe?Thr?Arg?Trp

30 35

Claims (8)

1. pig carcass character GFAT 1 gene, its cDNA sequence is as described in the sequence table SEQ ID NO:1.

2. pig carcass character GFAT 1 gene, its dna sequence dna is as described in the sequence table SEQ ID NO:2.

3. dna sequence dna according to claim 2 is characterized in that: there is the base mutation of a G101-A101 at the 101bp place of sequence table SEQ ID NO:2, causes the MvaI-RFLP polymorphism.

4. pig carcass character GFAT 1 gene according to claim 1 is wherein cloned the used primer sequence of GFAT1 gene shown in SEQ ID NO:1.

5. pig carcass character GFAT 1 gene according to claim 2, the used primer sequence of GFAT1 gene the 8th intron that wherein increases is shown in SEQ ID NO:2.

6. claim 1 or 2 application of described pig carcass character GFAT 1 gene in the pig molecule mark assisted Selection.

7. claim 4 or 5 application of described primer in the pig molecule mark assisted Selection.

8. one kind is screened hog on hook character gene GFAAT1 molecule marking method, prepares according to following steps:

The first step

Personnel selection GFAT1 gene cDNA is the information probe, does the homologous sequence screening, obtains the expressed sequence tag of homology more than 85%; Splice pig expressed sequence tag-contig then; According to expressed sequence tag-four pairs of primers of contig design, amplification obtains the purpose fragment; The black total RNA of pig muscle tissue extraction is a template with the west place in Hubei of growing up, and does the RT-PCR amplification, and PCR product purification and cloning and sequencing carry out sequential analysis, obtains as the described cDNA sequence of sequence table SEQ ID NO:1;

Second step

Extract DNA from the pig blood genome, with pig GFAT1 gene cDNA sequence is template design primer, carries out pcr amplification, PCR product purification and cloning and sequencing, acquisition is used the polymorphism that the PCR-RFLP method detects pig GFAT1 gene as dna sequence dna as described in the sequence table SEQ ID NO:2.

Images