CN117625813B - Application of SNP molecular marker affecting backfat thickness of long white pig - Google Patents
Application of SNP molecular marker affecting backfat thickness of long white pig Download PDFInfo
- Publication number
- CN117625813B CN117625813B CN202410091962.6A CN202410091962A CN117625813B CN 117625813 B CN117625813 B CN 117625813B CN 202410091962 A CN202410091962 A CN 202410091962A CN 117625813 B CN117625813 B CN 117625813B
- Authority
- CN
- China
- Prior art keywords
- genotype
- site
- snp molecular
- seq
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000003147 molecular marker Substances 0.000 title claims description 64
- 241000282898 Sus scrofa Species 0.000 claims abstract description 97
- 241000282887 Suidae Species 0.000 claims abstract description 38
- 210000000349 chromosome Anatomy 0.000 claims abstract description 31
- 238000009395 breeding Methods 0.000 claims abstract description 20
- 230000001488 breeding effect Effects 0.000 claims abstract description 19
- 238000000034 method Methods 0.000 claims abstract description 19
- 230000006872 improvement Effects 0.000 claims abstract description 6
- 239000003795 chemical substances by application Substances 0.000 claims description 16
- 239000002773 nucleotide Substances 0.000 claims description 15
- 125000003729 nucleotide group Chemical group 0.000 claims description 15
- 108700028369 Alleles Proteins 0.000 claims description 13
- 238000002741 site-directed mutagenesis Methods 0.000 claims description 8
- 230000002068 genetic effect Effects 0.000 claims description 7
- 230000035772 mutation Effects 0.000 claims description 5
- 238000010362 genome editing Methods 0.000 claims description 4
- 108091033409 CRISPR Proteins 0.000 claims description 2
- 238000010453 CRISPR/Cas method Methods 0.000 claims description 2
- 230000009261 transgenic effect Effects 0.000 claims description 2
- 230000008569 process Effects 0.000 abstract description 4
- 230000009286 beneficial effect Effects 0.000 abstract description 2
- 235000020997 lean meat Nutrition 0.000 abstract description 2
- 230000000694 effects Effects 0.000 description 8
- 108020004414 DNA Proteins 0.000 description 5
- 238000004519 manufacturing process Methods 0.000 description 5
- 230000001850 reproductive effect Effects 0.000 description 5
- 238000004458 analytical method Methods 0.000 description 3
- 238000012098 association analyses Methods 0.000 description 3
- 238000012937 correction Methods 0.000 description 3
- 238000010219 correlation analysis Methods 0.000 description 3
- 238000009396 hybridization Methods 0.000 description 3
- 239000011159 matrix material Substances 0.000 description 3
- 238000003908 quality control method Methods 0.000 description 3
- 101150113320 C7orf50 gene Proteins 0.000 description 2
- 101100495925 Schizosaccharomyces pombe (strain 972 / ATCC 24843) chr3 gene Proteins 0.000 description 2
- 239000000654 additive Substances 0.000 description 2
- 230000000996 additive effect Effects 0.000 description 2
- 238000013459 approach Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000009826 distribution Methods 0.000 description 2
- 235000016709 nutrition Nutrition 0.000 description 2
- 230000035764 nutrition Effects 0.000 description 2
- 238000000513 principal component analysis Methods 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- 206010028980 Neoplasm Diseases 0.000 description 1
- 241000289371 Ornithorhynchus anatinus Species 0.000 description 1
- 239000007984 Tris EDTA buffer Substances 0.000 description 1
- 238000010171 animal model Methods 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000004146 energy storage Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 238000012248 genetic selection Methods 0.000 description 1
- 244000144980 herd Species 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000013011 mating Effects 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 230000035935 pregnancy Effects 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000013179 statistical model Methods 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, in particular to application of SNP molecular markers affecting backfat thickness of a long white pig. The SNP molecular markers are as follows: the 668222 th site from the 5' end located on chromosome 3 of version 11.1 of the international swine genome, being T or G, SNP genotype TT individuals have a greater backfat thickness value than GG individuals; or at position 684615 from the 5' end on chromosome 3 of version 11.1 of the international swine genome, is a or G, and the SNP genotype AA individual has a greater backfat thickness value than the GG individual. The beneficial dominant genotype is selected for seed reserving, so that the backfat thickness of pigs can be reduced rapidly, the lean meat percentage of the pigs is improved, and the breeding improvement process of high-quality pigs is accelerated.
Description
Technical Field
The invention relates to the technical field of biology, in particular to application of SNP molecular markers affecting backfat thickness of a long white pig.
Background
The Danish is produced by the original pig, and four different strains of English, french, belgium and Xindan are used at present. The long white pig has high production performance, stable heredity, good general coordination force and remarkable hybridization effect, and is widely used as a male parent for hybridization in production. After hybridization in different forms, ideal offspring with different breeding targets can be obtained, and the purpose of breeding the native lean type pigs is achieved through a breeding process.
The whole genome association analysis (GWAS) identifies the relationship between the affected phenotype and the gene based on linkage disequilibrium among single nucleotide diversity (SNP), can effectively mine molecular markers related to the main selection trait, and is applied to molecular Marker Assisted Selection (MAS) and whole Genome Selection (GS) to realize early selection of the target trait. Compared with the traditional breeding method, MAS and GS breeding ensures that the alleles related to the characters are fast and pure, thereby not only accelerating the breeding efficiency and the genetic selection progress, but also avoiding the separation of commodity characters in the creation of a mating line and more efficiently breeding the livestock and poultry varieties with excellent characters.
The backfat thickness of the pig can be used for explaining the lean meat percentage fat of the pig. The higher value of backfat thickness indicates a lower lean percentage in pigs and conversely a higher lean percentage. In the large-scale pig raising process, the reproductive performance of the sow is one of important indexes for measuring the economic benefit of pig raising production, and the nutrition factor is one of important factors for influencing the reproductive performance of the sow, wherein the fat condition is one of important indexes for reflecting the body condition of the sow, and the fat condition is the nutrition condition and physical energy storage of the sow in different physiological stages. The problems of the fat conditions of the sows in different breeding stages, such as the fat conditions of the reserved sows in the breeding process, the fat conditions of the sows in different gestation stages, the fat conditions of the sows after weaning, the breeding conditions of the sows in the later stages, and the like are always problems in the pig raising production process. Backfat thickness is easy to measure and is often used as an important index for reflecting sow fat condition. Despite the extensive research done by researchers on backfat thickness and sow reproductive performance, none of the backfat thickness standards is applicable to different breeds and strains of pigs at different stages of reproduction. Therefore, by measuring the backfat thickness of specific breeds and strain pigs in different breeding stages, the influence of the backfat thickness on the reproductive performance of the sow is researched and analyzed, and corresponding backfat thickness standards are formulated, so that the backfat thickness standard has great significance for improving the reproductive performance of the sow, and is expected to be applied to the medicine field in future researches, for example, the backfat thickness standard can have potential practical value in the aspect of being applied to diseases such as cancers and the like.
Disclosure of Invention
Based on the above, the invention provides application of SNP molecular markers affecting the backfat thickness of long white pigs, and at least solves one problem in the prior art.
One of the invention provides an SNP molecular marker related to the backfat thickness of a long white pig, wherein the SNP molecular marker comprises at least one of the following SNP molecular markers:
The first, the nucleotide sequence containing said SNP molecular marker is shown in SEQ ID No. 1, said SNP molecular marker locates at 300 th site from 5 'end on SEQ ID No. 1, correspond to the 668222 th site from 5' end on chromosome 3 of the international pig genome of version 11.1, it is G or T;
second, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G.
The sequence shown in SEQ ID No. 1 is:
CAAAAGCCAGGAGACACGATACAGAAGTCAGGGTGGGAAGCCCCGCAGGCAACAACCTGCCTACTACCCTTCCAAGGTCCCCAGGGCTTTAGCCTGGATGGCGCGGGACCCCACGACTCGGCCAAGGCTGCTGGGACCAGCTTCCCGTGTCCTCTGGACAGAGCGGGCCCGGCCAGCACGGCCAGCCTCCTGCACGCCGCAGGCCGGCAAGGTGAGCGCAGGGATGGCGAGCTCCCGGCAGGAACCCTCTTTACAAGGATCAGACTCGGTTTCTGGGAACAAAGTCCCGAGTCTGCAGCKTGCTACCCCTCAGAACCAGGCGCCGCTCACAGGCTGTGCACGCTGGCCTGTCCCTGGGCGGACAGGAGGAGCAAAGCCAGGCCAGGGCTCTGGGGAGCGCCCCCACAGGTGACACGGAGGGGGGCACAGGCAGAGCCCCAGGAATGCACGGCCAAAGCAGGAGGCAGAGTACACACCCCCTCCCCAGCTCGCAGCAGGGAGGGGGCACCAGAGGCCCAGGGCACGGCGTCCACCGGCAGCGCCCCTAGTCGTGCGGGTCAGCGTCCAGGACAAGCCTGTGCCTGCAACGAGCGGGGCTGA, Wherein K is G or T.
The sequence shown in SEQ ID No. 2 is:
GGTGGGAAGGGGCCCGGCTGCTTTCTGGGGCAGGGAGAGGAGGGCACCCACCCCCAGGCCCTAGGATGCCATTTAGAGAAGCAACGTGCTGCCCAGCCTTTCAGGCCCCGGCTGTGCACCAGAGCCAAGTCTTGGCGGCCGAGCAGTCGTCCTAGTGCATGTGACAGAACTGTGCTGCTTCCTCCTGAAACCTCCCATCGAGCCATTTCCCTTTGATGACTGCTGGCTCCTCAACTCTCTAAGGCTAAAGCCTCTTGCATAACTGGGCTGCCCCAGGCTGCATCTGTCCACAGGGTCTCRCGGGCCTAGGGCCCCAAAATACCACCCAGGCATCAGAGCAGAGTGGCTCCTTGCGAAGGCCACCTCTCGAGCAGCAGAGGGACAGGGTGAAATGGGCCAGGGGTCCTCTGTGTCCCCAGCACGTCCACCCTGCGTCCCCCTTCCTCTCATACATGCGGACAGGAGGGCGGAGGGCACCCGGGAGGTTCCCGGTTTTCATTCCAGCGGAGGAAGCAAGGGTTCCCGTTAGAGCAGATGCAATGAGTAAAAACAACCGCTGGTTCCTCCCCTGGAAAGAACCAGAGGCGGGAAAAGATGGGT, Wherein R is A or G.
The SNP molecular marker is positioned on the C7orf50 gene of the long white pig and is an influencing factor of backfat thickness of the long white pig. For (I), when SNP molecular markers in sequences shown in SEQ ID No. 1 on two chromosomes are T, T respectively, the SNP molecular markers are called TT genotype, and the thickness of the TT genotype long white pig backfat is large; when the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes are T, G respectively, the two chromosomes are called TG genotypes, and the thickness of the long white pig backfat with the TG genotypes is between that of the long white pig backfat with the GG genotypes and that of the long white pig backfat with the TT genotypes; when the SNP molecular markers in the sequences shown in SEQ ID No. 1 on two chromosomes are G, G respectively, the SNP molecular markers are called GG genotype, and the thickness of the GG genotype backfat of a long white pig is small. For (II), when SNP molecular markers in sequences shown in SEQ ID No. 2 on two chromosomes are A, A respectively, the SNP molecular markers are called AA genotype, and the thickness of the AA genotype long white pig backfat is large; when the SNP molecular markers in the sequences shown in SEQ ID No. 2 on the two chromosomes are A, G respectively, the marker is called AG genotype, and the AG genotype long white pig backfat thickness is between AA genotype and GG genotype long white pig backfat thickness; when the SNP molecular markers in the sequences shown in SEQ ID No. 2 on two chromosomes are G, G respectively, the SNP molecular markers are called GG genotype, and the thickness of the GG genotype backfat of a long white pig is small.
The second invention provides an application of the SNP molecular marker in determining the backfat thickness of a long white pig.
The invention also provides a method for determining backfat thickness of long white pigs, which comprises the following steps: determining SNP molecular markers of the long white pigs according to one of the invention, and determining the backfat thickness character of the long white pigs according to the SNP molecular markers:
If the SNP molecular marker is the first, the backfat thickness character of the long white pig is from large to small, and the genotype sequence of the 300 th site from the 5' end on the SEQ ID No. 1 is as follows: TT genotype, TG genotype and GG genotype;
If the SNP molecular marker is the second type, the backfat thickness character of the long white pig is from large to small, and the genotype sequence of the 300 th site from the 5' end on the SEQ ID No. 2 is as follows: AA genotype, AG genotype, and GG genotype.
The fourth invention provides a method for genetic improvement of a long white pig, the genetic improvement being a genetic improvement of backfat thickness, the method comprising: determining SNP molecular markers according to one of the invention of the breeding pigs in the core group of long white pigs, and making corresponding selections according to the SNP molecular markers:
If the SNP molecular marker is the first type, selecting a boar individual with a 300 th site of GG genotype and TG genotype from the 5' end on the SEQ ID No. 1 from the long white pig core group, and eliminating the boar individual with a TT genotype at the site so as to increase the frequency of the allele G of the site by generations;
if the SNP molecular marker is the second type, selecting the pig breeder individuals with GG genotype and AG genotype at 300 th site from 5' end on SEQ ID No.2 in the long white pig core group, and eliminating the pig breeder individuals with AA genotype at the site so as to increase the frequency of allele G of the site by generations.
In some preferred embodiments, the corresponding selection is made based on the SNP molecular markers:
If the SNP molecular marker is the first type, selecting a boar individual with a 300 th site of GG genotype from the 5' end on the SEQ ID No. 1 from the long white pig core group, and eliminating the boar individual with the TG genotype and the TT genotype at the site so as to increase the frequency of the allele G of the site by generations;
If the SNP molecular marker is the second type, selecting a boar individual with a 300 th site of GG genotype from the 5' end on SEQ ID No.2 from the long white pig core group, and eliminating the boar individual with AG genotype and AA genotype at the site so as to increase the frequency of allele G of the site by generations.
The fifth invention provides a method for establishing a new strain of a long white pig for improving the growth traits of the pig, which comprises the following steps: making corresponding selection according to SNP molecular markers of the long white pigs:
If the SNP molecular marker is the first type, mutating the TT genotype of the pig with the TT genotype into the TG genotype or the GG genotype by a site-directed mutagenesis mode;
If the SNP molecular marker is the second type, the AA genotype of the pig with the AA genotype is mutated into the AG genotype or the GG genotype by means of site-directed mutagenesis.
In some preferred embodiments, the corresponding selection is made based on SNP molecular markers of long white pigs:
If the SNP molecular marker is the first type, the TG genotype and the TT genotype of the pig with the TG genotype or the TT genotype are mutated into the GG genotype by a site-directed mutagenesis mode;
If the SNP molecular marker is the second type, the AG genotype and the AA genotype of the pig with AG genotype or AA genotype are mutated into GG genotype by means of site-directed mutagenesis.
In some preferred embodiments, the mutation is performed using a transgenic approach or a gene editing approach.
In some preferred embodiments, the mutation is performed using the gene editing method of CRISPR/Cas 9.
Due to the adoption of the technical scheme, the embodiment of the invention has at least the following beneficial effects: the SNP molecular marker is closely related to backfat thickness, so that the related index of the Changbai pig can be detected by the SNP molecular marker, or the genetic improvement of the Changbai pig can be carried out by the SNP molecular marker.
Drawings
Fig. 1 is a graph of statistical analysis based on the backfat thickness behavior of long white pigs in an embodiment of the invention.
FIG. 2 is a Manhattan plot of whole genome correlation analysis in an embodiment of the invention, wherein the abscissa indicates chromosome number of pigs and the ordinate indicates-log 10 (p) value of SNP site.
FIG. 3 is a plot of backfat thickness violin for various mutant populations at position 668222 of chromosome 3 in the example of the present invention.
FIG. 4 is a plot of backfat thickness violin for various mutant populations at position 684615 of chromosome 3 in the example of the present invention.
Detailed Description
The following is a clear and complete description of the conception and technical effects produced thereby to fully illustrate the objects, aspects, and effects of the present invention.
Example 1: identification of SNP molecular markers related to backfat thickness of long white pigs
1. Experimental animal
The herd used in this example was a commercial breed of long white pigs.
2. Experimental method
And randomly selecting 2052 heads from pig groups, respectively collecting a small muscle tissue sample of each individual, extracting the genome DNA of each individual by a standard phenol-chloroform method, and dissolving the extracted genome DNA in TE buffer solution. The quality of the extracted genome DNA is detected by a Nanodrop spectrophotometer, and when the A260/280 ratio is 1.8-2.0 and the A260/230 ratio is about 1.7-1.9, the quality standard is achieved.
The concentration of DNA samples meeting the standard is diluted to 50 ng/. Mu.l, each DNA sample is re-sequenced by utilizing a Hi Seq XTen sequencer platform of Illumina company, reads is aligned to 11.1 version of International pig genome by utilizing BWA software, and then SNPs are obtained by sequentially using software such as SAMtools, platypus, beagle and the like. Quality control was performed on the obtained SNPs using PLINK, eliminating minor allele frequencies (minor allele frequency, MAF) <0.01.
3. Data and individual quality control
Quality control of SNPs genotype data obtained above and sequenced SNPs of 2074 individuals was performed using PLINK: the snps with genotype detection rate <95% and minor allele frequency (minor allele frequency, MAF) <0.01 were knocked out, then 2074 individuals were knocked out, namely 22 individuals with greater relatedness were knocked out, so 2052 individuals were all used for data analysis, and finally 33518 snps were determined for analysis.
4. Determination of pig backfat thickness phenotype
Statistical analysis is carried out on the backfat thickness characteristics of the long white pigs, as shown in figure 1, the result is approximately normal distribution, belongs to more typical quantitative characteristics, meets the basic requirements of association analysis, and has a variation coefficient of 24.72%. The related characters have obvious differences among the sexes and the strains.
5. Whole genome association (GWAS) analysis
And carrying out GWAS analysis on SNP molecular marker information of a long white pig group obtained by a second generation resequencing technology and backfat thickness composition of corresponding 2052 individuals by utilizing a mixed linear model in GEMMA (genome-WIDE EFFICIENT Mixed Model Association algorithm) software, wherein a statistical model 'Y=xα+sβ+Kμ+e' is adopted in a mixed linear model MLM program, wherein Y represents a phenotype, X represents a genotype, S is a structural matrix, K is a relative relationship matrix, α and β represent fixed effects, Kμ is a random effect, and e is a normal distribution residual error. The model can set the influence of the population structure as covariance, eliminate the influence of correlation between genetic differences (such as regions and the like) irrelevant to phenotype, and takes Principal Component Analysis (PCA), strain, sex and nest group effect as fixed effects in the embodiment. The parameters were set to-geno 0.05, -mind 0.1.1, -MAF 0.01, and the Hash equilibrium set filtration criteria 1e-6. And visualizing the Manhattan diagram and the Q-Q diagram of the GWAS result by utilizing qqman software packages in R software. P <0.05/N+1 and P <1/N+1 are respectively set as thresholds which are obvious and potentially relevant to the characters, wherein N is the number of markers (SNP number) of genotypes, bonferroni correction based on linkage imbalance correction is carried out by adopting estimated independent number of markers, the number of SNPs used for backfat thickness character association analysis is 33518, the number of individuals is 2052, 100 kg of correction data are selected as main variables, the birth plants, strains, sexes, year of birth, season of birth, weight of birth and corresponding date of birth are selected as covariates, and female parent and male parent individuals are assisted to form a genetic relationship matrix. There were 2 autosomal SNP sites reaching a 5% genome-wide level of significance (log 10 (1/52000)).
As can be seen from FIG. 2, two sites in autosomes that most significantly affect the backfat thickness trait of pigs fall on color 3, with a P value of 1.004740e-05. The mutation information was annotated to the gene name, both annotated to the relevant region of the C7orf50 gene.
This example focused on the highest point of-log 10 (p) values for chromosome 3 at position 300 from the 5' end on SEQ ID No.1 and SEQ ID No.2, and the 300 th point on SEQ ID No.1 from the 5' end corresponds to position 668222 from the 5' end of chromosome 3 of version 11.1 of the International pig genome, which is C or T; the 300 rd site from the 5 'end of the SEQ ID No.2 corresponds to the 684615 rd site from the 5' end of chromosome 3 of the 11.1 version of the International pig genome, and is A or G.
Example 2: the influence of SNP chr3: 668222 locus and SNP chr3: 684615 locus on the backfat thickness of long white pigs is verified
Two SNP molecular markers which are related to the backfat thickness of a long white pig and identified by the embodiment are positioned at the 300 th site from the 5' end on SEQ ID No.1 and SEQ ID No.2, wherein the SEQ ID No.1 corresponds to the 668222 site on chromosome 3 of a pig genome (11.1 version), the reference genome of the site is G genotype, and the mutant type is T. SEQ ID NO.2 corresponds to the pig genome (version 11.1) at position 684615 on chromosome 3, the reference genome of which is the G genotype and the mutant is A.
And (3) carrying out correlation analysis on the genotype of the SNP molecular marker locus positioned in SEQ ID NO.1 and the backfat thickness character of the long white pig, wherein the statistical result is shown in figure 3. The results show that the backfat thickness is the biggest TT type long white pig, the backfat thickness is the smallest GG type long white pig, the backfat thickness of the TG type long white pig is between the TT type and the GG type, and the backfat thickness between the three genotypes has extremely obvious difference, and accords with the additive model.
And (4) carrying out correlation analysis on the genotype of the SNP molecular marker locus positioned in SEQ ID NO.2 and the backfat thickness character of the long white pig, wherein the statistical result is shown in figure 4. The results show that the back fat thickness is the largest of the AA type long white pigs, the back fat thickness is the smallest of the AA type long white pigs, the back fat thickness of the AG type long white pigs is between the AA type and the GG type, and the back fat thickness among the three genotypes has extremely obvious difference, so that the model accords with an additive model.
In conclusion, the molecular marker provided by the invention can efficiently and accurately identify the backfat thickness of the identified long-white pig, further judge the meat production performance of the long-white pig, has obvious application value in the breeding of the long-white pig, and provides a reliable reference for the breeding of the long-white pig.
The present invention is not limited to the above embodiments, but is merely preferred embodiments of the present invention, and the present invention should be considered as being within the scope of the present invention as long as the technical effects of the present invention are achieved by the same or equivalent means. Various modifications and variations are possible in the technical solution and/or in the embodiments within the scope of the invention.
Claims (8)
1. Use of a SNP molecular marker associated with long white pig backfat thickness for determining long white pig backfat thickness, characterized in that the SNP molecular marker comprises at least one of the following SNP molecular markers:
The first, the nucleotide sequence containing said SNP molecular marker is shown in SEQ ID No. 1, said SNP molecular marker locates at 300 th site from 5 'end on SEQ ID No. 1, correspond to the 668222 th site from 5' end on chromosome 3 of the international pig genome of version 11.1, it is G or T; the long white pig backfat thickness character is from big to small, and the genotype sequence of the 300 th site from the 5' end on the SEQ ID No. 1 is as follows: TT genotype, TG genotype and GG genotype;
Second, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G; the backfat thickness property of the long white pig is from big to small, and the genotype sequence of the 300 th site from the 5' end on the SEQ ID No. 2 is as follows: AA genotype, AG genotype, and GG genotype.
2. A method of determining backfat thickness in a long white pig, comprising: determining SNP molecular markers of the long white pigs, and determining backfat thickness characters of the long white pigs according to the SNP molecular markers:
If the SNP molecular marker is the first type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No.1, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No.1, corresponds to a 668222 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is G or T; the backfat thickness property of the long white pig is from big to small, and the genotype sequence of the 300 th site from the 5' end on the SEQ ID No.1 is as follows: TT genotype, TG genotype and GG genotype;
If the SNP molecular marker is the second type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G; the backfat thickness property of the long white pig is from big to small, and the genotype sequence of the 300 th site from the 5' end on the SEQ ID No. 2 is as follows: AA genotype, AG genotype, and GG genotype.
3. A method for genetically improving backfat thickness traits of a long white pig, comprising: determining SNP molecular markers of breeding pigs in a core group of the long white pigs, and making corresponding selections according to the SNP molecular markers:
If the SNP molecular marker is the first type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 1, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 1, corresponds to a 668222 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is G or T; selecting individual breeding pigs with GG genotype and TG genotype at 300 th site from 5' end on the SEQ ID No. 1 from the core group of the long white pigs, and eliminating individual breeding pigs with TT genotype at the site so as to increase the frequency of allele G of the site by generations;
If the SNP molecular marker is the second type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G; and selecting the boar individuals with GG genotype and AG genotype at the 300 th site from the 5' end on the SEQ ID No. 2 from the long white pig core group, and eliminating the boar individuals with AA genotype at the site so as to increase the frequency of the allele G of the site by generations.
4. The method for genetic improvement of backfat thickness traits of long white pigs according to claim 3, wherein corresponding selection is made according to said SNP molecular markers:
if the SNP molecular marker is the first type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 1, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 1, corresponds to a 668222 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is G or T; selecting individual breeding pigs with GG genotype at 300 th site from 5' end on the SEQ ID No. 1 from the long white pig core group, eliminating individual breeding pigs with TG genotype and TT genotype at the site, and increasing the frequency of allele G of the site by generation;
If the SNP molecular marker is the second type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G; and selecting the pig breeder individuals with GG genotype at the 300 th site from the 5' end on the SEQ ID No. 2 from the long white pig core group, and eliminating the pig breeder individuals with AG genotype and AA genotype at the site so as to increase the frequency of allele G of the site by generations.
5. A method of establishing a long white pig line for improving a growth trait of a pig, comprising: making corresponding selection according to SNP molecular markers of the long white pigs:
If the SNP molecular marker is the first type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No.1, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No.1, corresponds to a 668222 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is G or T; then for pigs with TT genotype, the TT genotype is mutated into TG genotype or GG genotype by means of site-directed mutagenesis;
if the SNP molecular marker is the second type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G; then, for the pig with AA genotype, the AA genotype is mutated into AG genotype or GG genotype by means of site-directed mutagenesis.
6. The method for setting up a long white pig line for improving a pig growth trait according to claim 5, wherein the selection is made according to the SNP molecular markers of the long white pigs:
If the SNP molecular marker is the first type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 1, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 1, corresponds to a 668222 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is G or T; then for the pig with TG genotype or TT genotype, the TG genotype and TT genotype are mutated into GG genotype by means of site-directed mutagenesis;
if the SNP molecular marker is the second type, namely the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No. 2, the SNP molecular marker is positioned at a 300 th site from the 5 'end on the SEQ ID No. 2, corresponds to a 684615 th site from the 5' end on chromosome 3 of the version 11.1 international swine genome, and is A or G; then, for the pig with AG genotype or AA genotype, the AG genotype and AA genotype in the pig are mutated into GG genotype by means of site-directed mutagenesis.
7. The method for creating a long white pig line for improving a pig growth trait according to claim 5, wherein the mutation is performed by a transgenic method or a gene editing method.
8. The method of claim 5, wherein the mutation is performed by gene editing method of CRISPR/Cas 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410091962.6A CN117625813B (en) | 2024-01-23 | 2024-01-23 | Application of SNP molecular marker affecting backfat thickness of long white pig |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410091962.6A CN117625813B (en) | 2024-01-23 | 2024-01-23 | Application of SNP molecular marker affecting backfat thickness of long white pig |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117625813A CN117625813A (en) | 2024-03-01 |
| CN117625813B true CN117625813B (en) | 2024-04-16 |
Family
ID=90035870
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410091962.6A Active CN117625813B (en) | 2024-01-23 | 2024-01-23 | Application of SNP molecular marker affecting backfat thickness of long white pig |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117625813B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101130776A (en) * | 2007-07-20 | 2008-02-27 | 华中农业大学 | Pig carcass character GFAT1 gene clone and its application |
| CN102719523A (en) * | 2011-12-28 | 2012-10-10 | 中山大学 | Molecule labeling method for maker-assisted selection of pig backfat thickness |
| CN104480109A (en) * | 2014-12-31 | 2015-04-01 | 华中农业大学 | Molecular marker related to porcine backfat thickness character |
| KR102081569B1 (en) * | 2018-12-11 | 2020-02-26 | 대한민국 | SNP marker for predicting backfat thickness of pig |
| CN114107516A (en) * | 2020-09-01 | 2022-03-01 | 中国农业科学院农业基因组研究所 | SNP marker for evaluating pig backfat thickness and detection method thereof |
-
2024
- 2024-01-23 CN CN202410091962.6A patent/CN117625813B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101130776A (en) * | 2007-07-20 | 2008-02-27 | 华中农业大学 | Pig carcass character GFAT1 gene clone and its application |
| CN102719523A (en) * | 2011-12-28 | 2012-10-10 | 中山大学 | Molecule labeling method for maker-assisted selection of pig backfat thickness |
| CN104480109A (en) * | 2014-12-31 | 2015-04-01 | 华中农业大学 | Molecular marker related to porcine backfat thickness character |
| KR102081569B1 (en) * | 2018-12-11 | 2020-02-26 | 대한민국 | SNP marker for predicting backfat thickness of pig |
| CN114107516A (en) * | 2020-09-01 | 2022-03-01 | 中国农业科学院农业基因组研究所 | SNP marker for evaluating pig backfat thickness and detection method thereof |
Non-Patent Citations (4)
| Title |
|---|
| Association of genetic variants for FABP3 gene with back fat thickness and intramuscular fat content in pig;K. H. Cho et al.;《Mol Biol Rep 》;20100917;第38卷;2161-2166 * |
| Association of Twelve Candidate Gene Polymorphisms with the Intramuscular Fat Content and Average Backfat Thickness of Chinese Suhuai Pigs;Binbin Wang et al.;《Animals》;20191023;第9卷;1-12 * |
| SNPs IN THE PORCINE PPARGC1A GENE: INTERBREED DIFFERENCES AND THEIR PHENOTYPIC EFFECTS;MONIKA STACHOWIAK et al.;《CELLULAR & MOLECULAR BIOLOGY LETTERS》;20061206;第12卷;231-239 * |
| 分子标记及其在种猪选育中的应用;杨明等;《华南农业大学学报》;20191231;第40卷(第S期);127-131 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117625813A (en) | 2024-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108531608B (en) | BMP6 gene as molecular marker for black goat lambing number character | |
| CN107779516B (en) | It is a kind of influence pig birth weight character SNP marker and its application | |
| CN108676897B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| CN114015789A (en) | Genome selection method for cultivating disease-resistant improved Dongxiang spots | |
| CN110951889A (en) | Haplotype molecular marker related to chicken body weight and application thereof | |
| CN114941033A (en) | Method for breeding local high-quality white-feather chicken high-egg-yield strain based on SNP locus assistance | |
| US20240043912A1 (en) | Genomic selection (gs) breeding chip of huaxi cattle and use thereof | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN107858440A (en) | A kind of SNP marker related to pig birth weight character and application thereof | |
| CN117625813B (en) | Application of SNP molecular marker affecting backfat thickness of long white pig | |
| CN112266965A (en) | Genome selection method for improving genetic progress of residual feed intake of yellow-feathered broilers | |
| CN113355427B (en) | SNP (single nucleotide polymorphism) marker related to pig backfat thickness and utilization method thereof | |
| CN113736890B (en) | SNP molecular marker related to healthy number and living number rate and application thereof | |
| Carmo et al. | Association of MYF5 gene allelic variants with production traits in pigs | |
| CN113736889B (en) | SNP molecular marker related to pig stillbirth number and live litter rate on chromosome 7 and application thereof | |
| CN117487936B (en) | SNP molecular marker affecting eye muscle area of Changbai pig and application thereof | |
| CN114134233B (en) | SNP (Single nucleotide polymorphism) related to age of pigs reaching 100kg day and eye muscle area | |
| CN113699247A (en) | SNP molecular marker on pig No. 1 chromosome and related to pig remaining feed intake and application thereof | |
| CN114085914B (en) | SNP molecular marker located on chromosome 9 of pig and related to litter size and application thereof | |
| CN111354417B (en) | Novel method for estimating aquatic animal genome variety composition based on ADMIXTURE-MCP model | |
| CN114431188B (en) | Breeding method of muscovy ducks | |
| CN110172516B (en) | Method for detecting single nucleotide polymorphism of 5' flanking region of cattle lncFAM200B gene and application thereof | |
| Yao et al. | Whole-Genome Sequencing of Bamei Mutton Sheep for Screening the Genes and SNPs Associated with Litter Size under Selection | |
| CN116042859A (en) | SNP molecular marker related to total nipple number of pigs and application | |
| CN115094149A (en) | SNP marker related to pig backfat thickness as well as detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |