CN116042859A - SNP molecular marker related to total nipple number of pigs and application - Google Patents

SNP molecular marker related to total nipple number of pigs and application Download PDF

Info

Publication number
CN116042859A
CN116042859A CN202310061057.1A CN202310061057A CN116042859A CN 116042859 A CN116042859 A CN 116042859A CN 202310061057 A CN202310061057 A CN 202310061057A CN 116042859 A CN116042859 A CN 116042859A
Authority
CN
China
Prior art keywords
molecular marker
pigs
breeding
pig
genotype
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310061057.1A
Other languages
Chinese (zh)
Inventor
叶勇
李绍云
黄如渠
简运华
李结
杨杰
路鹏云
关翔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong Guangken Animal Husbandry Engineering Research Institute Co ltd
Guangdong Guangken Animal Husbandry Group Co ltd
Original Assignee
Guangdong Guangken Animal Husbandry Engineering Research Institute Co ltd
Guangdong Guangken Animal Husbandry Group Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangdong Guangken Animal Husbandry Engineering Research Institute Co ltd, Guangdong Guangken Animal Husbandry Group Co ltd filed Critical Guangdong Guangken Animal Husbandry Engineering Research Institute Co ltd
Priority to CN202310061057.1A priority Critical patent/CN116042859A/en
Publication of CN116042859A publication Critical patent/CN116042859A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
    • Y02P60/87—Re-use of by-products of food processing for fodder production

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a SNP molecular marker related to total nipple number of pigs and application thereof. Therefore, by applying the molecular marker, a high-efficiency and accurate molecular marker assisted breeding technology can be quickly established, and the molecular marker assisted breeding technology is applied to the genetic improvement for improving the total nipple number of the breeding pigs, so that the reproductive performance of pig groups is improved, the economic profit of enterprises is improved, and the core competitiveness is improved.

Description

SNP molecular marker related to total nipple number of pigs and application
Technical Field
The invention relates to the fields of molecular markers and animal genetic breeding, in particular to SNP molecular markers related to total nipple numbers of pigs and application thereof.
Background
Breast milk is the primary nutrient source for piglets in early stages and provides immune protection for piglets. In recent decades, the breeding goals of breeding pigs on reproductive performance have mainly focused on increasing litter size. Therefore, with the increase of the number of piglets born in the litter, more milk heads are needed for feeding the piglets, and similarly, the smaller milk heads affect the weaning weight of the piglets and increase the death rate of the piglets in the lactation period, and the sufficient nipple number can meet the requirements of the piglets on more production and more activity. Therefore, the nipple number of the sow becomes one of important characters reflecting the reproductive character of the sow, and is an important breeding target in the breeding work of the live pigs. However, in actual production, the breeding of the nipple number of the breeding pigs is mainly performed by phenotypic selection, so that it is necessary to provide a practical SNP marker related to the total nipple number of the pigs, and by using marker-assisted selection and genome selection technologies, the total nipple number of the pigs is increased, and the improvement genetic progress of the reproductive traits of the pigs is improved.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to the total nipple number of pigs and application thereof, so as to solve the problems.
According to a first aspect of the present invention, there is provided a SNP molecular marker related to the total nipple number of pigs and application thereof, wherein the SNP molecular marker is an A > C base mutation located at 97614602bp locus of chromosome 7 of Sscoofa 11.1 version of the International pig genome (the molecular marker may be abbreviated as g.116A > C hereinafter). Therefore, the molecular marker assisted breeding technology can be quickly established, and is applied to the genetic improvement for improving the total nipple number of the breeding pigs, so that the reproductive performance of pig groups is improved, the economic profit of enterprises is improved, and the core competitiveness is improved.
In certain embodiments, the gene sequence upstream and downstream of the SNP molecular marker site is shown in SEQ NO.1, and the SNP molecular marker is located at the A > C base mutation represented by M at the 116 th site of the sequence shown in SEQ ID NO.1 (the molecular marker may be abbreviated as g.116A > C hereinafter).
According to a second aspect of the invention, there is provided the use of a SNP molecular marker in pig total nipple trait breeding, the SNP molecular marker being an A > C base mutation located at the 97614602bp locus of chromosome 7 of version 7 of the international pig genome Sscoffa 11.1 or an A > C base mutation represented by M located at the 116 th locus of the sequence shown in SEQ ID No. 1. Therefore, by applying the SNP molecular marker, the total number of the breasts of a pig group, especially the total number of breasts of a sow, has positive influence on the milk-eating growth and survival rate of the piglet, can greatly improve the reproductive performance of the pig, especially the reproductive performance of the sow and the growth and survival rate of the piglet, and improves the core competitiveness of enterprises and the economic value of the sow.
In certain embodiments, the application comprises the steps of:
1) Detecting a molecular marker g.116A > C for the replacement breeding pigs;
2) Selecting and reserving individuals with the allele type of CC or AC genotype detected in the step 1), and selecting and reserving pigs as the individuals with the AA genotype type, so that pigs with high total nipple number characters can be bred.
According to a third aspect of the present invention there is provided the use of a SNP molecular marker in the breeding of high total emulsion number pig lines, the SNP molecular marker being an A > C base mutation located at the 97614602bp locus of chromosome 7 of version 7 of the International pig genome Sscoffa 11.1 or an A > C base mutation represented by M located at the 116 th locus of the sequence shown in SEQ ID No. 1. Therefore, the pig strain with high total nipple number is obtained through cultivation, and the replacement gilts bred by the strain have high total nipple number characteristics, so that the breeding performance of the replacement gilts can be improved, the survival rate of piglets is improved, and the economic targets of high yield and high activity are realized.
In certain embodiments, the application comprises the steps of:
1) Detecting a molecular marker g.116A > C for the replacement breeding pigs;
2) Selecting and reserving individuals with the allele type of CC or AC genotype detected in the step 1) as reserved pigs, and breeding the reserved boars and sows;
3) Detecting the molecular marker in the claim 1 or 2 for the pigs bred in the step 2), reserving CC or AC genotype individuals, eliminating AA genotype individuals, breeding, and breeding to obtain the high-reproductive-performance pig strain with high total nipple number.
According to a fourth aspect of the present invention there is provided a method of genetic modification of pigs, the method comprising the steps of:
1) Detecting a molecular marker g.116A > C in the reserve breeding pigs;
2) Selecting and reserving the individual of the breeding pigs with the molecular marker genotype of CC or AC in the step 1), and eliminating the individual with the AA genotype;
3) Breeding by taking the individuals screened in the step 2) as the breeding pigs, and continuously selecting and reserving the breeding pig individuals with the molecular marker genotype of CC or AC in the step 1) in offspring, so as to eliminate AA genotype individuals; the frequency of allele C in the offspring pig population is increased by generation, thereby increasing the total number of the offspring pigs.
Therefore, the frequency of allele C in the pig population can be improved by the method, so that the total number of the offspring pigs is increased.
According to a fifth aspect of the present invention, there is provided the use of a SNP molecular marker in the selection of piglets with high total nipple number genetic trait, the SNP molecular marker being an A > C base mutation located at the 97614602bp locus of chromosome 7 of version 7 of the International pig genome Sscoofa 11.1 or an A > C base mutation represented by M located at the 116 th locus of the sequence shown in SEQ ID No. 1. Therefore, piglets with high total number of breasts can be selected as backup sows in the piglet stage, the breeding cost of the backup sows can be saved to the greatest extent, and the enterprise competitiveness is improved.
In certain embodiments, the application comprises the steps of:
1) Detecting a molecular marker g.116A > C in the piglets to be screened;
2) When the genotype of the molecular marker detected in the step 1) is CC or AC, the piglet to be screened has high total nipple number genetic characters and is reserved; when the genotype is AA, the piglet to be screened has low total nipple number genetic character and is eliminated.
According to a sixth aspect of the present invention, there is provided a primer set for detecting SNP molecular markers associated with the total nipple number of pigs, the primer set having the nucleotide sequence as follows:
P001-F：5’-TCTTTCAAGTTTTCCTGGGCAGCTC-3’，
P002-R：5’-AGCCAACTGGTCGGTGGAGAAG-3’。
therefore, the primer pair can be used for efficiently detecting the genotype of the SNP molecular marker related to the total nipple number of the pig and screening out the dominant genotype, and the primer pair can be used for rapidly establishing an efficient and accurate molecular marker assisted breeding technology to rapidly and accurately carry out the improved sexual breeding improvement on the high total nipple number of the breeding pig and accelerate the breeding progress.
According to a seventh aspect of the present invention, there is provided a kit for detecting SNP molecular markers associated with the total number of nipples of pigs, the kit comprising a primer pair having the nucleotide sequence:
P001-F：5’-TCTTTCAAGTTTTCCTGGGCAGCTC-3’，
P002-R：5’-AGCCAACTGGTCGGTGGAGAAG-3’。
according to an eighth aspect of the invention, there is provided an SNP molecular marker related to the total nipple number of pigs or a primer pair or a kit containing the primer pair for detecting the molecular marker in screening the total nipple number trait of pigs, identifying the nipple number trait of pigs, breeding the high nipple number trait variety of pigs, improving the total nipple number trait of pigs and improving the reproductive trait of pigs.
Therefore, the kit can be used for efficiently detecting the genotype of the SNP molecular marker related to the total nipple number of the pig, screening out the dominant genotype, rapidly establishing an efficient and accurate molecular marker assisted breeding technology through the primer pair, rapidly and accurately carrying out the sexual breeding improvement on the high total nipple number of the breeding pig, and accelerating the breeding progress.
The invention has the beneficial effects that:
1. the SNP molecular marker can be used for rapidly establishing a high-efficiency and accurate molecular marker assisted breeding technology, and is applied to the genetic improvement for improving the total nipple number of the breeding pigs, so that the reproductive performance of pig groups is improved, the economic profit of enterprises is improved, and the core competitiveness is improved.
2. The application of the SNP molecular marker in pig total nipple number character breeding is disclosed, the total nipple number of a pig group, especially the total nipple number of a sow, can be improved, the pig reproductive performance, especially the reproductive performance of a sow and the growth and survival rate of the piglet can be greatly improved, and the core competitiveness of enterprises and the economic value of the sow can be improved.
3. The application of SNP molecular markers in the cultivation of high total nipple number pig strains is disclosed, the pig strains with high total nipple number are obtained through cultivation, and the replacement gilts obtained through breeding of the strains all have high total nipple number characteristics, so that the reproductive performance of the replacement gilts can be improved, the survival rate of piglets is improved, and the economic targets of high yield and high activity are realized.
4. A genetic improvement method for pigs is disclosed, by which the frequency of allele C in a pig population can be improved, thereby increasing the total number of emulsion heads in offspring pigs.
5. The application of the SNP molecular marker in screening piglets with high total nipple number genetic characters is disclosed, so that piglets with high total nipple number can be selected as backup sows in the piglet stage, the breeding cost of the backup sows can be saved to the greatest extent, and the enterprise competitiveness is improved.
6. The primer pair can be used for detecting the genotype of the SNP molecular marker related to the total nipple number of the pig, screening out dominant genotypes, quickly establishing a high-efficiency and accurate molecular marker assisted breeding technology, quickly and accurately carrying out improved breeding on the high total nipple number of the breeding pig, and accelerating breeding progress.
7. The kit can be used for efficiently detecting genotypes of SNP molecular markers related to the total nipple numbers of pigs, screening dominant genotypes, rapidly establishing an efficient and accurate molecular marker assisted breeding technology through the primer pair, rapidly and accurately carrying out improved breeding on the high total nipple numbers of breeding pigs, and accelerating breeding progress.
8. Discloses an SNP molecular marker related to the total nipple number of pigs or an application of a primer pair or a kit containing the primer pair for detecting the molecular marker in screening the total nipple number characters of pigs, identifying the nipple number characters of pigs, breeding the high nipple number character varieties of pigs, improving the total nipple characters of pigs and improving the reproductive character inheritance of pigs. Therefore, a high-efficiency and accurate molecular marker assisted breeding technology can be quickly established, the high total nipple number of the breeding pigs is quickly and accurately improved by sexual breeding, and the breeding progress is quickened.
Drawings
FIG. 1 is a complete genome association analysis GWAS Manhattan plot of large white pigs, long white pigs, and Duroc pigs on chromosome 7 for total teat number traits: wherein the abscissa indicates the chromosomal location of the pig; the ordinate represents the-logP value.
Detailed Description
The invention is described in further detail below with reference to the accompanying drawings.
Example 1
(1) Experimental animal
The experimental pig group used in the invention is 1131 head of pure white pig, long white pig and Duroc pig of Guangdong widely-cultivated livestock group stock limited company, and is the core group of the company.
The experiment selects big white pigs, long white pigs and Duroc pigs in the resource group, the pig group can eat and drink water freely, and the whole feeding mode, feeding conditions and the like are kept consistent all the time, thus being a conventional method.
(2) Sample collection
Collecting the pigtail or ear tissue, soaking in 75% ethanol solution, and storing in a refrigerator at-20deg.C.
(3) Pig whole genome 50K SNP judgement
Ear tissue or tail tissue is collected for each individual of the above-mentioned resource population 1131 big white pig, long white pig and Duroc pig, whole genome DNA is extracted by using standard phenol-chloroform method, and the concentration and OD ratio (OD 260/280, OD 260/230) of DNA of each sample are accurately measured by using Nanodrop2000/2000C nucleic acid protein detector. And detecting a qualified DNA sample by a Nanodrop2000/2000C nucleic acid protein detector, and diluting the DNA to about 50 ng/. Mu.L according to the detected concentration. And mixing 6 mu L of the extracted DNA sample to be detected with 2 mu L of Loading Buffer, loading the mixture into agarose gel with the mass-volume ratio of 1%, carrying out electrophoresis for 25min at 150V, and observing and photographing under an ultraviolet spectrophotometer and gel imaging equipment to observe the integrity of the DNA.
The DNA samples were sent to Beijing Kang Pusen Biotechnology Co., ltd. For genotyping of the pig genome-wide 50k SNP chip (Medium core one seed chip, beijing Kang Pusen Biotechnology Co., ltd.). Quality control is carried out on all sample SNP chip scanning typing data by using a checkmarker in an R language GenABEL package, and the detection individual rate is lower than 90%, the family Mendelian error rate is higher than 0.1, the minimum allele frequency is lower than 0.05 and the Hady-Wenberg equilibrium significance level is higher than 10 -6 The effective genotype data of 24435 SNPs was finally obtained.
(4) Whole genome association (GWAS) analysis
In order to eliminate the group layering effect, the invention calculates the principal component characteristic quantity of all individuals based on the whole genome sequence information by adopting gcta software, and adopts the first 5 principal components as covariates to correct the influence of potential group layering on the result. The invention adopts a linear mixed model in GEMMA software to carry out GWAS analysis of the total nipple number character. Determining a significance threshold of the association degree of the SNP and the total nipple number trait by adopting a Bonferrini method, wherein the genome level significance threshold is 0.05 divided by the effective SNP locus number, namely the genome significance level threshold is 2.05E-06, namely 0.05/24435 (effective SNP number); the chromosome level significance threshold was 1 divided by the number of effective SNP sites, i.e., the chromosome level significance threshold was 4.09E-05, i.e., 1/24435 (number of effective SNPs).
The GWAS analysis results are shown in fig. 1. As can be seen from FIG. 1, there is a site on chromosome 7 of the large white pig, the long white pig and the Duroc pig group, which significantly affects the total number of milk heads (the site is located at the A > C mutation of chromosome 97614602bp of the 7 th version of the International pig genome Sscoofa 11.1), the upstream and downstream gene sequences of the significantly associated SNP site are shown as SEQ ID No.1, wherein the SNP site is located at the A > C mutation represented by M at the 116 th site of the sequence shown as SEQ ID No.1, the molecular marker is abbreviated as g.116A > C (the P value is 2.42 e-15), and the upstream and downstream gene sequences of the SNP site are shown as SEQ ID No. 1:
TCTTTCAAGTTTTCCTGGGCAGCTCGGGAATCTGAGCTAGGTCAG GGCGCTTTCACACCCCCAGCTGGGTAGAGTGGACGAGACAATAGCTG CTATCACTTTACCATTGGAAGTGM(A>C)CCCCCGAATTTGCACTTCTT TCATCTCGGGACTGCAGCACTTGAGGGTGGGCGATTTCCTGGGGGGA GTGGCTTAAGCCGCTTCTCCACCGACCAGTTGGCT
note that: m marked in the sequence table is a mutation site, the M site is a T > C mutation, the mutation site is shown by bold font (mutant bases, namely allelic mutation in brackets), and the position of a designed primer sequence is shown in an underlined and italic mode at the head and the tail of the sequence.
(5) Correlation analysis of different genotypes and backfat phenotype
According to Table 1, the molecular marker g.116A > C is extremely obviously related to the total nipple number character (P < 0.001), which shows that the molecular marker obviously affects the total nipple number of pigs, and the total nipple number of the population can be improved through selecting the SNP locus of the pigs, so that the breeding process is accelerated. In addition, individuals with genotype CC type were found to be higher than the total nipple numbers of AA type and AC type in Table 1. The average of the phenotype of individuals of type CC was 1.40 and 0.89 higher than the average of the phenotype of individuals of type AA and AC, respectively. In addition, the distribution in the three genotype total number of taps phenotype was shown to have very significant differences (P < 0.01) based on the analysis of variance with both phenotypes. Therefore, the breeding pigs with CC genotypes are gradually reserved in breeding, so that the frequency of the allele C of the locus is increased by generations, the total number of the milk heads of the breeding pigs can be obviously increased, and more economic benefits are brought to breeding enterprises.
TABLE 1 statistical analysis of the characteristics of the total papilla number at the 97614602 mutation site of the molecular marker chromosome 7
Figure BDA0004061231970000061
Note that: * Representing extremely significant differences
Example 2 amplification and sequencing of the DNA sequence of interest
(1) Primer design
The DNA sequence of SEQ ID NO.1 on chromosome 7 of pigs was downloaded via Ensembl website (http:// asia. Ensembl. Org/index. Html) and primers were designed using primer design software Oligo 7. The DNA sequence of the designed primer is as follows:
P001-F：5’-TCTTTCAAGTTTTCCTGGGCAGCTC-3’(SEQ ID NO:2)，
P002-R：5’-AGCCAACTGGTCGGTGGAGAAG-3’(SEQ ID NO:3)；
(2) PCR amplification
1. Mu.L of DNA template, 3.4. Mu.L of double distilled water, 2X Tag PCR StanMix with Loading Dye. Mu.L, and 0.3. Mu.L of each of the primers P001-F and P002-R were added to 10. Mu.L of the reaction system. The PCR reaction conditions were: after pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 57.6℃for 30s, elongation at 72℃for 45s,35 cycles, and elongation at 72℃for 5min.
(3) DNA sequencing
Sequencing and identifying DNA sequences: the gene fragment was tested for both positive and negative responses in Shenzhen Dacron Gene technology Co. And comparing the detected sequence with NCBI genome sequence to obtain mutation of corresponding SNP locus, and sequencing the sequence to be identical with SEQ ID NO.1 sequence.
Example 3 analysis of the Effect of molecular markers g.116A > C
As can be seen from Table 1, the dominant allele type CC of the molecular marker g.116A > C can increase the nipple number by 1.40 compared with the minor allele type AA. Therefore, the CC type pigs in the group are gradually selected and reserved through molecular marker assisted selection or genome selection, so that the frequency of the dominant allele C allele can be obviously increased, the improvement of the total nipple number of the breeding pigs is facilitated, the breeding improvement process of the pigs is accelerated, and finally the economic benefit of breeding of the breeding pigs is effectively improved.
Example 4 application of molecular marker g.116A > C in pig total nipple number character breeding
1) Detecting a molecular marker g.116A > C for the replacement breeding pigs;
2) Selecting and reserving individuals with the allele type of CC or AC genotype detected in the step 1), and selecting and reserving pigs as the individuals with the AA genotype type, so that pigs with high total nipple number characters can be bred.
Example 5 application of molecular marker g.116A > C in breeding high total emulsion number pig line
1) Detecting a molecular marker g.116A > C for the replacement breeding pigs;
2) Selecting and reserving individuals with the allele type of CC or AC genotype detected in the step 1) as reserved pigs, and breeding the reserved boars and sows;
3) Detecting the molecular marker in the claim 1 or 2 for the pigs bred in the step 2), reserving CC or AC genotype individuals, eliminating AA genotype individuals, breeding, and breeding to obtain the high-reproductive-performance pig strain with high total nipple number.
Example 6A method for genetic modification of pigs
1) Detecting a molecular marker g.116A > C in the reserve breeding pigs;
2) Selecting and reserving the individual of the breeding pigs with the molecular marker genotype of CC or AC in the step 1), and eliminating the individual with the AA genotype;
3) Breeding by taking the individuals screened in the step 2) as the breeding pigs, and continuously selecting and reserving the breeding pig individuals with the molecular marker genotype of CC or AC in the step 1) in offspring, so as to eliminate AA genotype individuals; the frequency of allele C in the offspring pig population is increased by generation, thereby increasing the total number of the offspring pigs.
Example 7 application of molecular marker g.116A > C in screening piglets with high total nipple genetic character
1) Detecting a molecular marker g.116A > C in the piglets to be screened;
2) When the genotype of the molecular marker detected in the step 1) is CC or AC, the piglet to be screened has high total nipple number genetic characters and is reserved; when the genotype is AA, the piglet to be screened has low total nipple number genetic character and is eliminated.
What has been described above is merely some embodiments of the present invention. It will be apparent to those skilled in the art that various modifications and improvements can be made without departing from the spirit of the invention.

Claims (10)

1. A SNP molecular marker related to total nipple number of pigs and application thereof, wherein the SNP molecular marker is A > C base mutation at 97614602bp locus of chromosome 7 of Sscoofa 11.1 version of the international pig genome.
2. The SNP molecular marker according to claim 1, wherein the gene sequence upstream and downstream of the SNP molecular marker site is shown as SEQ NO.1, and the SNP molecular marker is located at the A > C base mutation represented by M at the 116 th site of the sequence shown as SEQ ID NO. 1.
3. The use of the SNP molecular marker as set forth in claim 1 or 2 in pig total nipple trait breeding.
4. The application of claim 3, wherein the application comprises the steps of:
1) Detecting the molecular marker of claim 1 or 2 in a replacement stock;
2) Selecting and reserving individuals with the allele type of CC or AC genotype detected in the step 1), and selecting and reserving pigs as the individuals with the AA genotype type, so that pigs with high total nipple number characters can be bred.
5. Use of the SNP molecular marker of claim 1 or 2 for breeding high total teat number swine lines, the use comprising the steps of:
1) Detecting the molecular marker of claim 1 or 2 in a replacement stock;
2) Selecting and reserving individuals with the allele type of CC or AC genotype detected in the step 1) as reserved pigs, and breeding the reserved boars and sows;
3) Detecting the molecular marker in the claim 1 or 2 for the pigs bred in the step 2), reserving CC or AC genotype individuals, eliminating AA genotype individuals, breeding, and breeding to obtain the high-reproductive-performance pig strain with high total nipple number.
6. A method of genetic modification of a pig, wherein the method comprises the steps of:
1) Detecting the molecular marker as described in claim 1 or 2 in a replacement stock;
2) Selecting and reserving the individual of the breeding pigs with the molecular marker genotype of CC or AC in the step 1), and eliminating the individual with the AA genotype;
3) Breeding by taking the individuals screened in the step 2) as the breeding pigs, and continuously selecting and reserving the breeding pig individuals with the molecular marker genotype of CC or AC in the step 1) in offspring, so as to eliminate AA genotype individuals; the frequency of allele C in the offspring pig population is increased by generation, thereby increasing the total number of the offspring pigs.
7. Use of the SNP molecular marker as set forth in claim 1 or 2 for screening piglets with high total nipple genetic trait, wherein the use comprises the steps of:
1) Detecting the molecular marker as claimed in claim 1 or 2 in the piglets to be screened;
2) When the genotype of the molecular marker detected in the step 1) is CC or AC, the piglet to be screened has high total nipple number genetic characters and is reserved; when the genotype is AA, the piglet to be screened has low total nipple number genetic character and is eliminated.
8. A primer pair for detecting the SNP molecular marker as set forth in claim 1 or 2, wherein the primer pair nucleotide sequence is as follows:
P001-F：5’-TCTTTCAAGTTTTCCTGGGCAGCTC-3’，
P002-R：5’-AGCCAACTGGTCGGTGGAGAAG-3’。
9. a kit for detecting the SNP molecular marker as set forth in claim 1 or 2, wherein the kit contains the primer pair as set forth in claim 8.
10. Use of the molecular marker of claim 1 or 2 or the primer pair of claim 8 or the kit of claim 9 for screening a pig total teat number trait, identifying a pig teat number trait, breeding a pig high teat number trait variety, increasing a pig total teat trait, and genetically improving a pig reproductive trait.
CN202310061057.1A 2023-01-17 2023-01-17 SNP molecular marker related to total nipple number of pigs and application Pending CN116042859A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310061057.1A CN116042859A (en) 2023-01-17 2023-01-17 SNP molecular marker related to total nipple number of pigs and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310061057.1A CN116042859A (en) 2023-01-17 2023-01-17 SNP molecular marker related to total nipple number of pigs and application

Publications (1)

Publication Number Publication Date
CN116042859A true CN116042859A (en) 2023-05-02

Family

ID=86129298

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310061057.1A Pending CN116042859A (en) 2023-01-17 2023-01-17 SNP molecular marker related to total nipple number of pigs and application

Country Status (1)

Country Link
CN (1) CN116042859A (en)

Similar Documents

Publication Publication Date Title
CN108676897B (en) SNP marker influencing daily gain traits of pigs and application thereof
CN110541038A (en) SNP molecular marker located on pig No.1 chromosome and related to daily gain of pig and application
CN108913779B (en) SNP marker influencing daily gain traits of pigs and application thereof
CN110144408B (en) SNP molecular marker located on pig chromosome 7 and related to total papilla number and application
CN110468212B (en) SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application
CN113564264B (en) SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirth and litter size of sow and application thereof
CN112899376B (en) Method for detecting economic traits of Tibetan chicken by FOXO1 gene SNP marker and application thereof
CN112941198B (en) SNP marker for detecting pig eye muscle area and application thereof
CN113736890B (en) SNP molecular marker related to healthy number and living number rate and application thereof
CN116286804A (en) SNP molecular marker related to pig correction of backfat thickness of 115 kg body weight and application
CN112760387B (en) SNP molecular marker related to total nipple number of pigs and application
CN113637768B (en) SNP molecular marker related to number of sow-produced malformed piglets on chromosome 13 of pig and application thereof
CN113736889B (en) SNP molecular marker related to pig stillbirth number and live litter rate on chromosome 7 and application thereof
CN112481385A (en) SNP marker for detecting pig backfat thickness and application thereof
CN110438238B (en) SNP (single nucleotide polymorphism) site related to premna ungula weight on chromosome 6 of meat Simmental cattle and application
CN115011704A (en) SNP molecular marker influencing litter interval traits and application thereof
CN114085914B (en) SNP molecular marker located on chromosome 9 of pig and related to litter size and application thereof
CN116042859A (en) SNP molecular marker related to total nipple number of pigs and application
CN113584185A (en) SNP molecular marker located on pig chromosome 12 and related to piglet malformation number and application thereof
CN112592984B (en) SNP molecular marker affecting swine nipple number character and application thereof
CN116445474A (en) SNP molecular marker related to pig total litter size and application
CN116287305A (en) SNP molecular marker related to age of pigs reaching 115 kg body weight in days and application
CN111808974B (en) SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application
CN112266968B (en) Copy number variation molecular marker influencing weight age in days and daily gain on pig chromosome 13 and application
CN111705137B (en) SNP (Single nucleotide polymorphism) locus related to live weight of Chinese cattle and cattle before slaughter and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination