CN100469876C - Method for procducing great cattles through transgene cloning ferritin gene of human milk - Google Patents

Abstract

This invention relates to a method for transgenetic cloning of large domestic animals from hLF BAC DNA. The method comprises: (1) utilizing hLF BAC DNA as gland special expression carrier; (2) mixing hLF BAC DNA and pEGFP-NEO or pNEO at a certain ratio, introducing into nucleus of domestic animals for cell transfection, and obtaining hLF BAC DNA transgenetic cell; (3) cloning with the cell as the nucleus donor to obtain transgenetic clone animals containing hLF BAC DNA. The transgenetic mile cow gland expressed hLF BAC DNA can be used to produce health products and drugs, and the milk can be used to produce health milk and milk products with high added values.

Description

Change the production method of the zooblast of human lactoferrin gene

Technical field

The present invention relates to bioengineering field, particularly relate to transgenosis-clone technology field.

Background technology

Study on Transgenic Animal be human according to own wish have purpose, planned, with good grounds, the genetic composition of pre-insight change animal is arranged, and the purpose that changes its genetic composition is diversified.Wish that such as the geneticist observing its phenotype by the genetic composition that changes animal changes, the physiologist wishes to study by the expression of specific gene the influence of this gene pairs organism physiology situation.Producing relevant transgenic research with animal then wishes to give animal new phenotypic character by transgenic technology.The research relies on molecular biology, animal embryo and gamete operative technique on experimental technique.

The making method of transgenic animal mainly contains the microinjection of pronuclear-stage embryos at present, retroviral infection is grown early stage animal embryo, the sperm vector method, the ES cell technology, the PGCs technology, somatic cell nuclear transfer technique, retroviral vector infects the ovocyte of MII phase, and sperm head and DNA merge injection ovocyte method.Improvement on these methods has promoted the process that Study on Transgenic Animal is transformed to production practice by the laboratory widely with raising.

Wherein traditional and the most the most frequently used method is the microinjection of pronuclear-stage embryos, and this method is one of method of using at present the making transgenic animal relatively more extensive, that effect is more stable by American Gordon invention.Promptly under the micrurgy instrument, foreign DNA is injected in the protokaryon of fertilised non-human eggs cell by a glass capillary, again this fertilized egg cell is transplanted into recipient cell intrauterine, when zygote is divided, foreign DNA may be integrated into the host chromosome group, treats that this development of fertilized ova maturation can obtain transgenic animal.But the efficient of the breeding transgenic livestock that microinjection obtains is extremely low, ox particularly, and sheep and pig etc. often are lower than 1%, and this will increase the cost of making breeding transgenic livestock greatly.

Along with the development of somatic cell clone technique, it is to become transgenic animal that gene manipulation techniques combines with clone technology, particularly the main mode of big Livestock Production.At present, the major progress that obtains is transgenic technology and the application of target position operative technique on cloned animal.At first, utilize the clone to carry out transgenosis and be meant before nuclear transplantation, earlier the fusion gene of goal gene and marker gene is imported the somatocyte of cultivating, screen genetically modified positive cell and clone thereof by the performance of marker gene again, and then transplant.1997, the scientist Schnieke of Britain PPL company and the Wilmut of Roslyn institute etc. were jointly by the somatic cell nuclear transfer technique Transgenic Sheep that takes the lead in having made in the world.Utilize fetal fibroblast system,, clone again through after the transfection.Transfected foreign gene contains the complete coding region and the β-BLG gene promoter of people's plasma thromboplastin component gene, and plasma thromboplastin component can be efficiently expressed, and comprises the plasma thromboplastin component albumen of 125 μ g in every milliliter of milk.Utilize the clone to carry out transgenosis, in case the nuclear transplantation success, theoretically, the transgenosis success ratio is 100%.The method of procaryotic injection can make a large amount of non-transgenic embryos by pregnancy, and this is a kind of wasting of resources, can not cause the surrogate mother to go conceived non-transgenic animal and utilize the clone to carry out transgenic technology.In addition, when utilizing the clone to carry out transgenosis, the sex of transgenic animal can be determined in advance.Like this, if expect can be in mammary gland marking protein, the transgenic animal that just can make the clone are jenny entirely.

Because the animal transgenic technology can change the production traits of animal according to people's wish, obtain the needed product of people, particularly some albumen medicine and healthcare products, scientists has begun the animal transgenic technology is applied in the middle of the practice, at present the animal transgenic technology mainly contains following application: (1), promote growth of animal, improve the output of live-stock product, improve product quality, (2), animal disease resistant breeding, (3) set up the animal model of diagnosing and treating human diseases, (4) produce pharmaceutical protein.

Animal mammary gland bioreactor is a kind of animal transgenic technology proteic technology such as express polypeptide medicine, industrial enzyme, vaccine and antibody in mammary gland cell of utilizing.The function of transforming mammary gland by engineered method helps the mechanism that we further study mammary cancer, improves the nutritive ingredient of milk, even can synthetic drugs.This technology has the low characteristics that drop into high production, and its efficient is 100 times that utilize with intestinal bacteria and animal cell culture technology, is a kind of very potential new and high technology.1987, people such as Simons successfully expressed sheep lactoglobulin gene first in transgenic mouse milk, and the protein content in the mouse milk sample approximately is that animal cell expression is proteic more than 400 times up to 23 grams per liters.This technology is once swift and violent development occurring just obtaining.At present, cow's milk albumin gene people organizes the profibr(in)olysin factor, and human growth hormone gene, human body antitrypsin gene, genes such as human urokinase gene and human interferon gene all obtain expressing in the mammary gland of mouse.Various famous scientists thinks that this will be the unprecedented revolution of livestock industry, may bring huge economic benefit to society.

Utilize the method for galactophore biological reactor to transform milk cow, milk goat, make the milk composition of producing be similar to people's milk, both nutritious function, medicinal function is arranged again, this milk can make child look tall and big, promote brain and neurodevelopment, raise immunity, this new health care product necessarily has wide future.The nutrition or the physiological and biochemical property that improve milk also are that people wish one of target that realizes by the genetic composition that changes animal, promptly make so-called nutritional medicine (Nutraceuticals).Domestic animal milk and converted products thereof can provide human 30% nutrient protein, contain abundant indispensable amino acid, calcium and inorganic phosphate, and the very high casein of digestibility, are human high-quality source of nutrition; But breast is also not fully up to expectations on quality with domestic animal milk.Therefore, people are studying always and how to improve milk quality.Since Gordon foundes the animal transgenic technology, all try to be the first and carry out transgenic breeding and correlation technique research thereof in countries in the world.Studies show that foreign gene can not only obtain integrating and express in transgenic animal, and can obtain tissue specificity (mammary tissue, uterine tube) and development-specific expression, and can utilize molecular engineering to find all genes of regulating milk-content now.

Human lactoferrin (Human lactoferrin is a kind of glycosylated protein that belongs to iron-binding protein family HLF), finds first by Sorensen, and by Blanc and Isliker name.Lactoferrin can reversibility ground in conjunction with two iron ions, its ionic bond intensity is 300 times of transferrin (in vivo iron being played the major protein of transportation effect).Human lactoferrin is made up of 692 amino acid, and molecular weight is about 80,000Da.Lactoferrin extensively is present in the secondary granule of mammiferous body fluid and neutrophilic granulocyte, and the physiological function that lactoferrin has mainly comprises: the antibacterial of wide spectrum, anti-inflammatory function and immune physiological regulation function.These functions are directly obtained iron ion by lactoferrin or are combined in cell surface and make the somatic cells permeability increase realization.Lactoferrin can be in conjunction with the iron ion in zone that is inflamed, thereby stops the free iron ion to participate in the deleterious oxidizing reaction of catalysis.Lactoferrin also can influence the amplified reaction of T cell simultaneously.Some studies show that lactoferrin anti-microbial effect in vivo is more than external strong.This may be owing to exist antibacterial and potential immunoloregulation function district on the lactoferrin.In vivo, lactoferrin is brought into play antibiotic and immunoregulation effect by combining with intravital cell.

Lactoferrin has widely biologic activity, and it mainly shows: (1) .. is to the effect of baby's iron metabolism.Some description of test lactoferrins can promote baby's iron to absorb, and find then that in rhesus monkey and people's experiment absorption does not have obvious facilitation to lactoferrin to iron.(2). anti-microbial effect.Lactoferrin is the intravital a kind of wide spectrum antimicrobial proteins of people, to pathogenic bacterium, and fungi, protozoon, virus all has lethal effect.(3). the effect in inflammatory reaction.Lactoferrin can be regulated inflammatory reaction by multiple different approach.A. regulate the complement activation approach.Lactoferrin can be blocked the C3 conversion enzyme in the classical pathway, makes complement factor C3 deposition, thereby stops the erythrocyte splitting of complement-mediated.B. the deferrization lactoferrin can be consumingly in conjunction with free iron, thereby limited the generation of active oxygen radical, and further suppressed the infringement of active oxygen radical pair cell, stops the peroxidation of cytolemma lipid.C. lactoferrin can mobilize the polymorphic nucleus monocyte to migrate to inflammation part fast.D. lactoferrin can influence the generation of the various kinds of cell factor, and these cytokines are being brought into play epochmaking effect in inflammatory reaction.Experiment in vitro shows that lactoferrin can suppress lipopolysaccharide-induced monocyte and produce IL-1, IL-6 and TNF-α, and the minimizing of IL-1 has caused the minimizing of GM-CSF, has further suppressed the generation of medullary cell.In addition, lactoferrin can strengthen the secretion of human polymorphonuclear leukocyte to IL-8.E. lactoferrin can with combined with lipopolysaccharide.Its combining site is positioned at the contiguous zone of N end 1-5 and two locus of 28-34.Lactoferrin combines lipopolysaccharides with the lipopolysaccharide binding protein competition, has therefore reduced the lipopolysaccharides of lipopolysaccharide binding protein mediation and combining of CD14, plays the effect of regulating inflammatory reaction.(4). other effect.In the brain of suffering from the Parkinsonism mouse, the enhancing that detects lactoferrin is expressed, and lactoferrin certain effect of performance in body defence Parkinsonism is described.This external many autoimmune diseases patient has detected the antibody of lactoferrin on one's body, as rheumatoid arthritis, vasculitis, systemic lupus, elementary sclerosis vasculitis, illustrates that lactoferrin tool in these treatment of diseases and diagnosis has certain effect.Recently, there is the people to find that also lactoferrin can suppress the growth and the transfer of tumour cell.

The multi-functional attribute of human lactoferrin has caused the research of people to its encoding gene, so that on this basis this albumen is carried out scale operation.People such as people such as M.J.Powell and M.W.Rey have delivered the cDNA sequence and the portion gene group sequence of human lactoferrin first respectively in nineteen ninety.Studies show that afterwards, human lactoferrin are positioned at the position of people's No. three karyomit(e) q21-q23, and the about 35kb of total length has 17 exons and forms, and the size of intron is between 300bp-3.3kb.Based on the research of human lactoferrin gene, many investigators begin to be devoted to the genetically modified research of human lactoferrin, to understand by the possibility of genetically modified mode mass production restructuring lactoferrin and the character of restructuring lactoferrin.The final purpose of human lactoferrin transgenic research is to produce restructuring lactoferrin identical or close with human lactoferrin on a large amount of functions by transgenic technology, makes it to benefit for the mankind.

The past people were the host with fungi, yeast, plant, animal cell line, animal once, had carried out the human lactoferrin transgenic research.Following table has been summarized the situation of this aspect research.

The overview of table 1 human lactoferrin transgenic research

Table?1?The?outline?of?the?HLF?transgenic?study

In the research in the past, human lactoferrin cDNA once was widely used in all kinds of transgenic researches.This mainly is because human lactoferrin cDNA than the easier acquisition of genom sequence gene, because the cDNA sequence is shorter, also is easier to be built in the expression vector go.Simultaneously, cDNA can be used for procaryotic expression, and it is used in the transgenic research earlier.Reported first in 1993 such as Qianwa Ling the research in yeast, expressed of restructuring lactoferrin.In this research, human lactoferrin and yeast sucrase signal sequence district are used to guide the secretion of restructuring lactoferrin respectively.The yeast that contains yeast sucrase signal sequence has higher restructuring lactoferrin expression amount, and the yeast that the contains the human lactoferrin signal sequence then expression amount of restructuring lactoferrin is very low.In fungi, the Aspergillus bacterial classification is secreted glycosylated protein under field conditions (factors), and this attribute makes it become a kind of host of ideal express recombinant glycosylated protein, and it has been used for commercially producing of glycosylated protein now.Useful human lactoferrin gene transforms the report of Aspergillus nidulans and Aspergillus awamori.In these two researchs, the promotor of the gene of high expression level is used to guide the expression of restructuring lactoferrin in the host.In Aspergillus awamori, human lactoferrin cDNA and link together at the glucoamylase gene that Aspergillus awamori efficiently expresses middlely separates with the KEX-2 cleavage site.Through translation, fusion rotein cuts with KEX-2, forms independent restructuring lactoferrin.In this research, in the transformant of express recombinant human lactoferrin, introduce sudden change, can obtain the expression amount (2,000 μ g/ml) of higher restructuring lactoferrin.This expression amount be up to now in the human lactoferrin transgenic research of yeast, fungi, clone the restructuring lactoferrin expression amount the highest.This may be because adopted the method that merges to carry out transfection also the cause of Aspergillus awamori as transformed host.According to the result of former studies, the expression level of reorganization human lactoferrin in yeast, fungi, clone in the used host of transgenosis, promotor and the remarkably influenced of secretion signal region sequence.Owing to the effect of human lactoferrin antimicrobial, influenced the normal growth of some yeast and fungi, after cultivation, do not reach higher concentration, their growth is suppressed by the excretory restructuring lactoferrin.Like this, select the insensitive bacterium of restructuring lactoferrin bacteriostatic action is just seemed very important.When the promotor of transgenosis host's autogene and signaling zone sequence are used for transgenic research, tend to obtain the expression level of higher external secretion restructuring lactoferrin.Up to the present, the full gene of lactoferrin of also having no talent carries out the report of transgenic research in fungi and clone.Also has the further leeway of research in this respect.

1993, reported first such as Gerard J.Platenburg the human lactoferrin gene transgenic mice obtained success.The research in early stage this field only is confined to human lactoferrin cDNA.Discovering afterwards, the amount of transgenic mice excretory restructuring lactoferrin that carries human lactoferrin gene group complete sequence is far above the amount that carries human lactoferrin cDNA.The lactoferrin cDNA that choose respectively such as Jan H.Nuijens in 1997 are connected with the ALPHAs1-casein gene promoter with human lactoferrin whole genome sequence fragment and are built into the mammary tissue specific expression vector.The result shows that the expression scope of cDNA transgenic mice restructuring lactoferrin is 400-1,300 μ g/ml, and be 300-3 in the transgenic mice of the full gene fragment of genome, 800 μ g/ml.In the transgenic experiments that Sun Jung Kim in 1999 etc. carry out, show, use at the same time under the situation of Beta-casein as promotor, the lactation amount that contains the segmental transgenic mice of human lactoferrin gene complete sequence reaches as high as 6,600 μ g/ml, and the expression amount of the restructuring lactoferrin of the transgenic mice that obtains with cDNA is no more than 30 μ g/ml.In some cases, can obtain higher Recombinant Protein Expression amount as transgenic line with cDNA.CDNA[51 as human body protein C], people IGF-1 cDNA and people EPO cDNA etc.But under the other situation, can not get the high expression level amount with the cDNA transgenosis.For this reason, have research adopted the pattern attached component (matrix attachment elements, MARs), locuscontrol region territory (locus control regions, LCRs), or yac clone etc. overcomes position effect, to obtain the recombinant exogenous protein of high expression level amount.Work in the past shows, has in the intron of some genes to exist controlling element forward or negative sense, regulating and control expression of gene.Human lactoferrin is genetically modified to be studies show that, exists important controlling element in human lactoferrin gene inside, the expression of human lactoferrin is being brought into play the regulating and controlling effect of forward.Still need now and further study with controlling element in investigator's lactoferrin intron having expressed the mechanism of regulating and controlling effect.In the past, genetically modified research mainly is confined on the mouse to mammiferous human lactoferrin, relates to big domestic animal is rare.The transgenic research that big domestic animal such as ox, sheep is carried out human lactoferrin will be next step developing direction.

Summary of the invention

The present invention is directed to the blank of above-mentioned prior art, plan genetic engineering technique, the cell transfecting technology combines with somatic cell clone technique, employing contains the BAC sequence that is about 150kb of whole person's bovine lactoferrin gene as transgenic structure, the production method of the zooblast that changes human lactoferrin gene is provided, the further cloning great cattle of the transgenetic animal cell that obtains is in order to the restructuring lactoferrin of scale operation biologically active.

Change the production method of the zooblast of human lactoferrin gene, its operation steps is as follows: (1) utilizes and contains the hLF BAC DNA of whole person's bovine lactoferrin gene as mammary gland-specific expression vector, (2) select carrier pNEO to be mixed in proportion hLF BAC DNA and double alternative carrier pEGFP-NEO or single mark, import in the animal somatic cell nuclear, carry out cell transfecting, acquisition changes the transgenic cell of hLF BAC DNA over to, wherein, described heavy livestock is meant ox, goat, sheep, pig or rabbit, the structure of described hLF BAC DNA as shown in Figure 1, the structure of pEGFP-NEO as shown in Figure 2, the structure of pNEO is as shown in Figure 3.

Described introduction method is the micro-injection altogether of somatocyte, and its operation steps is as follows: (1) selects carrier to mix by a certain percentage with double alternative carrier or single mark hLF BAC DNA; (2) with microinjection instrument the DNA mixed solution is expelled in the heavy livestock somatic cell nuclear; (3) utilize marker gene and pcr amplification method to filter out positive cell.

The micro-injecting method altogether of described somatocyte, it is 1:3 that described hLF BAC DNA and double alternative carrier or single mark are selected carrier blended mol ratio.

Described heavy livestock is an ox.

Utilization of the present invention contains the HLF BAC that the is about 150kb (5 ' control region that comprises about 90kb of human lactoferrin gene, 3 ' the control region of the coding region of about 28.9kb and about 31kb) as transgenic structure, obtain to change the transgenic mice that total length HLF BAC DNA is arranged by zygote protokaryon embryo microinjection, restructuring lactoferrin is at every heavy stably express that all detects of the female mouse mammary gland of the positive, expression amount is 0.5-7.8g/l, show and utilize complete human lactoferrin gene expression system can in other mammal galactophore, obtain efficient special expression, also show with the disconnected DNA of lengthy motion picture and can reduce the influence of position effect transgene expression.

Cell transfecting for large fragment DNA (more than the 100kb) rarely has bibliographical information both at home and abroad, and the present invention has also attempted a lot of methods, but because goal gene is oversize, adopts electric-shocking method and other cell transfecting method to carry out cell transfecting and be difficult to obtain positive cell.The HLF BAC DNA that the present invention will obtain efficiently expressing in mouse mammary gland and double alternative carrier pEGFP-NEO or single mark select carrier pNEO in molar ratio example (1:3) mix, carry out cell transfecting, import in the animal somatic cell genome by micro-injection altogether, screen the acquisition positive cell by G418.Positive cell mono-clonal is again cultivated and amplification, and the transgenic cell that detects the HLF BAC NDA that 150kb is arranged through PCR just can carry out somatic cell clone, obtains the transgene clone ox.Detect through PCR and Southern, obtain the transgene clone ox that change at two the HLF BAC that contains the total length human lactoferrin gene altogether.Transgenic cattle is wherein carried out the expression of recombinant proteins analysis, show that the restructuring lactoferrin expression amount reaches 3.4 grams per liters, and have natural bioactive.The restructuring lactoferrin of these transgenosis cow mammary gland specifically expressings can be developed to healthcare products and medicine, and the milk that contains restructuring lactoferrin also can directly be developed to the nourishing milk and the milk preparation of high added value.

The present invention explores and perfect cell transfecting technology and somatic cell clone technique combine produces the approach of the transgenic animal of carrying the pulsating external source functional gene of complete length, and transgenic animal have greatly been improved, the make efficiency of the big domestic animal of transgenosis particularly, technological line used in the present invention are suitable for utilizing the disconnected DNA of this lengthy motion picture to carry out the underlying group production of transgenic cattle, goat, sheep, pig and rabbit and expand numerous as transgenic structure.

Description of drawings

Fig. 1: HLF BAC structure iron, 5 ' control region is about 90kb, and 3 ' control region is about 31kb, and the HLF coding region is about 28.9kb, contains 17 exons.

Fig. 2: the structure iron of double alternative carrier pEGFP-NEO

EGFP is for strengthening green fluorescence protein gene, and NEO is a neomycin resistance gene, and IRES is a ribosome bind site, and SalI, NotI, AscI and BamHI are restriction enzyme site, and CMV-IE Enhancer is the CMV-IE enhanser, and pEF321 is the EF321 promotor.

Fig. 3: single mark is selected the structure iron of carrier pNEO

NEO is a neomycin resistance gene, SalI, and NotI, AscI and BamHI are restriction enzyme site, and pPGK is the PGK promotor, and Amp is an ammonia benzyl resistant gene.

Fig. 4: the PCR of hLF transgene clone ox detects

M:100bp marker, A: be hLF5 ' primer, B: be the hLF primer, C:hLF3 ' primer .1 is the iron baby, 2 is auspicious baby, 3 positive contrasts, 4 negative contrasts, 5 is blank.

Fig. 5: the Southern result of hLF transgene clone ox.1: the iron baby; 2: auspicious baby; 3: negative control; 4-6: the positive control that is respectively 1,5 and 10 copy.

Fig. 6: subtracting property of human lactoferrin transgene clone cow's milk sample PAGE result.Swimming lane 1: albumen Marker, 2: human lactoferrin standard substance (80kD), 3: people milk, 4: the auspicious baby sample (lactagogue) of suckling, 5: ordinary milk, 6: ordinary milk (lactagogue), 7: clone's milk (lactagogue), 8: change double-tagging gene clone ox (lactagogue).

Fig. 7: human lactoferrin transgene clone cow's milk sample Western result, swimming lane 1: human lactoferrin standard substance (80kD), 2: people's milk, 3: the auspicious baby sample (lactagogue) of suckling, 4: ordinary milk, 5: ordinary milk (lactagogue), 6: clone's milk (lactagogue), 7: change double-tagging gene clone ox (lactagogue)

Fig. 8: auspicious baby and human milk final proof Non-reducing and Reducing PAGE result, M are protein standard, and N1 and R1 are the HLF standard substance, and N2 and R2 are human milk, and N2 and R2 are auspicious baby's breast sample

Fig. 9: auspicious baby and human milk final proof Western result, M is a protein standard, and N1 and R1 are the HLF standard substance, and N2 and R2 are human milk, and N2 and R2 are auspicious baby's breast sample.

Figure 10: non-the subtracting property PAGE result that auspicious baby and human milk final proof are handled with N-glycosidase F, swimming lane 1 is a protein standard, and 3 cut the result for HLF standard substance enzyme, and 4 cut the result for people's galactenzyme, and 5 cut the result for auspicious baby's enzyme, and 6 is human milk, and 7 is auspicious baby, and 8 is the HLF standard substance

Embodiment:

The present invention is described in further detail below in conjunction with embodiment.

Embodiment

1 experiment material

1.1 plasmid and bacterial strain

Host bacterium bacillus coli DH 5 alpha and DH10B, pIRES-NEO and pCMV-EGFP-IRES-NEO are available from Clontech company.

1.2 laboratory animal

The fetus at about 3 monthly ages of Holstein milk cow is taken from the slaughterhouse, and the ox ovary is from slaughterhouse, surrounding area, Beijing.

1.3 main agents

DMEM/F12 powder, DMEM powder culture medium, trypan blue (trypan blue), TCM199 powder, glutamine and G418 are Gibco company product; Foetal calf serum is a Hyclone company product; DNTP and PCR primer are purchased in Shanghai bio-engineering corporation; The Taq enzyme is purchased in China Agricultural University Agricultural biotechnologies laboratory; Restriction endonuclease SspI and BamHI are Huamei Bio-Engrg Co.,'s product; IPTG, X-gal, penbritin (Amp), kantlex (Kan), keyhole limpet hemocyanin (KLH) are all available from magnificent biotech firm; Saturated phenol is ancient cooking vessel state bio-engineering corporation product; Trypsinase, penicillin streptomycin, EDTA, Hepes, FSH, LH, 17 β-E2, EGF, Unidasa, HEPES, FAF BSA, cytochalasin B, Hoechest33342, cycloheximide, A23187,6-DMAP, D-N.F,USP MANNITOL, Sodium.alpha.-ketopropionate, heparin sodium, mineral oil and other inorganic salt etc. are Sigma company product.

1.4 culture medium preparation

SOB substratum: dispose every liter of substratum, should add at the 950ml deionized water: peptone: 20g yeast extract: 5g NaCl 0.5g. shakes the vessel solute and dissolves fully, add 250mmol/L KCl solution 10ml then, be adjusted to pH7.0 with 5mol/LNaOH.Sterilization.

The LB liquid nutrient medium: peptone 10g, yeast powder 5g, NaCl 10g is dissolved in the 800ml water, regulates pH value to 7.5, constant volume system 1000ml, autoclaving.

The LB solid medium: peptone 10g, yeast powder 5g, NaCl 10g is dissolved in the 800ml water, adds cosmetics 15g, regulates pH value to 7.5, is settled to 1000ml, autoclaving.

1.5 the preparation of reagent

The DMEM nutrient solution: DMEM powder 13.4g, NaHCO33.7g, penicillin 66mg, Streptomycin sulphate 100mg, Mill-Q ultrapure water constant volume to 1 liter, PH 7.0-7.4, osmotic pressure are 280-320mOsm/kg, with the sterilization of 0.2 μ m membrane filtration, 4 ℃ of preservations.Add 10% serum during use.

0.1%Trypsin/EDTA enzymic digestion liquid: Trypsin 0.1g, KCl 0.04g, NaHCO3, NaCl 0.8g, EDTA 0.02g, the Mill-Q ultrapure water dissolving with sterilization is settled to 100ml, with the sterilization of 0.2 μ m membrane filtration ,-20 ℃ of preservations.

DPBS liquid: DPBS powder 9.7g, Mill-Q ultrapure water constant volume to 1 liter, PH 7.0-7.2 is with the sterilization of 0.2 μ m membrane filtration, 4 ℃ of preservations.

No calcium magnesium PBS solution: KCl 0.2g, KH2PO4 0.2g, NaCl 8.0g, Na2HPO4 12H2O 2.88g, Mill-Q ultrapure water constant volume to 1 liter, PH 7.0-7.4, osmotic pressure are 280-320mOsm/kg, with the sterilization of 0.2 μ m membrane filtration, 4 ℃ of preservations.

The Gimsa mother liquor: Gimsa powder 0.5g adds a small amount of glycerine the Gimsa powder is fully ground in mortar.Adding glycerine to total amount again is 22ml, 56 ℃ of insulation 2h, and then add 33ml methyl alcohol, and be kept in the brown reagent bottle, standby.

Cell pyrolysis liquid: 10mM Tris.Cl (PH 8.0), 0.1M EDTA (PH8.0), 0.5%SDS.

The Proteinase K stock solution: Proteinase K 100mg, be dissolved in the 5mL aqua sterilisa, packing ,-20 degree are preserved.

TBS liquid: NaCl 8.0g, KCl 0.2g, Tris.Cl 3.0g is dissolved in the 1L redistilled water autoclaving.

G418 stores liquid: 1g G418 is dissolved in the 1mL1mol/mL HEPES solution (PH7.0-7.2), adds Mill-Q10mL, filtration sterilization, and-20 degree are preserved.

Twice electric shock damping fluid (2 * HeBS): 280mM Nacl, 10mM Kcl, 1.5mM Na2HPO4,12mMGlucose, 50mM Hepes, PH7.0-7.4, filtration sterilization, the 1mL packing ,-20 degree are preserved.

1Mol/L Tris.Cl (pH8.0): 121.1gTris alkali is dissolved in the 800ml water, transfers pH value to 8.0 with HCl, is settled to 1000ml, autoclaving.

0.5Mol/L EDTA (pH8.0): the 126.1g disodium ethylene diamine tetraacetate joins in the 800ml water, transfers pH value to 8.0 with NaOH, is settled to 1000ml, autoclaving.

RNase solution: RNaseA is dissolved in 10mMol/L Tris.Cl (pH7.5), among the 5mMol/L NaCL, is made into the concentration of 10mg/ml,, slowly cool to room temperature, be distributed into aliquot and be stored in-20 ℃ in 100 ℃ of heating 15min.

TE damping fluid: 10mMol/L NaCL, 10mMol/L Tris.Cl (pH8.0), 1mMol/L EDTA (pH8.0), autoclaving.

After 5mol/L LiCl:30.2g lithium chloride two water (LiCl.2H2O) are dissolved in 80ml water fully, be settled to the 100ml autoclaving.

50 * TAE:242gTris alkali, the 57.1ml glacial acetic acid, 100ml0.5Mol/L EDTA (pH8.0) is settled to 1000ml after the dissolving.

Penbritin (Amp) stock solution: sodium ampicillin is dissolved in behind the aqua sterilisa with the filter filtration sterilization of 0.22 μ m, is mixed with 100mg/ml, be stored in-20 ℃.

3mol/L NaAc (pH5.2): the 24.604g anhydrous sodium acetate is dissolved in the 80ml water, regulates pH value to 5.2 with glacial acetic acid, is settled to 100ml, autoclaving.

1mol/L CaCl2: dissolve 54gCaCl2.6H2O in 200ml water, filtration sterilization is distributed into every part of 10ml, is stored in-20 ℃, takes out portion during the preparation competence and is diluted to 100ml, filtration sterilization, pre-cold standby.

The ethidium bromide stock solution: add the 1g ethidium bromide in 100ml water, preserve in 4 ℃ of brown bottles the dissolving back.

DNA extraction extraction buffer: 50mMol/L Tris.Cl (pH8.0), 100mMol/L EDTA (pH8.0), 100mMol/LNaCl, 1%SDS.

2 * Cracking buffer:0.2N NaOH, 0.5%SDS, 20% sucrose.

Phenol: imitative (1:1): equal-volume phenol, chloroform mix, and are stored in 4 ℃ of brown bottles.

Proteinase K solution: water is made into 20mg/ml ,-20 ℃ of preservations.

TCM199 nutrient solution: claim TCM199 powder 9.9g, NaHCO ₃2.2g, Sodium.alpha.-ketopropionate 0.1375g, EDTA 0.372g is with 1L ultrapure water constant volume, PH7.2-7.4, malleation filtration sterilization, 4 ℃ of preservations.Cultivate with adding 10% FCS in the working fluid.

Operation liquid H199: in the TCM199 that contains 25mM Hepes, add 10% FCS.

Towards ovum liquid: add 10% FCS in the DPBS solution.

Unidasa: Unidasa 0.2g, being dissolved in 10ml does not have in the calcium DPBS solution, filtration sterilization ,-20 ℃ of storages.

Working fluid: use towards 10 times of ovum liquid dilutions.

Merge liquid: 0.3M N.F,USP MANNITOL, 0.1mM MgSO ₄, 0.05mM CaCl ₂, 0.5mMHEPES, 0.05% BSA transfers PH to 7.2-7.4, filtration sterilization.

Maturation culture solution: add 10% FBS, 10u/ml FSH, 100U/ml LH, lug/ml estradiol, 100U/ml penicillin, 100ug/ml Streptomycin sulphate in the M199 nutrient solution.

The CR1aa nutrient solution:

Above-mentioned composition is added 90ml ddH ₂Among the O, treat that all reagent thoroughly after the dissolving, add 0.055g HemicalciumL-lactate (5mM).Adjusting pH is 7.4, uses ddH ₂O is added to 100ml, and osmotic pressure is between the 265-285mOsm.Filtration sterilization.

1.6 key instrument equipment

1) CO2 incubator: U.S. Forma Scientific Inc.

2) inverted microscope and fluorescent microscope: Japanese Nikon company

3) culture dish, culturing bottle, centrifuge tube and cell cryopreservation pipe: Nunc company

4) electric shock instrument: U.S. BTX company (ECM 2001)

5) electrophoresis apparatus: DYY-III2 voltage stabilizing electrophoresis apparatus, Liuyi Instruments Plant, Beijing

6) Bechtop: Beijing treating plant factory

7) ℃ Ultralow Temperature Freezer-80: Japanese SANYO company

8) ice-making machine: Japanese SANYO company

9) ultrapure water instrument: U.S. MILLIPORE company

10) refrigerated centrifuge: Eppendorf company

11) high speed freezing centrifuge: BECKMAN company

12) gel imaging system: ALPHA INNOTECH company

13) PHS-3C acidometer: go up marine rainbow benefit instrument plant

14) autosterilization pot: Japanese SANYO company

15) sequenator: ABI 377 type DNA sequencer, U.S. PERKIN ELMER company

16) water bath with thermostatic control instrument: U.S. LIFESCIENCE company

17) 9700 type PCR instrument: U.S. PERKIN ELMER company

18) ABI377DNA sequenator: U.S. PERKIN ELMER company

1.7 analysis tool software and network address:

Homology analysis software: DNAMAN

PCR primer-design software: Oligo6.0

Dna sequence analysis software: Chromas

DNA and protein sequence database: NCBI/GenBank/Nucleotides, Protein

2 experimental techniques

2.1 the preparation of HLFBAC DNA

2.1.1 hLF gene BAC positive strain

From the people BAC library of Genome Systems Inc, screen acquisition hLF gene BAC positive strain, used PCR primer such as table 2 by PCR.The skeleton carrier of BAC is pBeloBAC11, and its length is 7.35kb.Two NotI sites are arranged on it, be used to connect the external source fragment.HLF gene fragment length used in this experiment is about 150kb.Wherein 5 ' the distolateral wing sequence length is about 90kb, and 3 ' the distolateral wing sequence length is about 31kb.Show that through restriction analysis and order-checking this BAC fragment contains 17 exons at interior complete hLF encoding gene, total length is 28.9kb, is the result schematic diagram of HLF BAC as Fig. 1.

2.1.2 a large amount of extractions and the purifying of BAC

A large amount of extractions of BAC are described referring to " molecular cloning experiment guide " a large amount of extraction bacteriums from bacterium.BAC extracts after the NotI enzyme is cut, and electroelution reclaims behind the hLF gene fragment pulse electrophoresis after enzyme is cut.

Design a pair of primer, amplification hLF gene 3 ' end is to identify gene.Primer sequence such as following table 2:

HLF5?5’CCTGGGCAACAAAGCGAGAC

3’

HLF6?5’GCTATGGCTCCTTCTCTACTG3’

The annealing temperature of PCR is respectively: 68 ℃.The length of PCR product is 1313bp.

2.2 pEGFP-NEO and pNEO select vector construction

For the ease of the screening positive cell, we have at first made up and have contained green fluorescence protein gene (EGFP) and two selective marker carriers (pEGFP-NEO) of neomycin gene and neomycin gene list selective marker carrier (pNEO).

1) structure of pEGFP-NEO

Cut the segment that pBC1 reclaims about 6kb with NotI and SalI enzyme, connect one and contain SalI successively, the Linker of BamHI and NotI, be built into pXM, cut pCMV-EGFP-IRES-NEO and reclaim 4kb segment EGFP-IRES-NEO with BamHI and NotI enzyme, cut pXM with BamHI and NotI enzyme simultaneously, and be connected with EGFP-IRES-NEO and promptly constitute pEGFP-NEO, pEGFP-NEO structure iron such as Fig. 2.

2) structure of pNEO

Cut the segment that pBC1 reclaims about 6kb with NotI and SalI enzyme, connect one and contain SalI successively, the Linker of BamHI and NotI, be built into pXM, cut pIRES-NEO and reclaim 2kb segment IRES-NEO with BamHI and NotI enzyme, cut pXM with BamHI and NotI enzyme simultaneously, and be connected with IRES-NEO and promptly constitute pNEO, pNEO structure iron such as Fig. 3.

2.3 cell cultures, gene transfection and positive cell screening

2.3.1 the foundation of fetal fibroblast system, fetus uterine tubal epithelium clone, fetus ovarian epithelial cell system

One 5 the monthly age holstein cow fetus take from milk cow center, Beijing, transport whole uterus back laboratory, take out fetus, with PBS and 70% alcohol wash number all over after take out from fetal skin, uterine tube, ovary respectively and organize sample, shred into 1mm ³About fritter, DMEM/F12 plants piece in the 25cm that contains 1mL DMEM/F12+10%FBS after cleaning 2 times in batches ²Culturing bottle in, treat to add DMEM/F12+10%FBS to 6mL again after tissue block adherent is firmly, in 37 ℃, 5%CO ₂Incubator is cultivated 6～7d, and every 2d changes liquid 1 time, treat that the cell growth converges after, with 0.25% trypsin had digestive transfer culture 2～3 times, frozen with DMEM/F12+20%FBS+10%DMSO in batches.

2.3.2 the foundation of granulosa cell system

The holstein cow ovary is taken from milk cow center, Beijing, place 30 ℃ of physiological saline to transport the laboratory back, is the ovarian follicle of 2-8mm with the diameter for the 0.7mm syringe needle extracts diameter, the recovery form is even, the ovarian cumulus-ovocyte-complex body (COCs) of compact structure, with 0.1% hyaluronic acid enzyme solution concussion 3min, the centrifugal back of DMEM/F12+10%FBS washing was resuspended to 1 * 10 after PBS cleaned 3 times ⁵Individual/mL, the 6mL cell solution is spread to 25cm ²Culturing bottle in, in 37 ℃, 5%CO ₂Incubator is cultivated 3～4d, treat that the cell growth converges after, with 0.25% trypsin had digestive transfer culture 2～3 times, frozen with DMEM/F12+20%FBS+10%DMSO.

2.3.3 somaticly go down to posterity, freezing, and recovery

Primary cell to be planted grows to 80% when converging, and a cell part is freezing, and a part goes down to posterity and continues to cultivate.

2.3.3.1 go down to posterity

Carefully absorb nutrient solution in the culturing bottle with sterilization glass elbow suction pipe, inject no calcium magnesium PBS (37 degree incubation) along the opposite bottle wall of cell growth wall and wash cell twice, to dispel remaining serum and cell metabolite.

↓

With add 0.05% trypsinase/0.02%EDTA Digestive system with quadrat method, add-on gets final product for covering cell monolayer that (diameter 100mm culture dish generally adds the 1ml Digestive system, add the 200uL Digestive system in the 35mm culture dish), put into incubator and digest 1-2min.Examine under a microscope, treat that cell begins to become bowlder, beat the culture dish wall, make cell thoroughly take off wall, add nutrient solution then and stop digestion with finger.

↓

Blow and beat repeatedly with sterilization glass elbow suction pipe, cell makes its dispersion become individual cells, centrifugal 5min collecting cell under the 1000rpm.With nutrient solution by 1:2 or 1:3 dilution proportion and again inoculating cell to culture dish, cultivate.

2.3.3.2 it is freezing

After the attached cell digestion, collecting cell is in centrifuge tube, and centrifugal 5min is to remove most supernatant under 1000rpm.

↓

Add refrigerating fulid (DMEM+20%FCS+10%DMSO) the re-suspended cell precipitation of 4 degree precoolings, make cell concn be about 107 cell/ml, transitional cell is to frozen pipe.

↓

Put into 4 degree refrigerator precooling 30min, more frozen pipe is inserted on the thick foam, place the liquid nitrogen liquid level to fumigate 2h then, drop into liquid nitrogen then rapidly and preserve.

2.3.3.3 recovery

From liquid nitrogen, take out frozen pipe, drop into fast in the 37 degree water-baths, and in water-bath, constantly shake frozen pipe fast to thaw rapidly.

↓

After treating that refrigerating fulid thoroughly thaws, be transferred in the centrifuge tube with 10 times of fresh medium dilutions and with lysate, centrifugal 5min removes DMSO to extenuate refrigerating fulid toxicity under 1000rpm.

↓

With fresh nutrient solution suspension cell precipitation, cell dilution to desired concn, is continued to cultivate.

2.3.4 the transfection preparation of DNA

A large amount of extractions of hLf BAC are described referring to " molecular cloning experiment guide " a large amount of extraction bacteriums from bacterium.BAC extracts after the NotI enzyme is cut, and electroelution reclaims behind the hLF gene fragment pulse electrophoresis after enzyme is cut, and uses injection TE the hLF gene fragment dissolved dilution of purifying to 5ng/ μ l.Extract two marks simultaneously and select carrier pEGFP-NEO and single mark to select carrier pNEO, electroelution recovery through the NotI enzyme is cut after is used injection TE the marker gene fragment dissolved dilution of purifying to 1ng/ μ l.

2.3.5 the micro-injection altogether of goal gene and marker gene

Cover glass after cleaning, sterilizing is placed in six orifice plates,, treat to take out when cell grows to 60-80% for the cytogene injection to reach the 3-6 various somatocyte inoculation culture in generation.

↓

Dilute hLF BAC DNA and double alternative carrier plasmid pEGFP-NEO DNA or single mark respectively with injection TE and select vector plasmid pNEO DNA to 5ng/ μ l and 1ng/ μ l, and then the equal-volume mixing, make the injection concentration of hLF BAC and double alternative carrier be respectively 2.5ng/ μ l and 0.5ng/ μ l (mol ratio 1:3).

↓

Growth is had somatic cover glass to move to fill in the diameter 100mm culture dish of operation liquid H199, with suction have mixed base because of entry needle gene is injected nucleus, extract entry needle rapidly after waiting nucleus to expand.

↓

Cell cultures behind the gene injection is after 2 days, and pair cell carries out the G418 screening, the positive cell mono-clonal is cultivated and amplification

2.3.6 the mono-clonal of positive cell is cultivated

Under fluorescent microscope, observe the luminous situation of aforesaid method gained cell clone, live good dispersion (away from other clone) and the many fluorescence clones of cell quantity with the marking pen circle; Absorb nutrient solution, with no calcium magnesium PBS rinsing cell secondary, under the high power anatomical lens, 30-50ul 0.25% tryptic digestive juice is dripped on the good cell clone of mark, after most cells to be cloned is shunk and is taken off wall, do not wait cell suspension, draw cell clone fast, but near other clone's cell noting not sucking; Transitional cell is blown and beaten the cell dispersion agglomerate in four orifice plates that are added with 500 μ l nutrient solutions; The clone who chooses continues to cultivate, and reduces G418 concentration to 300 μ g/ml and keeps screening; After treating that clone cell quantity enlarges the back or converges, a part of cell transfer is continued enlarged culturing in the 35mm culture dish, another part is used for transgenosis and detects, and the cell after other enlarges is freezing as early as possible.

2.3.7 the PCR of transfectional cell detects

Because this experiment is adopted is the HLF BAC DNA of 150kb of 150kb and the micro-common injecting method of pEGFP-NEO or pNEO, therefore can not guarantee that with the G418 screening positive colony point is the transgenic cell that changes the HLF BAC DNA that 150kb is arranged, identify so before carrying out somatic cell clone, must carry out PCR to transgenic cell.In order to ensure the HLF BAC DNA that changes complete 150kb over to, we hold at the 5 ' end and 3 ' of the HLF of 150kb BAC DNA, and the HLF coding region has been designed a pair of primer respectively and carried out pcr amplification.

2.3.7.1 the extraction of cell genomic dna

With trypsinase/EDTA liquid digestion collecting cell, and use the PBS washed twice.

↓

Add 200 μ l cell pyrolysis liquids, final concentration is the Proteinase K of 100 μ g/ml, and 55 degree water-bath digestion are spent the night.

↓

With phenol, phenol/chloroform, each extracting of chloroform once.

↓

Add equal-volume dehydrated alcohol and 0.1 times of volumes of acetic acid sodium deposit D NA.

↓

70% washing with alcohol once after, be dissolved among the TE ,-20 degree are preserved.

2.3.7.2 PCR reaction

Primer sequence is as follows:

Table 3: the PCR primers designed and the reaction conditions that change the human lactoferrin clened cows

Reaction system: template DNA, 3 μ l; Primer 1 μ l; 2.5mMdNTP, 3 μ l; 10 * Tag enzyme Buffer, 5 μ l; The Tag enzyme, 10U; Add ddH2O at last and supply system to 50 μ l.

Reaction parameter: 94 ℃ 5 '; ℃ 40 ＂ → 72,94 ℃ of 40 ＂ → 60 ℃ 1 '; 72 ℃ 10 of 25 cycles '; 4 ℃ of preservations.

2.4 transgenosis somatic cell clone

2.4.1 the maturation of ovocyte is cultivated

Collect the ovary of the ox that grows up from the slaughterhouse, place 30 ℃ physiological saline in 4h, to deliver to the laboratory, after cleaning three times in 37 ℃ the PBS liquid, is the ovarian follicle of 2～8mm with the diameter for the 0.7mm syringe needle extracts diameter, the recovery form is even, ovarian cumulus-the ovocyte of compact structure-complex body (COCs), with twice of ripe liquid (M199+10%FBS+0.01U/ml bFSH+0.01U/mlbLH+1 μ g/ml estradiol) washing, then ovarian cumulus-ovocyte-complex body is put into four orifice plates that contain ripe liquid with 50-60 piece/hole, at 38.5 ℃, after maturation is cultivated 18～20h in the 5%CO2 incubator, the pipe that sophisticated ovocyte is put into 0.1% Unidasa vibrates behind 2～3min, blow and beat gently with Glass tubing again, cumulus cell and ovocyte are broken away from fully, select complete form, tenuigenin evenly and the ovocyte of discharging first polar body be the somatic cell nuclear acceptor.

2.4.2 the stoning of ovocyte

The ovocyte that will have first polar body moves into and contains in the operation liquid of M199+10%FBS+7.5 μ g/ml cytochalasin B, under 200 power microscopes, above polar body, zona pellucida cut an osculum with a glass needle, again with internal diameter be 20 μ m Glass tubing with first polar body with and the ovocyte of below in karyomit(e) absorb in the lump, the solution of putting into M199+20%FBS again give a baby a bath on the third day after its birth all over after, place incubator standby.

2.4.3 move nuclear and merge

The donorcells of serum starvation 2～4d is digested 2～4min with 0.25% trypsin, the selection diameter is that the somatocyte of 10～12 μ m has gone its immigration in the ovocyte zona pellucida of nuclear with 20 μ m diameter Glass tubings, put it into then in the Zimmerman liquid [15] and put into integration slot behind balance 3～5min, rotating ovum makes donorcells vertical with electric field with the ovocyte contact surface, field intensity in DC pulse is 2.5kV/cm simultaneously, burst length is 10 μ s, pulse number is 2 times, recurrent interval is after merging (fusion instrument is the ECM-2001 of BTX company) under the condition of 1s, reconstructed embryo is moved in the M199+10%FBS liquid rapidly, observe fusion rate after placing 0.5h, select the fusion embryo and carry out next step activation processing.

2.4.4 the activation of reconstructed embryo and cultivation

Reconstructed embryo is put into 5 μ mol/L Ionomycin (Sigma) liquid, change to behind the 4min in the 1.9mmol/L6-DMAP liquid, move into again behind the 4h in the CR1aa+5%FBS liquid, observe division rate after in 38.5 ℃, 5% CO2 incubator, cultivating 2d, observe blastocyst rate behind the 7d

2.4.5 embryo transfer detects with gestation

Clone's blastaea of the 7d that form is good moves in the horn of uterus of the receptor cow of the same period. and what receptor cow was selected all is the multiparity cow, wherein red is that the clone embryos of southern Hebei ox is moved into the Holstein milk cow, the clone embryos of Holstein milk cow is moved into Luxi Yellow cattle. and the 60d after transplanting carries out rectum and detects, to determine pregnancy rate.

2.5 the PCR of transgene clone and Southern identify

2.5.1 the PCR of transgene clone ox identifies

Identify for the PCR that changes the human lactoferrin clened cows, because the transgenosis that we adopt is the hLF BAC of 150kb, in order to detect genetically modified integrity, we have designed a pair of primer at hLF upstream region of gene control region 5 ' end, designed a pair of primer in its coding region, also designed a pair of primer, primer sequence and reaction conditions such as table 4 at its downstream control region 3 ' end:

Table 4: the PCR primers designed and the reaction conditions that change the human lactoferrin clened cows

PCR result such as Fig. 4, as can be seen from Figure 4, we amplify corresponding special product by three pairs of primers of design in the clened cows genome of two, show that two transgene clone ox all integrates complete hLF BAC DNA.

2.5.2 the Southern of transgene clone ox identifies

Southern detects the about 10 μ g of transgene clone ox DNA that then get the PCR test positive and digests with EcoRI, low pressure is electrophoresis at a slow speed, after changeing film, carry out Southern hybridization, hybridizing used probe is the hLF gene coding region fragment of the isotope-labeled 2.5kb of α-P32dCTP.

Fragment with a 2.5kb size of bovine lactoferrin gene coding region is identified this two transgene clone Niu Jinhang Southern.As can be seen from Figure 5, change the bovine lactoferrin gene that the people is arranged in this two clened cows genome really, and iron baby's transgenosis copy number is 1, auspicious baby's transgenosis copy number is 2.

2.6 transgenic cattle restructuring lactoferrin expression analysis

2.6.1 medicine lactagogue

Press of the transgene clone Niu Jinhang medicine lactagogue of 1/4 dosage with the lactagogue pin that Cao Tan pharmaceutical factory, Xi'an produces to the 6-8 monthly age, simultaneously with double-tagging carrier transgene clone ox, common clened cows, carry out lactagogue in contrast with common Fresian of monthly age, it also is contrast with the ordinary milk, collect the milk sample every day 3 times, collected for two weeks altogether.

2.6.2 PAGE electrophoresis, Western and the ria-determination of transgenosis milk

Newborn sample to transgenic cattle dilutes three times with heavily steaming aqua sterilisa, removes butterfat, goes caseic processing, obtains whey portion at last.Lactoferrin promptly is present in the whey.After newborn sample carried out degreasing and remove casein to transgenosis milk sample and contrast, the PAGE glue of the last sample Buffer of usefulness subtracting property (reducing) SDS sex change carried out electrophoresis, result such as Fig. 6.From then on figure auspicious as can be seen baby suckle sample have one with human lactoferrin standard substance specific band of the same size.Carry out Western hybridization, result such as Fig. 7 with the anti-human lactoferrin antibody of rabbit.From the auspicious as can be seen baby's breast sample of Western result and people's milk one and human lactoferrin standard substance specific band of the same size are arranged, show the restructuring lactoferrin of energy The expressed in auspicious baby's mammary gland.

Utilize the radioimmunoassay method to detect the expression amount of restructuring lactoferrin in the transgenosis milk sample.With chloramines-T method mark, the newborn sample of getting 6 time points detects the human lactoferrin standard substance with 125I.The expression amount mean value that records restructuring lactoferrin in auspicious baby's breast sample is 3.43g/l, shows that we can efficiently express complete restructuring lactoferrin at employed human lactoferrin gene structure with complete autogenous control district in transgenic cattle mammary gland.

2.6.3 the glycosylation analysis of restructuring lactoferrin

The ddH2O that whey sample 2 μ l are added 10 * glycoprotein sex change damping fluid of 2 μ l respectively and add an amount of volume respectively makes final volume to 20 μ l.Every duplicate samples adds 1/10 volume, 10 * G7 damping fluid and 1/10 volume 10%NP-40 damping fluid.The Glycosylase F of every duplicate samples adding 5U is hatched 1hr at 37 ℃.Further analyze as SDS-PAGE detected through gel electrophoresis and Westem blot.Fig. 8 is auspicious baby's breast sample and contrasts with the SDS/PAGE gel electrophoresis figure of non-subtracting property (Non-reducing) with the sex change of subtracting property (Reducing) sample-loading buffer.As shown in the figure, lactoferrin is the rate of migration height in non-subtracting property (Non-reducing) sample-loading buffer, and different type of glycosylation also can be separated.As can be seen from Figure 8, human lactoferrin in auspicious baby's breast sample is consistent with the type of glycosylation of natural human lactoferrin, all have only two types, it is glycosylation modified and close in the human breast cell to show that human lactoferrin is subjected in bovine mammary cell, therefore can obtain the restructuring lactoferrin close with the natural human lactoferrin in the transgenosis cow mammary gland.

Carry out the Western results of hybridization behind non-the subtracting property PAGE of Fig. 9 for auspicious baby and human milk whey sample, the restructuring lactoferrin in auspicious baby's breast sample have with human milk in natural human lactoferrin and the identical type of glycosylation (A and Type B) of human lactoferrin standard substance.Further specifying restructuring lactoferrin, to be subjected to the natural human lactoferrin in bovine mammary cell identical glycosylation modified in the human breast cell.

Figure 10 is non-the subtracting property PAGE result that auspicious baby and human milk whey sample are handled with N-glycosidase F, before as can be seen from the figure handling, the restructuring lactoferrin of auspicious baby's whey has two kinds of main type of glycosylation (A and Type B), identical with the type of glycosylation of human milk and standard substance, and two kinds of type of glycosylation ratios are also close with human milk, show that the restructuring lactoferrin and the natural human lactoferrin of cow mammary gland bio-reactor expression is more approaching.And after handling with N-glycosidase F, different glycosyls is all digested to be fallen, and molecular weight is identical.

Attached: SEQ ID NO 1: the primary structure of human lactoferrin is an aminoacid sequence, totally 711 amino acid

1 MKLVFLVLLF?LGALGLCLAG?RRRRSVQWCA?VSQPEATKCF?QWQRNMRRVR

51 GPPVSCIKRD?SPIQCIQAIA?ENRADAVTLD?GGFIYEAGLA?PYKLRPVAAE

101?VYGTERQPRT?HYYAVAVVKK?GGSFQLNELQ?GLKSCHTGLR?RNAGWNVPIG

151?TLRPFLNWTG?PPEPIEAAVA?RFFSASCVPG?ADKGQFPNLC?RLCAGTGENK

201?CAFSSQEPYF?SYSGAFKCLR?DGAGDVAFIR?ESTVFEDLSD?EAERDEYELL

251?CPDNTRKPVD?KFKDCHLARV?PSHAVVARSV?NGKEDAIWNL?LRQAQEKFGK

301?DKSPKFQLFG?SPSGQKDLLF?KDSAIGFSRV?PPRIDSGLYL?GSGYFTAIQN

351?LRKSEEEVAA?RRARVVWCAV?GEQELRKCNQ?WSGLSEGSVT?CSSASTTEDC

401?IALVLKGEAD?AMSLDGGYVY?TAGKCGLVPV?LAENYKSQQS?SDPDPNCVDR

451?PVEGYLAVAV?VRRSDTSLTW?NSVKGKKSCH?TAVDRTAGWN?IPMGLLFNQT

501?GSCKFDEYFS?QSCAPGSDPR?SNLCALCIGD?EQGENKCVPN?SNERYYGYTG

551?AFRCLAEDAG?DVAFVKGVTV?LQNTDGNNNE?AWAKDLKLAD?FALLCLDGKR

601?KPVTEARSCH?LAMAPNHAVV?SRMDKVERLK?QVLLHQQAKF?GRNGSDCPDK

651?FCLFQSETKN?LLFNDNTECL?ARLHGKTTYE?KYLGPQYVAG?ITNLKKCSTS

701?PLLEACEFLR?K

Claims (5)

1. change the production method of the zooblast of human lactoferrin gene, its operation steps is as follows: (1) utilizes and contains the hLF BAC DNA of whole person's bovine lactoferrin gene as mammary gland-specific expression vector, (2) select carrier pNEO to be mixed in proportion hLF BAC DNA and double alternative carrier pEGFP-NEO or single mark, import in the animal somatic cell nuclear, carry out cell transfecting, acquisition changes the transgenic cell of hLF BAC DNA over to, wherein, described animal is meant ox, goat, sheep, pig or rabbit, the structure of described hLF BAC DNA as shown in Figure 1, the structure of pEGFP-NEO as shown in Figure 2, the structure of pNEO is as shown in Figure 3.

2. the production method of the zooblast of commentaries on classics human lactoferrin gene according to claim 1, described introduction method are the micro-injection altogether of somatocyte.

3. the production method of the zooblast of commentaries on classics human lactoferrin gene according to claim 2, the micro-injecting method altogether of described somatocyte, its operation steps is as follows: (1) selects carrier to mix by a certain percentage with double alternative carrier or single mark hLF BAC DNA; (2) with microinjection instrument the DNA mixed solution is expelled in the animal somatic cell nuclear; (3) utilize marker gene and pcr amplification method to filter out positive cell.

4. it is 1:3 that the production method of the zooblast of commentaries on classics human lactoferrin gene according to claim 3, described hLF BACDNA and double alternative carrier or single mark are selected carrier blended mol ratio.

5. the production method of the zooblast of commentaries on classics human lactoferrin gene according to claim 1, described animal are ox.

Images