CN102676559B - Recombinant lysostaphin locus specific integration vector and recombinant cell established by same - Google Patents

Abstract

The invention discloses a recombinant lysostaphin locus specific integration vector and a recombinant cell established by same. Recombinant lysostaphin gene consists of cow growth hormone signal peptide and mutant lysostaphin mature peptide, regulatory sequences of casein gene are added to the 5' end and the 3' end of the recombinant lysostaphin gene, and an insulator element of chicken beta lactoglobulin is added behind the casein 5' end and a terminator codon of enhanced green fluorescent protein (EGFP) respectively. A bovine fetal fibroblasts cell integrated with target gene is used as a donor cell for constructing transgenic cloned embryo through nuclear transfer, and a transgenic cloned embryo is obtained through somatic cell nuclear transfer (SCNT). By the normally developed transgenic cloned embryo, mastitis-resistant high-yield cow with the transferred recombinant lysostaphin gene is expected to be produced through an embryo transplantation technology.

Description

A kind of reconstitution cell of recombinate lysostaphin site-specific integration carrier and structure thereof

Technical field

The invention belongs to the technology of gene conversion and animal clone field, relate to the structure of the nuclear donor cell of transgene clone embryo, particularly a kind of reconstitution cell of recombinate lysostaphin site-specific integration carrier and structure thereof.

Background technology

Mammitis of cow (mastitis) has another name called mastadenitis of cow, mainly caused by the cause pathogeny imcrobe infection in the environment, and be to bring one of principal disease of serious financial loss to the milk cattle cultivating person, have a strong impact on the sound development of milk cattle cultivating industry.There is the document announcement U.S. annual because the losses such as the dairy products output that mammitis of cow causes and Quality Down reach 3,500,000 dollars.Mammitis of cow is divided into clinic mastitis and Subclinical mastitis.Cause that mammitis of cow may have many factors, comprise situation, the microorganism of curing the disease of Niu Benshen and affect milk cow and the microbial environment factor.The microbe species of wherein curing the disease is a lot, streptococcus aureus is the topmost pathogenic bacteria of mammitis of cow, this bacterium can cause acute, chronic and subclinical property (latent mammitis) mastitis, produce for the milk industry and bring massive losses, production declining not only, also increase treatment and to the expense (Gill of milk cow medical services, J.et al, 2006.Efficacy and pharmacokinetics of bacteriophage therapy in treatment of subclinical Staphylococcus aure-us mastitis in lactating dairy cattle.Antimicrob.Agents Chemother.50,2912-2918).

For many years, the treatment mammitis of cow all is the method that adopts the Broad spectrum antibiotics treatment, although effectively, and curative ratio less than 50%.The application of Broad spectrum antibiotics has also caused the generation of serious Resistant strain, increased treatment difficulty (D.Ferber.Antibiotic resistance-Livestock feed ban preserves drugs ' power.[J] .Science 2002; 295:27-28).Therefore, use the special microbiotic of pathogenic bacteria to be expected to reduce the probability that resistance produces.

In order to reduce the use of Broad spectrum antibiotics, avoid antibiosis is have the appearance of the bacterial strain of resistance, we are by the special antibiotic of mammary gland secretion pathogenic bacteria of transgenic dairy, thereby avoid using in a large number the caused problem of microbiotic, the opposing mammitis of cow (D.E.Kerr and O.Wellnitz Mammary expression of new genes to combat mastitis[J] Anim Sci 2003.81:38-47).

The production of transgenic animal is since 20 century 70 middle periods, produce transgenic animal (the BOWEN RA that continued more than 20 year with pronuclear microinjection, REED ML, SCHNIEKE A, et al.Transgenic cattle resulting from biopsied embryos:expression of c-ski in a transgenic calf[J] .Biol Reprod, 1994,50:664-8), but the widespread use of this technology has certain limitation, and foreign gene is random integration often.On domestic animal, it is (SHIM H that embryonic stem cell is not also built, GUTIERREZ-ADAN A, CHEN LR, et al.Isolation of pluripotent stem cells from cultured porcine primordial germ cells[J] .Biol Reprod, 1997,57:1089).Shown powerful vitality (GOO J and use somatic cell clone technique production transgenic animal, BHUIYAN M.M.U., HYUN Y J, et al.An approach for producing transgenic cloned cows by nuclear transfer of cells transfected with human alpha 1-antitrypsin gene[J] .Theriogenology, 2006,65 (9): 1800-1812.), its outstanding advantage is directly to utilize the fixed somatocyte that is integrated with goal gene to carry out body-cell neucleus transplanting (SCNT) for nuclear donor, the transgenosis step is advanceed to the somatic cell culture stage, so only need the donorcells of selection mode the best before body-cell neucleus transplanting, the natality that not only can improve transgenic animal can also reduce its production cost.

Lysostaphin (Lysostaphin) is a kind of metalloprotease of imitation staphylococcus (staphylococcus simulans) secretion, catalytic activity with hydrolysis aureus cell wall peptidoglycan pentapeptide bridging, golden Portugal bacterium there is powerful bacteriolysis (Recsei P A, GrussA D, Novick R P.Cloning, sequence, and expression of the lysostaphin gene from S taphylococcus simulans[J] .Proc Natl Acad Sci USA, 1987,84 (5): 1127-1131).A kind of amyloid protein precursor of natural lysostaphin genes encoding, the bacterium elder generation expressing protein precursor that produces, be secreted into outside the born of the same parents and cut the lysostaphin that N holds a plurality of 13aa tumor-necrosis factor glycoproteinss and becomes maturation by the thiol proteinase effect, mature lysostaphin is than high approximately 4.5 times of (the Thumm G of activity of amyloid protein precursor, Gotz F.Studies on p rolysostaphin p rocessing and characterization of the Lysostaphin immunity factor (Lif) of Staphylococcus simulans biovar staphylolyticus[J] .MolMicrobiol, 1997,23 (6): 1251-1265).The external relevant zooscopy that successfully turns the lysostaphin gene has: express the Lysostaphin staphylococcus by transgenic mouse milk and infect, the result shows that the economical load by the method enhancing lactation animal health reduction mastitis of genetic engineering is a kind of effective strategy (David E.Kerr1, Karen Plaut, A.John Bramley, etal Lysostaphin expression in mammary glands confers protection against staphylococcal infection in transgenic mice[J] .Nat Biotechnol 2001; 19:66-70).Carried the transgenic cattle birth of Lysostaphin gene in 2005, improve ability (the Wall RJ of the mastitis of milk cow staphylococcus infection, Powell AM, Paape MJ, etal.Genetically enhanced cows resist intramammary Staphylococcus aureus infection.Nat Biotechnol 2005; 23:445-451.).Domestic research to lysostaphin only sees as the antibiotic therapy trauma infection contamination, and the treatment of mammitis of cow and endometritis has obtained good effect.But as goal gene, take zooblast as host cell, particularly the somatocyte of milk cow is the expression vector of host cell, goes back the understatement road with lysostaphin; Also do not make up the report of the nuclear donor cell clone of gene clone embryo as goal gene with lysostaphin.

Φ C31 specificity intergrase can mediated gene unidirectional insertion, the site that produces after the locus specificity restructuring occurs owing to there are not other cofactors to exist in the cell, site after the restructuring no longer is the identification substrate of intergrase, compares advantage on efficient with intergrases such as FLP with Cre.In a lot of animals and plants, all find to have pseudo attP site, and they are arranged in mostly between gene or intron, only have to be arranged on a small quantity exon.4 integration sites (Ou H L, Huang Y, Zeng Y T, et al. in the genome of ox, have been located

C31integrase-mediated integration hotspot in favor of transgene expression exists in the bovine genome[J] .FEBS J, 2009,276 (1): 155-63) one of them site integration efficiency reaches 74%, is most effective in the known site.Just explanation is under the mediation of Φ C31 specificity intergrase for this, and the insertion of foreign gene can not affect the normal expression of host genome and foreign gene self.Will be with the carrier and the plasmid co-transfection cell of expressing Φ C31 site-specific integration enzyme in attB site, this method is more guaranteed transgenosis strategy on a kind of efficient.

Summary of the invention

The problem that the present invention solves is to provide a kind of reconstitution cell of recombinate lysostaphin site-specific integration carrier and structure thereof, with reconstitution cell as nuclear donor cell, for the transgenic dairy of preparation anti-Staphylococcus aureus mastitis provides solid basis.

The present invention is achieved through the following technical solutions:

A kind of restructuring dissolving staphylococcal bacteria plain gene, its nucleotide sequence is shown in SEQ.ID.NO.1.

Described restructuring dissolving staphylococcal bacteria plain gene is at the CSN5 controlling element of its 5 ' end connection shown in SEQ.ID.NO.2, at the CSN3 controlling element of its 3 ' end connection shown in SEQ.ID.NO.3.

Also be connected with att B sequence shown in SEQ.ID.NO.4 at 5 of CSN5 controlling element ' end, also be respectively equipped with the insulator sequence in the upstream and downstream of att B sequence.

Described insulator sequence is the chicken beta-lactoglobulin insulator sequence shown in SEQ.ID.NO.5.

Restructuring dissolving staphylococcal bacteria plain gene also be connected with the fluorescent mark gene in the upstream, the downstream also is connected with the antibiotic-screening gene.

Be provided with terminator or insulator sequence between described fluorescent mark gene and the restructuring dissolving staphylococcal bacteria plain gene, be connected with the loxp sequence in the upstream and downstream of antibiotic-screening gene.

Comprise the restructuring dissolving staphylococcal bacteria plain gene shown in the SEQ.ID.NO.1, its 5 ' end connects the CSN5 controlling element shown in SEQ.ID.NO.2, at the CSN3 controlling element of its 3 ' end connection shown in SEQ.ID.NO.3;

5 of CSN5 controlling element ' end also is provided with fluorescent mark gene and promotor successively, is provided with the antibiotic-screening gene between CSN3 controlling element and promotor.

Between fluorescent mark gene and CSN5 controlling element, also be provided with att B sequence, also be respectively equipped with the insulator sequence in the upstream and downstream of att B sequence; Upstream and downstream at the antibiotic-screening gene is connected with the loxp sequence.

The reconstitution cell that makes up based on the mammary gland specific expression vector of described restructuring lysostaphin, take the holstein cow fetal fibroblast as host cell, the mammary gland specific expression vector of linearizing restructuring lysostaphin is transfected in the host cell.

Described reconstitution cell makes up the application of the nuclear donor cell of transgene clone embryo as nuclear transplantation.

Compared with prior art, the present invention has following useful technique effect:

1, the present invention has made up a kind of restructuring dissolving staphylococcal bacteria plain gene, has carried out glycosylation sudden change and guarantee to produce in mammalian cell and have bioactive lysostaphin in its mature polypeptide coding sequence; Secondly dissolving staphylococcal bacteria plain gene mature peptide is connected to bovine beta-lactoglobulin signal peptide back and forms restructuring dissolving staphylococcal bacteria plain gene, be secreted in the milk after the dissolving staphylococcal bacteria plain gene is expressed in mammary gland cell; Instruct restructuring dissolving staphylococcal bacteria plain gene specific efficient in the mammary tissue of ox to express with CSN5, CSN3 as controlling element at last.

2, the present invention also by the attB sequence, realizes the integration of specific site with goal gene and controlling element thereof under the mediation of Phi C 31 integrase, the detected result of the reconstitution cell that makes up show goal gene by whole to being the site to expecting; With the expression vector pCMVINT cotransfection bovine fetal fibroblast of mammary gland specific expression vector pEGFP-C1MAB and Phi C 31 integrase, make up the bovine fetal fibroblast system that turns its rhzomorph gene of molten grape.Its fluorescence microscopy is observed the expression of marker gene EGFP, and through G418 screening acquisition positive cell, extract the positive cell genome, go forward side by side performing PCR and Southernbloting identify and confirm that goal gene restructuring lysostaphin is incorporated into the genome of bovine fetal fibroblast.And further in the upstream and downstream design Loxp of antibiotic-screening marker gene neo sequence, cut off the neo gene by the restructuring of Loxp sequence.

3, the mammary gland specific expression vector pEGFP-C1MAB that made up of the present invention; also respectively added an element that contains two chicken beta-lactoglobulin insulator sequence copy numbers at the front end of 5 ' control region of beta-casein gene and the downstream of EGFP encoder block; insert postgenome and protect goal gene and EGFP not to be subjected near the impact of the silencer of insertion point genome, goal gene and marker gene can normal expressions.

4, make up the nuclear donor cell of transgene clone embryo as nuclear transplantation with the bovine fetal fibroblast that comprises goal gene restructuring lysostaphin, obtain the transgene clone embryo by SCNT, the uterus that these embryos is moved into recipient cattle is expected to produce the milk cow that turns restructuring dissolving staphylococcal bacteria plain gene.

Description of drawings

Fig. 1 is the plasmid map of mammary gland specific expression vector pEGFP-C1MAB.

Fig. 2 is the structure schematic flow sheet of mammary gland specific expression vector pEGFP-C1MAB.

Fig. 3 is chicken beta-lactoglobulin insulator amplification schematic flow sheet.

Fig. 4 is the agarose gel electrophoresis detection figure of EcoR1109I single endonuclease digestion carrier pEGFP-C1MAB.

Fig. 5 is the agarose gel electrophoresis detection figure of Mlu I and Xho I double digestion carrier pEGFP-C1MAB.

Fig. 6 is the as a result figure that the reporter gene EGFP of the bovine fetal fibroblast of fluorescence microscope pEGFP-C1MAB carrier positive expression expresses.

Fig. 7 is the detected result figure to the agarose gel electrophoresis after the genomic restructuring lysostaphin of the bovine fetal fibroblast gene amplification of pEGFP-C1MAB carrier positive expression.

Fig. 8 is to the genomic inverse PCR of bovine fetal fibroblast of pEGFP-C1MAB carrier positive expression figure as a result.

Fig. 9 is the genomic comparison result figure to ox among the genomic inverse PCR sequencing result of the bovine fetal fibroblast of pEGFP-C1MAB carrier positive expression and the NCBI.

Figure 10 is to the Southern bloting of the genomic restructuring lysostaphin of bovine fetal fibroblast of pEGFP-C1MAB carrier positive expression figure as a result.

Figure 11 is the fate map that comprises the reconstituted embryo of restructuring dissolving staphylococcal bacteria plain gene;

Figure 12 is the detected result figure to the agarose gel electrophoresis after the genomic restructuring lysostaphin of the restructuring embryo gene amplification that comprises restructuring dissolving staphylococcal bacteria plain gene.

Embodiment

The present invention at first makes up the mammary gland specific expression vector pEGFP-C1MAB that contains restructuring lysostaphin and green fluorescent protein (EGFP) gene, can make restructuring dissolving staphylococcal bacteria plain gene specific expressed in mammary tissue, secondly under the plasmid pCMVInt mediation of expressing Φ C31 site-specific integration enzyme, with Fugen HD with mammary gland-specific expression vector pEGFP-C1MAB transfection high yield cow fetal fibroblast, the expression of fluorescence microscope marker gene EGFP, and through G418 screening acquisition positive cell, carry out PCR and Southern bloting and identify, confirm that goal gene restructuring lysostaphin is incorporated in the genome of bovine fetal fibroblast.At last, the recombinate bovine fetal fibroblast of dissolving staphylococcal bacteria plain gene of transfection is moved in the ox enucleation oocyte as nuclear donor, obtain the transgene clone embryo, the performing PCR of going forward side by side is identified.

The present invention is described in further detail with experiment below in conjunction with accompanying drawing, and the explanation of the invention is not limited.

1, the structure of mammary gland specific expression vector pEGFP-C1MAB

The plasmid map of mammary gland specific expression vector pEGFP-C1MAB as shown in Figure 1, this carrier comprises that goal gene is restructuring lysostaphin gene, its 5 ' end connects such as the CSN5 controlling element, at the CSN3 controlling element shown in the connection of 3 ' end;

The upstream of CSN5 controlling element also is provided with fluorescent mark gene and promotor successively, is provided with antibiotic-screening gene neo between CSN3 controlling element and promotor, is connected with the loxp sequence in the upstream and downstream of antibiotic-screening gene; Between fluorescent mark gene and CSN5 controlling element, also be provided with att B sequence, also be respectively equipped with the insulator sequence in the upstream and downstream of att B sequence.

Mammary gland specific expression vector pEGFP-C1MAB consists of through repeatedly splicing and the shearing of intermediate carrier, specifies its building process below in conjunction with structure schema shown in Figure 2.

1.1 the clone of goal gene

The rite-directed mutagenesis of staphylococcus plain gene mature peptide

Dissolving staphylococcal bacteria plain gene mature peptide is done point mutation, and the albumen the 125th of mature peptide, 232 N point mutation are Q, and namely protein is that the Asn point mutation is Gln.That AAT is mutated into CAG at dna sequence dna, do respectively point mutation for 373～375,694～696 in sequence, with the biological activity of dissolving staphylococcal bacteria fibroin in eukaryotic cell of recovering to express, through the eukaryotic cell expression secretion, the lysostaphin mature peptide after the sudden change can be kept its biological activity.

The lysostaphin gene order of announcing according to GenBank ID:M15686 designs mature peptide point mutation primer.With the full gene of synthetic lysostaphin (XAFW021, TaKaRa numbering: CAG593) be template, utilize the point mutation of overlap extension pcr realization mature peptide, primer sequence is as follows:

TB1：gctgcaacac atgaacattc agcac

TB2：gatcttgggc agttgactgt gaaaatgaat taac

TB3：gttaattcat tttcacagtc aactgcccaa gatccaatgc c

TB4：tcactttata gttccccaaa gaacacctaa agtattagta gatttctgcc atgttcttac agg

TB5：tcactttata gttccccaaa gaacacctaa ag

The PCR reaction system of 50 μ L is:

(Mg ²⁺Plus): 10 μ L, dNTP Mixture (each 2.5mM): 4 μ L, TB1 (10 μ mol/L): 1 μ L, TB2 (10 μ mol/L): 1 μ L,

DNAPolymerase (2.5U/ μ L)): 0.5 μ L, template 1 μ L adds sterilization ultrapure water to 50 μ L;

Reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 64 ℃ of annealing 15s, 72 ℃ are extended 25s, 30 PCR circulations, 72 ℃ are extended 7min again.

At first utilize primer TB1, the front 391bp of TB2 amplification dissolving staphylococcal bacteria plain gene mature peptide sequence, suddenlyd change 373～375 codon of sequence of PCR product called after fragment 1, this fragment, the 125th amino acid of the albumen that also just suddenlyd change simultaneously;

Use and then primer TB3, TB4, reaction system and reaction conditions are the same, the rear 384bp of amplification dissolving staphylococcal bacteria plain gene mature peptide sequence.The suddenlyd change codon of 694～696 of sequences of PCR product called after fragment 2, this fragment.The 232nd amino acid of albumen has also just suddenlyd change simultaneously;

Use at last primer TB1 and TB5, take the mixture of segment 1 and fragment 2 equal proportions as template, reaction system is the same again.The PCR reaction conditions is: 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, 62 ℃ of annealing 15s, 72 ℃ are extended 45s, 30 PCR circulations, 72 ℃ are extended 10min again and finish to add 0.5 μ L rTaq archaeal dna polymerase, 0.5 μ L TB1 and 0.5 μ L TB5 in the product the inside of reaction afterwards, put in the PCR instrument 72 ℃ of reactions 10 minutes (purpose of this reaction be add at the resulting amplified production of previous step two ends A be convenient to next step and finish TA clone).To be the TA clone after the PCR product purification recovery of increasing, be connected to pMD-18T Vector, transformed competence colibacillus cell E.coli DH5 α, recon is selected in blue hickie screening by α-complementary, cut the positive recombinant plasmid of evaluation and deliver the order-checking of Shanghai biotechnology Services Co., Ltd through BamH I enzyme, the result shows that the dissolving staphylococcal bacteria plain gene is consistent with the sequence of announcement, and successfully realize the point mutation of lysostaphin mature peptide in predetermined site, the gained carrier is called recombinant plasmid plys.

Bovine beta-lactoglobulin signal peptide length is 48bp, GenBank ID:U31361.1.Then the method by PCR obtains merging the dissolving staphylococcal bacteria plain gene at 5 ' interpolation bovine beta-lactoglobulin signal peptide of the lysostaphin gene order of point mutation, and the purpose that adds the beta-lactoglobulin signal peptide is to be secreted in the milk after the dissolving staphylococcal bacteria plain gene is expressed in mammary gland cell.

Be to add BamH I restriction enzyme site carrying out PCR upstream and downstream primer, specific design is as follows:

LysBGHS：ggatccatga agtgcctcct gcttgccctg gccctcactt gtggcgccca ggccgctgcaacacatgaac attc

LysB GHA：ggatcctcac tttatagttc cccaaagaac acc

The PCR reaction system of 50 μ L is: 10 * PCR Buffer:5 μ L, dNTPs (2.5mmol/L): 4 μ L, upstream primer (10 μ mol/L): 1 μ L, downstream primer (10 μ mol/L): 1 μ L, LAtaq polysaccharase (5U/ μ L): 0.5 μ L, template is the lysostaphin PCR product 1 μ L after the point mutation, adds ultrapure water to 50 μ L.

Clone's the restructuring dissolving staphylococcal bacteria plain gene with the bovine beta-lactoglobulin signal peptide is connected with 4 ℃ of pMD-20T Vector and spends the night, transformed competence colibacillus cell E.coli DH5 α, recon is selected in blue hickie screening by α-complementary, cuts through BamH I enzyme and identifies positive recombinant plasmid and deliver the order-checking of Shanghai biotechnology Services Co., Ltd.Consistent with desired design shown in the sequencing result, successfully realize the lysostaphin gene cloning of restructuring, the gained carrier is called the plys carrier.Constructed restructuring dissolving staphylococcal bacteria plain gene, its concrete nucleotide sequence is shown in SEQ.ID.NO.1.

1.2 the amplification of regulating and controlling sequence and expression vector establishment

Utilize the regulating and controlling sequence of cattle beta-casein gene to regulate and control lysostaphin specific expression in bovine mammary epithelial cell of restructuring, the regulating and controlling sequence that specifically connects casein gene at 5 of goal gene ' end, be called CSN5 as controlling element, its function is to make restructuring dissolving staphylococcal bacteria plain gene specific expressed in mammary gland; Regulating and controlling sequence at goal gene 3 ' connection casein gene is called CSN3 as controlling element, and its function is to make restructuring dissolving staphylococcal bacteria plain gene can stop normally transcribing and translating in mammary gland cell.

The gene order of the cattle beta-casein of announcing according to GenBank ID:M55158.1, the regulating and controlling sequence of the about 2.8kb before this albumen initiator codon that increases.Xho I restriction enzyme site is added in the upstream.Primer is as follows:

CSN5F：ctcgagtgag aaaagggaaa tgttgaatgg g

CSN5R：atgcctaatg ttatctcccc tttgtcc

The PCR reaction system of 50 μ L is: 10 * PCR Buffer:5 μ L; dNTPs (2.5mmol/L): 4 μ L; upstream primer (10 μ mol/L): 1 μ L; downstream primer (10 μ mol/L): 1 μ L; LATaq polysaccharase (5U/ μ L): 0.5 μ L; normal cow genome group 1 μ L adds ultrapure water to 50 μ L.

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 63 ℃ of annealing 45s, 72 ℃ are extended 1min, 35 PCR circulations, 72 ℃ are extended 7min again.The nucleotide sequence of the CSN5 that increases is specifically shown in SEQ.ID.NO.2.

The gene order of the cattle beta-casein of announcing according to GenBank ID:M55158.1,3 ' control region of this albumen terminator codon 620bp that increases, restriction enzyme site BamH I is added in the upstream, and lower have the restriction enzyme site of an interpolation Acc65I.Primer is as follows:

CSN3F：aatgattcca agtaagccga tg

CSN3R：ggtaccacgc gttccaattt taattttcca cagc

The PCR reaction system of 50 μ L is: 10 * PCR Buffer:5 μ L; dNTPs (2.5mmol/L): 4 μ L; upstream primer (10 μ mol/L): 1 μ L; downstream primer (10 μ mol/L): 1 μ L; LATaq polysaccharase (5U/ μ L): 0.5 μ L; normal cow genome group 1 μ L adds ultrapure water to 50 μ L.

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 59 ℃ of annealing 45s, 72 ℃ are extended 1min, 35 PCR circulations, 72 ℃ are extended 7min again.The nucleotide sequence of the CSN3 that increases is specifically shown in SEQ.ID.NO.3.

Product with pcr amplification connects the pMD20-T carrier respectively, and enzyme cuts evaluation and order-checking obtains correct plasmid, respectively called after pCSN5, pCSN3.

Distinguish double digestion pCSN5, pCSN3 plasmid with BamH I and Acc65I, reclaim the large fragment of pCSN5 and the small segment of pCSN3, spend the night through 4 ℃ of connections of T4DNA ligase enzyme, recon transformed competence colibacillus cell E.coli DH5 α cuts the correct recon called after pCSN53 of evaluation through BamH I and Acc65I enzyme.

Again BamH I digested plasmid pCSN53 and plasmid plys reclaim the small segment of pCSN53 and plys, and 4 ℃ of connections of T4DNA ligase enzyme are spent the night, and recon transformed competence colibacillus cell E.coli DH5 α, enzyme cut and identify correct recon and order-checking, called after pCSN53lys.

1.3attB the clone of site and chicken beta Globulin insulator

The gene order of the attB that announces according to GenBank ID:X60952, with the carrier that comprises the attB sequence as amplification template.

The primer is as follows:

attBS：gtcgacgatg taggtcacgg ；

attBA：gtcgacatgc ccgccgt ；

The PCR reaction system of 50 μ L is: 5 * PCR Buffer:10 μ L, dNTPs (2.5mmol/L): 4 μ L, attBS (10 μ mol/L): 1 μ L, attBA (10 μ mol/L): 1 μ L, primestar polysaccharase (5U/ μ L): 0.5 μ L, template 1 μ L adds ultrapure water to 50 μ L.

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 1min, 31 PCR circulations, 72 ℃ are extended 7min again;

Add the rTaq polysaccharase of 0.5 μ L after the PCR reaction in system, 72 ℃ are extended 30min, finish to add the A process.

Adding PCR product behind the A is connected with 4 ℃ of pMD-20T Vector and spends the night, transformed competence colibacillus cell E.coli DH5 α, recon is selected in blue hickie screening by α-complementary, cuts through enzyme and identifies positive recombinant plasmid pattB and deliver the order-checking of Shanghai biotechnology Services Co., Ltd.

The nucleotide sequence of the attB that increases is shown in SEQ.ID.NO.4.

The gene order of the chicken beta Globulin insulator of announcing according to GenBank ID:U78775.2; two insulator elements that contain two repetitions with different restriction enzyme sites of method amplification with overlapping PCR; be not subjected near the impact of the silencer insertion point genome with protection goal gene and EGFP, goal gene and marker gene can normal expressions.

Primer and downstream primer add respectively Spe I, Nde I and two groups of restriction enzyme sites of BamH I, EcoR I at its upstream.Insulator amplification flow process referring to shown in Figure 3 designs two groups of primers.

First group of the primer is as follows:

Insulor21S：gacagaatca tagaacggcc gaaaagaagc aggctttcct

Insulor21A：catatgggcc gttctatgat tctgtc

Insulor22S：actagtgaaa agaagcaggc tttcct

Insulor22A：aggaaagcct gcttcttttc ggccgttcta tgattctgtc

Second group of the primer is as follows:

twoInsulor21S：gacagaatca tagaacggcc gaaaagaagc aggctttcct

twoInsulor21A：gaattcggcc gttctatgat tctgtc

twoInsulor22S：ggatccgaaa agaagcaggc tttcct

twoInsulor22A：aggaaagcct gcttcttttc ggccgttcta tgattctgtc

The PCR fs reaction system of 50 μ L is: 10 * PCR Buffer:5 μ L, dNTPs (2.5mmol/L): 4 μ L, upstream primer (10 μ mol/L) S:1 μ L, downstream primer (10 μ mol/L) A:1 μ L, primestar polysaccharase (5U/ μ L): 0.5 μ L, chicken blood genome: 1 μ L adds ultrapure water to 50 μ L.

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 63 ℃ of annealing 30s, 72 ℃ are extended 1min, 31 PCR circulations, 72 ℃ are extended 10min again.

Insulor21, Insulor22 fragment and twoInsulor21, twoInsulor22 fragment that the fs amplification obtains; Take Insulor21, Insulor22 fragment as template, the upstream and downstream primer is respectively Insulor22S and Insulor21A, carries out the amplification of pInsulator sequence; Take twoInsulor21 and twoInsulor22 fragment as template, the upstream and downstream primer is respectively twoInsulor22S and twoInsulor21A, carries out the amplification of ptwoInsulator sequence; Reaction system and response procedures are as follows:

The PCR reaction system of 50 μ L is: 5 * PCR Buffer:10 μ L, dNTPs (2.5mmol/L): 4 μ L, upstream primer (10 μ mol/L): 1 μ L, downstream primer (10 μ mol/L): 1 μ L, primestar polysaccharase (5U/ μ L): 0.5 μ L, template 1 μ L adds ultrapure water to 50 μ L.

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 63 ℃ of annealing 30s, 72 ℃ are extended 1min, 33 PCR circulations, 72 ℃ are extended 10min again.

Add the rTaq polysaccharase of 0.5 μ L after the PCR reaction in system, 72 ℃ are extended 30min, finish to add the A process.

Adding two groups of PCR products (pInsulator, ptwoInsulator) behind the A is connected with pMD-20T Vector4 ℃ and spends the night, transformed competence colibacillus cell E.coli DH5 α, recon is selected in blue hickie screening by α-complementary, cuts through enzyme and identifies positive recombinant plasmid pInsulator and ptwoInsulator and deliver the order-checking of Shanghai biotechnology Services Co., Ltd.

With Spe I and Nde I double digestion pInsulator, pattB plasmid, reclaim the large fragment of pattB and the small segment of pInsulator, spend the night through 4 ℃ of connections of T4DNA ligase enzyme, recon transformed competence colibacillus cell E.coli DH5 α cuts the correct recon called after pattBInsulator1 of evaluation through Spe I and Nde I enzyme.Again BamH I and EcoR I digested plasmid ptwoInsulator and pattBInsulator1, reclaim the small segment of pattBInsulator1 and ptwoInsulator, 4 ℃ of connections of T4DNA ligase enzyme are spent the night, recon transformed competence colibacillus cell E.coli DH5 α, enzyme is cut and is identified correct recon and order-checking, called after pattBInsulator12.The nucleotide sequence of the chicken beta Globulin insulator Insulator12 of two repetitions of wherein increasing is shown in SEQ.ID.NO.5.

1.4 the clone of antibiotic-screening gene and loxp sequence

Primers amplification according to carrier pEGFP-C1 comprises the 1642bp of antibiotic-screening gene neo to the sequence of 8bp, before upstream primer, add loxp sequence and the restriction enzyme site Ase I of 34bp, before downstream primer, add loxp sequence and the restriction enzyme site Mlu I of 34bp.Two loxp of place sequence directions of amplified production are consistent.The Loxp sequence is tattgaagca tattacatac gatatgcttc aata.

Design of primers is as follows:

neoloxp21S：acgcgttatt gaagcatatt acatacgata tgcttcaata aaattgtaag cgttaatattttgttaaaat tcg；

neoloxp21A：attaattatt gaagcatatc gtatgtaata tgcttcaata aactaatgca tggcggtaatacgg；

The PCR reaction system of 50 μ L is: 5 * PCR Buffer:10 μ L, dNTPs (2.5mmol/L): 4 μ L, neoloxp21S (10 μ mol/L): 1 μ L, neoloxp21A (10 μ mol/L): 1 μ L, primestar polysaccharase (5U/ μ L): 0.5 μ L, template 1 μ L adds ultrapure water to 50 μ L.

Add the rTaq polysaccharase of 0.5 μ L after the PCR reaction in system, 72 ℃ are extended 30min, finish to add the A process.

Adding PCR product behind the A is connected with 4 ℃ of pMD-20T Vector and spends the night, transformed competence colibacillus cell E.coli DH5 α, recon is selected in blue hickie screening by α-complementary, cuts through enzyme and identifies positive recombinant plasmid pneoloxp3100 and deliver the order-checking of Shanghai biotechnology Services Co., Ltd.

With Ase I and Mlu I double digestion pEGFP-C1, pneoloxp3100 plasmid, reclaim the large fragment of pEGFP-C1 and the large fragment of pneoloxp3100, spend the night through 4 ℃ of connections of T4DNA ligase enzyme, recon transformed competence colibacillus cell E.coli DH5 α cuts the correct recon called after pEGFP-C1loxp of evaluation through Spe I and Nde I enzyme.Plasmid pEGFP-C1loxp is transformed in the JM110 competent cell, again extract plasmid.

Use again BspE I and Xba I digested plasmid pEGFP-C1loxp, reclaim large fragment, fill sticky end with the Klenow enzyme, carry out from connecting with solution I, 4 ℃ of connections are spent the night, Cheng Huanhou transformed competence colibacillus cell E.coli DH5 α, enzyme is cut and is identified correct and order-checking, called after pEGFPloxp-plus.

With the synthetic multiple clone site that contains useful Spe I, EcoR I, 3 restriction enzyme sites of Xho I of the form of primer, two ends are sticky ends of Mlu I, first base of the adjacent sticky end of Spe I one side becomes A by T, and concrete sequence is as follows, MCS2F:cgcgactagtgaattcctcgaga

MC S2R：cgcgtctcgaggaattcactagt

With Mlu I single endonuclease digestion plasmid pEGFPloxp-plus, reclaim fragment, through the T4DNA ligase enzyme synthetic multiple clone site and enzyme are cut back to close 4 ℃ of products and be connected and spend the night recon transformed competence colibacillus cell E.coli DH5 α, cut the correct recon of evaluation, called after pEGFP-C1M. through Mlu I enzyme

Cut pEGFP-C1M and pattBInsulor12 with Spe I and EcoR I enzyme, reclaim the fragment of pEGFP-C1M and the small segment of pattBInsulor12, spend the night through 4 ℃ of connections of T4DNA ligase enzyme, recon transformed competence colibacillus cell E.coli DH5 α, enzyme is cut and is identified correct and order-checking, called after pEGFP-C1MA.

Cut pEGFP-C1MA and pCSN53lys with Xho I and Mlu I enzyme, reclaim the large fragment of pEGFP-C1MA fragment and pCSN53lys, spend the night recon transformed competence colibacillus cell E.coli DH5 α through 4 ℃ of connections of T4DNA ligase enzyme, enzyme is cut and is identified correct and order-checking, called after pEGFP-C1MAB.

At first identify that with the EcoR1109I single endonuclease digestion detected result can be seen the target stripe of a treaty 10000bp as shown in Figure 4 for the pEGFP-C1MAB carrier, stripe size and original vector in the same size illustrate that plasmid is no problem.

And then identify that with Mlu I and Xho I double digestion detected result can be seen two objective bands as shown in Figure 5, shows that plasmid is no problem, meets the big or small characteristics of former plasmid.

The endotoxic plasmid purification test kit of going with Promega company extracts concentration and the purity of measuring plasmid behind the plasmid with the nucleic acid-protein determinator, and after measured, the concentration of plasmid is 600ng/ μ l, and OD260/280 is 1.90, illustrates that plasmid is purer, can be used for transfection.

2, pEGFP-C1MAB expression vector transfection bovine fetal fibroblast and screen nuclear donor cell system

2.1, the cultivation of bovine fetal fibroblast

The bovine fetal fibroblast (＜3 generation) of getting a pipe holstein cow from liquid nitrogen thaws in 38 ℃, DMEM (Dulbecco ' s Modified Eagle Media) cell culture fluid that adds 0.8ml is centrifugal, abandon supernatant, it is resuspended to add cell nutrient solution (the DMEM cell culture fluid adds 10% foetal calf serum), get in the culture dish that the 3ml cell suspending liquid is inoculated in diameter 6cm, place CO ₂Cultivate under 38.5 ℃ of conditions in the incubator.

Treat that bovine fetal fibroblast reaches 80% when converging, inhale and abandon nutrient solution, use without Ca ²⁺, Mg ²⁺PBS flushing cell, add pancreatin and EDTA mixture slaking liquid, peptic cell.Observation of cell under inverted microscope is treated the most cells retraction, becomes circle, when the intercellular substance enlarges, is stopped digestion with the DMEM cell culture fluid that contains 10% foetal calf serum, after pipettor piping and druming, centrifugal collection suspends, be inoculated in 24 orifice plates in 1: 3 ratio, put into CO ₂Cultivate in the incubator.

As screening of medicaments, owing on the skeleton of expression vector pEGFP-C1MAB G418 resistant gene neo is arranged with G418 ^r, foreign gene neo ^rObtain expressing, so that under bovine fetal fibroblast can survive in the nutrient solution that contains finite concentration G418, and the normal cell of untransfected can be dead under this concentration, therefore needs the minimum lethal concentration of definite normal cell G418 to be used as screening concentration.

The mensuration of G418 minimum lethal concentration: the G418 that adds respectively concentration gradient in the bovine fetal fibroblast nutrient solution screened for 1 week, measured Normocellular G418 minimum lethal concentration.When the concentration of G418 in the cell culture fluid 〉=600 μ g/ml, all dead at the microscopically visible cell, so the minimum lethal concentration of G418 is 600 μ g/ml.

2.2, pEGFP-C1MAB expression vector transfection bovine fetal fibroblast

The present invention specifically adopts FuGen HD (Roche) transfection reagent under the condition that has serum to exist, expression vector pCMVINT and the bovine fetal fibroblast of cotransfection pEGFP-C1MAB and Phi C 31 integrase.Carry out transgenosis with FuGen HD transfection reagent and compare with other method, easy and simple to handle, good reproducibility, be not subjected to the restriction of DNA size, inorganization specificity and immunogenicity, do not need serum starvation, little to cell injury.Concrete operations are as follows:

Inoculation the day before yesterday is inoculated in the 2nd generation bovine fetal fibroblast in 6 orifice plates, and overnight incubation makes cell reach 70-80% to converge.For every porocyte, respectively the expression vector pCMVINT of the Phi C 31 integrase of 2 μ g pEGFP-C1MAB expression vectors and 2 μ g and the FuGen HD transfection reagent of 8 μ l are joined in the Opti-MEM nutrient solution, final volume is 200 μ l, behind the incubated at room 15min, slowly it is joined in the DMEM cell culture fluid that contains 10% foetal calf serum, be converted to the normal DMEM cell culture fluid that contains serum behind the 24h and continue to cultivate.

2.3, pEGFP-C1MAB carrier positive cell screening

After the nutrient solution that does not contain transfection reagent (the DMEM cell culture fluid that contains 10% foetal calf serum) cultivation transfectional cell 24 hours, the expression of visual report gene EGFP under fluorescent microscope, and in containing the DMEM cell culture fluid of 10% serum, add 600 μ g/ml G418 screening positive cell; With the negative contrast of the bovine fetal fibroblast of untransfected, its cell culture fluid is added with the G418 (600 μ g/ml) of same concentration.

The expression of visual report gene EGFP under fluorescent microscope, the result can see that under fluorescent microscope genetically modified bovine fetal fibroblast sends green fluorescence as shown in Figure 6, illustrates that pEGFP-C1MAB has entered cell and positive expression; Behind the pEGFP-C1MAB transfectional cell 7d, the cell of control group is all dead, the G418 concentration that will comprise the groups of cells of the pEGFP-C1MAB transfection positive reduces by half and continues screening until cell covers with at the bottom of the ware, can see positive cell and form island shape cell mass, under fluorescent microscope, still can see green fluorescence; Then peptic cell usefulness does not add the normal nutrient solution enlarged culturing of G418.

The positive cell that screens all is the cell of stable transfection pEGFP-C1MAB, and goal gene is incorporated on the genome of cell, rather than is free on outside the genome; In the process of stable transfection, under the mediation of Φ C31 site-specific integration enzyme, the gene that carries on the plasmid pEGFP-C1MAB can be incorporated on the specific false attP of the genome position of host cell; Screen 7 days more lasting purposes that reach stable transfection of screening of half-value dose by G418, show as reporter gene continuous expression in transfected positive cell, therefore the positive cell of screening continues to send green fluorescence and presents the G418 resistance.

2.4, the PCR of pEGFP-C1MAB carrier positive cell identifies

Get the bovine fetal fibroblast of the pEGFP-C1MAB positive expression that passed to for the 8th generation, extract cell genomic dna, take genomic dna as template, PCR identifies whether restructuring dissolving staphylococcal bacteria plain gene is incorporated in the cellular genome, negative control is the normal bovine fetal fibroblast of untransfected, and PCR identifies that the primer is to being P1 and P2;

P1：atgaagtgcc tcctgcttgc cc

P2：tcactttata gttccccaaa gaacacc

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 63 ℃ of annealing 30s, 72 ℃ are extended 1min, 30 PCR circulations, 72 ℃ are extended 7min again; Reclaim the PCR product and carry out the detection of 0.8% agarose gel electrophoresis, detected result as shown in Figure 7, wherein, swimming lane M is DNAMarker, swimming lane 2 is the bovine fetal fibroblast of untransfected, and swimming lane 1 is the bovine fetal fibroblast of pEGFP-C1MAB transfection, and swimming lane 1 is compared with 2, obviously can see the band about a treaty 800bp, goal gene is 789bp.And see not that as the swimming lane 1 of negative control the illustration purpose gene integration has arrived the genome of host cell bovine fetal fibroblast.

Restructuring lysostaphin gene integration has arrived the genome of host cell bovine fetal fibroblast, and 5 ' control region of the bovine beta-casein that is attached thereto and 3 ' control region also can be incorporated into the genome of bovine fetal fibroblast with goal gene.

2.5, the detection of pEGFP-C1MAB carrier positive cell integration site

Cut pEGFP-C1MAB carrier positive cell genome with BamH I enzyme, reclaim enzyme after 12 hours and cut product also with 50 μ L water elution liquid wash-outs, add 50 μ L solution I and be made into the linked system of 100 μ L, the connection of spending the night, directly take connect product as template direction of travel PCR. primer as follows:

P2S：cgatgtaggt cacggtctcg aag；

P2A：cgcagtcaat tctgtggaat aggg；

The PCR reaction system of 50 μ L is: 10 * PCR Buffer:5 μ L, dNTPs (2.5mmol/L): 4 μ L, anti-1S (10 μ mol/L): 1 μ L, anti-1A (10 μ mol/L): 1 μ L, LA Taq polysaccharase (5U/ μ L): 0.5 μ L, template 1 μ L adds ultrapure water to 50 μ L.

The PCR reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of annealing 45s, 72 ℃ are extended 1min, 38 PCR circulations, 72 ℃ are extended 7min again; Reclaim the PCR product; carry out the PCR reaction of same program take the PCR product as template; and detect with 0.8% agarose gel electrophoresis; detected result as shown in Figure 8, wherein, swimming lane M is Trans100bp Marker; swimming lane 1 is the cow genome of untransfected; swimming lane 2 is the bovine fetal fibroblast genome of pEGFP-C1MAB transfection, and swimming lane 2 is compared with 1, obviously can see the band about a treaty 500bp.And do not see as the swimming lane 1 of negative control.Illustrate that the positive cell genome is combined with reverse primer, amplify the PCR product, the insertion of illustration purpose gene is simultaneously carried out site-directed integration according to the insertion principle of φ C31 intergrase.

For the second time the PCR product is delivered the order-checking of Shanghai biotechnology Services Co., Ltd, and the genome of ox is compared among sequencing result and the NCBI, comparison result as shown in Figure 9, the result shows that goal gene is inserted in No. 9 karyomit(e)s of ox.

2.6, the Southern blotting of pEGFP-C1MAB carrier positive cell detects

With the positive cell genomic dna, do Southern blotting testing goal gene and whether be entirely integrated in the genome of bovine fetal fibroblast.Used probe sequence T1 and T2 are as follows:

T1：tggtcaaata atcggttggt ctg

T2：ccaaacatga ccgtcttgtt tca

The experimental implementation of Southern blotting is finished according to the experimental program that Roche company provides, and cuts the positive cell genome with the restriction enzyme HindIII enzyme that spends the night, detected result as shown in figure 10, the expression goal gene has been inserted in the genome.

3, with above-mentioned genome conformity the bovine fetal fibroblast of restructuring dissolving staphylococcal bacteria plain gene as nuclear donor cell, make up the transgene clone embryo.

3.1, the maturation in vitro of ovocyte cultivates

Ovary picks up from ox slaughterhouse, Xi'an, the aseptic holstein cow ovary of taking, transport the laboratory back in 2-3 hour, extract the ovarian follicle of 3～8mm diameter, collect ovocyte ovarian cumulus complex body, select under the stereomicroscope and have complete cumulus cell more than three layers, the uniform ovocyte of kytoplasm is used for ripe the cultivation.The maturation culture solution of ovocyte is: TCM199 (Gibaco) adds 10% foetal calf serum, the Urogastron of 10ng/ml, and culture condition is: 38.5 ℃, 5%CO ₂, 95% air atmosphere surrounding, saturated humidity; Remove cumulus cell with 0.2% Unidasa behind the ripe 20h of cultivation, with the criterion of first polar body discharging as oocyte maturation, select mature oocyte and be used for the nuclear transplantation test.

3.2 the structure of transgene clone embryo

The present invention adopts body-cell neucleus transplanting (SCNT) technology that donor nuclei is transferred to and removes in the nuclear mature oocyte, wherein, the donorcells that is integrated with foreign gene controlled in 10 generations, and this mainly considers to reduce the accumulation of sudden change in culturing process that vitro culture causes.

Nuclear transplantation is specially: micrurgy liquid is for containing 10%FBS, the PBS of 5 μ g/ml cytochalasin Bs, stoning pipe sucking-off first polar body and part kytoplasm on the micrurgy instrument with internal diameter 20 μ m, with 10 μ g/mlHoechst, 33342 dyeing 10min, under fluorescent microscope, choose complete non-nucleus egg mother cell; Remove first polar body fully and chromosomal ovocyte is used to nuclear transplantation.

Notes nuclear and the fusion of ovocyte, detailed process is as follows: the He Sitan bovine fetal fibroblast of the transfection pBELS in 6～10 generations of 0.25% tryptic digestion contact inhibition 3d is as donor cell.With the stoning pipe donorcells is injected under the ovocyte zona pellucida of stoning success.The caryoplasm complex body merges balance 3min in the liquid at electricity, merge with the microelectrode method, use the microelectrode tip that is connected with the micrurgy instrument to arrange recombinant chou, make the film contact surface vertical with the line of two electrodes, push down gently recombinant chou with the microelectrode point, give electricimpulse and carry out the electricity fusion.Fusion voltage is 28V, and time of fusion is 10 μ m.Recombinant chou after the fusion is put into the M199 of 10%FBS, 38.5 ℃, 5%CO ₂, full closing under the humidity cultivate, and observes the fusion situation behind the 2h.

3.3, activation and the vitro culture of transgene clone embryo

The reconstituted embryo (cell-ooecium matter recombinant chou) that merges is in containing the M199 of 10%FBS behind the balance 2h, with containing 5 μ mol/L ionomycin (Ionomycin, available from SIGMA company) mSOFaa nutrient solution (available from SIGMA company) process 5min, then in the mSOFaa nutrient solution that contains 2mmol/L dimethylaminopurine (6-DMAP), cultivate 5h, transfer to after washing 3 times in the mSOF aa droplet and cultivate, culture density is 5 each reconstituted embryo of μ L, at 38.5 ℃, 5%CO ₂, cultivate under the saturated humidity, every 48h half amount is changed liquid 1 time, checks the blastaea developmental state on the 7th～9 day, as shown in figure 11, the normal development of clone's embryo is to blastaea.

3.4, transgene clone embryo PCR identifies goal gene

The extraction of restructuring embryo genomic dna: the embryo's sample of will recombinate is put into the centrifuge tube of 100 μ l sterilization, adds the 20 μ l distilled water of sterilizing, and boils behind the 5m in slightly centrifugally, places-20 ℃ to preserve or be directly used in PCR.

Take the genome of the recombinant clone embryo that extracts as template, PCR identifies restructuring dissolving staphylococcal bacteria plain gene, and the PCR reaction: reaction system and process are with step 2.4.With the negative contrast of not genetically modified clone's embryo.Pcr amplification product is through 0.8% agarose gel electrophoresis, obtained the big or small amplified band about 800bp that is, conform to the expection size, as shown in figure 12, wherein, swimming lane M is 100bp DNALadder, swimming lane 1 is not genetically modified clone's embryo, swimming lane 2 is the recombinant clone embryo, and swimming lane 2 is compared with 1, obviously can see a band about 789bp.Illustration purpose gene lysostaphin is incorporated in the embryonic gene group.

4, the embryo transfer of transgene clone embryo and gestation are identified

The 7th day blastaea moves into behind the spontaneous estrus the 7th day He Sitan recipient cattle intrauterine with Nonoperative method, and each recipient cattle is transplanted 2 pieces of blastaeas.Observe it after recipient cattle is transplanted and return the feelings situation, the 60d after transplanting that does not return feelings is done conceived the inspection with B ultrasonic.Check once every January later on, to observe the pregnancy maintenance situation.

Co-transplantation of the present invention turns in the acceptor Contents in Cows of restructuring lysostaphin gene clone embryo to 100 estrus synchronization, has after two months 48 to set up gestation, has 30 to keep gestation and will continue monitored after 3 months.

Claims (4)

1. mammary gland specific expression vector of dissolving staphylococcal bacteria plain gene of recombinating, it is characterized in that, comprise the restructuring dissolving staphylococcal bacteria plain gene shown in the SEQ.ID.NO.1, its 5' end connects the CSN5 controlling element shown in SEQ.ID.NO.2, at the CSN3 controlling element of its 3' end connection shown in SEQ.ID.NO.3;

The 5' end of CSN5 controlling element also is provided with fluorescent mark gene and promotor successively, is provided with the antibiotic-screening gene between CSN3 controlling element and promotor.

2. the mammary gland specific expression vector of a kind of dissolving staphylococcal bacteria plain gene of recombinating as claimed in claim 1, it is characterized in that, between fluorescent mark gene and CSN5 controlling element, also be provided with att B sequence, also be respectively equipped with the insulator sequence in the upstream and downstream of att B sequence; Upstream and downstream at the antibiotic-screening gene is connected with the loxp sequence.

3. the reconstitution cell that makes up based on the mammary gland specific expression vector of restructuring lysostaphin claimed in claim 2, it is characterized in that, take the holstein cow fetal fibroblast as host cell, with the expression vector cotransfection of the mammary gland specific expression vector of linearizing restructuring lysostaphin and Phi C 31 integrase in host cell.

4. reconstitution cell claimed in claim 3 makes up the application of the nuclear donor cell of transgene clone embryo as nuclear transplantation.

Images