CN100445379C - Human alpha-lacto albumin gene transgenic cloned macro domectic animal production method - Google Patents

Abstract

The present invention relates to a producing method of transgenic cloned heavy livestock with the transferring human alpha-whey gene, which comprises the following operating procedures: (1) building a galactophore specific expressing carrier with the complete gene frame of the human alpha-whey protein, (2) building a cascaded structure between the galactophore specific expressing carrier of the human alpha-whey protein and a double-label choosing carrier, and transmitting the cascaded structure DNA into livestock body nucleoli to obtain transgenic cells, (3) cloning the body cells with the transgenic cells as a nucleolus donor to obtain the transgenic cloned heavy livestock with the transferred human alpha-whey protein. The recombinant human alpha-whey protein specifically expressed by the transgenic milk cow galactophore can be developed into health-care products and medicines; milk containing the recombinant human alpha-whey protein can be directly developed into health-care milk and milk products with high added values.

Description

Change the production method of the zooblast of human alpha-lactalbumin gene

Technical field

The present invention relates to bioengineering field, particularly relate to transgenosis-clone technology field.

Background technology

Study on Transgenic Animal be human according to own wish have purpose, planned, with good grounds, the genetic composition of pre-insight change animal is arranged, and the purpose that changes its genetic composition is diversified.Wish that such as the geneticist observing its phenotype by the genetic composition that changes animal changes, the physiologist wishes to study by the expression of specific gene the influence of this gene pairs organism physiology situation.Producing relevant transgenic research with animal then wishes to give animal new phenotypic character by transgenic technology.The research relies on molecular biology, animal embryo and gamete operative technique on experimental technique.

The making method of transgenic animal mainly contains the microinjection of pronuclear-stage embryos at present, retroviral infection is grown early stage animal embryo, the sperm vector method, the ES cell technology, the PGCs technology, somatic cell nuclear transfer technique, retroviral vector infects the ovocyte of MII phase, and sperm head and DNA merge injection ovocyte method.Improvement on these methods has promoted the process that Study on Transgenic Animal is transformed to production practice by the laboratory widely with raising.

Wherein traditional and the most the most frequently used method is the microinjection of pronuclear-stage embryos, and this method is one of method of using at present the making transgenic animal relatively more extensive, that effect is more stable by American Gordon invention.Promptly under the micrurgy instrument, foreign DNA is injected in the protokaryon of fertilised non-human eggs cell by a glass capillary, again this fertilized egg cell is transplanted into recipient cell intrauterine, during again with this zygote division, foreign DNA may be integrated into the host chromosome group, treats that this development of fertilized ova maturation can obtain transgenic animal.But the efficient of the breeding transgenic livestock that microinjection obtains is extremely low, ox particularly, and sheep and pig etc. often are lower than 1%, and this will increase the cost of making breeding transgenic livestock greatly.

Along with the development of somatic cell clone technique, it is to become transgenic animal that gene manipulation techniques combines with clone technology, particularly the main mode of big Livestock Production.At present, the major progress that obtains is transgenic technology and the application of target position operative technique on cloned animal.At first, utilize the clone to carry out transgenosis and be meant before nuclear transplantation, earlier the fusion gene of goal gene and marker gene is imported the somatocyte of cultivating, screen genetically modified positive cell and clone thereof by the performance of marker gene again, and then transplant.1997, the scientist Schnieke of Britain PPL company and the Wilmut of Roslyn institute etc. were jointly by the somatic cell nuclear transfer technique Transgenic Sheep that takes the lead in having made in the world.Utilize fetal fibroblast system,, clone again through after the transfection.Transfected foreign gene contains the complete coding region and the β-BLG gene promoter of people's plasma thromboplastin component gene, and plasma thromboplastin component can be efficiently expressed, and comprises the plasma thromboplastin component albumen of 125 μ g in every milliliter of milk.Utilize the clone to carry out transgenosis, in case the nuclear transplantation success, theoretically, the transgenosis success ratio is 100%.The method of procaryotic injection can make a large amount of non-transgenic embryos by pregnancy, and this is a kind of wasting of resources, can not cause the surrogate mother to go conceived non-transgenic animal and utilize the clone to carry out transgenic technology.In addition, when utilizing the clone to carry out transgenosis, the sex of transgenic animal can be determined in advance.Like this, if expect can be in mammary gland marking protein, the transgenic animal that just can make the clone are jenny entirely.

Because the animal transgenic technology can change the production traits of animal according to people's wish, obtain the needed product of people, particularly some albumen medicine and healthcare products, scientists has begun the animal transgenic technology is applied in the middle of the practice, at present the animal transgenic technology mainly contains following application: (1), promote growth of animal, improve the output of live-stock product, improve product quality, (2), animal disease resistant breeding, (3) set up the animal model of diagnosing and treating human diseases, (4) produce pharmaceutical protein.

Animal mammary gland bioreactor is a kind of animal transgenic technology proteic technology such as express polypeptide medicine, industrial enzyme, vaccine and antibody in mammary gland cell of utilizing.The function of transforming mammary gland by engineered method helps the mechanism that we further study mammary cancer, improves the nutritive ingredient of milk, even can synthetic drugs.This technology has the low characteristics that drop into high production, and its efficient is 100 times that utilize with intestinal bacteria and animal cell culture technology, is a kind of very potential new and high technology.1987, people such as Simons successfully expressed sheep lactoglobulin gene first in transgenic mouse milk, and the protein content in the mouse milk sample approximately is that animal cell expression is proteic more than 400 times up to 23 grams per liters.This technology is once swift and violent development occurring just obtaining.At present, cow's milk albumin gene people organizes the profibr(in)olysin factor, and human growth hormone gene, human body antitrypsin gene, genes such as human urokinase gene and human interferon gene all obtain expressing in the mammary gland of mouse.Various famous scientists thinks that this will be the unprecedented revolution of livestock industry, may bring huge economic benefit to society.In in the past 10 years, there have been tens companies to carry out the research work of this respect.Especially, along with the animal cloning technology maturation, transgenic technology has obtained development more fully.This will make the scale operation of galactophore biological reactor real more, and therefore the international competition around this technology will be inevitable.

Utilize the method for galactophore biological reactor to transform milk cow, milk goat, make the milk composition of producing be similar to people's milk, both nutritious function, medicinal function is arranged again, this milk can make child look tall and big, promote brain and neurodevelopment, raise immunity, this new health care product necessarily has wide future.The nutrition or the physiological and biochemical property that improve milk also are that people wish one of target that realizes by the genetic composition that changes animal, promptly make so-called nutritional medicine (Nutraceuticals).Domestic animal milk and converted products thereof can provide human 30% nutrient protein, contain abundant indispensable amino acid, calcium and inorganic phosphate, and the very high casein of digestibility, are human high-quality source of nutrition; But breast is also not fully up to expectations on quality with domestic animal milk.Therefore, people are studying always and how to improve milk quality.Since Gordon foundes the animal transgenic technology, all try to be the first and carry out transgenic breeding and correlation technique research thereof in countries in the world.Studies show that foreign gene can not only obtain integrating and express in transgenic animal, and can obtain tissue specificity (mammary tissue, uterine tube) and development-specific expression, and can utilize molecular engineering to find all genes of regulating milk-content now.

Alpha-lactalbumin is little, the tart of molecular weight, the Ca of high-affinity ²⁺Conjugated protein, it almost is present in all Mammals milk.In mammary gland secretory cell, alpha-lactalbumin is as regulating subunit synthetic by with galactoside transferase interaction catalysis lactose.The different folding mutant of also finding alpha-lactalbumin recently has the function of sterilization and inducing death of neoplastic cells, can also form the papilloma that mixture kills skin with oleic acid, has broad application prospects.

The function of alpha-lactalbumin:

(1) nutritive value of alpha-lactalbumin.Because alpha-lactalbumin is moiety important in the human milk, account for 28% of total protein content, account for 49% of protein content of whey, can imagine that alpha-lactalbumin is except physiological function, or important nutritive ingredient in the milk.If relatively the amino acid of people's milk and dairy protein is formed, will find that the content of tryptophane and halfcystine is starkly lower than the content in people's milk in the milk, is that the content of alpha-lactalbumin is lower in the milk and cause this result's major cause.The content of alpha-lactalbumin tryptophane and halfcystine (wt/wt) is respectively 6% and 5% in the human milk.Tryptophane is must amino acid, must supply with by breast milk, though and halfcystine is not must amino acid because newborn baby's metabolic system imperfection, if edible milk also may cause the shortage of halfcystine.Tryptophane and halfcystine also may participate in the activity of infant's important physical.For example, tryptophane may be relevant with sleeping behavior, eats the infant of milk always, and their sleep may be affected; And halfcystine is the integral part of Triptide, and it can be used as antioxidant, and the protection cell is avoided the injury of oxygenizement.Therefore, more Ensure Liquid is reasonable for the milk preparation that makes the infant, and people have begun to attempt milk people emulsification, and the work of this respect is also being carried out in our laboratory.

(2) alpha-lactalbumin is regulated lactose synthetic function.People know that very early alpha-lactalbumin is an integral part of lactose synthetase, under the glucose existence condition, combines with galactoside transferase, regulates the specificity of this enzyme.Because alpha-lactalbumin is easy to depolymerization from the galactoside transferase, so long regard it as lactose synthetase one and regulate subunit, thereby what rise in lactose is synthetic is regulating effect.Another subunit of this enzyme is galactoside transferase (GT), it can the catalysis galactose residue in multiple secretory cell from the UDP-semi-lactosi to glycoprotein.And in mammiferous mammary gland, narrow spectrum galactoside transferase and alpha-lactalbumin interact, and can increase affinity and the specificity of GT to glucose by this process, make its catalytic substrate object become glucose, and whole catalytic process is as follows:

This is reflected in the golgi body and takes place, and alpha-lactalbumin combines with galactoside transferase on the golgi body inner membrance and forms lactose synthetase, and this combination makes lactose synthetase increase greatly for the avidity of glucose.Because alpha-lactalbumin is continuous excretory, therefore, it is kept for the lactose synthetic is very necessary.Lactose and containing of alpha-lactalbumin take temperature from known various animal milk, they the two between and be proportionate between the secretory volume of they and breast.The synthetic beginning of lactose appearance total and alpha-lactalbumin is accompanied, and this has obtained proof in many experiments.In addition, experiment and experiment in vitro show in the body, the synthetic influence that is subjected to prolactin or galactagogin and glucocorticosteroid of alpha-lactalbumin, but can be suppressed by progesterone period of pregnancy.

(3) function of the sterilization of alpha-lactalbumin and cell death inducing.People such as Pelligrini find with trypsinase and Chymotrypsin hydrolysis alpha-lactalbumin, three kinds of polypeptide have been produced with sterilization idiocratic, these polypeptide work to most gram-positive microorganisms, and this explanation alpha-lactalbumin has anti-microbial effect after being degraded by endopeptidase.Hakansson et al has found a kind of mutant of alpha-lactalbumin conformation, and this mutant is to antibiotic sensitive and have the streptococcus pneumoniae of resistance all to have kill capability.Albumen with fungicidal activity can be separated from casein by ion-exchange and gel chromatography.More interesting discovery is the alpha-lactalbumin of native state, having in the presence of the C18:1 lipid acid, can be transformed into the form with fungicidal activity, and as noted earlier, alpha-lactalbumin has several lipid acid binding sites.

Recently Hakansson and Svensson etc. have described the possible more attracting function of alpha-lactalbumin, and they find some polymers, though can not represent the characteristic of alpha-lactalbumin derivative fully, they are effective Ca ²⁺Increase and the dead inductor of programming, have cytotoxicity widely, can kill the embryo and the lymphocyte of all experiments.Polymeric alpha-lactalbumin form can partly be separated from the casein of milk.As if discover that further alpha-lactalbumin induces the dead part of programming comprising this proteic oligomer, and oligomer experiences the change of similar molten ball conformation again, oligomerization is keeping the molten spherical attitude of alpha-lactalbumin biologically active.The front was carried, at Zn ²⁺Exist down, can obtain the aggregation of alpha-lactalbumin, but not know whether they have cytotoxicity.The alpha-lactalbumin of multimerization is attached to cell surface, enters tenuigenin and accumulates in nucleus; Simultaneously, we also find to take off ionic alpha-lactalbumin and Zn ²⁺In conjunction with comparing Ca with the interaction of immobilized artificial membrane ²⁺Conjugated protein more effective with interaction immobilized artificial membrane, these two phenomenons are on all four.People such as Kohler point out that also the polymeric alpha-lactalbumin can activate Caspases, and induce programming dead, and the direct line of action plastochondria of alpha-lactalbumin, cause the release of cytochrome C, and this is a dead initial very important step of cell programming.

(4) alpha-lactalbumin has the function of treatment papilloma: for human alpha-lactalbumin, the most breathtaking research recently is to find that alpha-lactalbumin oleic acid mixture can suppress and remove papilloma.Papilloma is a kind of by caused, the common tumour of keratinocyte infection papillomavirus, usually occurs in skin and mucous epithelium.The skin papilloma generally is benign, and the mucous epithelium papilloma can cause some other malignant tumour.People such as Gustafsson (2005) utilize cation-exchange chromatography to obtain human alpha-lactalbumin and C18:1 fatty acid complexes, to 40 papilloma patients carry out at random, be contrast with the placebo, the topical therapeutic of double blinding, the first stage of treatment result shows, patient's papilloma focus of 75% is obviously dwindled, and control group has only 15%; Second phase treated after 2 years, patient's papilloma focal cleaning of 83%, and, show that alpha-lactalbumin oleic acid mixture has good efficacy for papilloma without any side effect.Alpha-lactalbumin oleic acid mixture also has the effect of the kill tumor cell of broad-spectrum, and to not infringement of normal cell.

Present human alpha-lactalbumin is purifying from people's milk mainly, because the source is limited, limited the use of human alpha-lactalbumin, therefore utilized the clened cows mammary gland that changes the human alpha-lactalbumin gene to produce recombination human alpha-whey albumen significant as pharmaceutical protein and healthcare products.

The alpha-lactalbumin gene of people, ox, goat and sheep is positioned in respectively on the 12nd, 5,5 and No. 3 karyomit(e), the also known in the world gene that obtains multiple coding alpha-lactalbumin.Except that the alpha-lactalbumin gene of wallaby, this gene transcription element length of other species all about 2Kb, generally comprises 4 exons.The sequence of people and mouse alpha-lactalbumin gene and genome are studied clear at first.Human alpha-lactalbumin full length gene 2433bp, the long 717bp of exon, the long 1636bp of intron.The human alpha-lactalbumin gene order contains Alu repeated sequence, and this sequence is oppositely inserted among the intron I, and Alu sequence has 500 approximately in human genome, 000 copy accounts for human total genomicly 5%～6%, and the member is numerous, nearly 300,000 kinds, so claim Alu sequence family.Alu sequence in the human alpha-lactalbumin gene and its homology of Alu common sequences reach 88%, contain the conservative intraware of various Alu and Alu sample sequence.Remove four kinds of corresponding exon sequences in this genetic transcription unit of wallaby with other, may also have the 5th exons structure, one section sequence in four other exons 5 ' end upstream exists without any regulating and controlling sequence, people infer that it may comprise the 5th exon, but this also needs further confirmation.

For human alpha-lactalbumin, the transgenic research report is also few at present, mainly lays particular emphasis on the regulation and control and the expression study of alpha-lactalbumin gene.The Fujiwara etc. of Japan utilized 210kb to contain human alpha-lactalbumin gene complete expression regulation unit in 1997 to carry out transgenic rat research, in transgenic rat milk, obtain efficiently expressing of 2.0-4.3mg/ml human alpha-lactalbumin, and be not subjected to the influence of position effect.Takase and Hagiwara utilize the human alpha-lactalbumin gene cDNA to carry out transgene tobacco research, have expressed the 5mg human alpha-lactalbumin with natural radioactivity in the 5g leaf.After Fujiwara in 1999 etc. have done a large amount of analysis and research work, think that the human alpha-lactalbumin gene of 3 ' flanking region of the 5 ' flanking region that comprises 50kb and 50kb can obtain the stably express that not influenced by position effect, but the transgene expression of 3 ' flanking region that only contains 5 ' and the 20kb of 20kb can be subjected to the influence of position effect.People such as Liu Si state in 2003 utilize 5 ' the end control region of human alpha-lactalbumin gene 7.3kb, 2.0kb the coding region and Trobest 3 ' the end control region carrier construction of 227bp, in five transgenic mices, only there is a mouse can detect the expression of human alpha-lactalbumin (0.3mg/ml), shows that this expression vector is not very desirable.

Human alpha-lactalbumin also has germicidal action except having important nutritive value, and the function of treatment tumour.Because human alpha-lactalbumin is mainly purified from people's milk at present, it is limited to originate, and therefore utilizes the particularly big Livestock Production recombination human alpha-whey of transgenic animal albumen, will have important application prospects.Reaching its maturity of clone technology not only makes the animal transgenic technology obtain developing more fully and replenishing, and also makes to utilize the various important function albumen of galactophore biological reactor scale operation reality more.Adopt genomic dna to make transgenic animal than the more high efficiency expression of the acquisition of cDNA sequence [5] as goal gene, but excessive fragment is not easy to genetic manipulation again, the minor structure transgene carrier that therefore obtains to efficiently express has great significance.Up to the present, also never see the transgenosis report of alpha-lactalbumin complete genome DNA.

Summary of the invention

The present invention is directed to the blank in the above-mentioned field, combine by transgenosis, cell transfecting technology and somatic cell clone technique, provide a kind of commentaries on classics people α--the transgene cloning great cattle production method of lactalbumin gene, for we realize milk people emulsification and develop recombination human alpha-whey albumen healthcare products and medicine lays the foundation.

The invention provides a kind of production method of changeing the zooblast of human alpha-lactalbumin gene, its operation steps is as follows: (1) utilizes complete human alpha-lactalbumin gene structure to make up mammary gland-specific expression vector phLa4, (2) the cascaded structure phLa4-EGFP-NEO of structure human alpha-lactalbumin mammary gland-specific expression vector phLa4 and double alternative carrier pEGFP-NEO, the cascaded structure DNA that obtains is imported in the domestic animal somatic cell nuclear, obtain transgenic cell; Wherein, described heavy livestock is meant ox, goat, sheep, pig or rabbit, the nucleotide sequence of complete human alpha-lactalbumin gene structure is shown in SEQ ID NO:1, the structure of mammary gland-specific expression vector phLa4 as shown in Figure 1, the structure of double alternative carrier pEGFP-NEO as shown in Figure 2, the enzyme tangent line collection of illustrative plates of cascaded structure phLa4-EGFP-NEO is as shown in Figure 3.

Described introduction method is the electroporation transfection method.

Described heavy livestock is an ox.

Double alternative carrier pEGFP-NEO was built into phLa4-EGFP-NEO on the phLa4 expression vector that the present invention will obtain efficiently expressing in mouse mammary gland connected.Utilize electric shock transfection and G418 screening to take out transgenic cell, carry out mono-clonal again and cultivate.Utilize somatic cell clone technique to obtain the transgene clone ox, detect, obtain the transgene clone ox that three commentaries on classics have phLa4-EGFP-NEO altogether through PCR and Southern.All can express the recombination human alpha-whey albumen with natural radioactivity in these transgenic cattle mammary gland, expression level is the 1.10-1.55 grams per liter.The recombination human alpha-whey albumen of these transgenosis cow mammary gland specifically expressings can be developed to healthcare products and medicine, contain nourishing milk and milk preparation that the proteic milk of recombination human alpha-whey also can directly be developed to high added value.

The present invention explores and perfect cell transfecting technology and somatic cell clone technique combine produces the approach of the transgenic animal of carrying external source functional gene (goal gene autogenous control element), and transgenic animal have greatly been improved, the make efficiency of the big domestic animal of transgenosis particularly, technological line used in the present invention is applicable to the underlying group production of transgenic cattle, goat, sheep, pig and rabbit and expands numerous.

Description of drawings

Fig. 1: human alpha-lactalbumin full gene cloning phLa4 structural pattern figure

Fig. 2: the structure iron of double alternative carrier pEGFP-NEO

EGFP is for strengthening green fluorescence protein gene, and NEO is a neomycin resistance gene, and IRES is a ribosome bind site, and SalI, NotI, AscI and BamHI are restriction enzyme site, and CMV-IE Enhancer is the CMV-IE enhanser, 21 promotors that pEF321 has been EF.

Fig. 3: the linear collection of illustrative plates after the phLa4-EGFP-NEO enzyme is cut

Human alpha-lactalbumin is the human milk alpha-lactalbumin gene that disappears, and GFP is for strengthening green fluorescence protein gene, and Neomycin is a neomycin resistance gene, SalI, NotI, BamHI and MluI are restriction enzyme site, and Ampicillin is an ampicillin resistance gene

The amplification of Fig. 4: hLA5 ' end primer.

M:1kb ladder; 1: Xing Wa; 2: Long Wa; 3: the meeting baby; 4: the non-transgenic clened cows; 5: positive control; 6: negative control; 7:blank.

The amplification of Fig. 5: hLA3 ' end primer.

M:1kb ladder; 1: Xing Wa; 2: Long Wa; 3: meeting baby: 4: the non-transgenic clened cows; 5: positive control; 6: negative control; 7:blank.

Fig. 6: the amplification of GFP primer.

M:1kb ladder; 1: Xing Wa; 2: Long Wa; 3: the meeting baby; 4: the non-transgenic clened cows; 5: positive control 1; 6: positive control 2; 7: negative control; 8:Blank

Fig. 7: the amplification of NEO primer

.M:1kb ladder; 1: Xing Wa; 2: Long Wa; 3: the meeting baby; 4: the non-transgenic clened cows; 5: positive control 1; 6: positive control 2; 7: negative control; 8:Blank

Fig. 8: the Southern result of hLA transgene clone ox.

Swimming lane 1 is Xing Wa, and swimming lane 2 is grand baby, swimming lane 3 and 4 negative contrasts, and swimming lane 5-7 is respectively the positive control of 1,2 and 5 copy.

Fig. 9 Xing Wa, Long Wa and meeting baby and non-the subtracting property PAGE of contrast cow's milk sample electrophorogram, swimming lane 1:HLA standard substance, 2: human milk, 3: emerging baby's breast sample, 4: grand baby's breast sample, 5: meeting baby breast sample, 6: two mark carrier transgene cow milk samples, 7: clone's cow's milk sample, 8: common ox lactagogue sample, 9: the normal galactopoiesis sample of common ox

Figure 10 Xing Wa, Long Wa and meeting baby and contrast cow's milk sample Western results of hybridization, swimming lane 1:HLA standard substance (14.1kD), 2: human milk, 3: emerging baby's breast sample, 4: grand baby's breast sample, 5: meeting baby breast sample, 6: two mark carrier transgene cow milk samples, 7: clone's cow's milk sample, 8: common ox lactagogue sample, 9: the normal galactopoiesis sample of common ox.

Figure 11: reorganization and natural human alpha-lactalbumin promote lactose synthesis capability comparison diagram, and S1-3 is the human alpha-lactalbumin standard substance, XW, and LW and HW represent Xing Wa, Long Wa and meeting baby sample.

Embodiment

The present invention is described in further detail below in conjunction with embodiment.

Embodiment

1 experiment material

1.1 plasmid and bacterial strain

Host bacterium bacillus coli DH 5 alpha and DH10B, pGEM-5Zf, pGEM-T are available from Promega company, and pCMV-EGFP-IRES-NEO and pIRES-NEO are available from Clontech company

1.2 laboratory animal

The fetus at about 3 monthly ages of Holstein milk cow is taken from the slaughterhouse, and the ox ovary is from slaughterhouse, surrounding area, Beijing.

1.3 main agents

DMEM/F ₁₂Powder, DMEM powder culture medium, trypan blue (trypan blue), TCM199 powder, glutamine and G418 are Gibco company product; Foetal calf serum is a Hyclone company product; DNTP and PCR primer are purchased in Shanghai bio-engineering corporation; The Taq enzyme is purchased in China Agricultural University Agricultural biotechnologies laboratory; Restriction endonuclease SspI and BamHI are Huamei Bio-Engrg Co.,'s product; IPTG, X-gal, penbritin (Amp), kantlex (Kan), keyhole limpet hemocyanin (KLH) are all available from magnificent biotech firm; Saturated phenol is ancient cooking vessel state bio-engineering corporation product: trypsinase, penicillin streptomycin, EDTA, Hepes, FSH, LH, 17 β-E2, EGF, Unidasa, HEPES, FAF BSA, cytochalasin B, Hoechest33342, cycloheximide, A23187,6-DMAP, D-N.F,USP MANNITOL, Sodium.alpha.-ketopropionate, heparin sodium, mineral oil and other inorganic salt are Sigma company product.

1.4 culture medium preparation

SOB substratum: dispose every liter of substratum, should add at the 950ml deionized water: peptone: 20g yeast extract: 5g NaCl0.5g. shakes the vessel solute and dissolves fully, add 250mmol/L KCl solution 10ml then, be adjusted to pH7.0 with 5mol/L NaOH.Sterilization

The LB liquid nutrient medium: peptone 10g, yeast powder 5g, NaCl 10g is dissolved in the 800ml water, regulates pH value to 7.5, constant volume system 1000ml, autoclaving.

The LB solid medium: peptone 10g, yeast powder 5g, NaCl 10g is dissolved in the 800ml water, adds cosmetics 15g, regulates pH value to 7.5, is settled to 1000ml, autoclaving.

1.5 the preparation of reagent

The DMEM nutrient solution: DMEM powder 13.4g, NaHCO33.7g, penicillin 66mg, Streptomycin sulphate 100mg, Mill-Q ultrapure water constant volume to 1 liter, PH 7.0-7.4, osmotic pressure are 280-320mOsm/kg, with the sterilization of 0.2 μ m membrane filtration, 4 ℃ of preservations.Add 10% serum during use.

0.1%Trypsin/EDTA enzymic digestion liquid: Trypsin0.1g, KCl 0.04g, NaHCO ₃, NaCl 0.8g, EDTA 0.02g, the Mill-Q ultrapure water dissolving with sterilization is settled to 100ml, with the sterilization of 0.2 μ m membrane filtration ,-20 ℃ of preservations.

DPBS liquid: DPBS powder art 9.7g, Mill-Q ultrapure water constant volume to 1 liter, PH 7.0-7.2 is with the sterilization of 0.2 μ m membrane filtration, 4 ℃ of preservations.

No calcium magnesium PBS solution: KCl0.2g, KH ₂PO ₄0.2g, NaCl 8.0g, Na ₂HPO ₄12H ₂O 2.88g, Mill-Q ultrapure water constant volume to 1 liter, PH 7.0-7.4, osmotic pressure are 280-320mOsm/kg, with the sterilization of 0.2 μ m membrane filtration, 4 ℃ of preservations.

The Gimsa mother liquor: Gimsa powder 0.5g adds a small amount of glycerine Gimsa powder water is fully ground in mortar.Adding glycerine to total amount again is 22ml, 56 ℃ of insulation 2h, and then add 33ml methyl alcohol, and be kept in the brown reagent bottle, standby.

Cell pyrolysis liquid: 10mM Tris.Cl (PH 8.0), 0.1M EDTA (PH8.0), 0.5%SDS.

The Proteinase K stock solution: Proteinase K 100mg, be dissolved in the 5mL aqua sterilisa, packing ,-20 degree are preserved.

TBS liquid: NaCl 8.0g, KCl 0.2g, Tris.Cl 3.0g is dissolved in the 1L redistilled water autoclaving.

G418 stores liquid: 1g G418 is dissolved in the 1mL 1mol/mL HEPES solution (PH7.0-7.2), adds Mill-Q10mL, filtration sterilization, and-20 degree are preserved.

Twice electric shock damping fluid (2 * HeBS): 280mM Nacl, 10mM Kcl, 1.5mM Na2HPO4,12mM Glucose, 50mM Hepes, PH7.0-7.4, filtration sterilization, the 1mL packing ,-20 degree are preserved.

1Mol/L Tris.Cl (pH8.0): 121.1gTris alkali is dissolved in the 800ml water, transfers pH value to 8.0 with HCl, is settled to 1000ml, autoclaving.

0.5Mol/L EDTA (pH8.0): the 126.1g disodium ethylene diamine tetraacetate joins in the 800ml water, transfers pH value to 8.0 with NaOH, is settled to 1000ml, autoclaving.

RNase solution: RNaseA is dissolved in 10mMol/L Tris.Cl (pH7.5), among the 5mMol/L NaCL, is made into the concentration of 10mg/ml,, slowly cool to room temperature, be distributed into aliquot and be stored in-20 ℃ in 100 ℃ of heating 15min.

TE damping fluid: 10mMol/L NaCL, 10mMol/L Tris.Cl (pH8.0), 1mMol/L EDTA (pH8.0), autoclaving.

After 5mol/L LiCl:30.2g lithium chloride two water (LiCl.2H2O) are dissolved in 80ml water fully, be settled to the 100ml autoclaving.

50 * TAE:242gTris alkali, the 57.1ml glacial acetic acid, 100ml0.5Mol/L EDTA (pH8.0) is settled to 1000ml after the dissolving.

Penbritin (Amp) stock solution: sodium ampicillin is dissolved in behind the aqua sterilisa with the filter filtration sterilization of 0.22 μ m, is mixed with 100mg/ml, be stored in-20 ℃.

3mol/L NaAc (pH5.2): the 24.604g anhydrous sodium acetate is dissolved in the 80ml water, regulates pH value to 5.2 with glacial acetic acid, is settled to 100ml, autoclaving.

1mol/L CaCl ₂: in 200ml water, dissolve 54gCaCl ₂.6H ₂O, filtration sterilization is distributed into every part of 10ml, is stored in-20 ℃, takes out portion during the preparation competence and is diluted to 100ml, filtration sterilization, pre-cold standby.

The ethidium bromide stock solution: add the 1g ethidium bromide in 100ml water, preserve in 4 ℃ of brown bottles the dissolving back.

DNA extraction extraction buffer: 50mMol/L Tris.Cl (pH8.0), 100mMol/L EDTA (pH8.0), 100mMol/L NaCl, 1%SDS.

2 * Cracking buffer:0.2N NaOH, 0.5%SDS, 20% sucrose.

Phenol: imitative (1: 1): equal-volume phenol, chloroform mix, and are stored in 4 ℃ of brown bottles.

Proteinase K solution: water is made into 20mg/ml ,-20 ℃ of preservations.

TCM199 nutrient solution: claim TCM199 powder 9.9g, NaHCO ₃2.2g, Sodium.alpha.-ketopropionate 0.1375g, EDTA0.372g is with 1L ultrapure water constant volume, PH7.2-7.4, malleation filtration sterilization, 4 ℃ of preservations.Cultivate with adding 10%FCS in the working fluid.

Operation liquid H199: in the TCM199 that contains 25mM Hepes, add 10%FCS.

Towards ovum liquid: add 10%FCS in the DPBS solution.

Unidasa: Unidasa 0.2g, being dissolved in 10ml does not have in the calcium DPBS solution, filtration sterilization ,-20 ℃ of storages.

Working fluid: use towards 10 times of ovum liquid dilutions.

Merge liquid: 0.3M N.F,USP MANNITOL, 0.1mM MgSO ₄, 0.05mM CaCl ₂, 0.5mMHEPES, 0.05%BSA transfers PH to 7.2-7.4, filtration sterilization.

Maturation culture solution: add 10%FBS in the M199 nutrient solution, 10u/ml FSH, 100U/ml LH, 1ug/ml estradiol, 100U/ml penicillin, 100ug/ml Streptomycin sulphate.

The CR1aa nutrient solution:

Above-mentioned composition is added 90ml ddH ₂Among the O, treat that all reagent thoroughly after the dissolving, add 0.055g Hemicalcium L-lactate (5mM).Adjusting pH is 7.4, uses ddH ₂O is added to 100ml, and osmotic pressure is between the 265-285mOsm.Filtration sterilization.

1.6 key instrument equipment

1) CO2 incubator: U.S. Forma Scientific Inc.

2) inverted microscope and fluorescent microscope: Japanese Nikon company

3) culture dish, culturing bottle, centrifuge tube and cell cryopreservation pipe: Nunc company

4) electric shock instrument: U.S. BTX company (ECM 2001)

5) electrophoresis apparatus: DYY-III2 voltage stabilizing electrophoresis apparatus, Liuyi Instruments Plant, Beijing

6) Bechtop: Beijing treating plant factory

7) ℃ Ultralow Temperature Freezer-80: Japanese SANYO company

8) ice-making machine: Japanese SANYO company

9) ultrapure water instrument: U.S. MILLIPORE company

10) refrigerated centrifuge: Eppendorf company

11) high speed freezing centrifuge: BECKMAN company

12) gel imaging system: ALPHA INNOTECH company

13) PHS-3C acidometer: go up marine rainbow benefit instrument plant

14) autosterilization pot: Japanese SANYO company

15) sequenator: ABI 377 type DNA sequencer, U.S. PERKIN ELMER company

16) water bath with thermostatic control instrument: U.S. LIFESCIENCE company

17) 9700 type PCR instrument: U.S. PERKIN ELMER company

18) ABI 377DNA sequenator: U.S. PERKIN ELMER company

1.7 analysis tool software and network address:

Homology analysis software: DNAMAN

PCR primer-design software: Oligo6.0

Dna sequence analysis software: Chromas

DNA and protein sequence database: NCBI/GenBank/Nucleotides, Protein

2 experimental techniques

2.1 the structure of transgene expression vector

Design primers F 1 (upstream) according to GeneBank sequence (X05153): 5 ' GAGTGATGCTTCCATTTCAG3 ' F2 (downstream): 5 ' CAGAGATGTACAGGATCTGC 3 '.The fragment of the 790bp of (comprising first exon) between the amplification human alpha-lactalbumin gene 5 ' end non-coding region and first intron, reaction conditions: 94 ℃ of 3min, 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1min, 30 circulations, 72 ℃ of 7min.

Utilize this primer to be filtered out the clone (called after phLa1) who contains the human alpha-lactalbumin gene from Clontech laboratories.Inc. company cosmid library.Utilize NotI and NdeI double digestion positive colony, reclaim the fragment of 8.5kb, link to each other, get subclone hLa2 with the pGEM-5Zf carrier.With end sequencing result and known array comparative analysis, find that this clone lacks the fragment of the about 1kb that comprises part second intron to the four exons.For obtaining complete alpha-lactalbumin gene, be that template amplification obtains the fragment that its 3 ' end lacks with human gene group DNA.Design primers F 4-F5 adds a restriction enzyme site (F4 BglII, F5 NotI) and a protection base T respectively at primer 5 ' end simultaneously.F4 (upstream): 5 '-TAGATCTAGGGGTTAGGGGAACT-3 ' F5 (downstream): 5 '-TGCGGCCGCATTGAGTTGGTACAGACAGT-3 ' reaction conditions: 94 ℃ of 3min, 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1min, 30 circulations, 72 ℃ of 7min.F4 is positioned at 1375bp place, gene downstream, and F5 is positioned at 2521bp place, gene downstream, the fragment of amplification 1146bp.The pcr amplification product of human alpha-lactalbumin gene 3 ' end is linked to each other with the pGEM-T carrier, obtain cloning phLa3, cut this clone with BglII and NotI enzyme, reclaim the fragment of 1.1kb, and this fragment linked to each other with the phLa2 fragment that the NotI double digestion is crossed with BamHI, promptly obtain human alpha-lactalbumin full gene cloning phLa4, enzyme is cut and is checked order and identify its exactness.Our constructed phla4 carrier contains human alpha-lactalbumin gene 9459bp altogether, comprising the 5 ' flanking region of 6.9kb, the coding region of 2.4kb and the 3 ' flanking region of 159bp.Its structural pattern such as Fig. 1.

2.2 phLa4-EGFP-NEO expression vector establishment

1) construction strategy of .phLa4 marker expression carrier

For the ease of the screening positive cell, we have at first made up and have contained green fluorescence protein gene (EGFP) and two selective marker carriers (pEGFP-NEO) of neomycin gene and neomycin gene list selective marker carrier (pNEO), respectively two labeled vectors are connected with the pBC-hLa carrier that makes up before this then to be built into phLa-EGFP-NEO and phLa-NEO expression vector.

1) structure of pEGFP-NEO

Cut the segment that pBC1 reclaims about 6kb with NotI and SalI enzyme, connect one and contain SalI successively, the Linker of BamHI and NotI, be built into pXM, cut pCMV-EGFP-IRES-NEO and reclaim 4kb segment EGFP-IRES-NEO with BamHI and NotI enzyme, cut pXM with BamHI and NotI enzyme simultaneously, and be connected with EGFP-IRES-NEO and promptly constitute pEGFP-NEO, as Fig. 2.

2) phLa4-EGFP-NEO expression vector establishment

Cut phLa4 and pEGFP-NEO with NotI and SalI enzyme, both connections promptly constituted phLa4-EGFP-NEO, cut and sequencing analysis, determine the success of phLa4-EGFP-NEO vector construction, carrier figure following (Fig. 3) by enzyme:

2.3 cell cultures, gene transfection and positive cell screening

2.3.1 it is foster that fetal fibroblast former is commissioned to train

In Bechtop, fetus is immersed in 30sec in 70% alcohol,, takes off the several piece face tissue of ear and ridge in the DMEM+10%FCS nutrient solution with the instruments of sterilizing with PBS rinsing several times.

↓

In diameter 60mm plate, fetal tissue's chopping is become 1mm ³Size organize fragment, will organize fragment to be transferred in the 15ml centrifuge tube again, centrifuge washing for several times under the 1000rpm.

↓

With sterilization glass elbow suction pipe the small org fragment is drawn to 25cm ²In the culturing bottle, tissue block is evenly distributed on bottle wall by the glass pipette elbow.

↓

Careful upset culturing bottle (preventing that tissue block from falling) allows tissue block attach on bottle wall, places 37 degree, 5%CO ₂Place 2～4h in the incubator, treat tissue block adherent after, just putting culturing bottle again, add an amount of nutrient solution and continue to cultivate.

2.3.2 the going down to posterity of fetal fibroblast, freezing, and recovery

Primary cell to be planted grows to 80% when converging, and a cell part is freezing, and a part goes down to posterity and continues to cultivate.

2.3.2.1 go down to posterity

Carefully absorb nutrient solution in the culturing bottle with sterilization glass elbow suction pipe, inject no calcium magnesium PBS (37 degree incubation) along the opposite bottle wall of cell growth wall and wash cell twice, to dispel remaining serum and cell metabolite.

↓

With add 0.05% trypsinase/0.02%EDTA Digestive system with quadrat method, add-on gets final product for covering cell monolayer that (diameter 100mm culture dish generally adds the 1ml Digestive system, add the 200uL Digestive system in the 35mm culture dish), put into incubator and digest 1-2min.Examine under a microscope, treat that cell begins to become bowlder, beat the culture dish wall, make cell thoroughly take off wall, add nutrient solution then and stop digestion with finger.

↓

Blow and beat repeatedly with sterilization glass elbow suction pipe, cell makes its dispersion become individual cells, centrifugal 5min collecting cell under the 1000rpm.With nutrient solution by 1: 2 or 1: 3 dilution proportion and again inoculating cell to culture dish, cultivate.

2.3.2.2 it is freezing

After the attached cell digestion, collecting cell is in centrifuge tube, and centrifugal 5min is to remove most supernatant under 1000rpm.

↓

Add refrigerating fulid (DMEM+20%FCS+10%DMSO) the re-suspended cell precipitation of 4 degree precoolings, make cell concn be about 10 ⁷Individual cell/ml, transitional cell is to frozen pipe.

↓

Put into 4 degree refrigerator precooling 30min, frozen pipe is inserted in be placed on the stifling 2h of liquid nitrogen liquid level on the thick foam again, drop into liquid nitrogen then rapidly and preserve.

2.3.2.3 recovery

From liquid nitrogen, take out frozen pipe, drop into fast in the 37 degree water-baths, and in water-bath, constantly shake frozen pipe fast to thaw rapidly.

↓

After treating that refrigerating fulid thoroughly thaws, be transferred in the centrifuge tube with 10 times of fresh medium dilutions and with lysate, centrifugal 5min removes DMSO to extenuate refrigerating fulid toxicity under 1000rpm.

↓

With fresh nutrient solution suspension cell precipitation, cell dilution to desired concn, is continued to cultivate.

2.3.3 the preparation of somatocyte injection DNA

Big upgrading grain phLa4-EGFP-NEO and phLa4-NEO, with the SalI digested plasmid, endonuclease reaction is as follows:

The about 10-20 μ of plasmid DNA g

10 * reaction buffer, 20 μ l

Restriction enzyme 10-20U

Dd H2O supplies system to 200 μ l

After mentioned reagent adds well, mixing, 37 degree water-bath digestion 2h, whether get 5 μ L enzymes cuts product and detects enzyme with 0.7% agarose gel electrophoresis and cut complete, if enzyme cuts entirely, add phenol, each extracting of phenol/chloroform once, add 2 times of volume dehydrated alcohols and 0.1 times of volumes of acetic acid sodium (PH5.2), mixing postposition-20 is spent night; The centrifugal 15min of 12000rpm reclaims precipitation, 70% washing with alcohol once, vacuum-drying adds the TE dissolving.

2.3.4 bovine fetal fibroblast is to G418 toxicity sensitivity Detection

Cell cultures to the is used 0.25% tryptic digestion after 3 generations, by every hole 0.5～1 * 10 ⁵The dispersion so that cell is tried one's best in individual cell inoculation to the 13 diameter 35mm culture dish.Next day therein in 12 holes gradient with 100 μ g/ml add the G418 of final concentration successively from 100 μ g/ml to 1200 μ g/ml, also have in the hole not add G418 in contrast.Three weeks of cultured continuously, changed in per 3～4 days and to cover once, add G418 simultaneously.Every day, observation of cell was grown or death condition.

2.3.5 electric shock transfection

The DNA that before the transfection 10～50 μ g purifying is reclaimed incorporates among 500 μ l, 2 * HeBS, replenishes the sterilization ultrapure water to 1ml, the ice bath precooling.

↓

Before transfection 2～3 days, with 0.25% trypsin solution digestion culturing cell.With 1 * 10 ⁶Individual cell is transferred in 75cm ²In the culturing bottle, add complete culture solution, put 37 degree, 5%CO ₂Cultivate in the incubator.

↓

Before the transfection, under inverted microscope, observe cultured cells, determine that cell is in the logarithmic growth later stage.With 0.25% trypsin solution peptic cell, the centrifugal 5min sedimentation cell of 1000rpm.

↓

Cell precipitation with 1 * HeBS centrifuge washing of ice bath precooling 1 time, is carried out cell counting simultaneously.

↓

The cell of some amount is suspended in the buffer electrode that is added with DNA again, changes in the electric shock cup ice bath 10min before electric shock after mixing over to.

↓

When cell is ready for electric shock, strength of electric field (E) and burst length (t) are set, try earlier, guaranteed to produce required pulse.The cup that will shock by electricity inserts in the electric shock tank, according to selected strength of electric field (E) and the burst length (t), and the electric shock cell.

↓

To behind the cell ice bath 10min after the electric shock, change 75cm over to ²Culturing bottle in, add in the DMEM nutrient solution contain 20%FCS in 37 degree, 5%CO ₂Cultivate in the incubator.

↓

Treat the cell growth state recovery after 1-2 days, cell is enlarged 10 times of cultivations, add an amount of G418 and screen.

↓

Changed liquid once, and added G418 simultaneously in per 3～4 days.Every day, observation of cell was grown or death condition.After 6-10 days, select the positive colony cell.

2.3.6 the mono-clonal of positive cell is cultivated

Under fluorescent microscope, observe the luminous situation of aforesaid method gained cell clone, live good dispersion (away from other clone) and the many fluorescence clones of cell quantity with the marking pen circle; Absorb nutrient solution, with no calcium magnesium PBS rinsing cell secondary, under the high power anatomical lens, 30-50ul 0.25% tryptic digestive juice is dripped on the good cell clone of mark, after most cells to be cloned is shunk and is taken off wall, do not wait cell suspension, draw cell clone fast, but near other clone's cell noting not sucking; Transitional cell is blown and beaten the cell dispersion agglomerate in four orifice plates that are added with 500 μ l nutrient solutions; The clone who chooses continues to cultivate, and reduces G418 concentration to 300 μ g/ml and keeps screening; After treating that clone cell quantity enlarges the back or converges, a part of cell transfer is continued enlarged culturing in the 35mm culture dish, another part is used for transgenosis and detects, and the cell after other enlarges is freezing as early as possible.

2.4 transgenosis somatic cell clone

2.4.1 the maturation of ovocyte is cultivated

Collect the ovary of the ox that grows up from the slaughterhouse, place 30 ℃ physiological saline in 4h, to deliver to the laboratory, after cleaning three times in 37 ℃ the PBS liquid, is the ovarian follicle of 2～8mm with the diameter for the 0.7mm syringe needle extracts diameter, the recovery form is even, the ovarian cumulus-ovocyte-complex body (COCs) of compact structure, with twice of ripe liquid (M199+10%FBS+0.01U/ml bFSH+0.01U/mlbLH+1 μ g/ml estradiol) washing, then ovarian cumulus-ovocyte-complex body is put into four orifice plates that contain ripe liquid with 50-60 piece/hole, at 38.5 ℃, 5%CO ₂After maturation is cultivated 18～20h in the incubator, the pipe that sophisticated ovocyte is put into 0.1% Unidasa vibrates behind 2～3min, blow and beat gently with Glass tubing again, cumulus cell and ovocyte are broken away from fully, select complete form, tenuigenin evenly and the ovocyte of discharging first polar body be the somatic cell nuclear acceptor.

2.4.2 the stoning of ovocyte

The ovocyte that will have first polar body moves into and contains in the operation liquid of M199+10%FBS+7.5 μ g/ml cytochalasin B, under 200 power microscopes, above polar body, zona pellucida cut an osculum with a glass needle, again with internal diameter be 20 μ m Glass tubing with first polar body with and the ovocyte of below in karyomit(e) absorb in the lump, the solution of putting into M199+20%FBS again give a baby a bath on the third day after its birth all over after, place incubator standby.

2.4.3 move nuclear and merge

The donorcells of serum starvation 2～4d is digested 2～4min with 0.25%trypsin, the selection diameter is that the somatocyte of 10～12 μ m has gone its immigration in the ovocyte zona pellucida of nuclear with 20 μ m diameter Glass tubings, put it into then in the Zimmerman liquid [15] and put into integration slot behind balance 3～5min, rotating ovum makes donorcells vertical with electric field with the ovocyte contact surface, field intensity in DC pulse is 2.5kV/cm simultaneously, burst length is 10 μ s, pulse number is 2 times, recurrent interval is after merging (fusion instrument is the ECM-2001 of BTX company) under the condition of 1s, reconstructed embryo is moved in the M199+10%FBS liquid rapidly, observe fusion rate after placing 0.5h, select the fusion embryo and carry out next step activation processing.

2.4.4 the activation of reconstructed embryo and cultivation

Reconstructed embryo is put into 5 μ mol/L Ionomycin (Sigma) liquid, change to behind the 4min in the 1.9mmol/L 6-DMAP liquid, move into again behind the 4h in the CR1aa+5%FBS liquid, at 38.5 ℃, 5%CO ₂Observe division rate after cultivating 2d in the incubator, observe blastocyst rate behind the 7d

2.4.5 embryo transfer detects with gestation

Clone's blastaea of the 7d that form is good moves in the horn of uterus of the receptor cow of the same period. and what receptor cow was selected all is the multiparity cow, wherein red is that the clone embryos of southern Hebei ox is moved into the Holstein milk cow, the clone embryos of Holstein milk cow is moved into Luxi Yellow cattle. and the 60d after transplanting carries out rectum and detects, to determine pregnancy rate.

2.5 the PCR of transgene clone and Southern identify

2.5.1PCR detect

Change in the cow genome group in order to prove conclusively phLa4-EGFP-NEO, for hLa4, we have designed two pairs of primers,

Primer 1 sequence is the upstream: 5 ' GAG TGA TGC TTC CAT TTC AG 3 ', downstream: 5 ' CAGAGATGTACAGGATCTGC 3 '; Reaction conditions is: 94 ℃ of 3min, 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1min, 30 circulations, 72 ℃ of 7min; Product length is 790bp;

The primer 2 sequence is the upstream: 5 '-TAG ATC TAG GGG TTA GGG GAA CT-3 ' downstream: 5 '-TGCGGC CGC ATT GAG TTG GT ACA GAC AGT-3 ' reaction conditions: 94 ℃ of 3min, 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 1min, 30 circulations, 72 ℃ of 7min; Product length is 1146b.

In the EGFP gene, primer sequence is: the upstream: 5`TGC AGT GCT TCA GCC GCT AC 3` downstream: 5`CTCAGG TAG TGG TTG TCG GG 3`.PCR condition: 94 ℃ of 5min; 94 ℃ of 40sec, 62 ℃ of 40sec, 72 ℃ of 40sec, 30cycles; 72 ℃ of 7min, 4 ℃ of 1 ∞, product length is 380bp.

For the NEO gene, primer sequence is: the upstream: 5`AGG ATC TCC TGT CAT CTC ACC TTG CTCCTG 3` downstream: 5`AAG AAC TCG TCA AGA AGG CGA TAG AAG GCG 3`.PCR condition: 94 ℃ of 5min; 94 ℃ of 40sec, 60 ℃ of 40sec, 72 ℃ of 40sec, 30cycles; 72 ℃ of 7min, 4 ℃ of 1 ∞, product length is 490bp.

Because the human alpha-lactalbumin gene is about 10kb, so we are respectively at its 5 ' end and a pair of primer of 3 ' end design, and as can be seen from Figure 4 and Figure 5, clened cows Xing Wa, Long Wa and meeting baby change complete human alpha-lactalbumin gene.From Fig. 6 and Fig. 7 then as can be seen, these three clened cows double alternative carriers simultaneously.

2.5.2Southern detect

The about 10 μ g of transgene clone ox DNA that get the PCR test positive digest with EcoRI, and low pressure is electrophoresis at a slow speed, behind the commentaries on classics film, carry out Southern hybridization, and hybridizing used probe is α-P ³²The hLA gene fragment of the isotope-labeled 1.5kb of dCTP.With the positive contrast of phLa4-EGFP-NEO plasmid; with the negative contrast of non-transgenic clened cows genome; hybridization can obtain the 1.5kb fragment; determined further that as shown in Figure 8 Xing Wa and Long Wa commentaries on classics has people's lactalbumin gene; can estimate the human alpha-lactalbumin gene that Xing Wa and Long Wa change 1 copy; according to the transgenic mice result, can infer that this two transgenic cattle can efficiently express human alpha-lactalbumin in mammary gland.

2.6 transgenic cattle recombination human alpha-whey protein expression and activation analysis

2.6.1 medicine lactagogue

Press of the transgene clone Niu Jinhang medicine lactagogue of 1/4 dosage with the lactagogue pin that Cao Tan pharmaceutical factory, Xi'an produces to the 6-8 monthly age, simultaneously with double-tagging carrier transgene clone ox, common clened cows, carry out lactagogue in contrast with common Fresian of monthly age, it also is contrast with the ordinary milk, collect the milk sample every day 3 times, collected for two weeks altogether.

2.6.2 PAGE electrophoresis, Western and the ria-determination of transgenosis milk

Newborn sample to transgenic cattle dilutes three times with heavily steaming aqua sterilisa, removes butterfat, goes caseic processing, obtains whey portion at last.Alpha-lactalbumin promptly is present in the whey.After newborn sample carried out degreasing and remove casein to transgenosis milk sample and contrast, the PAGE glue of the last sample Buffer of usefulness subtracting property (reducing) SDS sex change carried out electrophoresis, result such as Fig. 9.From then on scheming as can be seen, three transgenosis milk samples have one and human alpha-lactalbumin standard substance specific band of the same size.Carry out Western hybridization, result such as Figure 10 with the anti-human alpha-lactalbumin antibody of rabbit.From Western result as can be seen three transgenosis milk samples and people's milk have one with alpha-lactalbumin standard substance specific band of the same size, show in the transgenic cattle mammary gland that changes the human alpha-lactalbumin gene can The expressed recombination human alpha-whey albumen.

Utilize the radioimmunoassay method to detect the proteic expression amount of recombination human alpha-whey in the transgenosis milk sample.The human alpha-lactalbumin standard substance are used ¹²⁵I chloramine-t method mark, the newborn sample of getting 6 time points detects.Record that the proteic expression amount mean value of recombination human alpha-whey is 1.10-1.55g/l in the newborn sample, show that we can efficiently express complete recombination human alpha-whey albumen by employed human alpha-lactalbumin gene structure with complete autogenous control district in transgenic cattle mammary gland.

2.6.3 recombination human alpha-whey albumin biological activity assay

Alpha-whey albumin can change β-1, and the specificity of 4-galactoside transferase substrate can be synthesized lactose at physiological condition.Under the situation that lacks alpha-whey albumin, β-1,4-galactoside transferase catalysis UDP-semi-lactosi combines with N-acetyl grape amine, synthetic N-acetyl lactosamine and UDP, chemical equation is as follows:

UDP-galactose+N-acetyl-D-glucosamine→N-acetyllactosamine+UDP。

And behind the adding alpha-whey albumin, can improve β-1, and the 4-galactoside transferase is to the substrate binding ability of glucose, and chemical equation is: UDP-D-galactose+D-glucose → lactose+UDP.

For whether the human alpha-whey albumin of identifying reorganization has this activity, carry out external checking.Under this reaction system: add 5.78mU GTase, 50mM Hepes (pH6.63), 0.0245%Triton X-100,0.0245%BSA, 9mM MnCl in the 100ul solution ₂, 25mM Glucose, 0.4mM UDP-Galactose, the 10 μ l alpha-lactalbumin that recombinates, 37 ℃ of reactions 2 hours, synthetic lactose.Detect the synthetic of lactose with the lactose detection kit.The result as shown in figure 11, recombinant protein can synthesize lactose equally, show the reorganization alpha-whey albumin have natural bioactive.

Attached 1:SEQ ID NO 1: complete human alpha-lactalbumin gene order, sequence chart is as follows: comprise the 5 ' flanking region of 6.9kb and the 3 ' flanking region of 159bp, total length 9459bp; Four exons and three introns, wherein 6937-7185 is first exon, and 7743-7911 is second exon, and 8390-8465 is the 3rd exon, and 8965-9297 is the 4th exon.

1 ATATGAACTT?TAAAGTAGTT?TTTTCCAATT?CTGTGAAGAA?AGTCATTGGT?AGCTTGATGG

61 GGATGGCATT?GAATCTATAA?ATTACCTTGG?GCAGTATGGC?CATTTTCACG?ATATTGATTC

121 TTCCTACCCA?TGAGCATGGA?ATGTTCTTCC?ATTTGTTTGT?ATCCTCTTTT?ATTTCATTGA

181 GCAGTGGTTT?GTAGTTCTCC?TTGAAGAGGT?CCTTCACGTC?CCTTATAAGT?TGGATTCCTA

241 GGTATTTTAT?TCTTTTTGAA?GCAATTGTGA?ATGGGAGTTC?ACTCATGATT?TGGCTCTCTG

301 TTTGTCTGTT?ATTGGTGTAT?AAGAATGCTT?GTGATTTTTG?TACATTGATT?TTGTATCCTG

361 AGACTTTGCT?GAAGTTGCTT?ATCAGCTTAA?GGAGATTTTG?GGCTGAGACG?ATGGGGTTTT

421 CTAGATATAC?ATTCATGTCG?TCTGCAAAGA?GGGACAATTT?GACTTCCTCT?TTTCCTAATT

481 GAATACCCTT?TATTTCCTTC?TCCTGCCTAA?TTGCCCTGGC?TAGAACTTCC?AACACTATGT

541 TGAATAGGAG?TGCTGAGAGA?GGGCATCCCT?GTCTTGTGCC?AGTTTTCAAA?GGGAATGCTT

601 CCAGTTTTTG?CCCATTCAGT?ATGATATTGG?CTGTGGGTTT?GTCATAGATA?GCTCTTATTA

661 TTTTGAGATA?CGTCTCATCA?ATACCTAATT?TATTGAGAGT?TTTTAGCATG?AAGGGTTGTT

721 GAATTTTCTC?AAAGGCCTTT?TCTGCATCTA?TTGAAATAAT?CATGTGGTTT?TTGTCTTTGG

781 TTCTGTTTAT?ATGCTGGATT?ACATTTATTG?ATTTGTGTAT?ATTGAACCAG?CCTTGCATCC

841 CAGGGATGAA?GCCCACTTGA?TCATGGTGGA?TAAGCTTTTT?GATGTGCTGC?TGGATTCGGT

901 TTGCCAGTAT?TTTACTGAGG?ATTTTTGCAT?CAATGTTCAT?CAAGGATATT?GGTCTAAAAT

961 TGTCTTTTTT?GGTTGTGTCT?CTGCCAGGCT?TTGGTATCAG?GATGATGCTG?GCCTCATAAA

1021 ATGAGTTAGG?GAGGATTCCC?TCTTTTTCTA?TTGATTGGAG?TAGTTTCAGA?AGGAATGGTA

1081 CCAGTTCCTC?CTTGTACCTC?TGGTAGAATT?TGGCTGTGAA?TCCATCTGGT?CCTGGACTCT

1141 TTTTGGTTGG?TAAGCTATTG?ATTATTGCCA?CAATTTCACA?GACTGGCAAA?TTGGATAAAG

1201 AGTCAAGACC?CGTCAGTGTG?CTGTATTCAG?GAAACCCATC?TCATGTGCAG?AGACACACAT

1261 AGGCTCAAAA?TAAAAGGATG?GAGGAAGATC?TACCAAGCAA?ATGGAAAACA?AAAAAAGGCA

1321 GGGGTTGCAA?TCCTAGTCTC?TGATAAAACA?GACTTTAAAC?CAACAAAGAT?CAAAAGAGAC

1381 AAAGAAGGCC?ATTACATAAT?GGTAAAGGGA?TCAATTCAAC?AAGAGGAGCT?AACTATCCTA

1441 AGTATATATG?CACCCAATAC?AGGAGCACCC?AAGTTCATAA?AGCAAGTCCT?GAGTGACCTA

1501 CAAAGAGACT?TAGACTCCCA?CACAATAATA?ATGGGAGACT?TTAACACCCC?ACTGTCAACA

1561 TTAGACAGAT?CAACGAGACA?GAAAGTTAAC?AAGGATACCC?AGGAATTGAA?CTCAGCTCTG

1621 CACCAAGCAG?ACCTAATAGA?CATCTACAGA?ACTCTCCACC?CCAAATCAAC?ACAATATACA

1681 TTTTTTTTCA?GCACCACACC?ACACCTATTC?CAAAATTGAC?CACATAGTTG?GAAGTAAAGC

1741 TCTCCTCAGC?AAATGTAAAA?GATCAGAAAT?TATAACAAAC?TGTCTCTCAG?ACCACGGTGC

1801 AATCAAACTA?CAACTCAGGA?TAAAGAAACT?CACTCAAAAC?CGCTCAACTA?CATGGAAACT

1861 GAACAACCTG?CTCCTGAATG?ACTACTGGGT?ACATAACGCA?ATGAAGGCAG?ACATAAAGAT

1921 GTTCTTTGAA?ACCAACGAGA?ACAAAGACGC?AACATACCAG?AATCTCTGGG?ACACATTCAA

1981 AGCAGTGTGT?AGAGGGAAAT?TTATAGCACT?AAATGCCCAC?AAGAGAAAGC?AGGAAAGATC

2041 CAAAATTGAC?ACCCTAACAT?CACAATTAAA?AGAACTAGAA?AAGCAAGAGC?AAACACATTC

2101 AAAAGCTAGC?AGAAAGCAAG?AAATAACTAA?AATCAGAGCA?GAACTGAAGG?AAATAGAGAC

2161 ATAAAAAACC?CTTCAAAAAT?TAATGAATCC?AGGAGCTGGT?TTTTTTGAAA?GGATCAACAA

2221 AATTGATAGA?CCGCTAGCAA?GGCTAATAAA?GAAGAAAAGA?GAGAAGAATC?AAATAGATGC

2281 AATAAAAAAT?GATAAAGGGG?ATATCACCAC?CGATCCCATA?GAGATGCAAA?CTACCATCAG

2341 AGAATACTAT?AAACATCTCT?ACGCAAATAA?ACTAGAAAAT?CTAGAAGAAA?TGGATAAATT

2401 CCTTGACATA?TACACCCTCC?TAAGACTAAA?CCAGGAAGAA?GTTGACTCTC?TGAATAGACC

2461 AATAACAGGC?TCTTTTTTGT?TTTTTAAATT?TTGGTGGGTA?CATCATAGCT?GTGTATATTT

2521 ATGGGGTACA?TAAAATGTTT?TGATACAGGC?ATGCAATGTG?AAATAAATAC?TTTATGGGGA

2581 ATGCGGTGGT?AGATTGTTAA?TATGAGTTGC?CAGGATGATG?TTTGGCAAGG?AAGAAATGAG

2641 GAGGAAGAAA?GGGAAGCCAT?TCCTAAAAGG?AAAGGAAAAA?CTACCATGTT?CACAAAAAAT

2701 AGGATGTAAG?ATTCTATCAA?AGGTGTTGAT?GTAAAATTAT?GTAAATATGT?TTATTTAAAA

2761 ATAAACATTT?TATAAATTAA?AAATGAAAAA?TCAATTAAAA?TTTGCATAGA?AATTTTTTTA

2821 GCTTCTTGGT?AATTACATGT?GTATCGGTTT?GTTTTAGCTA?ATATTCAGTT?AAAAAGGTAA

2881 AATTTATTTT?AGTATCTTTT?AAAATCATTT?TTGTGTTATA?ATTTATATTT?CCATGCTTGC

2941 ATTTTTTGGT?TGATACTATC?CCCAATTCAC?ACAAATGAAT?CAATGGTTCA?TTTAAGTATA

3001 AAAGCAGTGA?TATAAATAGT?AATGCAAATA?TAGCAATCCA?AAATAAGCCC?ATATAAATTG

3061 CAAGCAGGCC?TTTGGTGTGG?GATATAGAAT?GTGAATCTAT?AATGCTGAGT?AACTTTGTAA

3121 GGACTTTTGG?ACAAGCAGCT?GAAAAAGAAA?AATGCCAATA?AAAAATCACT?CCCTTTCTAA

3181 ATCTTAATTA?CTTTAATTAA?CTCTTTAATT?TGGTTAAACA?TTTTCATGAA?ATTTGGGTTT

3241 CAAGATCTAG?CATCATTGTC?TACCTAGTGA?TAATTTTCCT?GAATTATGAG?AGAAAGTAGA

3301 ACAAGATGAG?GATATAAGTG?TATTTTAAAA?TAGAGACAGG?GTCTTGCTCT?ATTGCCCAGG

3361 CTAGAGTGAG?TGGCACAATC?AAAGCCCACT?GCATTCTTGA?ACTCCTGGGC?TCAAGCAATC

3421 CTCGTACCTC?AGTAGCTAGG?ACTATAGGCA?CGTGCCACTA?TGCCTGGCTA?ATTTTTATTT

3481 TTTTTTGTAG?TGACAGAGTC?TTGCTATGTT?GCCCAGGCTG?GTCTCCAACT?CCTGGCCTCA

3541 AGTGATCCTC?CTGCCTCAGC?CTCCCAAAAT?GTTGGGAGTA?TAGGCATGAG?CCACTGCAGG

3601 CACAAGGTAA?GGATATTAAC?TGCAAGATGT?AATGGCCATT?ATGACTGTGG?CTCTCAGGGT

3661 GTTCCCTCTA?AATGGCAGGC?CTAGGCTCTG?TCTAGAAACT?CCAGCTCACC?TACAGACTAC

3721 AGTTTCAGAT?GGAAAACGTG?CCTTGAAACA?CATGCTTTCA?ATTTCTTTAT?TTTCAGAAAT

3781 AAAGATATTT?TAATTTTATT?TTTATTATTA?TTATTATTTT?TTGAGATGGA?GTCTTGCTCT

3841 GTTTCCCAGG?CTGGAGTGCA?GTGGCACAAT?CTTGGCTCAC?TGCAGCCTTC?ACCTCCTGGG

3901 TTCAAGCGAT?CCTCCTGCCT?CAGCTGCCCG?AGTAGCTGGG?ATTATAGACT?CCTGCCAGCA

3961 TGCTCAGCTA?ATTTTTGTAT?TTTTAGTAGA?GACGGAATTT?TGCCATGTTG?GTCAGGCTGG

4021 TCTCGAACTC?CTGACCTCAA?ATAATCTGCC?TACCTTGGCT?TCTCAAAGTG?CTGGGATTAC

4081 AGGCATGACC?CACCATGCCC?GGCCTGAACT?TTTTATTTTA?TAAATAAAGA?AATTTACTTT

4141 TAGAAATAAA?ATTTTTATTT?TGTTCATCTT?CAAAAAGGTG?ATTTCTGGTT?TTAGAAACCT

4201 GGATATTTCC?CCACAGCATC?TGAGAGAATG?AACATAATTT?TCTAGTCTAT?TTCTAACAAA

4261 ATCTAGGTAA?GTGTATTGTA?AATGCCTCTT?CACCATCTTG?ATTCAGCTCT?CGACCTCCAT

4321 GCAGAGCACC?CTGAGTAAAC?CTCTCTGGAA?AGGGAGATTT?TGGAGGAGGT?TTCTTCCTGG

4381 ACAGGAATTG?TTGAGCAGGA?GCTTTCTTCC?ACGAGCTGTG?CTTAATGTCT?TTCCACATAC

4441 TTCCTCTTTC?AGTGCTGCGA?TCATTGTGTA?TTGTTCTCCT?TTGGACAATC?TCCAAGAGGC

4501 TGCATCTTTC?TCTGGATGTT?TGCAGTTGTT?CCCATTAGAC?ACTTTCTATC?TTCTTTTTCA

4561 GATGACCCCC?ACGTATCCTA?TTTTAAGAAC?ATTTATAGGG?AAATAATGGT?TCCTTTTGCC

4621 GGAGACATGT?TTATTTTCTT?TTCTGCACTT?AGTTGTGATT?CCTGACCTGT?ATGCTTATTT

4681 TTATTGCTTA?TAGGGAAGGG?CCAAGGTATA?ATCAAATGAT?AGGCAAGCAG?GCAGCTGCCT

4741 TAGGTCTTGA?CTTGGCTGAA?AGTGTAGAAA?ACCCCTGTGA?TTCTTGAGAC?CCTGGCCCAC

4801 CCTTTTACTC?TATCACAGGT?ACTTAGTCAA?TAGCCTAGGG?CAGGAGGCAT?TTTACACAAG

4861 ACTCCACTAT?TGGAAGGACT?AGTCCTCAGG?ACTAGCTTTT?CTTATCTTTC?CCTCTCACAC

4921 ATGGTTCAAG?GTCACTCTCA?GCCATATTCT?CAACAAAGCT?TAGAGTGATA?GAATTCCCAT

4981 TCCTGTCGTG?TACCCTTGCA?GTGCCTCTGG?GTGGAATGCG?GAGAAATGGA?GTGGCTCCAC

5041 TTCTGTTGTG?TTTCTGAACA?TGTATCTCTT?GCTATCAGAA?CTTTCTGCTC?ATCCCTTCTG

5101 GCACACCAAG?ATCCTCCACA?TTCCCTTCAC?TCATGCCACT?TCATATACTG?GTTATCCATG

5161 GTACAGAAGA?CAGGATTTAA?CTGAGAGGAC?TTTTCCCTGA?CTCTGAATAC?ATGTAGGAGA

5221 TAACGATATG?GAAGACCTTC?AGTATGTAAG?TCTTAAATAG?ATTGGTTGGG?ATAAATGTTC

5281 CCTGAAACAT?AAGAAACAGC?GCAGCGGCTC?CTGTCTGTAA?TCCTAGCACT?TTGGGAGGCC

5341 GAGGCCCAGG?CAGGCAAATT?GCCTGAGCTC?AGAAGTTTGA?GACCAGCCTG?GCCAACATGC

5401 AGAAACTCCG?TCTCTACTAA?AAATACATAA?ATTAACCGGG?CATGGTAACA?CGTGCCTGTA

5461 GTCCCAGCTA?CTCGGGAGGC?TGAGGCAGGA?GAATCACTTG?AGCCTGGGAG?GCAGAGGTTG

5521 CAGTGAGCCA?AGATCGCGCC?ACTGCATTCC?AGCCTGGGCA?ACAGAGTGAG?ACTTGGTCAA

5581 AAAAAAAAAA?AAAAAAGGAA?GAAGAAGAAG?AAATCAGGTT?TAGAGATGAG?GACAAAGAAG

5641 ACGAATGGTG?GCATGAAGGA?GCTAAGAGCT?ACTTGTCACC?ATGACATGAA?GCTTCATGCC

5701 AGCAAATTAA?AGGAGCTATT?CAGAACTAGT?ATCCTCAACT?CTACTTGCTC?AGGGGCACTG

5761 ACCTTATAGA?GATTCCAGAC?ATAAGCTTGT?TCAGCCTTAA?AGTCCAATCT?TTCCACTGGC

5821 TTGGGTCCTT?CCCACTTTCT?GTGGCCAACT?CTGAGGTTGT?CTACAAGTTA?TTGGTCTTAG

5881 ATTTATGTAA?TGTCTCAATG?CCAGTGTAGT?ATTTGGTTAT?TTACGGTAGG?AGTGGTTAGG

5941 GGTGGGGAAT?CTGATAATAG?CTCGTAGGAT?AGCTAGATTC?TTTTTTTTTT?TTTTTTTTTT

6001 TAAAGATAGG?GTCTCACTTT?GTCTCCCAGG?ATGGATGGAG?TGCAGTGGAG?TGAACATGGC

6061 TCACTGCAGC?CTCGACCTCC?TGTGCTCAAG?TGTTCCTCCT?GCCTCAGCCC?CTCAAGTAGC

6121 TGGGACTACA?GGCACATGTC?ACCATGCCCA?GCTAATTTTT?TTTGTAGAGA?TGGGATTTTA

6181 CCATGTTGCC?CAGGCTGGTC?TCGAGCTCCT?GGGCTCAAGT?GATCCACCAG?ACTCGGCCTC

6241 CCAAAATGCC?GGGATTACAG?GTGTGAGCCA?CTGTGCCTGG?CCTAGATGCT?TTCATACAGG

6301 CTTTTCAATT?ATGCATTTTC?CTTAAGTAGG?AAGTCTTAAG?ATCCAAGTTA?TATCGGATTG

6361 TTGTAGTCTA?CGTTCCCATA?TTCTATTCCT?ATTTCTGAGC?CTTCAGTCAT?GAGCTACCAT

6421 ATTAAAGAAC?TAATTCTGGG?CCTTGTTACA?TGGCTGGATT?GGTTGGACAA?GTGCCAGCTC

6481 TGATCCTGGG?ACTGTGGCAT?GTGATGACAT?ACACCCCCTC?TCCACATTCT?GCATGTCTCT

6541 AGGGGGGAAG?GGGGAAGCTC?GGTATAGAAC?TTTATTGTAT?TTTCTGATTG?CCTCACTTCT

6601 TATATTGCCC?CCATGCCCTT?CTTTGTTCCT?CAAGTAACCA?GAGACAGTGC?TTCCCAGAAC

6661 CAACCCTACA?AGAAACAAAG?GGCTAAACAA?AGCCAAATGG?GAAGCAGGAT?CATGGTTTGA

6721 ACTCTTTCTG?GCCAGAGAAC?AATACCTGCT?ATGGACTAGA?TACTGGGAGA?GGGAAAGGAA

6781 AAGTAGGGTG?AATTATGGAA?GGAAGCTGGC?AGGCTCAGCG?TTTCTGTCTT?GGCATGACCA

6841 GTCTCTCTTC?ATTCTCTTCC?TAGATGTAGG?GCTTGGTACC?AGAGCCCCTG?AGGCTTTCTG

6901 CATGAATATA?AATAAATGAA?ACTGAGTGAT?GCTTCCATTT?CAGGTTCTTG?GGGGTAGCCA

6961 AAATGAGGTT?CTTTGTCCCT?CTGTTCCTGG?TGGGCATCCT?GTTCCCTGCC?ATCCTGGCCA

7021 AGCAATTCAC?AAAATGTGAG?CTGTCCCAGC?TGCTGAAAGA?CATAGATGGT?TATGGAGGCA

7081 TCGCTTTGCC?TGAATGTGAG?TTCCCTGCCT?CTGTGTTTCA?TCCATTCCTC?ATACGCTTCT

7141 CTCCTCCATC?CCCTCTTTCT?TCCACTTCGC?CCCTCCACTT?TTACTTAATT?ATCTAATCAT

7201 CCTCTTTTCT?GCTCATTTGC?ATACTCTTTT?ATTTCATGTA?TGTATATATG?TATGTATTTA

7261 TTTATTTTTG?AGGTGGAGTT?TCGCTCTTGT?TGCCCAGACT?GGAGTGCAAT?GGTGTAATCT

7321 CGGCTCACTG?CAACCTCCGC?CTCCTCGGTT?CAAGTGATTC?TCCTGCCTCA?GCCTCCCAAG

7381 TAGCTGGAAT?TACAGGCACC?CACCACCATG?CCTGGCTAAT?TTTGTATTTT?TTGTAGAGAC

7441 AGGGTTTCAC?CATGTTGGCC?AGGCTGGTCT?CAAACTTCTG?ACCTCAGGTG?ATCCGCCCTC

7501 CTCAGCCTCC?CAAAGTGTTG?GGATTACAAG?CGTGAGCCAT?CATGCCTGGC?CCCATTTATT

7561 TTCCTATCCT?TTCTTTCTCT?TATTGTCTGA?TTTTTTTTTG?GAATTCTCCA?TCTCATCAAG

7621 AAACTCTGAG?CTTTGCCATC?TTTGGAGATT?GGCTGGAAAG?CATTTTTGTC?TGAGAATTAC

7681 AGTTCCTCCT?TTATGCAGAT?CCTGTACATC?TCTGTGGTAT?CTCTTTCTCA?TCTTTCCCTC

7741 AGTGATCTGT?ACCATGTTTC?ACACCAGTGG?TTATGACACA?CAAGCCATAG?TTGAAAACAA

7801 TGAAAGCACG?GAATATGGAC?TCTTCCAGAT?CAGTAATAAG?CTTTGGTGCA?AGAGCAGCCA

7861 GGTCCCTCAG?TCAAGGAACA?TCTGTGACAT?CTCCTGTGAC?AGTGAGTAGC?CCCTATAACC

7921 CTCTTTCTCT?GTTTTTCTGA?GGCCTGCCCT?TGGGATAATC?TCCTTTTTAG?TGCCAAGCAG

7981 ACCTCAGGCT?TCATTGCCTT?GGCTGGGCTC?TATAAAAATT?GTGGGACTTG?AATTGGCAGT

8041 ACTGAGTAAG?AAGCTGTTTG?GATTTTTCAT?GGTCATCAAA?TCCCCAGACA?GTTCCTTGAG

8101 GTTCAGTGGT?AGACAATCGG?AGCTGTCTGA?GAGTCTTGGA?ATCTGATTGT?CTGCATTTTC

8161 AGGGTAAGTC?AGTTGATGAA?GCTGATGATT?CCTCCAGAGA?TATCCCAGGG?AAATGAAGGA

8221 AGTCCCTACC?CAGGGTTAGA?CATTACCACA?TTGGTCCTTT?CATATAGAAA?GACAACAGGC

8281 ACAAGCCTTG?AGTTTAGAGA?ACCCACTGGA?TCAGGGGTTA?GGGGAACTCA?GTGCCTTTCT

8341 GGGTAATACT?TGTCAGCTGT?CTCAATCCTT?TCCCTGTAAC?TCCTGCCAGA?GTTCCTGGAT

8401 GATGACATTA?CTGATGACAT?AATGTGTGCC?AAGAAGATCC?TGGATATTAA?AGGAATTGAC

8461 TACTGGTGAA?TCCTTATTCT?ATTTTCTATT?TCCCCATCCT?CCTTCTCCTT?ACCCCATTAG

8521 CCCAGCACCC?CTTTCCTCTT?ACCCTATCTC?TTGGTCATTT?AATCTAGAAT?ACAGTGTCTG

8581 AAACAAAGCT?TACCTAGAGA?CTCAGGTTTC?TGTTATTAAG?CCTCTCTCGC?TCCGCTCCTT

8641 GGTAGCAATT?TTCCTAATAA?GGGGTTGCCT?AATGGAGGGC?TCAGACCCAG?GCCTCCTTTC

8701 ACTTAGACTT?GGACATCTAA?TTCCACTTGT?TTAGTTCTAT?GCCCTAAAGC?AAGCTGTTGG

8761 TAACATTGCA?TCTCTTTTTT?AACCCTACAA?TTTTCTTGGA?TATTTTTTAT?GGACTGTATT

8821 CCACTTGATG?GCTTGTGTCG?CTTGACATCA?GGCCAGGAAT?GTCTTTCTGT?AATTCTCGTC

8881 CACGCTCTTC?CACTTCAGCC?CTCCTGGGAA?TGAATGTAAA?GATTCAGTCA?GCTAACTCAC

8941 CTTGTCCCCC?TTCTCCATTA?TCAGGTTGGC?CCATAAAGCC?CTCTGCACTG?AGAAGCTGGA

9001 ACAGTGGCTT?TGTGAGAAGT?TGTGAGTGTC?TGCTGTCCTT?GGCACCCCTG?CCCACTCCAC

9061 ACTCCTGGAA?TACCTCTTCC?CTAATGCCAC?CTCAGTTTGT?TTCTTTCTGT?TCCCCCAAAG

9121 CTTATCTGTC?TCTGAGCCTT?GGGCCCTGTA?GTGACATCAC?CGAATTCTTG?AAGACTATTT

9181 TCCAGGGATG?CCTGAGTGGT?GCACTGAGCT?CTAGACCCTT?ACTCAGTGCC?TTCGATGGCA

9241 CTTTCACTAC?AGCACAGATT?TCACCTCTGT?CTTGAATAAA?GGTCCCACTT?TGAAGTCACT

9301 GGCTGTAATT?TTTTTCCCCC?TGGAGGGAAG?GGGAAGAAAT?AGGATGAGTA?GGTGGACACT

9361 GAAGCCATAG?GTCATAGCCA?CCTTCCATCT?CTACTGAAGA?AGAAGTAGGC?TGAATTTACA

9421 ATAGAAAGGT?GAAGGTTACT?GTCTGTACCA?ACTCAATGC

Attached 2:SEQ ID NO 2: the human alpha-lactalbumin primary structure is an aminoacid sequence, totally 142 amino acid, and wherein preceding 19 is signal peptide sequence, figure is as follows for the HLA aminoacid sequence:

1 MRFFVPLFLV?GILFPAILAK?QFTKCELSQL?LKDIDGYGGI?ALPELICTMF

51 HTSGYDTQAI?VENNESTEYG?LFQISNKLWC?KSSQVPQSRN?ICDISCDKFL

101 DDDITDDIMC?AKKILDIKGI?DYWLAHKALC?TEKLEQWLCE?KL

Claims (3)

1. change the production method of the zooblast of human alpha-lactalbumin gene, its operation steps is as follows: (1) utilizes complete human alpha-lactalbumin gene structure to make up mammary gland-specific expression vector phLa4, (2) the cascaded structure phLa4-EGFP-NEO of structure human alpha-lactalbumin mammary gland-specific expression vector phLa4 and double alternative carrier pEGFP-NEO, the cascaded structure DNA that obtains is imported in the domestic animal somatic cell nuclear, obtain transgenic cell; Wherein, described domestic animal is meant ox, goat, sheep, pig or rabbit, the nucleotide sequence of complete human alpha-lactalbumin gene structure is shown in SEQ ID NO:1, the structure of mammary gland-specific expression vector phLa4 as shown in Figure 1, the structure of double alternative carrier pEGFP-NEO as shown in Figure 2, the enzyme tangent line collection of illustrative plates of cascaded structure phLa4-EGFP-NEO is as shown in Figure 3.

2. the production method of the zooblast of commentaries on classics human alpha-lactalbumin gene according to claim 1 is characterized in that described DNA introduction method is the electroporation transfection method.

3. the production method that changes the zooblast of alpha-lactalbumin gene over to according to claim 1 is characterized in that described domestic animal is an ox.

Images