CN100434533C - Molecular marking closely linked with wheat Brock powdery mildew resistant gene - Google Patents
Molecular marking closely linked with wheat Brock powdery mildew resistant gene Download PDFInfo
- Publication number
- CN100434533C CN100434533C CNB2006100138040A CN200610013804A CN100434533C CN 100434533 C CN100434533 C CN 100434533C CN B2006100138040 A CNB2006100138040 A CN B2006100138040A CN 200610013804 A CN200610013804 A CN 200610013804A CN 100434533 C CN100434533 C CN 100434533C
- Authority
- CN
- China
- Prior art keywords
- wheat
- brock
- gene
- powdery mildew
- mark
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a molecular mark closely linked with a Brock gene which can resist wheat powdery mildew, particularly to an AFLP molecular mark and a used primer linked with a powder mildew resistance gene, which belongs to agricultural biological engineering. Disease resistant wheat Brock, suscept wheat Jing 411 and a subisopolar gene line prepared from Brock and Jing 411 are used as material in the present invention in order to search a new molecular mark which can perfectly approach Brock in powdery mildew resistance unknown genes, and a mark selection is carried out by the combination of 225 AFLP primers, wherein the link system between the 227 bp specific fragment produced by primer combination P7/M14 and the disease resistance gene is strong, namely P7/M14<227>, and the genetic distance between the mark and resisting gene is 1.9cM. Cloned and sequenced, the actual length of the P7/M14<227> is 227 bp, and can be used for a new molecular mark of a powdery mildew resistance gene. Compared with the former sieved correlative mark, the mark is possible for being use for assisting selective breeding.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, particularly chain AFLP molecule marker and the primer thereof with powdery mildew resistance gene.
Technical background
The wheat powdery mildew that is caused by obligatory parasitism fungi wheat powdery mildew (Erysiphe graminis f.sp.tritici) is one of main disease of harm Wheat Production.In recent years, along with popularization of short stem, the semi-dwarf mutant wheat breed, the increase of field cultivation density and the improvement of water and fertilizer condition, this disease is on the rise in China's north and south wheat district hazard rating, becomes one of major obstacle factor of current improving yield of wheat, stable yields.Nineteen ninety, wheat powdery mildew was popular in 39% wheat planting district, the whole nation, caused production loss to reach 400,000,000 kilograms.At present, wheat powdery mildew has become one of common disease that threatens China's Wheat Production, so very urgent to the control of this disease.
Although can take chemical agent to prevent and treat wheat powdery mildew in the practice,, cultivate disease-resistant variety and be the safest, economy, effective measures.At the beginning of the seventies, China introduces the wheat derived varieties of tool 1B/1R as anti-source, is once once having the kind more than 90% to carry the Pm8 mildew-resistance gene, because the unicity of resistant gene, the result causes wheat powdery mildew repeatedly to be very popular in China.After this, China wheat breeding man is devoted to introduce in many ways the kind that has new disease-resistant gene with transformation, but because some disease-resistant gene is expressed inconsistent in different genetic backgrounds, cause and really be used to produce actual mildew-resistance gene seldom, that uses in breeding only has a Pm4a, Pm4b, Pm6, Pm8 and combination Pm2+6 thereof, Pm2+4 etc., adding wheat powdery mildew, to have a colony big, wide accommodation, characteristics such as the many and virulence variation of physiological strain is fast, the firm application soon of disease-resistant variety (being) that makes many costs time cultivation for many years, that have even also use, just owing to germ colony changes of toxicity has been lost resistance.The enforcement period of the ninth five-year plan, Pm4a, Pm6 have all begun to lose resistance throughout the country.China first transformation success and Pm21 gene of naming have voluntarily been released in twentieth century end, Beijing area.At present, utilized this gene comparatively widely in China's wheat breeding project, should cause vigilantly, prevented that the single phenomenon in anti-source from taking place once more, controls the popular of Powdery Mildew effectively.Just must excavate and utilize for this reason new resistance source energetically and constantly carry out adding up of disease-resistant gene, cultivate the persistent wheat breed of resistance.
For realizing above-mentioned task, excavate new resistance source, in the past, breeding men came assistant breeding by morphology mark and biochemical marker mostly, but this class mark has shortcomings such as workload is big, mark quantity is few, easy affected by environment.Along with development of molecular biology, a class is applied to wheat anti-powdery mildew research by domestic and international many scholars based on the molecular marking technique of DNA variation.Use molecule marker, can exempt heavy work program in the traditional breeding method, follow the tracks of, detect foreign gene, can also be aggregated to a plurality of mildew-resistance genes in the same improved seeds, obtain durable resistance.In addition, gene accurately being positioned on the highdensity molecular linkage map, is starting point with closely linked molecule marker, uses karyomit(e) walking methods such as (Chromosome Walking), approaches target gene gradually, finally clones this gene.Facts have proved that dna molecular marker is to carry out the important tool that disease resistance is identified and assistant breeding is studied.
Wheat is mainly controlled by major gene the resistance of Powdery Mildew, and the early gene symbol is M1, and the gene symbol of definite designation is Pm (powdery mildew).Since nineteen thirty Australia scholar reported first since Australian spring wheat variety Thew carries a dominance mildew-resistance gene, so far 30 Pm gene locuss have been identified, except that Pm29, all the other major genes have been positioned on karyomit(e) or the chromosome arm.Disease-resistant gene is still arranged in addition not by definite designation, represent with M1 temporarily.Since carrying out the powdery mildew resistance gene in wheat molecule marking research beginning of the nineties, existing disease-resistant gene near half has found corresponding molecule marker, but still has the unknown gene of a lot of mildew-resistances, does not filter out molecule marker as yet.Therefore, continue to use molecular marker method, screen the mark relevant, significant application value is arranged on agricultural with mildew-resistance gene.
Cultivated wheat Brock is introduced from Britain by professor Yang Zuomin of China Agricultural University, strong mildew-resistance.Reach near isogenic line with No. 15 physiological strains infection of white powder germ Brock, capital 411 by their preparations, occur without any bacterial plaque on 2 week back discovery Brock and the near isogenic line resistance single-strain blade, show strong mildew-resistance, and the 411 serious microbiological contaminations of recurrent parent capital.It is reported, contain Pm2 (Liu Z Y among the Brock, Sun Q X, Ni Z F, et al.1999.Development of SCAR markers linked to the Pm21 gene conferring resistance topowdery mildew in common wheat.Plant Breeding, 118:215-219), but, the wheat breed that contains pm2 in the production has been lost resistance (Li Longye mostly to the white powder germ, yellow Yuanjiang River. the effect of the known resistant gene of wheat powdery mildew and evaluation. Scientia Agricultura Sinica, 1990,23 (3): 20-26).For whether the resistance that confirms Pm2 among the Brock exists, we once infected with No. 15 physiological strains of North China popular white powder germ sociales contains 11 wheat cultivation kinds that Pm2 comprises Brock, found that, except that Brock has strong anti-characteristic, all the other 10 cultivars are moderate even the hyperinfection Powdery Mildew, thereby, we infer, the resistance of cultivated wheat Brock is not to come from Pm2, (document sees reference: Wang Zhenying but come from the new gene of another the strong mildew-resistance beyond the Pm2, Zhao Pei, Chen Hong, et al.2005.Identifiation ofRAPD markers and development of SCAR msrkers linked to a powdery mildew resistance gene, and their location on chromosome in wheat cultivar Brock.Plant Production Science.8 (5): 578-585).We the early stage studies show that, the new gene of strong mildew-resistance is the dominance monogenic inheritance among the Brock, (document sees reference: Zhenying Wang for the major gene of mildew-resistance, Qi Zheng, Yongkang Peng, et al., 2004.Identification of Random Amplified Polymorphic DNA and Simple Seqence RepeatMarkers Linked to Powdery Mildew resistance in Common wheat cultivar Brock.PlantProduction Science.7 (3): 318-322).Utilize the F in anti-source donor parents Brock, near isogenic line and recurrent parent capital 411 and Brock * capital 411
2Separation is anti-, the sense individual plant is a material, with RAPD, SSR, SCAR molecule marking method, finds molecule marker OPP15 chain with the mildew-resistance goal gene among the Brock
917, S2092
972, and Xgwm114
120The genetic distance of goal gene is respectively 6.0cM, 4.9cM and 9.3cM (document sees reference: Wang Zhenying among they and the Brock, Zhao Pei, Chen Hong, et al.2005.Identificationof RAPD markers and development of SCAR markers linked to a powdery mildew resistance gene, and their location on chromosome in wheat cultivar Brock.Plant Production Science.8 (5): 578-585).On the basis of above-mentioned research, with the higher AFLP molecular marking technique of polymorphism, further searching approaches the molecule marker and the primer of unknown mildew-resistance gene among the Brock more, screening is beneficial to the map based cloning of breeding of wheat molecular marker assisted selection and disease-resistant gene than RAPD, the SSR of existing mildew-resistance gene, the molecule marker that the SCAR mark is more pressed close to target gene.
Summary of the invention
Technical problem:
The object of the present invention is to provide PCR-based with common wheat Brock in the method that obtains of the chain AFLP mark of mildew-resistance unknown gene and the nucleotide sequence of combination of primers and this mark.With powdery-mildew-resistance wheat cultivar Brock is donor parents, best in quality but be recurrent parent to wheat breed capital 411 of Powdery Mildew sensitivity, by hybridization, backcross and selfing after the near isogenic line (NILs) of preparation mildew-resistance stability of characteristics, with amplified fragment length polymorphism (AFLP) analytical procedure, Brock, capital 411 and near isogenic line are carried out primer screening, combination of primers P7/M14 shows the polymorphism of amplified production in above-mentioned materials, obtain and the linked AFLP mark P7/M14 of mildew-resistance gene
227, this combination of primers can both detect characteristic strip in all resistance individual plants, can be used for the wheat powdery mildew assisted selection.
Technical scheme:
With the closely linked molecule marker P7/M14 of wheat Brock powdery mildew resistant gene
227Using the AFLP molecular marking technique adopts following method to obtain: with wheat cultivation kind Brock is the resistance donor parents, best in quality but be recurrent parent to wheat breed capital 411 of Powdery Mildew sensitivity, by hybridization, backcross and selfing after near isogenic line Brock/015//capital 411 of preparation mildew-resistance stability of characteristics
7(NILs), with Brock, capital 411 and near isogene is material, extracts their overall dna respectively with phenol-chloroform method, adopts the AFLP molecular marking technique, with 225 pairs of molecule markers that primer screening is relevant with the wheat powdery mildew resistance, filter out an AFLP molecule marker P7/M14
227, identify through linksystem, this mark and powdery mildew resistance gene in wheat close linkage, with the genetic distance of resistant gene be 1.9cM; Screening P7/M14
227The used AFLP primer sequence of mark is:
P7：CACTGCGTACATGCAGAGC
M14：GATGAGTCCTGAGTAAACC
P7/M14
227Base sequence be:
GATGAGTCCTGAGTAAACCCTGAGAATGCAGAGCACGTAAATAAATATCGA
CGTTCAAATCCCTGAAATCCATACCCTGACCTCCCTGATCCCGGTCGTTTCT
GACCTTTAGGTTGTATCCAAACAGGGGGATTTTTACCTGGGCAGAGAACGG
ACGGGATCAAGGTGAGTCATCTACATGCAGGTGGGTCTCATGGTCTCCTGG
ATTGCTCTGCATGTACGCAGTC。
Adopt the AFLP molecule marking method, screening and the linked molecule marker of powdery mildew resistance gene in wheat, its specific practice is:
Genomic dna with Brock, capital 411 and near isogenic line is a template, is connected under the effect of T4 dna ligase with the joint primer by behind Pst I and the Mse I double digestion, connects product as the aflp analysis template.The present invention selects 225 pairs of combination of primers to carry out aflp analysis for trying in the material at 3 altogether, found that the amplified production polymorphism appears in 28 combination of primers, and the linksystem identification and analysis finds to have only the amplified fragments P7/M14 of combination of primers P7/M14
227With mildew-resistance gene linkage relationship is arranged, the genetic distance between itself and the mildew-resistance gene is 1.9cM.With P7/M14
227Its long 227bp is found in clone and order-checking.
Beneficial effect:
Powdery Mildew is a kind of serious plant disease that influences Wheat Production.The present invention utilizes molecule marking method to obtain a new AFLP molecule marker chain with powdery mildew resistance gene.Utilize this method, shortcomings such as conventional breeding method required time cycle length have not only been overcome, and can targetedly disease-resistant gene be selected to obtain in the laboratory, on purpose a plurality of mildew-resistance genes of polymerization, cultivate new variety of wheat with stable resistance, also can utilize simultaneously the molecular marker clone mildew-resistance gene of this new powdery mildew resistance gene, positive effect be arranged for the molecular genetics mechanism of further understanding wheat anti-powdery mildew.Therefore, this result of study is all very valuable in wheat breeding practice and disease-resistant theoretical investigation.Its advantage specifically is summarized as follows:
1, the chain molecule marker of of the present invention and powdery mildew resistance gene, it is the new mark that in the filial generation individual plant stable, obtains to the wheat breed Brock of North China's Powdery Mildew bacterial immunity and resistance thereof, No. 15 physiological strains all there is resistance, and stable existence, can be used for wheat powdery mildew cultivar identification and disease-resistant wheat offspring's assisted selection.
2, this research material therefor is the wheat breed to No. 15 physiological strains (be the mixed type physiological strain, be the multiple Powdery Mildew germ of North China's popular) immunity, North China white powder germ is had the resistance of comparison broad-spectrum.Therefore, be expected to be cloned into new powdery mildew resistance gene according to the gained molecule marker.
3, the present invention is with the higher AFLP molecular marking technique of polymorphism, the molecule marker P7/M14 that obtains
227With the new intergenic genetic distance of mildew-resistance be 1.9Cm, more press close to target gene than RAPD, SSR, the SCAR mark of this mildew-resistance gene that screened in the past, more likely be used for production practice.
Description of drawings
Fig. 1: capital 411, resistance individual plant, Brock genome dna electrophoresis figure;
Fig. 2: the part combination of primers is in Beijing 411, the AFLP amplified production electrophoretogram in the resistance individual plant, Brock;
Fig. 3: P7/M14
227Analyze band diagram with the mildew-resistance gene linksystem;
Fig. 4: P7/M14
227Nucleotide sequence;
Wherein symbol is expressed as respectively among Fig. 1-4:
1: susceptible parent capital 411; 2: the resistance individual plant; 3: disease-resistant parent Brock;
2A: combination of primers P7/M14 amplified production electrophoretogram;
2B: combination of primers P13/M13 amplified production electrophoretogram;
2C: combination of primers P3/M10 amplified production electrophoretogram;
2D: combination of primers P6/M10 amplified production electrophoretogram;
2E: combination of primers P9/M5 amplified production electrophoretogram
M：λDNA Hind III/EcoR I Markers；
R: the disease-resistant individual plant of filial generation;
S: the susceptible individual plant of filial generation that does not have special band;
S
*: special band is arranged, but phenotype is susceptible filial generation individual plant;
Embodiment:
(specifying in conjunction with the accompanying drawings)
Embodiment 1:
The preparation of near isogenic line
The mildew-resistance donor gene of this molecule marker experiment is Brock, is a kind of wheat cultivation kind to the strong anti-characteristic of Powdery Mildew tool, and capital 411 is good wheat breeds, and 015 is excellent strain.The acquisition of this research experiment material is by Brock and 015 hybridization, F
1With capital 411 hybridization, a mildew-resistance stability of characteristics strain that obtains after gained offspring and 1 generation of capital 411 continuous backcross 7 generation selfings, these product tie up in the continuous backcross process, and every backcross progeny is that the back selection of coercing by the white powder germ obtains.
The separation of genomic dna
Get Brock, capital 411 and above-mentioned near isogenic line 0.2g etiolated seedling blade respectively, in liquid nitrogen, grind, be powder as far as possible, add rapidly 2 milliliters extract Buffer (50mM Tris-HCl, pH 8.0; 20mM EDTA; 50mM NaCl), mix gently, 65 ℃ of temperature are bathed 15min, put upside down mixing 2-3 time therebetween.0 ℃ of ice bath 10 minutes, 0-4 ℃, 3000 rev/mins centrifugal 15 minutes, beat easily supernatant, join in the new pipe, add the saturated phenol of equal-volume Tris-HCl (pH 8.0), mix gently.0-4 ℃, 3000 rev/mins centrifugal 10 minutes, get supernatant, add equal-volume phenol, chloroform-primary isoamyl alcohol (25: 24: 1) extracting, mixing gently.0-4 ℃, 3000 rev/mins centrifugal 10 minutes, get supernatant, add equal-volume chloroform-primary isoamyl alcohol (25: 24: 1) extracting, gently mixing.0-4 ℃, 3000 rev/mins, centrifugal 10 minutes, get supernatant, add 2 times of cold ethanol of volume ,-20 ℃ of precipitations are more than 1 hour.0-4 ℃, 12000 rev/mins, centrifugal 20 minutes, abandon supernatant, 75% ethanol 0-4 ℃ is of short duration centrifugal, washes precipitation 2 times, dries, and is dissolved in 100 μ l TE (pH8.0).Add 1 μ l RNase (10mg/ml), 37 ℃ are incubated 1 hour, to remove the RNA in the sample.Add equal-volume phenol, chloroform, extracting once, 0-4 ℃, 3000 rev/mins are centrifugal 10 minutes.Get supernatant, it is imitative to add equal-volume, extracting once, 0-4 ℃, 3000 rev/mins are centrifugal 10 minutes.Get supernatant, add the cold ethanol of two volumes ,-20 ℃ of precipitations are more than 2 hours.0-4 ℃, 12000 rev/mins, centrifugal 20 minutes.Abandon supernatant, 75% washing with alcohol product, 0-4 ℃ is of short duration centrifugal, washes precipitation 2 times, dries, and is dissolved among the 50 μ l TE (pH8.0).Detect the concentration of DNA sample respectively with ultraviolet spectrophotometry, 0.7% agarose gel electrophoresis detects the integrity of DNA and sees Fig. 1.
The screening of mark:
Aflp analysis is with reference to Vos (Vos, P., R.Hogers, M.Bleeker, M.Reijans, T.van de Lee, M.Hornes, A.Frijters, J.Pot, J.Peleman, M.Kuiper, M.Zabeau.AFLP:A new technique for DNAfingerprinting.Nucleic Acids Res, 1995, method 21:4407-4414) is carried out.Used joint and primer see Table 1.
Table 1AFLP analyzes used joint and primer
| Joint and primer | Sequence |
| The Pst I joint Mse I joint primer selective amplification primer that increases in advance | 5’CTCGTAGACTGCGTACATGCA3’ 3’CATCTGACGCATGT 5’ 5’GACGATGAGTCCTGAG3’ 3’TACTCAGGACTCAT5’ 5’GACTGCGTACATGCAG3’ 5’GATGAGTCCTGAGTAA3’ 5’-GACTGCGTACATGCAG ANN or GNN-3’ 5’-GATGAGTCCTGAGTAA CNN-3’ |
Annotate: partly for selecting base, N is any base A, G, T, C in following setting-out
1) genomic dna double digestion and joint connect: 100 * BSA, 0.2 μ l, NEB buffer4.0 μ l, Pst I (20U/ μ l) 0.25 μ l, Mse I (10U/ μ l) 0.5 μ l, Pst I joint (5pM) 1.0 μ l, Mse I joint (50pM) 1.0 μ l, T4 DNA ligase 0.4 μ l, 10 * T4 buffer, 2.0 μ l, DNA (100ng/ μ l) 5.0 μ l, ddH
2O polishing 40 μ l.Insulation is 8 hours under 37 ℃ of conditions.
2) pre-amplification: reaction system is 25 μ l, includes 1 μ L and connects product, 0.6pmol/L primer, 10 * PCR damping fluid, 2.5 μ L, the dNTPs of 0.2mmol/L, 1U Taq polysaccharase.The pcr amplification program is 94 ℃ of 2min; 94 ℃ of 35S, 56 ℃ of 35S, 72 ℃ of 60S, 30 circulations; 72 ℃ of 5min.Pre-expansion volume increase thing detects with 1% agarose electrophoresis, and it is standby to dilute 20 times of preservations.
3) selective amplification: the pre-expansion volume increase thing of dilution carries out aflp analysis for the selective amplification template.The selective amplification volume is 20 μ L, and AFLP selects the expansion system: Pst I joint primer (50ng/ μ L) 0.8 μ L, MseI joint primer (50ng/ μ L) 0.8 μ L, 10 * Buffer, 2.0 μ L, MgCl
2(25mM) 1.2 μ L, dNTP (10mM) 0.45 μ L, TaqE (5U/ μ L) 0.2 μ L, template DNA 2.0 μ L, ddH
2O polishing 20 μ L.Pcr amplification adopts the formula method that falls progressively, and its program is 94 ℃ of 2min:94 ℃ of 35S, 65 ℃ of 35S, and 72 ℃ of 30S, each cycle annealing temperature reduces by 0.7 ℃ later on, totally 12 circulations; 94 ℃ of 35S then, 56 ℃ of 35S, 72 ℃, 60S, 30 circulations; Last 72 ℃ of 5min.Amplification is carried out on MJ Research PTC-200 type PCR instrument.
4) detection of amplified production: amplified production 8 μ L add equivalent loading Buffer (98% methane amide; 10mMEDTA pH8.0; 0.25% bromjophenol blue; 0.25% dimethylbenzene green grass or young crops), 95 ℃ of sex change 5min, stand-by in ice bath immediately.Denaturing polyacrylamide gel with 6% (containing 6mol/L urea) electrophoretic separation, argentation shows electrophoretogram.
5) P7/M14
227The screening of mark and linksystem are identified and genetic distance calculates: with Brock, capital 411 and near isogene is material, 225 pairs of AFLP combination of primers of picked at random in table 2, cut connection, pre-amplification, select amplification and amplified production detection architecture to carry out the AFLP molecular screening with above-mentioned enzyme, found that amplified production polymorphism (Fig. 2 .A, B, C, D, E) appears in 28 combination of primers.For detecting polymorphic bands that above-mentioned 28 combination of primers that filter out produce and the linkage relationship between mildew-resistance gene, we with above-mentioned 28 combination of primers to Brock and capital 411 hybridize, F
1Obtain 79 disease-resistant individual plants and 27 susceptible individual plants carry out pcr amplification for separating after the selfing, the pcr amplification system that it adopted is: Pst I joint primer (50ng/ μ L) 0.8 μ L, Mse I joint primer (50ng/ μ L) 0.8 μ L, 10 * Buffer, 2.0 μ L, MgCl
2(25mM) 1.2 μ L, dNTP (10mM) 0.45 μ L, TaqE (5U/ μ L) 0.2 μ L, template DNA 2.0 μ L, ddH
2O polishing 20 μ L.The pcr amplification reaction program is: 94 ℃ of 2min; 94 ℃ of 35S, 65 ℃ of 35S, 72 ℃ of 30S, each cycle annealing temperature reduces by 0.7 ℃ later on, totally 12 circulations; 94 ℃ of 35S then, 56 ℃ of 35S, 72 ℃, 60S, 30 circulations; Last 72 ℃ of 5min.Amplification is carried out on MJ Research PTC-200 type PCR instrument.Found that, Fig. 2 .B, 2C, 2D, amplified production polymorphism that 2E is shown and mildew-resistance characteristic are irrelevant, have only between 227bp specific fragment that combination of primers P7/M14 produces and disease-resistant gene and have strong linksystem (seeing Fig. 2 .A).Have 2 strains specific band to occur in the susceptible strain of 27 strains, specific band does not appear in 25 strains; The specific band (see figure 3) all appears in the disease-resistant strain of 79 strains.This fragment named be P7/M14
227Use the MAPMAKER3.0 computed in software, the genetic distance of mildew-resistance gene is 1.9cM among this mark and the Brock.P7/M14
227Can be used as the molecule marker of mildew-resistance unknown gene among the Brock.
The combination of primers of table 2AFLP mark
| Primer Designation | PstI selective primers | Primer Designation | MseI selective primers |
| P1 | gACTgCgTACATgCAgAAC | M1 | gATgAgTCCTgAgTAACAA |
| P2 | gACTgCgTACATgCAgAAg | M2 | gATgAgTCCTgAgTAACAg |
| P3 | gACTgCgTACATgCAgACA | M3 | gATgAgTCCTgAgTAACAT |
| P4 | gACTgCgTACATgCAgACC | M4 | gATgAgTCCTgAgTAACTg |
| P5 | gACTgCgTACATgCAggTA | M5 | gATgAgTCCTgAgTAACCT |
| P6 | gACTgCgTACATgCAgACT | M6 | gATgAgTCCTgAgTAACTA |
| P7 | gACTgCgTACATgCAgAgC | M7 | gATgAgTCCTgAgTAACgA |
| P8 | gACTgCgTACATgCAgAgg | M8 | gATgAgTCCTgAgTAACAC |
| P9 | gACTgCgTACATgCAgAAT | M9 | gATgAgTCCTgAgTAACgC |
| P10 | gACTgCgTACATgCAgACg | M10 | gATgAgTCCTgAgTAACCA |
| P11 | gACTgCgTACATgCAgAgA | M11 | gATgAgTCCTgAgTAACAC |
| P12 | gACTgCgTACATgCAgAgT | M12 | gATgAgTCCTgAgTAACgT |
| P13 | gACTgCgTACATgCAggAC | M13 | gATgAgTCCTgAgTAATCT |
| P14 | gACTgCgTACATgCAggAT | M14 | gATgAgTCCTgAgTAAACC |
| P15 | gACTgCgTACATgCAgggT | M15 | gATgAgTCCTgAgTAAgCA |
P7/M14
227Clone and order-checking: mainly consult pGEM-T easy Vector System (Promega company) specification sheets and add following composition reaction: 2 * Buffer 5 μ l that connect in the following order on ice, pGEM-Teasy vector (50mg/ml) 1 μ l, the PCR product 2 μ l that add the A tail, T4 ligase enzyme (3U/ μ l) 1 μ l, aseptic two H that steam
2O polishing 10 μ l; Pressure-vaccum mixing gently, 4 ℃ of connections are spent the night.To connect product 2 μ l and be transformed among the 100 μ l competent cell DH5 α, filter out positive colony, and entrust Shanghai to give birth to the order-checking of worker bio-engineering corporation.It is AFLP molecule marker P7/M14 as a result
227Physical length is the 227bp (see figure 4).
SEQUENCE LISTING
＜110〉Tianjin Normal University
＜120〉with the closely linked molecule marker of wheat Brock powdery mildew resistant gene
<130>060518
<160>3
<170>PatentIn version 3.2
<210>1
<211>19
<212>DNA
＜213〉artificial sequence
<400>1
cactgcgtac atgcagagc 19
<210>2
<211>19
<212>DNA
＜213〉artificial sequence
<400>2
gatgagtcct gagtaaacc 19
<210>3
<211>227
<212>DNA
＜213〉wheat Brock (Triticum aestivum)
<400>3
gatgagtcct gagtaaaccc tgagaatgca gagcacgtaa ataaatatcg acgttcaaat 60
ccctgaaatc cataccctga cctccctgat cccggtcgtt tctgaccttt aggttgtatc 120
caaacagggg gatttttacc tgggcagaga acggacggga tcaaggtgag tcatctacat 180
gcaggtgggt ctcatggtct cctggattgc tctgcatgta cgcagtc 227
Claims (1)
1. with the closely linked molecule marker of wheat Brock powdery mildew resistant gene, it is characterized in that described molecule marker P7/M14
227Base sequence be:
GATGAGTCCTGAGTAAACCCTGAGAATGCAGAGCACGTAAATAAATATC
GACGTTCAAATCCCTGAAATCCATACCCTGACCTCCCTGATCCCGGTCG
TTTCTGACCTTTAGGTTGTATCCAAACAGGGGGATTTTTACCTGGGCAG
AGAACGGACGGGATCAAGGTGAGTCATCTACATGCAGGTGGGTCTCAT
GGTCTCCTGGATTGCTCTGCATGTACGCAGTC；
Molecule marker P7/M14
227Using the AFLP molecular marking technique adopts following method to obtain: with wheat cultivation kind Brock is the resistance donor parents, best in quality but be recurrent parent to wheat breed capital 411 of Powdery Mildew sensitivity, by hybridization, backcross and selfing after near isogenic line Brock/015//capital 411 of preparation mildew-resistance stability of characteristics
7(NILs), with Brock, capital 411 and near isogene is material, extracts their overall dna respectively with phenol-chloroform method, adopts the AFLP molecular marking technique, with 225 pairs of molecule markers that primer screening is relevant with the wheat powdery mildew resistance, filter out an AFLP molecule marker P7/M14
227, identify through linksystem, this mark and powdery mildew resistance gene in wheat close linkage, with the genetic distance of resistant gene be 1.9cM;
Screening P7/M14
227The used AFLP primer sequence of mark is:
P7：CACTGCGTACATGCAGAGC
M14：GATGAGTCCTGAGTAAACC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100138040A CN100434533C (en) | 2006-05-23 | 2006-05-23 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100138040A CN100434533C (en) | 2006-05-23 | 2006-05-23 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1884578A CN1884578A (en) | 2006-12-27 |
| CN100434533C true CN100434533C (en) | 2008-11-19 |
Family
ID=37582884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100138040A Expired - Fee Related CN100434533C (en) | 2006-05-23 | 2006-05-23 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100434533C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955988B (en) * | 2010-01-28 | 2012-05-30 | 天津师范大学 | Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1428440A (en) * | 2002-09-27 | 2003-07-09 | 天津师范大学 | Molecular marker linked with wheat mildew-resistance gene |
| CN1556218A (en) * | 2003-12-31 | 2004-12-22 | 天津市农业生物技术研究中心 | SCAR molecule marker closely linked with wheat anti powdery mildew gene |
| CN1661106A (en) * | 2004-12-30 | 2005-08-31 | 南京农业大学 | Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application |
| CN1737151A (en) * | 2005-07-12 | 2006-02-22 | 南京农业大学 | Wheat anti-powdery mildew gene Pm21 linked codorminant PCR marker and its usage |
-
2006
- 2006-05-23 CN CNB2006100138040A patent/CN100434533C/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1428440A (en) * | 2002-09-27 | 2003-07-09 | 天津师范大学 | Molecular marker linked with wheat mildew-resistance gene |
| CN1556218A (en) * | 2003-12-31 | 2004-12-22 | 天津市农业生物技术研究中心 | SCAR molecule marker closely linked with wheat anti powdery mildew gene |
| CN1661106A (en) * | 2004-12-30 | 2005-08-31 | 南京农业大学 | Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application |
| CN1737151A (en) * | 2005-07-12 | 2006-02-22 | 南京农业大学 | Wheat anti-powdery mildew gene Pm21 linked codorminant PCR marker and its usage |
Non-Patent Citations (2)
| Title |
|---|
| 小麦抗白粉病基因的分子标记. 解超杰等.中国农业大学学报，第8卷第1期. 2003 |
| 小麦抗白粉病基因的分子标记. 解超杰等.中国农业大学学报，第8卷第1期. 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1884578A (en) | 2006-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104630215A (en) | Series molecular markers closely linked with muskmelon powdery mildew resistant gene Pm-2Fand acquisition method of series molecular markers | |
| WO2014075401A1 (en) | Method for cloning plant disease resistance genes in high-throughput manner | |
| CN111961746B (en) | SNP molecular marker related to blight and disease resistance of cotton on land and application thereof | |
| Su et al. | Fine mapping and molecular marker development of the Sm gene conferring resistance to gray leaf spot (Stemphylium spp.) in tomato | |
| CN103966335B (en) | A kind of SNP that utilizes develops the method with the closely linked SNP-SSR molecule marker of SNP | |
| CN108179146B (en) | Disease-resistant transgenic soybean event B5C9120-3 exogenous insert flanking sequence and application thereof | |
| CN107475418B (en) | Molecular marker closely linked with tillering character of millet, primer and application | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN101487056B (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN113881799B (en) | Functional molecular marker for screening/detecting tobacco root black rot main effect resistance locus and application thereof | |
| KR100781205B1 (en) | SSR primer isolated from Perilla spp. and use thereof | |
| CN101880658A (en) | Molecular marker of line with genic sterile recessive epistatic interaction in brassica napus and application | |
| CN108239640B (en) | Disease-resistant transgenic soybean event B5C9122-2 exogenous insert flanking sequence and application thereof | |
| CN100494401C (en) | SCAR molecule marker closely linked with wheat anti powdery mildew gene | |
| CN103215289B (en) | Gene sequence a for causing watermelon bisexual flower development and obtaining method thereof | |
| CN100434533C (en) | Molecular marking closely linked with wheat Brock powdery mildew resistant gene | |
| CN108374006B (en) | Disease-resistant transgenic soybean event B5C9123-5 exogenous insert flanking sequence and application thereof | |
| CN110777218A (en) | Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN101955988B (en) | Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> | |
| CN113046467A (en) | SNP loci significantly associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN102094091B (en) | Method for separating and detecting spontaneous mutation gene based on agarose gel denaturation and renaturation and biotin affinity adsorption | |
| CN108239641B (en) | Disease-resistant transgenic soybean event B5B9104-3 exogenous insert flanking sequence and application thereof | |
| CN106636386B (en) | Molecular marker DNdCAPS8.03-1 linked with maize head smut resistant minor major site and application thereof | |
| Elahi et al. | Breeding rice for salinity tolerance using the Pokkali allele: finding a linked DNA marker | |
| CN114574608B (en) | SNP (Single nucleotide polymorphism) marker related to cucumber anti-target spot and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| DD01 | Delivery of document by public notice |
Addressee: Wang Zhenying Document name: Notification of Termination of Patent Right |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20081119 Termination date: 20090623 |