CN101955988B - Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> - Google Patents
Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> Download PDFInfo
- Publication number
- CN101955988B CN101955988B CN2010101019219A CN201010101921A CN101955988B CN 101955988 B CN101955988 B CN 101955988B CN 2010101019219 A CN2010101019219 A CN 2010101019219A CN 201010101921 A CN201010101921 A CN 201010101921A CN 101955988 B CN101955988 B CN 101955988B
- Authority
- CN
- China
- Prior art keywords
- brock
- resistant
- powdery mildew
- jing411
- capital
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular detection method of a mating system and a genetic background of powdery mildew-resistant near-isogenic lines Brock/Jing411<7>, and a nucleotide sequence of a molecular marker P15/M14-160 closely linked with a powdery mildew-resistant gene, which belong to the field of gene engineering of agricultural biology. The near-isogenic lines are obtained by hybridizing common powdery mildew-resistant wheat Brock serving as a disease-resistant gene donor parent with cultivated wheat Jing411 which has high agronomical characters, does not resist powdery mildew and serves as a recurrent parent, wherein the first generation (F1) is continuously backcrossed with the Jing411 for seven generations and inbred for one generation to breed the near-isogenic lines Brock/Jing411<7>. Disease-resistant single plants are selected under the stress of the powdery mildew during every hybridization and backcross. Four AFLP spectral patterns are disclosed, namely parental ditype, partial disease-resistant donor Brock type, partial recurrent parent Jing411 type and crossover type, and can reflect the biparental genetic background in the near-isogenic lines.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, relate to the preparation of mildew-resistance near isogenic line, relate to the Molecular Detection and the application of wheat Brock powdery mildew resistant near isogenic line genetic background in particular.
Technical background
Near isogenic line (Near-isogenic Lines; NIL) proposed by Yong etc., it is close to refer to genetic background, one group of strain (Young N D that target gene is different; Zamir D G; Tanksley S D.Use of isogenic lines andsimultaneoue probing to identify DNA markers tightly linked to the TM-Za gene in tomato.Genetics.1988,120:579-585), it can be used for research (Tian Qingzhen such as polypheny analysis, target gene separation, gene Fine Mapping and clone; Zhou Ronghua; Jia Jizeng. the Molecular Detection of wheat anti-powdery mildew near isogenic line genetic background. Acta Agronomica Sinica, 2004,30 (3): 205-209; Zhang Yi, Li Yunfeng, Xie Rong, Yang Zhenglin; Zhong Bingqiang, Shen Fucheng, Tan Zijun, what brilliance. the structure of clustering property of paddy rice small ear near isogenic line and property evaluation such as near thereof. Acta Agronomica Sinica; 2006,32 (3): 397-401), therefore, be the precious material of genetics and breeding research.Cultivated the NIL of the many objective traits that comprise disease resistance with many for backcrossing through hybridization; And be applied to ([Borb á laD in the association area research separately; Harrach J F; Mikl ó s P, et al.Antioxidant ethylene and membrane leakage responses topowdery mildew infection of near-isogenic barley lines with various types of resistance.
European Journal of Plant Pathology.2008,121:21-33; Mumtaz S; Khan I A; Ali S; Et al.Development of RAPD based markers for wheat rust resistance gene cluster (Lr37-Sr38-Yr17) derived from Triticum ventricosum L.African Journal of Biotechnology.2009,8 (7): 1188-1192; Zhu S, Walker D R, Boerma H R, et al.Effects of defoliating insectresistance QTLs and a crylAc transgene in soybean near-isogenic lines.
Theoretical and Applied Genetics.2008,116:455-463; Brevis J C, Chicaiza O, Khan I A; Et al.Agronomicand quality evaluation of common wheat near-isogenic lines carrying the Leaf Rust ResistanceGene Lr47.Crop Science.2008,48,1411-1451.Zhou R H; Zhu Z D, Kong X Y, Huo N X; Tian Q Z, Li P, Jin C Y; Dong Y C, Jia J Z.Development of wheat near-isogenic lines forpowdery mildew resistance.
Theoretical and Applied Genetics.2005,110:640-648).But the cultivation of NIL needs the 7-8 year with selection, and the cycle is long, and the evaluation index of efficiency of selection is to backcross the algebraic sum mode of appearance, and this method is grown and environmental influence easily, and efficiency of selection is low.Follow the tracks of and estimate NIL genetic background on the molecular level, safety is high, not restricted by growth and envrionment conditions, therefore, can improve cultivation process and the efficiency of selection of NIL.Contain the new gene of a mildew-resistance (Wang Z Y among the cultivated wheat Brock; Zheng Q; Peng Y K; Et al.Identification of random amplified polymorphic DNA and simple sequence repeat markerslinked to powdery mildew resistance in common wheat cultivar Brock.Plant ProductionScience, 2004,7 (3): 318-322; Wang Z Y; Zhao P; Chen H, et al.Identification of RAPDmarkers and development of SCAR markers linked to a powdery mildew resistance gene, andtheir location on chromosome in wheat cultivar Brock.Plant Production Science; 2005,8 (5): 578-585).After China Agricultural University with Brock is 015 hybridization of the good wheat line of donor and agronomic traits, offspring and 411 hybridization of improved seeds capital, the F of acquisition mildew-resistance
1, to hybridize once more for recurrent parent with capital 411, the offspring backcrosses with capital 411, and coerces down at powdery mildew and to select, and has prepared near isogenic line Brock/015//capital 411
7
The present invention is the mildew-resistance gene donor parents with Brock, directly with improved seeds capital 411, through hybridizing, backcross and the individual selection of powdery mildew under coercing, has prepared mildew-resistance near isogenic line Brock/ capital 411
7And utilize the AFLP method, to the near isogenic line Brock/ capital 411 of the present invention's preparation
7Genetic background detect, this detects in mildew-resistance gene donor parents Brock, recurrent parent capital 411 and near isogenic line Brock/015/ capital 411
7With Brock/ capital 411
7Between carry out.The result finds to have 4 kinds of AFLP spectral patterns: " parental ditype ", " disease-resistant partially donor Brock type ", " recurrent parent capital 411 types partially " and " crossover " are detected, and they can reflect amphilepsis background in the near isogenic line.Simultaneously, to screening with the linked molecule marker of disease-resistant gene in 2 pairs of near isogenic lines, obtain compact linkage molecule mark P15/M14-160.Above-mentioned detection near isogenic line genetic background can make it can on disease-resistant hereditary mechanism research and agricultural, use the better effect of performance.
Summary of the invention
The objective of the invention is to use wheat breed Brock to be the mildew-resistance gene donor parents to the white powder bacterial immunity; The kind capital 411 good with economical character is a recurrent parent; Preparation mildew-resistance near isogenic line through the AFLP detection technique, detects the genetic background between near isogenic line and parents; Thereby obtain reliable mildew-resistance near isogenic line, the mildew-resistance breeding, disease-resistant gene that are used for wheat are because of clone and disease-resistant molecular mechanism research.For realizing above-mentioned purpose, the present invention provides following technical scheme:
A kind of mildew-resistance near isogenic line Brock/ capital 4117 Genetic Detection methods is characterized in that comprising the steps:
1) aflp analysis is seen table 1 with reference to used joint and primer;
Used joint of table 1 aflp analysis and primer
| Joint and primer | Sequence |
| The preparatory amplimer of Pst I joint Mse I joint | 5’CTCGTAGACTGCGTACATGCA3’ 3’CATCTGACGCATGT?5’ 5’GACGATGAGTCCTGAG3’ 3’TACTCAGGACTCAT5’ 5’GACTGCGTACATGCAG3’ 5’GATGAGTCCTGAGTAA3’ |
| The selective amplification primer | 5’-GACTGCGTACATGCAG? ANN or GNN-3’ 5’-GATGAGTCCTGAGTAA CNN-3’ |
Annotate: partly for selecting base, N is any base A, G, T, C in following setting-out
2) genomic dna double digestion and joint connect: 100 * BSA, 0.2 μ l, NEB buffer 4.0 μ l, Pst I (20U/ μ l) 0.25 μ l; Mse I (10U/ μ l) 0.5 μ l, Pst I joint (5pM) 1.0 μ l, Mse I joint (50pM) 1.0 μ l; T4 DNAligase 0.4 μ l; 10 * T4 buffer, 2.0 μ l, DNA (100ng/ μ l) 5.0 μ l, ddH2O polishing 40 μ l.Insulation is 8 hours under 37 ℃ of conditions;
3) amplification in advance: reaction system is 25 μ L, includes 1 μ L and connects product, 0.6pmol/L primer, 10 * PCR damping fluid, 2.5 μ L, the dNTPs of 0.2mmol/L, 1U Taq polysaccharase.The pcr amplification program is 94 ℃ of 2min; 94 ℃ of 35S, 56 ℃ of 35S, 72 ℃ of 60S, 30 circulations; 72 ℃ of 5min.In advance amplified production detects with 1% agarose electrophoresis, and it is subsequent use to dilute 20 times of preservations;
4) selective amplification: the selective amplification volume is 20 μ L, and AFLP selects the expansion system: Pst I joint primer (50ng/ μ L) 0.8 μ L, Mse I joint primer (50ng/ μ L) 0.8 μ L, 10 * Buffer, 2.0 μ L, MgCl
2(25mM) 1.2 μ L, dNTP (10mM) 0.45 μ L, TaqE (5U/ μ L) 0.2 μ L, template DNA 2.0 μ L, ddH
2O polishing 20 μ L; Pcr amplification adopts the formula method that falls progressively, and its program is 94 ℃ of 2min:94 ℃ of 35S, 65 ℃ of 35S, and 72 ℃ of 30S, each cycle annealing temperature reduces by 0.7 ℃ later on, totally 12 circulations; 94 ℃ of 35S then, 56 ℃ of 35S, 72 ℃, 60S, 30 circulations; Last 72 ℃ of 5min.Amplification is carried out on MJ Research PTC-200 type PCR appearance.
5) detection of amplified production: amplified production adds equivalent loading Buffer (98% methane amide; 10mM EDTA (pH8.0); 0.25% bromjophenol blue; 0.25% YLENE is blue or green), 95 ℃ of sex change 5min, for use in ice bath immediately; Denaturing polyacrylamide gel with 6% (containing 6mol/L urea) electrophoretic separation, argentation shows electrophoretogram.
6) genetic background analysis: with two near isogenic line (Brock/015//capital 411
7Brock/ capital 411
7) and donor parents Brock and recurrent parent capital 411 be material; With 225 pairs of AFLP combination of primers of picked at random in the table 2; Cut connection, amplification in advance, select amplification and amplified production detection architecture to carry out the AFLP Molecular Detection with above-mentioned enzyme, the result has 4 kinds of parental ditypes, disease-resistant partially donor Brock type, inclined to one side recurrent parent capital 411 types and crossover to be detected.
The combination of primers of table 2 AFLP mark
| Primer Designation | PstI?selective?primers | Primer Designation | MseI?selective?primers |
| P1 | gACTgCgTACATgCAgAAC | M1 | gATgAgTCCTgAgTAACAA |
| P2 | gACTgCgTACATgCAgAAg | M2 | gATgAgTCCTgAgTAACAg |
| P3 | gACTgCgTACATgCAgACA | M3 | gATgAgTCCTgAgTAACAT |
| P4 | gACTgCgTACATgCAgACC | M4 | gATgAgTCCTgAgTAACTg |
| P5 | gACTgCgTACATgCAggTA | M5 | gATgAgTCCTgAgTAACCT |
| P6 | gACTgCgTACATgCAgACT | M6 | gATgAgTCCTgAgTAACTA |
| P7 | gACTgCgTACATgCAgAgC | M7 | gATgAgTCCTgAgTAACgA |
| P8 | gACTgCgTACATgCAgAgg | M8 | gATgAgTCCTgAgTAACAC |
| P9 | gACTgCgTACATgCAgAAT | M9 | gATgAgTCCTgAgTAACgC |
| P10 | gACTgCgTACATgCAgACg | M10 | gATgAgTCCTgAgTAACCA |
| P11 | gACTgCgTACATgCAgAgA | M11 | gATgAgTCCTgAgTAACAC |
| P12 | gACTgCgTACATgCAgAgT | M12 | gATgAgTCCTgAgTAACgT |
| P13 | gACTgCgTACATgCAggAC | M13 | gATgAgTCCTgAgTAATCT |
| P14 | gACTgCgTACATgCAggAT | M14 | gATgAgTCCTgAgTAAACC |
| P15 | gACTgCgTACATgCAgggT | M15 | gATgAgTCCTgAgTAAgCA |
Genetic Detection method of the present invention, wherein mildew-resistance near isogenic line Brock/ capital 411
7Preparation be: with mildew-resistance common wheat Brock is the disease-resistant gene donor parents, and so that economical character is good but cultivated wheat not mildew-resistance capital 411 is a recurrent parent, 411 hybridization of Brock * capital, cross combination is Brock/ capital 411 ", gained F
1All mildew-resistance was backcrossed for 7 generations with capital 411, and 1 generation of selfing is bred mildew-resistance near isogenic line Brock/ capital 411
7Hybridization each time and backcrossing is all coerced at powdery mildew and is selected disease-resistant individual plant down.
The present invention adopts AFLP method and the closely linked molecule marker P15/M14-160 of mildew-resistance gene, and its base sequence is:
GCAGAAGTCGTTTACAATCAGGTCATAGTAGAAACTGTTGAAATCAAAAGGAAATGGGTGCGTGTTTTGAATTGAGACGTGTTAGTCGCTAAATCGAGGTGTCAAAGCGTCGTTCTGTTCTTATGATCGCTCGTTATGTGTTGCTGAAGAAAATGTGGTC。
The present invention is with underlined advantage of comparing and beneficial effect:
Powdery Mildew is a kind of serious plant disease that influences Wheat Production.The present invention utilizes the cultivated wheat Brock to the white powder bacterial immunity to be the mildew-resistance gene donor parents; Use economical character good but near isogenic line is prepared for recurrent parent in the responsive capital 411 of powdery mildew; And utilize the AFLP method that the genetic background of this near isogenic line has been carried out Molecular Detection, set up detection method safely and effectively; Screen simultaneously and the closely linked molecule marker of mildew-resistance gene.The molecular genetics mechanism that the present invention to the seed selection of mildew-resistance cultivated wheat improved seeds, further understands wheat anti-powdery mildew has positive effect.Therefore, result of study of the present invention is all very valuable in wheat breeding practice and disease-resistant theoretical investigation.Its advantage specifically is summarized as follows:
(1) the wheat anti-powdery mildew near isogenic line of the present invention's preparation can be used for the wheat anti-powdery mildew breeding of new variety, the wheat anti-powdery mildew molecular mechanism research.
(2) this research material therefor is the wheat breed to No. 15 physiological strains (be the mixed type physiological strain, be the multiple Powdery Mildew germ of North China's popular) immunity, North China white powder germ is had the resistance of comparison broad-spectrum.Therefore, be expected to be cloned into new powdery mildew resistance gene according to the gained near isogenic line.
(3) the present invention uses the AFLP molecular marking technique, and near isogenic line and parents' genetic background is carried out Molecular Detection, obtains sure experimental result, and the new gene close linkage of molecule marker P15/M14-160 that obtains and mildew-resistance might be used for production practice.
Description of drawings
Fig. 1: the resistance reaction of near isogenic line, 411 pairs of Powdery Mildews of Brock and capital.Wherein a. capital 411; B. near isogenic line Brock/015//capital 411
7C. near isogenic line Brock/ capital 411
7D.Brock.
Fig. 2: the AFLP fingerprint near isogenic line and donor parents Brock, capital 411.1. capital 411 wherein; 2. near isogenic line Brock/015//capital 411
73. near isogenic line Brock/ capital 411
74.Brock
I represents " parental ditype "
II represents " disease-resistant partially donor Brock type "
III representative " recurrent parent capital 411 types partially "
IV represents " crossover "
Fig. 3: the AFLPs nucleotide sequence, wherein (1) is the sequencing result of sequencing result (6) P11/M14-206 of sequencing result (5) P13/M13-245 of sequencing result (4) P15/M14-206 of sequencing result (3) P3/M6-395 of sequencing result (2) P6/M3-163 of P6/M3-166.
Fig. 4: P15/M14 is in Brock, capital 411 and resist, feel the pcr amplification result in the individual plant.M wherein, DL2000Marker; The susceptible individual plant of 1-3; 4, Jing 411; 5, Brock; The disease-resistant individual plant of 6-18.
Embodiment
, and be not used in and also should be interpreted as the restriction to inventing in the listed claim by any way with helping understand the present invention below in conjunction with embodiment (accompanying drawing, table specify).What explain especially is that the used all ingredients of the present invention all has commercially available.
The preparation of embodiment 1, near isogenic line:
The preparation of near isogenic line of the present invention: the disease-resistant gene donor parents is from Britain common wheat kind Brock, and hybridize in the good but susceptible parent capital 411 of itself and economical character, and cross combination is " Brock/ capital 411 ", gained F
1All mildew-resistance is backcrossed with capital 411, and No. 15 physiological strains of popular powdery mildew are coerced down in the North China, select disease-resistant individual plant, and after 7 generations, selfing once obtains mildew-resistance near isogenic line Brock/ capital 411 again
7Fig. 1 is capital 411, near isogenic line Brock/015//capital 411
7, near isogenic line Brock/ capital 411
7With Brock blade microbiological contamination 2 during week relatively, find 411 serious microbiological contaminations unexpectedly, mycelia almost is paved with blade, and two near isogenic lines (Fig. 1 b c) He on the Brock blade does not see bacterial plaque.
The separation of embodiment 2, genomic dna:
Get 0.2g etiolated seedling blade, in liquid nitrogen, grind, be powder as far as possible, add rapidly 2 milliliters extract Buffer (50mM Tris-HCl, pH 8.0; 20mM EDTA; 50mM NaCl), mix gently, 65 ℃ of temperature are bathed 15min, put upside down mixing 2-3 time therebetween.0 ℃ of ice bath 10 minutes, 0-4 ℃, 3000 rev/mins centrifugal 15 minutes, beat easily supernatant, join in the new pipe, add the saturated phenol of equal-volume Tris-HCl (pH 8.0), mix gently.0-4 ℃, 3000 rev/mins centrifugal 10 minutes, get supernatant, add equal-volume phenol, chloroform-primary isoamyl alcohol (25: 24: 1) extracting, mixing gently.0-4 ℃, 3000 rev/mins centrifugal 10 minutes, get supernatant, add equal-volume chloroform-primary isoamyl alcohol (25: 24: 1) extracting, gently mixing.0-4 ℃, 3000 rev/mins, centrifugal 10 minutes, get supernatant, add 2 times of cold ethanol of volume ,-20 ℃ of depositions are more than 1 hour.0-4 ℃, 12000 rev/mins, centrifugal 20 minutes, abandon supernatant, 75% ethanol 0-4 ℃ is of short duration centrifugal, washes deposition 2 times, dries, and is dissolved in 100 μ l TE (pH8.0).Add 1 μ l RNase (10mg/ml), 37 ℃ are incubated 1 hour, to remove the RNA in the sample.Add equal-volume phenol, chloroform, extracting once, 0-4 ℃, 3000 rev/mins are centrifugal 10 minutes.Get supernatant, it is imitative to add equal-volume, extracting once, 0-4 ℃, 3000 rev/mins are centrifugal 10 minutes.Get supernatant, add the cold ethanol of two volumes ,-20 ℃ of depositions are more than 2 hours.0-4 ℃, 12000 rev/mins, centrifugal 20 minutes.Abandon supernatant, 75% ethanol 0-4 ℃ of short duration centrifugal, washes deposition 2 times, dries, and is dissolved among the 50 μ l TE (pH8.0).Detect the concentration of DNA sample respectively with ultraviolet spectrophotometry, 0.7% agarose gel electrophoresis detects the integrity of DNA.
Aflp analysis is with reference to Vos (Vos, P., R.Hogers, M.Bleeker; M.Reijans, T.van de Lee, M.Hornes, A.Frijters; J.Pot, J.Peleman, M.Kuiper; M.Zabeau.AFLP:A new technique forDNA fingerprinting.Nucleic Acids Res, 1995, the method that 21:4407-4414) waits is carried out.Used joint and primer are seen table 1.
1) genomic dna double digestion and joint connect: 100 * BSA, 0.2 μ l, NEB buffer 4.0 μ l, Pst I (20U/ μ l) 0.25 μ l; Mse I (10U/ μ l) 0.5 μ l, Pst I joint (5pM) 1.0 μ l, Mse I joint (50pM) 1.0 μ l; T4 DNAligase 0.4 μ l; 10 * T4buffer, 2.0 μ l, DNA (100ng/ μ l) 5.0 μ l, ddH
2O polishing 40 μ l.Insulation is 8 hours under 37 ℃ of conditions.
2) amplification in advance: reaction system is 25 μ L, includes 1 μ L and connects product, 0.6pmol/L primer, 10 * PCR damping fluid, 2.5 μ L, the dNTPs of 0.2mmol/L, 1U Taq polysaccharase.The pcr amplification program is 94 ℃ of 2min; 94 ℃ of 35S, 56 ℃ of 35S, 72 ℃ of 60S, 30 circulations; 72 ℃ of 5min.In advance amplified production detects with 1% agarose electrophoresis, and it is subsequent use to dilute 20 times of preservations.
3) selective amplification: the preparatory amplified production of dilution carries out aflp analysis for the selective amplification template.The selective amplification volume is 20 μ L, and AFLP selects the expansion system: Pst I joint primer (50ng/ μ L) 0.8 μ L, Mse I joint primer (50ng/ μ L) 0.8 μ L, 10 * Buffer, 2.0 μ L, MgCl
2(25mM) 1.2 μ L, dNTP (10mM) 0.45 μ L, TaqE (5U/ μ L) 0.2 μ L, template DNA 2.0 μ L, ddH
2O polishing 20 μ L.
Pcr amplification adopts the formula method that falls progressively, and its program is 94 ℃ of 2min:94 ℃ of 35S, 65 ℃ of 35S, and 72 ℃ of 30S, each cycle annealing temperature reduces by 0.7 ℃ later on, totally 12 circulations; 94 ℃ of 35S then, 56 ℃ of 35S, 72 ℃, 60S, 30 circulations; Last 72 ℃ of 5min.Amplification is carried out on MJ Research PTC-200 type PCR appearance.
4) detection of amplified production: amplified production adds equivalent loading Buffer (98% methane amide; 10mM EDTA (pH8.0); 0.25% bromjophenol blue; 0.25% YLENE is blue or green), 95 ℃ of sex change 5min, for use in ice bath immediately.Denaturing polyacrylamide gel with 6% (containing 6mol/L urea) electrophoretic separation, argentation shows electrophoretogram.
5) genetic background analysis: with two near isogenic line (Brock/015//capital 411
7Brock/ capital 411
7) and donor parents Brock and recurrent parent capital 411 be material; With 225 pairs of AFLP combination of primers of picked at random in the table 2; Cut connection, in advance amplification, select amplification and amplified production detection architecture to carry out the AFLP Molecular Detection with above-mentioned enzyme, the statistics of amplification spectral pattern is according to following method: by the bands of a spectrum (Fig. 2 I) that combination of primers P6/M3 amplifies, obviously can find out among 2 couples of NIL; There are two AFLP bands of a spectrum to come from donor parents Brock and recurrent parent capital 411 respectively; We are called " parental ditype " this AFLP spectral pattern, and the arrow indication is represented with I among the figure.The AFLP spectral pattern that increases out by combination of primers P3/M6, P6/M3, P6/M6, P6/M7, P11/M14, P13/M13, P15/M11, P15/M14, P15/M15; Show as the bands of a spectrum that exist among the donor parents Brock; In 2 couples of NIL, also all exist, equal disappearance in Beijing 411, we are referred to as " disease-resistant partially parent Brock type " this spectral pattern; Arrow indication among the figure is represented (Fig. 2 II) with II.And increase by P6/M3, P3/M6, P6/M6, P13/M13 combination of primers; Be present in specifically among the capital 411 and the 2 couples of NIL, in disease-resistant parent Brock, do not exist, we are referred to as " recurrent parent capital 411 types partially " this type AFLP bands of a spectrum; Arrow indication among the figure is represented (Fig. 2 III) with III.Except above-mentioned three kinds of spectral patterns; We have also seen in parent Brock and capital 411 and all not having existed; But the bands of a spectrum that in 2 couples of NIL, exist, like the AFLP bands of a spectrum that increased out by combination of primers P6/M3, P6/M6, P6/M7, P13/M13, we are referred to as " crossover " this spectral pattern; Arrow indication among the figure is represented (Fig. 2 IV) with IV.
The acquisition of embodiment 4, P15/M14-160 mark:
With Brock, capital 411 and near isogenic line is material; 225 pairs of AFLP combination of primers of picked at random in table 2; Cut connection, amplification in advance, select amplification and amplified production detection architecture to carry out the AFLP molecular screening with above-mentioned enzyme; The result finds have 28 combination of primers the amplified production polymorphum to occur, from polyacrylamide gel, reclaims above-mentioned specific fragment, increases to carrying out secondary with original primer respectively; Wherein 8 fragments obtain effectively amplification, amplified production is purified, clone, serve the Hai Shenggong order-checking after identifying.
Embodiment 5, P15/M14-160 molecule marker are identified with anti-linksystem from the powder ospc gene:
According to embodiment 4 sequencing results design special primer, with Brock * capital 411 F
2For 183 individual plants and two parent's wheat overall dnas is that template is carried out pcr amplification; The only bands of a spectrum and the resistant gene linked (Fig. 4) of combination of primers P15/M14 amplification; The amplimer sequence is F:GCAGAAGTCGTTTACAATCAG; R:GACCACATTTTCTTCAGCAAC, molecular weight of product is 160bp, names to be P15/M14-160.Show as at disease-resistant parent Brock and Brock * capital 411 F
2All detect these bands of a spectrum in separating obtained 136 individual plants; And these bands of a spectrum all do not appear in susceptible capital 411 and 47 susceptible individual plants; Exchange does not produce; Disease-resistant gene close among this AFLP molecule marker of possibility and the Brock is described, possibly be even a fragment in this disease-resistant gene.This molecule marker has important value at the wheat anti-powdery mildew assisted selection.
Sequence table
< 110>Tianjin Normal University
< 120>Molecular Detection of wheat Brock powdery mildew resistant near isogenic line and application
<160>2
<210>1
<211>160bp
<212>DNA
< 213>gene order
<220>
<221>gene
<222>(1)..(160)
<400>1
gcagaagtcg?tttacaatca?ggtcatagta?gaaactgttg?aaatcaaaag?gaaatgggtg 60
cgtgttttga?attgagacgt?gttagtcgct?aaatcgaggt?gtcaaagcgt?cgttctgttc 120
ttatgatcgc?tcgttatgtg?ttgctgaaga?aaatgtggtc 160
Claims (1)
- One kind with the closely linked molecule marker P15/M14-160 of mildew-resistance gene, its base sequence is:GCAGAAGTCGTTTACAATCAGGTCATAGTAGAAACTGTTGAAATCAAAAGGAAATGGGTGCGTGTTTTGAATTGAGACGTGTTAGTCGCTAAATCGAGGTGTCAAAGCGTCGTTCTGTTCTTATGATCGCTCGTTATGTGTTGCTGAAGAAAATGTGGTC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101019219A CN101955988B (en) | 2010-01-28 | 2010-01-28 | Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101019219A CN101955988B (en) | 2010-01-28 | 2010-01-28 | Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101955988A CN101955988A (en) | 2011-01-26 |
| CN101955988B true CN101955988B (en) | 2012-05-30 |
Family
ID=43483574
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101019219A Expired - Fee Related CN101955988B (en) | 2010-01-28 | 2010-01-28 | Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101955988B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605078B (en) * | 2012-03-27 | 2013-12-11 | 山东省农业科学院作物研究所 | Multiplex-polymerase chain reaction (PCR) kit for detecting wheat disease-resistant gene and application of kit |
| CN114480709B (en) * | 2022-01-30 | 2022-11-29 | 北京大学现代农业研究院 | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1428440A (en) * | 2002-09-27 | 2003-07-09 | 天津师范大学 | Molecular marker linked with wheat mildew-resistance gene |
| CN1884578A (en) * | 2006-05-23 | 2006-12-27 | 天津师范大学 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
-
2010
- 2010-01-28 CN CN2010101019219A patent/CN101955988B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1428440A (en) * | 2002-09-27 | 2003-07-09 | 天津师范大学 | Molecular marker linked with wheat mildew-resistance gene |
| CN1884578A (en) * | 2006-05-23 | 2006-12-27 | 天津师范大学 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
Non-Patent Citations (4)
| Title |
|---|
| Lorenz Hartl et al..Identification of AFLP markers closely linked to the powdery mildew resistance genes Pm1c and Pm4a in common wheat (Triticum aestivum L.).《Genome》.1999,第42卷(第2期),322-329. * |
| Ronghua Zhou et al..Development of wheat near-isogenic lines for powdery mildew resistance.《Theoretical and Applied Genetics》.2005,第110卷(第4期),640-648. * |
| 王振英等.簇毛麦6VS上4个新分子标记的鉴定及与抗白粉病基因Pm21的连锁分析.《作物学报》.2007,第33卷(第4期),605-611. * |
| 王轶等.栽培小麦Brock中与新抗白粉病基因紧密连锁的AFLP分子标记筛选与分析.《分子生物学学报》.2008,第41卷(第4期),294-300. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101955988A (en) | 2011-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nelson et al. | The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula | |
| Zhuang et al. | Mapping of leaf and neck blast resistance genes with resistance gene analog, RAPD and RFLP in rice | |
| Nishi et al. | Identification of DNA markers of tobacco linked to bacterial wilt resistance | |
| Xu et al. | Mapping boron efficiency gene (s) in Brassica napus using RFLP and AFLP markers | |
| CN105950736B (en) | Molecular marker co-separated from bruchid-resistant gene VrPGIP of mung bean and application thereof | |
| Stalker et al. | Molecular markers of Arachis and marker-assisted selection | |
| Singh et al. | A comparative genetic diversity analysis in mungbean (Vigna radiata L.) using inter-simple sequence repeat (ISSR) and amplified fragment length polymorphism (AFLP) | |
| CN101939447B (en) | Marker genetically linked to tobamovirus resistance in cucumber and the use thereof | |
| CN102770018A (en) | Cucumber vein yellowing virus (CVYV) resistant cucumber plants (Cucumis sativus L.) | |
| EP3045533B1 (en) | Marker associated with anthracnose resistance in plants of the genus fragaria and use thereof | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| Wu et al. | Fine mapping Ruv2, a new rust resistance gene in cowpea (Vigna unguiculata), to a 193-kb region enriched with NBS-type genes | |
| CN101487056B (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN108660247B (en) | Primer SmemboI-2 for identifying purity of solanum torvum third eggplant based on SNP marker and application | |
| CN101955988B (en) | Genetic detection method of powdery mildew-resistant near-isogenic lines Brock/Jing411<7> | |
| CN108676903B (en) | Primer SmemboI-1 for identifying purity of solanum torvum third eggplant based on SNP marker and application | |
| CN113637791B (en) | Molecular marker for simultaneously identifying restorability and authenticity of pepper male sterile three-line hybrid and identification method thereof | |
| CN105176985A (en) | SSR molecular marker primer of distant hybridization wheat, application and screening method | |
| CN109517919A (en) | The exploitation of Wheat-Thinopyrum intermedium wide spectrum Rust resistance T4DL.4DS-3Ai translocation line and SCAR mark | |
| Moumeni et al. | Genetic diversity and relatedness of selected Iranian rice cultivars and disease resistance donors assayed by simple sequence repeats and candidate defense gene markers | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN104560961A (en) | Molecular markers linked to ZYMV (zucchini yellow mosaic virus-1) dominant disease-resistant gene ZYMV-1 and application of molecular markers | |
| KR100264743B1 (en) | Map QTL related to cold tolerance at seedling stage of rice using RAPD marker and selection method of cold tolerant rice variety | |
| CN108504770B (en) | CAPS marker closely linked with cowpea rust-resistant gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120530 Termination date: 20130128 |