CN1661106A - Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application - Google Patents
Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application Download PDFInfo
- Publication number
- CN1661106A CN1661106A CN 200410103073 CN200410103073A CN1661106A CN 1661106 A CN1661106 A CN 1661106A CN 200410103073 CN200410103073 CN 200410103073 CN 200410103073 A CN200410103073 A CN 200410103073A CN 1661106 A CN1661106 A CN 1661106A
- Authority
- CN
- China
- Prior art keywords
- karyomit
- wheat
- band
- gene
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
A marker primer linked with the gene Pm21 resisting to powdery mildew of wheat features that the primers NAU/XiBao15F and NAU/XiBao 15R are designed according to the sequence of probe congtig 17515, and the experiments shown that it is linked with said gene Pm21. It can be used to culture the wheat resisting to powdery mildew and verify the purity of ordinary wheat variety.
Description
One, technical field
The invention discloses and wheat anti-powdery mildew gene Pm 21 linked labeled primer, can be used for wheat powdery mildew breeding for disease resistance molecular marker assisted selection; This mark can be used to differentiate the common wheat seed purity simultaneously, especially is used for the material that common wheat the 6th homology group karyomit(e) morphs that relates to that identification of cell engineering and chromosome engineering create.
Two, technical background
Wheat (T.aestivum L) has critical role as global important crops in agriculture production, but it is produced and but to be subjected to a lot of biologies and to coerce influence with abiotic stress.The wheat powdery mildew (Ergsiphe greminis f.sp.tritici) that is caused by obligatory parasitism fungi wheat powdery mildew (Erysiphegraminis DC) is China and endangers one of disease that is on the rise in many national Wheat Production in the world, and, the trend that constantly increases the weight of is arranged in recent years along with the improvement of fertilizer and water condition.
Common wheat (T.aestivum L) has 21 pairs of karyomit(e)s, every pair comprises two the same karyomit(e)s, these 21 karyomit(e)s are typically expressed as 1A, 1B, 1D, 2A, 2B, 2D, 3A, 3B, 3D, 4A, 4B, 4D, 5A, 5B, 5D, 6A, 6B, 6D, 7A, 7B, 7D, and common wheat is directly represented (Fig. 8) with AABBDD usually.Cluster hair wheat (Haynaldia villosaL) has 7 pairs of karyomit(e)s, and every pair comprises two the same karyomit(e)s, and these 7 karyomit(e)s are respectively 1V, 2V, 3V, 4V, 5V, 6V, 7V, and cluster hair wheat is represented (Fig. 9) with VV usually.Every karyomit(e) of common wheat and cluster hair wheat comprises long-armed and galianconism again, represents with L and S respectively, comprises long-armed 6VL and galianconism 6VS such as cluster hair wheat 6V karyomit(e).
The original wheat breed major part of China all contains the anti-source of Pm8, but along with the continuous variation of powdery mildew microspecies, Pm8 has lost resistance gradually, seeks and utilizes new mildew-resistance ospc gene significant for the security of China's Wheat Production.Agricultural University Of Nanjing's cytogenetics just be devoted to the excellent gene the cluster hair wheat (Haynaldia villosa L) is changed over to common wheat by the chromosome engineering technology from the beginning of the eighties in last century, what obtained high mildew-resistance relates to cluster hair wheat 6V chromosome translocation system and adds disappearance system that (document sees reference: 1, Chen P D, Qi L L, Zhou B, et al.Development andmolecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6AL translocation lines specifyingresistance to powdery mildew.Theor Appl Genet, 1995,91:1125-1128.2, L.L.Qi, S.L.Wang, P.D.Chen, D.J.Liu, B.S.Gill 1998 Identification and physical mapping of three Haynaldiavillosa chromosome-6V deletion lines TAG 97:1042-1046).Wherein wheat-haynaldia villosa translocation line 6VS/6AL replaces into cluster hair wheat 6V the short arm of a chromosome 6VS to common wheat 6A the short arm of a chromosome 6AS exactly, forms a translocation chromosome, and this karyomit(e) is made up of 6AL and 6VS, represents this translocation chromosome with 6VS/6AL.
IsozygotyWheat-haynaldia villosa translocation line 6VS/6AL compares with common wheat, and two 6A karyomit(e)s have become two 6VS/6AL karyomit(e)s (Figure 10);
HeterozygosisWheat-haynaldia villosa translocation line 6VS/6AL compares with common wheat, has only a 6A karyomit(e) to become 6VS/6AL karyomit(e), also preserves a 6A (6AS/6AL) karyomit(e) (Figure 11).Further research through molecular cytogenetics, powdery mildew resistance gene Pm 21 in the cluster hair wheat is located in the cluster hair wheat the short arm of a chromosome 6VS FL0.58 section that (document sees reference: L.L.Qi, S.L.Wang, P.D.Chen, D.J.Liu, B.S.Gill 1998 Identification and physical mapping of threeHaynaldia villosa chromosome-6V deletion lines TAG 97:1042-1046).Because 6VS karyomit(e) and common wheat karyomit(e) parent source relation are distant, and be difficult with common wheat karyomit(e) generation exchange, also finds the phenomenon with common wheat karyomit(e) generation exchange at present.All carry 6VS karyomit(e) so carry the material of Pm21 gene at present.Pm21 is the widest gene of the strongest to powder mildew resistance so far, anti-spectrum, to all immunity of known powdery mildew microspecies, so can make it to use in production practice better to the research of Pm21.
More existing scholars have screened and can be used to identify the chromosomal molecule marker OPH17 of cluster hair wheat
1900(document sees reference: Qi, L., M.Cao, P.Chen et al.Identification, mapping, and application of polymorphic DNA associatedwith resistance gene Pm21 of wheat.Genome 39:191-197,1996) and OPH17
1400(document sees reference: Liu Zhiyong, Sun Qixin, Li Hongjie etc. the Molecular Identification of wheat powdery mildew resistance gene Pm 21 and marker assisted selection. and Acta Genetica Sinica 26 (6): 673-682,1999).Because in the process of these marks of screening, the investigator has only analyzed the polymorphism that contains between chromosomal material of cluster hair wheat 6V and the common wheat, do not study this type of and be marked at the amplification situation that relates in other 6 cluster hair wheat chromosome materials, and in the process of using these marks, found containing afterwards also to amplify object tape in other several the chromosomal materials of cluster hair wheat, not that cluster hair wheat 6VS karyomit(e) is specially changed so just show these two marks.If whether contain 6V karyomit(e) in the expert evidence, can only only relate under the chromosomal situation of cluster hair wheat 6V in the material background and using.When whether these two marks also have a weak point to show to contain in the expert evidence cluster hair wheat 6V chromosomal, can not distinguish this karyomit(e) and be in and isozygoty or heterozygous state.
When utilizing the Pm21 gene to carry out the mildew-resistance breeding, the parent that breeding units is used is the wheat-haynaldia villosa translocation line (6VS/6AL) that Agricultural University Of Nanjing's cytogenetics is provided mostly, there have been several kinds to pass through variety certification, also had a lot of strains to be in the authorization process.Because 6VS karyomit(e) and 6AS karyomit(e) do not exchange, and all carry 6VS/6AL karyomit(e) so carry the plant of Pm21 gene in the seed.No matter in the breed breeding process or kind in the production use, it is all very important that this karyomit(e) of 6VS/6AL is in homozygotic state, otherwise offspring's powder mildew resistance will be separated, and this utilizes this material to carry out the target of breeding as the parent exactly.In addition, its purity will obtain guaranteeing when kind was used on producing, for the high powdery-mildew-resistance wheat kind of utilizing wheat-haynaldia villosa translocation line (6VS/6AL) to come out as parent's seed selection, the ratio that the seed that can utilize 6VS/6AL karyomit(e) to be in homozygotic state accounts for is as an important indicator of seed purity.But, utilize OPH17
1900And OPH17
1400When carrying out molecular marker assisted selection or identification of seed purity, can only whether contain 6VS/6AL karyomit(e) in the clear and definite material, and this karyomit(e) is to be in to isozygoty or heterozygous state can't be learnt.So, seek a kind of not only to specialization of 6VS but also can distinguish it and isozygoty or the mark of heterozygous state, thereby determine Pm21 gene pure or heterozygous state, not only can improve molecular marker assisted selection efficient, and when detecting seed purity, also can bring into play very big effect.
Molecule marker has a variety of, can identify simultaneously in the wheat that the mark overwhelming majority of a certain homology group's coloured differently body is the RFLP mark, but the shortcoming of such mark just is to use inconvenience, so the mark of exploitation PCR-based can conveniently use.Some scholars find that at the research of disease-resistant gene a lot of disease-resistant genes just exist in the common ancestor of modern plants, just along with the evolution of species and the change of pathogenic bacteria, disease-resistant gene is also experiencing constantly evolves, so may there be the very high disease-resistant gene analogue of homology in the closer species of close source relation at the homology of chromosome section.Since this class sequence on homologous chromosomes, all have the copy and homology very high, so the copy on the coloured differently body just has common PCR primer binding site; Because having experienced long evolution again, the disease-resistant gene analogue caused change on the different copy length, so its product length of PCR of carrying out with same primer is understood variant.Exploitation identifies that the mark of the PCR of a certain homology group's coloured differently body is a desirable approach according to disease-resistant gene analogue sequence.
The mark that can differentiate the 6th crowd of karyomit(e) 6A, 6B, 6D, 6VS simultaneously in a PCR reaction of PCR-based is attempted to seek in this laboratory in the process of clone Pm21 gene, be used for differentiating the common wheat seed purity.
Three, summary of the invention
Technical problem the object of the present invention is to provide the molecule marker primer chain with Pm21 of PCR-based, and in a PCR reaction, can differentiate common wheat the 6th homology group karyomit(e) 6A, 6B, 6D simultaneously by the banding pattern that amplifies with this primer, thereby determine Pm21 gene pure or heterozygous state, this primer can also be used for identifying the common wheat seed purity.This labeled primer not only can be used for improving molecular marker assisted selection efficient, and also can bring into play very big effect when detecting seed purity and identify the material that the 6th homology group karyomit(e) morphs.
Technical scheme
The present invention and Pm21 are chain and can differentiate and the labeled primer of common wheat seed purity it is characterized in that this primer is that stencil design obtains with probe Contig17515 sequence.Its sequence is: NAU/XiBao 15F:agatccaacaccagttcaag and NAU/XiBao 15R:atgttatggaggcttgtgtc.The fragment of the 902bp that this labeled primer amplifies from cluster hair wheat is positioned at 6VS karyomit(e) apart from kinetochore FL0.58 section, the band that 984bp, 1139bp, 987bp three bands that amplify from common wheat lay respectively on the 6AS is positioned at apart from the section of kinetochore FL0.34, band on the 6BS is positioned at apart from the section of kinetochore FL0.49, and the band on the 6DS is positioned at apart from kinetochore FL0.45-0.79 section.
The using method of above-mentioned labeled primer:
(1) with material DNA to be identified as template, carry out PCR with NAU/XiBao15F and NAU/XiBao15R as primer,
The PCR reagent set becomes: dna profiling 2 μ L, 2.5 μ L10 * PCR buffer, 1.5 μ LMgCl
2, 2 μ LdNTP, each 0.5 μ L of left and right sides primer, 0.25 μ L Taq DNA polymerase, 16 μ L d.d H
2O;
The PCR program is: 94 ℃ of pre-sex change 3; 94 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ were extended 32 circulations 1 minute and 30 seconds; 72 ℃ were extended 10 minutes; 10 ℃ of preservations, the PCR product is electrophoretic separation on 39: 1 glue of the polyacrylamide of non-sex change, is dyeing with argentation;
(2) labeled primer identifies that the result of Pm21 gene is: the individual plant that can amplify the special band of 902bp fragment carries the Pm21 gene, and its Pm21 gene is positioned on the cluster hair wheat 6VS karyomit(e); What can not amplify the special band of 902bp fragment does not then carry the Pm21 gene.
(3) labeled primer identifies that the disease-resistant karyomit(e) 6VS/6AL of individual plant isozygotys or the result of heterozygous state is:
The disease-resistant karyomit(e) 6VS/6AL that can amplify the plant of 1139bp, 987bp, 984bp, 902bp four bands is in heterozygous state: the band of 1139bp is from karyomit(e) 6BS, the band of 987bp is from 6DS, and karyomit(e) 6BS and karyomit(e) 6DS exist in pairs; The band of 984bp is from karyomit(e) 6AS, and the band of 902bp shows to have karyomit(e) 6AS/6AL and disease-resistant karyomit(e) 6VS/6AL in this individual plant simultaneously that disease-resistant karyomit(e) 6VS/6AL can not exist in pairs, is in heterozygous state from disease-resistant karyomit(e) 6VS.
The disease-resistant karyomit(e) 6VS/6AL that can amplify the plant of 1139bp, 987bp, 902bp three bands is in homozygotic state: the band amplification from the chromosomal 984bp of 6AS is not come out, 6A karyomit(e) does not just exist, so 6VS/6AL karyomit(e) exists in pairs, is in homozygotic state.
This labeled primer detects the method for carrying Pm21 gene seed purity: random choose single seed from seed to be detected at first, utilize labeled primer to identify that single seeded 6VS/6AL karyomit(e) isozygotys or heterozygous state, add up seed proportion in detecting the seed total amount that 6VS/6AL karyomit(e) is in homozygotic state again, be the seed purity index.
The present invention is advantage and beneficial effect compared with the prior art:
1, molecule marker primer NAU/XiBao15 of the present invention specialization when identifying cluster hair wheat 6VS karyomit(e) is stronger.The molecule marker OPT17 that has developed
1400And OPT17
1900Owing to be not specialization of 6VS, can only only relate under the chromosomal situation of cluster hair wheat 6VS identifying in the progeny material whether contain 6VS karyomit(e) at parent material.And carry out PCR reaction back as long as contain the band of 902bp in the product with NAU/XiBao15F and NAU/XiBao15R, just show and contain cluster hair wheat 6VS karyomit(e) in the material.
2, molecule marker NAU/XiBao15 of the present invention and Pm21 gene is chain tightr.Band and the Pm21 gene that comes out is positioned at 6VS karyomit(e) simultaneously apart from kinetochore FL0.58 section because primer NAU/XiBao15F and NAU/XiBao15R increase in cluster hair wheat, and 6VS and common wheat karyomit(e) do not exchange, so NAU/XiBao15 can be used as the molecule marker of powdery mildew resistance gene Pm21 and uses, and this mark and Pm21 gene linkage degree are higher than mark OPT171400 and OPT171900 and Pm21 gene linkage degree.
3, molecule marker primer NAU/XiBao15 of the present invention is more efficient when identifying common wheat 6AS, 6BS, 6DS karyomit(e).Molecule marker NAU/XiBao15 can amplify four bands that vary in size on 6AS, 6BS, 6DS, 6VS, this four band can specificity be followed the trail of this four karyomit(e)s.In research in the past, often need to determine to contain in the material which bar in these four karyomit(e)s, and in a PCR reaction, just can reach these four chromosomal purposes of discriminating with molecule marker NAU/XiBao15 with several marks.When carrying out the mildew-resistance breeding as the parent with wheat-haynaldia villosa translocation line (6VS/6AL), carry out molecular marker assisted selection with NAU/XiBao15, not only can whether contain 6VS/6AL in the expert evidence, can also identify whether 6VS/6AL karyomit(e) is in homozygotic state, can improve the efficiency of selection of breeding greatly like this.
4, molecule marker primer NAU/XiBao15 of the present invention is identifying that disease-resistant karyomit(e) 6VS/6AL isozygotys or more convenient and quicker, economy during heterozygous state.When using OPT171400 and these two molecule markers of OPT171900, just can amplify corresponding special band, can not distinguish 6VS/6AL and be in and isozygoty or heterozygous state as long as contain 6VS karyomit(e) in the material.Whether 6VS/6AL karyomit(e) was in homozygotic state in the expert evidence in the past, adopt tip of a root karyomit(e) mitosis metaphase C-banding technique or hybridization in situ technique to carry out often, not only experimental technique is loaded down with trivial details for these two kinds of technology, and cost is very high, has limitation so use when a large amount of expert evidence.If use NAU/XiBao15 to carry out molecular marker assisted selection, can easily identify with wheat-haynaldia villosa translocation line (6VS/6AL) and common wheat to be that whether 6VS/6AL karyomit(e) is homozygotic state in parent's the progeny material quickly.
5, when creating breeding material, can differentiate the material that common wheat the 6th homology group karyomit(e) morphs with the NAU/XiBao15 mark with cell engineering or chromosome engineering.
Four, description of drawings
Fig. 1: with raise wheat No. 5, translocation line (6VS/6AL), cluster hair wheat, hard bunch of wheat DNA as template, with carrying out pcr amplification with the primer NAU/XiBao15 among the present invention, contain the chromosomal material of the cluster hair wheat 6VS band that can both to amplify a common molecular weight be 902bp, and common wheat raises wheat and lacks this band for No. 5, illustrates that this 902bp band is positioned on the 6VS.
Fig. 2: with the common wheat China spring add cluster hair wheat 1V, 2V, 3V, 4V, 5V, 6V respectively, chromosomal 7 the material DNA of 7V are template, carry out pcr amplification with the primer NAU/XiBao15 among the present invention, the result shows to have only the chromosomal material of interpolation 6V can amplify the band of the 902bp the same with cluster hair wheat, illustrates that the band of this 902bp is positioned on the cluster hair wheat 6V.
Fig. 3: with common wheat 6V add disappearance be de16V# 2S-1DNA as template, carry out pcr amplification with the primer NAU/XiBao15 among the present invention, the result shows the still existence of 902bp band on the 6V, the band on the 6VS is positioned at the FL0.58 section.
Fig. 4: the DNA that overlaps nullisomic limbs (scarce 1A, scarce 1B, scarce 1D, scarce 2A, scarce 2B, scarce 2D, scarce 3A, scarce 3B, scarce 3D, scarce 4A, scarce 4B, scarce 4D, scarce 5A, scarce 5B, scarce 5D, scarce 6A, scarce 6B, scarce 6D, scarce 7A, scarce 7B, scarce 7D) with one of common wheat China spring is that template is carried out PCR, carry out pcr amplification with the primer NAU/XiBao15 among the present invention, the result shows that the material that lacks 6A has lacked the band of a 984bp, the material that lacks 6B has lacked the band of 1139bp, and the material of 6D has lacked the band of 987bp.
Fig. 5: with China spring disappearance be DNA as template, carry out pcr amplification with the primer NAU/XiBao15 among the present invention, disappearance is the band that band that 6AS-1 amplifies has lacked a 984bp, disappearance is the band that band that 6DS-2 amplifies has lacked a 987bp.
Fig. 6: according to disappearance is collection of illustrative plates, and the last 1139bp band of band, 6BS, the 6DS984bp band of 6AS being gone up 984bp are positioned the karyomit(e) shadow region.
Fig. 7: with raising No. 5 * wheat-haynaldia villosa of wheat translocation line (6VS/6AL) F
2The individual plant DNA of colony is a template, carries out the result of pcr amplification with the primer NAU/XiBao15 among the present invention.
Fig. 8: common wheat karyomit(e) diagrammatic sketch
Fig. 9: cluster hair wheat karyomit(e) diagrammatic sketch
Figure 10: its karyomit(e) of wheat-haynaldia villosa translocation line 6VS/6AL 6VS/6AL is the diagrammatic sketch when isozygotying
Figure 11: the diagrammatic sketch when its karyomit(e) of wheat-haynaldia villosa translocation line 6VS/6AL 6VS/6AL is heterozygosis
Five, embodiment
1, screening is positioned at the disease-resistant gene analogue on the 6V karyomit(e)
The cluster hair wheat seed is sowed in the culture dish and germinates, and is transplanted to the basin alms bowl after showing money or valuables one carries unintentionally, and to tri-leaf period the mixing powdery mildew spore of cultivating on susceptible material Soviet Union wheat No. three is shaken off on seedling.Powdery mildew inductive material is respectively at inoculation sampling after 24,48,72 hours, extracts respectively that balanced mix forms experimental group behind the RNA; Non-induced material was taken a sample simultaneously in these three periods, extracted respectively that balanced mix forms control group behind the RNA.Experimental group and control group are hybridized (the chip hybridization experiment is finished at Shanghai country biochip center) to barley chip of expression spectrum (available from Affymetrix company) simultaneously, obtained the probe of some up-regulated expressions, it is the disease-resistant gene analogue that a probe Contig17515 is wherein arranged.This gene may be positioned on the 6VS karyomit(e) as the candidate gene of Pm21.
2, develop the molecule marker of PCR-based according to the disease-resistant gene analogue of screening
Sequence according to the up-regulated expression gene designs primer NAU/XiBao15F (agatccaacaccagttcaag) and NAU/XiBao15R (atgttatggaggcttgtgtc) with Primer3 software (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi).
It is (public to raise wheat No. 5 (AABBDD) with common wheat, draw the institute of agricultural sciences of in Yangzhou, going to river), (6VS/6AL) is (public for the wheat-haynaldia villosa translocation line, create in Agricultural University Of Nanjing cytogenetics laboratory), the DNA of cluster hair wheat (VV), hard bunch of wheat (AABBVV) (hard bunch of wheat is by durum wheat AABB and cluster hair wheat VV synthetic) is template, is that primer carries out pcr amplification with NAU/XiBao15F and NAU/XiBao15R.PCR reagent is formed: dna profiling 2 μ L (50-100ng), 2.5 μ L10 * PCR buffer, 1.5 μ L MgCl
2, 2 μ LdNTP (2.5mmoL/L), each 0.5 μ L left and right sides primer (10mmol/L), 0.25 μ L Taq DNA polymerase (5u/ μ L), 16 μ Ld.d H
2O.The PCR program is: 94 ℃ of pre-sex change 3; 94 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ were extended 32 circulations 1 minute and 30 seconds; 72 ℃ were extended 10 minutes; 10 ℃ of preservations.The PCR product shows that it is the band of 902bp that translocation line (6VS/6AL), cluster hair wheat, hard bunch of wheat have a common molecular weight, lacks this band (Fig. 1) for No. 5 and raise wheat through 8% gather after third uncommon acid amides (39: 1) the gel electrophoresis silver dyes.(public to add the chromosomal interpolation of cluster hair wheat 1V-7V system in the common wheat China spring respectively, see Sears, E.R.1953.Addition of the genome of Haynaldia villosa to Triticum aestivum.Am.J.Bot.40:168-174.) DNA is a template, carry out the PCR and the electrophoresis of the same terms, the result shows that having only the chromosomal material of the 6V of interpolation to amplify molecular weight is the special band of 902bp, illustrates that this band of 902bp obtains (Fig. 2) from the 6VS amplification.Further adding disappearance with wheat-haynaldia villosa 6V is that (de16V# 2S-1 sees reference document: Lili Qi, Mingshu Cao, Peidu Chen, Wanlong Liand Dajun Liu.Identification, mapping, and application of polymorphic DNA associated withresistance gene Pm21 of wheat.Genome 39:191-197,1998) DNA carries out PCR as template, still can amplify this band (Fig. 3), the disappearance breakpoint result of study of adding disappearance system in conjunction with wheat-haynaldia villosa 6V shows that this 902bp product on the 6VS is positioned at the section of 6VS apart from kinetochore FL 0.58, because it is still disease-resistant that identify in the de16V# 2S-1 field, so Pm21 and 902bp band are positioned at same-individual zone of karyomit(e) 6VS.
21 nullisomic limbs systems with China spring are (public, document sees reference: KM Devos, ME Sorrells, JAAnderson, TE Miller, SM Reader, AJ Lukaszewski, J Dubcovsky, PJ Sharp, J Fails, MD Gale.1999.Chromosome aberrations in wheat nullisomic-tetrasomic and ditelosomic lines.CerealResearch Communications 27:231-239) DNA is a template, carries out the PCR and the electrophoresis of the same terms, lacks the band that the band that amplifies in the material of 6A has lacked a 984bp, lack the band that the band that amplifies in the material of 6B has lacked a 1139bp, lack the band (Fig. 4) that the band that amplifies in the material of 6D has lacked a 987bp.The result shows that 1139bp, the 987bp, 984bp three bands that increase out from common wheat are respectively on 6B, 6D, the 6A karyomit(e).
With the excalation of the 6th group of China spring system (is chromosome deletion by the part of karyomit(e) end, public, document Endo TR sees reference, Gill BS.The deletion stocks of common wheat.Heredity87:295-307,1996) DNA is a template, carry out identical PCR, product is electrophoresis on 8% poly-third uncommon acid amides (39: the 1) gel.The result shows that the disappearance of China spring is the band that the PCR product of 6AS-1 has lacked 984bp, disappearance be 6DS-2 the PCR product lacked the band of 987bp.Nearer from the end because of the part that the disappearance system that relates to 6BS lacks, all material 6B banding pattern all exists.According to the collection of illustrative plates of disappearance system, the band on the 6AS is positioned at apart from the section of kinetochore FL0.34, and the band on the 6BS is positioned at apart from the section of kinetochore FL0.49, and the band on the 6DS is positioned at apart from kinetochore FL0.45-0.79 section (Fig. 5).According to the collection of illustrative plates of three chromosomal integrations, this gene locus and RFLP mark Xpsr141.1, Xtam31 are relatively near (Fig. 6).
3, detect No. 5 (public the kind) * wheat-haynaldia villosa translocation line F that raise wheat with mark NAU/XiBao15
2Colony
With NAU/XiBao15F and N AU/XiBao15R is primer, F2 generation 24 the individual plant DNA that raise 5 * wheat-haynaldia villosa translocation line are that template is carried out PCR, the result shows the disease-resistant individual plant 1 of field evaluation, 2,3,4,5,7,8,9,10,13,17,18,19,20,23 can both amplify the special band on the 6VS, susceptible individual plant 6 is identified in the field, 11,12,14,15,16,21,22,24 all can not amplify the special band (Fig. 7) on the 6VS, can explanation amplify special band on the 6VS with anti-susceptible directly related, and promptly this primer can be used for identifying whether plant contains the Pm21 gene.
The amplification banding pattern of disease-resistant individual plant can be divided into two types again, one class can amplify four bands, as individual plant 1,2,3,4,7,10,13,19, this four band is respectively on 6BS, 6DS, 6AS, the 6VS from big to small, and the individual plant that amplifies this banding pattern only carries a 6VS/6AL translocation chromosome; Another kind ofly can only amplify three bands, as 5,8,9,17,18,23, this three band is respectively that the band on the 6AS does not amplify on 6BS, 6DS, the 6VS from big to small, and the individual plant that can amplify this banding pattern carries two 6VS/6AL translocation chromosomes.This result shows the NAU/XiBao15 mark can identify not only whether the F2 that raises No. 5 * wheat-haynaldia villosa of wheat translocation line carries the 6VS/6AL translocation chromosome for each individual plant, and can also identify this chromosomal isozygotying or heterozygous state.
Claims (6)
1, with wheat anti-powdery mildew gene Pm 21 linked labeled primer, it is characterized in that this primer is that stencil design obtains with probe Contig17515 sequence.
2, the labeled primer described and wheat anti-powdery mildew gene Pm 21 linked according to claim 1, its sequence is:
NAU/XiBao15F:agatccaacaccagttcaag and NAU/XiBao15R:atgttatggaggcttgtgtc
3, chain and can differentiate the labeled primer of common wheat seed purity according to claim 1 or 2 described and Pm21, it is characterized in that: the fragment of the 902bp that this primer amplifies from cluster hair wheat is positioned at 6VS karyomit(e) apart from kinetochore FL0.58 section, the band that 984bp, 1139bp, 987bp three bands that amplify from common wheat lay respectively on the 6AS is positioned at apart from the section of kinetochore FL0.34, band on the 6BS is positioned at apart from the section of kinetochore FL0.49, and the band on the 6DS is positioned at apart from kinetochore FL0.45-0.79 section.
4, the usage of the described and wheat anti-powdery mildew gene Pm 21 linked labeled primer of one of claim 1～3:
1) material DNA to be identified carries out PCR with NAU/XiBao15F and NAU/XiBao15R as primer as template, and the PCR reagent set becomes: dna profiling 2 μ L, 2.5 μ L10 * PCR buffer, 1.5 μ LMgCl
2, 2 μ LdNTP, each 0.5 μ L of left and right sides primer, 0.25 μ L Taq DNA polymerase, 16 μ L d.d H
2O;
The PCR program is: 94 ℃ of pre-sex change 3; 94 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ were extended 32 circulations 1 minute and 30 seconds; 72 ℃ were extended 10 minutes; 10 ℃ of preservations, the PCR product is electrophoretic separation on 39: 1 glue of the polyacrylamide of non-sex change, is dyeing with argentation;
2) labeled primer identifies that the result of Pm21 gene is: the individual plant that can amplify the special band of 902bp fragment carries the Pm21 gene, and its Pm21 gene is positioned on the cluster hair wheat 6VS karyomit(e); What can not amplify the special band of 902bp fragment does not then carry the Pm21 gene.
5, according to the usage of the described and wheat anti-powdery mildew gene Pm 21 linked labeled primer of claim 4, it is characterized in that,
The disease-resistant karyomit(e) 6VS/6AL that can amplify the plant of 1139bp, 987bp, 984bp, 902bp four bands is in heterozygous state: the band of 1139bp is from karyomit(e) 6BS, the band of 987bp is from 6DS, and karyomit(e) 6BS and karyomit(e) 6DS exist in pairs; The band of 984bp is from karyomit(e) 6AS, and the band of 902bp shows to have karyomit(e) 6AS/6AL and disease-resistant karyomit(e) 6VS/6AL in this individual plant simultaneously that disease-resistant karyomit(e) 6VS/6AL does not exist in pairs, is in heterozygous state from disease-resistant karyomit(e) 6VS;
The disease-resistant karyomit(e) 6VS/6AL that can amplify the plant of 1139bp, 987bp, 902bp three bands is in homozygotic state: the band amplification from the chromosomal 984bp of 6AS is not come out, 6A karyomit(e) does not just exist, so 6VS/6AL karyomit(e) exists in pairs, is in homozygotic state; Isozygoty or heterozygous state in order to the disease-resistant karyomit(e) 6VS/6AL that identifies individual plant.
6, the usage of and wheat anti-powdery mildew gene Pm 21 linked labeled primer according to claim 4 or 5 is characterized in that,
Detect the method for carrying Pm21 gene seed purity with this labeled primer: random choose single seed from seed to be detected at first, utilize labeled primer to identify that single seeded 6VS/6AL karyomit(e) isozygotys or heterozygous state, add up seed proportion in detecting the seed total amount that 6VS/6AL karyomit(e) is in homozygotic state again, be the index of seed purity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200410103073XA CN1328389C (en) | 2004-12-30 | 2004-12-30 | Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200410103073XA CN1328389C (en) | 2004-12-30 | 2004-12-30 | Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1661106A true CN1661106A (en) | 2005-08-31 |
| CN1328389C CN1328389C (en) | 2007-07-25 |
Family
ID=35010651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200410103073XA Expired - Fee Related CN1328389C (en) | 2004-12-30 | 2004-12-30 | Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1328389C (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100422203C (en) * | 2006-07-10 | 2008-10-01 | 南京农业大学 | Marker primer linked with wheat powdery mildew resistant gene Pm6 and its usage method |
| CN100422331C (en) * | 2006-06-28 | 2008-10-01 | 南京农业大学 | Cluster hair wheat-serine/threonine kinase gene and its coded protein |
| CN100434533C (en) * | 2006-05-23 | 2008-11-19 | 天津师范大学 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
| CN102864142A (en) * | 2012-09-20 | 2013-01-09 | 江苏大学 | Molecular marker 6VS-LEM with specificity for haynaldia villosa 6VS chromosomes and application thereof |
| CN104278028A (en) * | 2014-09-16 | 2015-01-14 | 天津师范大学 | Sequence of dasypyrum villosum 6VS DNA permeating into powdery mildew resistant near-isogenic line of wheat and application |
| CN105087760A (en) * | 2014-05-07 | 2015-11-25 | 江苏省农业科学院 | Labeled primer of wheat powdery mildew resistance gene Stpk-V and application of labeled primer |
| CN107699630A (en) * | 2017-10-27 | 2018-02-16 | 南京农业大学 | Chain molecular labeling and its application in breeding with wheat resistance genes Pm21 |
| CN113136452A (en) * | 2021-06-09 | 2021-07-20 | 江苏省农业科学院 | Primer pair for identifying common wheat-haynaldia villosa 6VS.6AL translocation line and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1252284C (en) * | 2002-09-27 | 2006-04-19 | 天津师范大学 | Molecular marker linked with wheat mildew-resistance gene |
| CN100494401C (en) * | 2003-12-31 | 2009-06-03 | 天津市农业生物技术研究中心 | SCAR molecule marker closely linked with wheat anti powdery mildew gene |
-
2004
- 2004-12-30 CN CNB200410103073XA patent/CN1328389C/en not_active Expired - Fee Related
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100434533C (en) * | 2006-05-23 | 2008-11-19 | 天津师范大学 | Molecular marking closely linked with wheat Brock powdery mildew resistant gene |
| CN100422331C (en) * | 2006-06-28 | 2008-10-01 | 南京农业大学 | Cluster hair wheat-serine/threonine kinase gene and its coded protein |
| CN100422203C (en) * | 2006-07-10 | 2008-10-01 | 南京农业大学 | Marker primer linked with wheat powdery mildew resistant gene Pm6 and its usage method |
| CN102864142A (en) * | 2012-09-20 | 2013-01-09 | 江苏大学 | Molecular marker 6VS-LEM with specificity for haynaldia villosa 6VS chromosomes and application thereof |
| CN105087760A (en) * | 2014-05-07 | 2015-11-25 | 江苏省农业科学院 | Labeled primer of wheat powdery mildew resistance gene Stpk-V and application of labeled primer |
| CN105087760B (en) * | 2014-05-07 | 2018-05-01 | 江苏省农业科学院 | The labeled primer of powdery mildew resistance gene in wheat Stpk-V a kind of and application |
| CN104278028A (en) * | 2014-09-16 | 2015-01-14 | 天津师范大学 | Sequence of dasypyrum villosum 6VS DNA permeating into powdery mildew resistant near-isogenic line of wheat and application |
| CN107699630A (en) * | 2017-10-27 | 2018-02-16 | 南京农业大学 | Chain molecular labeling and its application in breeding with wheat resistance genes Pm21 |
| CN113136452A (en) * | 2021-06-09 | 2021-07-20 | 江苏省农业科学院 | Primer pair for identifying common wheat-haynaldia villosa 6VS.6AL translocation line and application thereof |
| CN113136452B (en) * | 2021-06-09 | 2024-01-30 | 江苏省农业科学院 | Primer pair for identifying common wheat-haynaldia villosa 6VS.6AL translocation line and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1328389C (en) | 2007-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fatahi et al. | Characterization of Iranian grapevine cultivars using microsatellite markers | |
| Ma et al. | Genotyping-by-sequencing targeting of a novel downy mildew resistance gene Pl 20 from wild Helianthus argophyllus for sunflower (Helianthus annuus L.) | |
| CN106868131A (en) | No. 6 chromosomes of upland cotton SNP marker related to fibre strength | |
| CN102220430B (en) | Auxiliary screening method for stripe rust-resistance wheat and its special primers | |
| CN1322133C (en) | Wheat anti-powdery mildew gene Pm21 linked codorminant PCR marker and its usage | |
| CN108165656B (en) | Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance | |
| CN111778352B (en) | KASP primer group related to wheat grain weight and application thereof | |
| CN1328389C (en) | Tagged primer chained to Pm21 gene of anti powdery mildew of wheat and application | |
| CN101487056B (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN102220318B (en) | SSR (Single Sequence Repeats) marker interlocked with high-quality cotton fibre material 0-153 high-strength fibre major-effect genes | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN1904073A (en) | Method of auxiliary screening cold resistant paddy rice and its special primer | |
| CN102925544A (en) | Molecular marker for specifically tracking dasypyrumvillosum 6VS chromosome and use method thereof | |
| CN108624710B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN111926104A (en) | SSR molecular marker and method for identifying authenticity of filial generation of sugarcane and saccharum arundinaceum | |
| WO2023207233A1 (en) | Neutral snapshot marker of peas and use thereof in population genetic diversity analysis | |
| WO2015010008A1 (en) | Detection methods for oil palm shell alleles | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN111254212B (en) | Rice blast resistance gene Pi68(t) close linkage molecular marker and application thereof | |
| CN115976266A (en) | InDel functional molecular marker BW07-InDel closely linked with cotton boll size of upland cotton and application thereof | |
| CN111996275B (en) | Molecular marker RMD16 for assisting in identifying powdery mildew resistance of soybean to be detected | |
| CN105349677B (en) | Recover round-grained rice Rice Resistance black streak dwarf site and molecule labelling method | |
| CN103275975A (en) | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application | |
| CN110616275B (en) | Molecular marker derived from Yttrium okamuni cotton and cotton fiber strength QTL (quantitative trait locus) linkage and application thereof | |
| CN110468226B (en) | Molecular marker for resisting leaf rust of poplar and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |