CN100422331C

CN100422331C - Cluster hair wheat-serine/threonine kinase gene and its coded protein

Info

Publication number: CN100422331C
Application number: CNB2006100856296A
Authority: CN
Inventors: 曹爱忠; 王秀娥; 邢莉萍; 王海燕; 王苏玲; 周波; 陈佩度
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2006-06-28
Filing date: 2006-06-28
Publication date: 2008-10-01
Anticipated expiration: 2026-06-28
Also published as: CN1896243A

Abstract

Haynaldiavillosa serine/Hv-S/TPK, its coded protein are disclosed. CDNA sequence of Hv-S/TPK is SEQ ID NO.1, its coded amino acid sequence is SEQ ID NO.2. It has better powdery mildew resistance.

Description

A cluster hair wheat serine/threonine kinase gene and coded protein thereof

One, technical field:

The invention discloses a serine/threonine kinase gene (Hv-S/TPK) from cluster hair wheat, belong to the genetically engineered field, this gene changes the powder mildew resistance that susceptible wheat can improve wheat over to.

Two, technical background:

Wheat (Triticum asetivum L.) is the food crop the widest, that cultivated area is maximum that distribute in the world.Tightly inferior to paddy rice, occupy second in the cultivated area of China's wheat and output.The wheat growth phase is longer, is vulnerable to the influence of a lot of biologies and abiotic stress in its process of growth.Infect the second largest disease that the wheat powdery mildew that causes is China's wheat by obligatory parasitism fungi Blumeria graminis f.sp.tritici, the gesture that appearance in recent years increases the weight of has from south to north gradually been brought more and more serious harm to Wheat Production.Prevent and treat the most economical effective means of Powdery Mildew and be to use disease-resistant variety, but because the pathogenic bacteria microspecies change soon, China's most existing kind has lost the resistance to Powdery Mildew gradually.Separate and identify new mildew-resistance gene, utilize genetic engineering means to change susceptible variety over to, carry out the disease-resistant wheat molecular breeding, can improve the disease resistance of wheat.

Be positioned at the strong resistance of the Pm2l gene pairs Powdery Mildew on the cluster hair wheat 6V karyomit(e), anti-spectrum is wide, it is the most effective mildew-resistance gene (reference: Chen P D so far, Qi L L, Zhou B, et al.Developmentand molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6AL translocationlines specifying resistance to powdery mildew.Theor Appl Genet, 1995,91:1125-1128.), so clone this gene and it changed in the susceptible variety, can improve the resistance of wheat.The work of clone Pm2l has been carried out in this laboratory in recent years, and is screening the evaluation of having carried out the disease-resistant function of gene on the basis of candidate gene.

Three, summary of the invention:

Technical problem:

The objective of the invention is to disclose a serine/threonine kinase gene and coded protein thereof, this gene can be used as goal gene and imports common wheat from cluster hair wheat, improves the powder mildew resistance of wheat, carries out the wheat breed improvement.

Technical scheme:

Serine/threonine kinase gene of the present invention, from cluster hair wheat (Haynaldia villosa), called after Hv-S/TPK gene, its nucleotides sequence are classified SEQ ID NO.1 as.The protein of this serine/threonine kinase genes encoding, called after Hv-S/TPK protein, its aminoacid sequence are SEQ IDNO.2.

Beneficial effect:

1, the invention discloses a serine/threonine kinase gene (Hv-S/TPK) and coded protein thereof.The serine/threonine kinase gene is the reported first in the cluster hair wheat, and this gene can be used as goal gene and imports common wheat from cluster hair wheat, improves the powder mildew resistance of wheat, to carry out the wheat breed improvement.

2, utilize Hv-S/TPK gene of the present invention to make up plant expression vector as goal gene, wherein available any promotor is cauliflower mosaic virus (CAMV) 35S promoter, Ubiquitin promotor or other promotor for example.Can use selected marker for the evaluation of simplifying transformant and comprise enzyme antibiotics resistance, also can utilize the enzyme of the compound that colour-change (for example B-glucuronidase GUS) or luminous (for example luciferase) discern, also available unmarked selection.Method for transformation uses the sophisticated particle bombardment of wheat transformation technology.

Four, description of drawings

The sxemiquantitative RT-PCR of Fig. 1 Hv-S/TPK gene

0,24,48,72 hours sample is induced in 0,24,48,72 expressions

Fig. 2 is a primer with NAU/xibao15-F and NAU/xibao15-R, and it is that DNA is the PCR that template is carried out that a cover of raise wheat No. 5, cluster hair wheat and wheat-haynaldia villosa adds

Annotate: arrow is depicted as the amplified band from 6VS

Fig. 3 is a primer with NAU/xibao15-F and NAU/xibao15-R, and No. 5, wheat-haynaldia villosa cluster hair wheat DNA are the PCR that template is carried out to raise wheat

Annotate: arrow is depicted as the amplified band from 6VS

Fig. 4 RACE amplification

Annotate: arrow is depicted as the band of RACE

The disease-resistant qualification result of Fig. 5 excised leaf

The disease-resistant qualification result of plant under Fig. 6 natural condition

Fig. 7: common wheat karyomit(e) diagrammatic sketch

Fig. 8: cluster hair wheat karyomit(e) diagrammatic sketch

Fig. 9: the diagrammatic sketch of wheat-haynaldia villosa translocation line 6VS/6AL

Figure 10: it is the diagrammatic sketch of DA6V that wheat-haynaldia villosa adds

Five, embodiment

1, utilizes the disease-resistant gene analogue of barley gene chip screening cluster hair wheat

The seed of disease-resistant cluster hair wheat (public material, Chen P D, Qi L L, Zhou B, et al.Developmentand molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6AL translocationlines specifying resistance to powdery mildew.Theor Appl Genet, 1995,91:1125-1128.) be sowed in the culture dish and germinate, be transplanted to the basin alms bowl after showing money or valuables one carries unintentionally, shake off on seedling to induce mixing powdery mildew spore (taking from the mixing spore of field wheat powdery mildew under the natural condition of area, Nanjing) to tri-leaf period.Disease-resistant cluster hair wheat extracts RNA (the Trizol reagent with Invitrogen company extracts) balanced mix respectively and forms experimental group in the sampling in 24,48,72 hours of powdery mildew inoculation back; Non-inducer blade with induce sample to take a sample simultaneously, extract the RNA balanced mix respectively and form control group.The RNA sample Superscript of experimental group and control group ^TMThe II reverse transcription become cDNA (test kit is available from Gibco/BRL, Gaithersburg, MD USA), and further becomes cRNA in in-vitro transcription.The cRNA sample of experimental group and control group simultaneously with barley chip of expression spectrum Barley 1 GeneChip ( Http:// www.affymetrix.com/products/arrays/specific/barley.affx) hybridize, chip hybridization experiment " Shanghai biochip engineering center of country " is finished, experimental procedure with reference to Affymetrix company specification sheets " ExpressedAnalysis Technical Manual " ( Http:// www.affymetrix.com/support/technical/manual/expression manual.affx).Is standard screening up-regulated expression gene with experimental group signal and control group signal ratio greater than 2, obtains being numbered the disease-resistant gene analogue of Contig17515, is a serine/threonine kinase gene.Because this gene is in inducing sample than at non-expression amount height of inducing in the sample, experimental group hybridization signal and control group hybridization signal ratio are 2 ^1.7So, judge that tentatively this gene and powder mildew resistance have closely related property.

2, the expression amount of sxemiquantitative RT-PCR analyzing gene

In order to verify the verity of gene chip data, carry out sxemiquantitative RT-PCR analysis according to a pair of primer NAU/xibao15F of Contig17515 sequences Design (agatccaacaccagttcaag) and NAU/XiBao15R (atgttatggaggcttgtgtc).Disease-resistant cluster hair wheat non-induced and induces the cDNA of the sample of different time to be template, is that primer carries out sxemiquantitative RT-PCR and analyzes with NAU/xibao15, with house-keeping gene Tubulin as confidential reference items (primer of amplification Tubulin gene is tubulinF-agaacactgttgtaaggctcaac and tubulinR-gagctttactgcctcgaacatgg).The PCR program is 94 ℃ of pre-sex change 3min; 94 ℃ of sex change 30s, 56 ℃ of renaturation 1min, 72 ℃ are extended 2min, 23 circulations; 72 ℃ of 10min; 4 ℃ of preservations.PCR product electrophoresis on sepharose, in the cluster hair wheat sample, detect the band that a NAU/XiBao15 increases out, this sheet segment length 448bp behind cloning and sequencing, with the homology of Contig17515 be 96%, be Hv-S/TPK so this gene fragment in the cluster hair wheat named.

Sxemiquantitative RT-PCR result show: the Hv-S/TPK gene is subjected to powdery mildew to induce up-regulated expression in disease-resistant cluster hair wheat, and the expression amount result (Fig. 1) that RT-PCR shows is consistent with the expression amount result that gene chip shows.

3, the physical positioning of Hv-S/TPK gene

With NAU/xibao15 is primer, raise wheat No. 5 (public authorization kind) with common wheat, cluster hair wheat is (public, Chen P D, Qi L L, Zhou B, et al.Development and molecular cytogeneticanalysis of wheat-Haynaldia villosa 6VS/6AL translocation lines specifying resistance topowdery mildew.Theor Appl Genet, 1995,91:1125-1128.), it is that DA1V-DA7V is (public that wheat-haynaldia villosa one cover adds, see Sears, E.R.1953.Addition of the genome of Haynaldiavillosa to Triticum aestivum.Am.J.Bot.40:168-174) DNA is that template is carried out PCR, amplify a special band from cluster hair wheat, and add the special band (Fig. 2) that only in DA6V, detects this cluster hair wheat in the system at a cover, illustrate on the 6V karyomit(e) of this PCR product from cluster hair wheat.This fragment cloning order-checking back is 902bp, and its two ends, left and right sides are consistent with the sequence of the 448bp that amplifies from cluster hair wheat cDNA.No. 5,6VS/6AL translocation line are (public further to raise wheat with common wheat, Chen P D, Qi L L, Zhou B, et al.Development andmolecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6AL translocation linesspecifying resistance to powdery mildew.Theor Appl Genet, 1995,91:1125-1128.) carry out PCR for template, in translocation line, detect 902bp specific band (Fig. 3).Because the 6AS karyomit(e) in the 6VS/6AL translocation line is by the 6VS chromosome substitution of cluster hair wheat, and at the band that from translocation line, can amplify 902bp, so this PCR product is from 6VS karyomit(e).In sum, the Hv-S/TPK gene is positioned on the cluster hair wheat 6VS karyomit(e).(annotate: the karyomit(e) synoptic diagram of above-mentioned materials is seen Fig. 7,8,9,10)

4, utilization RACE method is separated the Hv-S/TPK full length gene

The cDNA that induced 24 hours with disease-resistant cluster hair wheat is that template is carried out RACE, adopts the SMART-RACE method (available from Clonetech, USA) to carry out the cDNA full-length clone of Hv-S/TPK.3 '-RACE is separated to the 307bp of gene 3 ' end, and 5 '-RACE is separated to the 621bp of gene 5 ' end, obtains the Hv-S/TPK full length gene (Fig. 4) of 1376bp through splicing.Redesign comprises the ORF frame at interior primer Hv-S/TPK-F:ATATAAGGGGCGGCTAAGGA and Hv-S/TPK-R:CACTGCGCCACCAATCTAGT according to the splicing sequence.With Hv-S/TPK-F and Hv-S/TPK-R is primer, with the cDNA that induced 24 hours is that template is carried out PCR, detect the sheet degree (Fig. 4) of a treaty 1200bp, this fragment is carried out cloning and sequencing and spliced sequence relatively with 1376bp, comparison result shows that this extension increasing sequence is consistent with the splicing sequence.

Be listed in the nucleotides sequence of Hv-S/TPK full length gene and carry out the BLAST compare of analysis in the ncbi database, the homology of the serine/threonine kinase gene of Hv-S/TPK and barley, paddy rice, Arabidopis thaliana, corn reaches 96%, 87%, 81%, 79%, proves that further Hv-S/TPK is a serine/threonine kinase gene.

5, the evaluation of gene function

Being that primer increases from cluster hair wheat that to be built into conversion carrier pAHC-25 (public for the gene fragment of coming out with Hv-S/TPK-F and Hv-S/TPK-R, reference: Christensen A H, Quail P H, Ubiquitinpromoter-based vectors for high-level expression of selectable and/or screenable markergenes in monocotyledonous plants.Transgenic Research, 1996,5:213-218.), with the gus gene encoding sequence on the Hv-S/TPK replacement pAHC25 carrier, thus target gene is cloned into the downstream of strong promoter Ubi, obtains expression vector pAHC-Hv-S/TPK.Herbicide resistance gene (Bar gene) is as the selectable marker gene of Plant Transformation.

With rataria and the callus (pH 5.8 for callus induction substratum: MS+2,4-D 2mg/L+ sucrose 30g/L+ agar 8g/L) of raising wheat 158 is transformation receptor, and the expression vector pAHC-Hv-S/TPK that builds is imported in the middle of the acceptor by particle gun.Callus after the bombardment (selects substratum to be: MS+2 through the screening of two-wheeled weedicide, 4-D 1mg/L+ sucrose 30g/L+ agar 8g/L+ weedicide (Bialaphos) 3-5mg/L, pH 5.8), resistant calli on division culture medium the regeneration resistant plant (division culture medium is: 1/2MS+ naa 1.0mg/L+ weedicide (Bialaphos) 34mg/L+30g/L sucrose+agar 8g, PH5.8).The total DNA that extracts the regeneration plant blade carries out PCR and detects, if the regeneration plant that 3 genes of anti-herbicide gene (Bar), promoter gene (Ubi) and target gene (Hv-S/TPK) all are detected is considered as positive plant.

Positive plant is carried out disease-resistant Function Identification.(1) the regeneration seedling is carried out the disease-resistant evaluation of excised leaf.Excised leaf places 2.4% agar powder to add on the fresh-keeping substratum of 20mg/L benzimidazolyl, inoculates fresh white powder germ spore, inoculates within back 24 hours in 18～20 ℃ of dark culturing, and then cultivate the result of " Invest, Then Investigate " morbidity in 7 days under the low light level.Qualification result shows: have only irritated spot on the transfer-gen plant, do not have the visible spore; And the powdery mildew spore spreads all over whole blade (Fig. 5) on the contrast blade.(2) seedling is got over Xia Houzhuan in the controlled environment chamber and plants the land for growing field crops, and transfer-gen plant is carried out disease-resistant evaluation under the natural occurrence condition.The land for growing field crops qualification result is consistent with the excised leaf qualification result, does not have sorus on transfer-gen plant, and sorus (Fig. 6) is arranged on the adjoining tree blade.Comprehensive excised leaf and land for growing field crops qualification result, transfer-gen plant are high anti-to Powdery Mildew, show that Hv-S/TPK has disease-resistant function.

Sequence that the present invention relates to and mark apportion are as follows:

(1) information of SEQ ID NO.1

(i) sequence signature:

(A) length: 1376bp

(B) type: Nucleotide

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: Nucleotide

(iii) sequence description: SEQ ID NO.1

(2) information of SEQ ID NO.2

(i) sequence signature:

(A) length: 310a.a

(B) type: amino acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: protein

(iii) sequence description: SEQ ID NO.2

Sequence table

＜110〉Agricultural University Of Nanjing

＜120〉a cluster hair wheat serine/threonine kinase gene and coded protein thereof

<130>000

<140>000

<141>2006-06-21

<160>3

<170>PatentIn?version?3.1

<210>SEQ?ID?NO.1

<211>1376

<212>DNA

＜213〉cluster hair wheat [Haynaldia villosa]

<221>CDS

<222>(163)..(1095)

<221>3′UTR

<222>(1096)..(1376)

<221>mRNA

<222>(1)..(1376)

<221>polyA_site

<222>(1360)..(1376)

<221>5′UTR

<222>(1)..(162)

<400>1

gagctagcaa?aggcaacaga?aaattttaac?ccctccaaca?agattggtga?ggggggtttt 60

ggatctgtat?ataaggggcg?gctaaggaat?ggaaaactta?ttgctgtcaa?ggtgttatct 120

gtagaatcaa?gacaaggatt?aaaggagttt?ctgaatgaac?tgatgtcaat?ttccaacata 180

tctcatggca?atcttgtcag?cctttatggc?tattgtgtgg?aaggaaacca?gaggatcctt 240

gtttacaatt?accttgagaa?taatagccta?gcacaaacac?ttctaggttc?tggccgcagc 300

aatatccagt?tcaattggag?aagtagagta?aatatttgcc?ttggtatcgc?ccgaggatta 360

gcataccttc?atgatgatgt?caatccccac?attgttcatc?gggatatcaa?agcaagcaat 420

atacttcttg?ataaggatct?cacccccaaa?atttctgatt?tcggtttagc?aaagcttcta 480

cctccaaatg?cgtcacatat?tagcacacgg?gttgcaggaa?cattaggcta?cttggctcct 540

gagtatgcca?ttcgaggaca?agtgacacgg?aagtcagatg?tttatagttt?tggtgttttg 600

cttctggaaa?tagtcagtgg?gagatccaac?accagttcaa?gattacccta?tgaagaccaa 660

atacttttgg?aaaagttccc?agaggttacc?aatggggttc?tcctcttgca?gacatggatg 720

tattatgagc?agggagattt?ggtgaaaatc?atagacagtt?ctgtgggtga?tgatttggat 780

attgaacaag?cctgcaggtt?cctgaaagtt?ggacttctct?gtacacaaga?tgtcacaaga 840

catcgaccca?ccatgtcaac?tgtcgtcagc?atgctagcag?gcgaaaagga?tgttgactcg 900

gagaagatca?gcaagcccgc?tacaattagc?gactttatgg?acctcaagat?caggagcatg 960

aggagagaaa?ataacatagc?tttcgcttct?tcctccacgt?tgctatccac?tatcatggca 1020

cactcttctc?cattgttgtc?gcaagagacg?acacaagcct?ccataacatt?caccgcaata 1080

tcagagcgtg?agtgacctga?agttggttgc?agatacgaag?accatgtaga?gaagtagcat 1140

agccagatac?cttttctttt?tcagaaaatt?tcttcctagt?gtatagattc?actttgttta 1200

tagtgtacac?agcattgctg?gcacaaagaa?gttaaccagt?tttactttgt?gtgtataata 1260

ctagattggt?ggcgcagtgt?cattgtataa?tttgtgcatg?tacatcgtgt?ctgttgtttg 1320

tttggagggt?aagaaaatac?aagtttgaga?tcctgtgagt?aaaaaaaaaa?aaaaaa 1376

<210>SEQ?ID?NO.2

<211>310

<212>PRT

<213>Haynaldia?villosa

<400>2

Met?Ser?Ile?Ser?Asn?Ile?Ser?His?Gly?Asn?Leu?Val?Ser?Leu?Tyr?Gly

1 5 10 15

Tyr?Cys?Val?Glu?Gly?Asn?Gln?Arg?Ile?Leu?Val?Tyr?Asn?Tyr?Leu?Glu

20 25 30

Asn?Asn?Ser?Leu?Ala?Gln?Thr?Leu?Leu?Gly?Ser?Gly?Arg?Ser?Asn?Ile

35 40 45

Gln?Phe?Asn?Trp?Arg?Ser?Arg?Val?Asn?Ile?Cys?Leu?Gly?Ile?Ala?Arg

50 55 60

Gly?Leu?Ala?Tyr?Leu?His?Asp?Asp?Val?Asn?Pro?His?Ile?Val?His?Arg

65 70 75 80

Asp?Ile?Lys?Ala?Ser?Asn?Ile?Leu?Leu?Asp?Lys?Asp?Leu?Thr?Pro?Lys

85 90 95

Ile?Ser?Asp?Phe?Gly?Leu?Ala?Lys?Leu?Leu?Pro?Pro?Asn?Ala?Ser?His

100 105 110

Ile?Ser?Thr?Arg?Val?Ala?Gly?Thr?Leu?Gly?Tyr?Leu?Ala?Pro?Glu?Tyr

115 120 125

Ala?Ile?Arg?Gly?Gln?Val?Thr?Arg?Lys?Ser?Asp?Val?Tyr?Ser?Phe?Gly

130 135 140

Val?Leu?Leu?Leu?Glu?Ile?Val?Ser?Gly?Arg?Ser?Asn?Thr?Ser?Ser?Arg

145 150 155 160

Leu?Pro?Tyr?Glu?Asp?Gln?Ile?Leu?Leu?Glu?Lys?Phe?Pro?Glu?Val?Thr

165 170 175

Asn?Gly?Val?Leu?Leu?Leu?Gln?Thr?Trp?Met?Tyr?Tyr?Glu?Gln?Gly?Asp

180 185 190

Leu?Val?Lys?Ile?Ile?Asp?Ser?Ser?Val?Gly?Asp?Asp?Leu?Asp?Ile?Glu

195 200 205

Gln?Ala?Cys?Arg?Phe?Leu?Lys?Val?Gly?Leu?Leu?Cys?Thr?Gln?Asp?Val

210 215 220

Thr?Arg?His?Arg?Pro?Thr?Met?Ser?Thr?Val?Val?Ser?Met?Leu?Ala?Gly

225 230 235 240

Glu?Lys?Asp?Val?Asp?Ser?Glu?Lys?Ile?Ser?Lys?Pro?Ala?Thr?Ile?Ser

245 250 255

Asp?Phe?Met?Asp?Leu?Lys?Ile?Arg?Ser?Met?Arg?Arg?Glu?Asn?Asn?Ile

260 265 270

Ala?Phe?Ala?Ser?Ser?Ser?Thr?Leu?Leu?Ser?Thr?Ile?Met?Ala?His?Ser

275 280 285

Ser?Pro?Leu?Leu?Ser?Gln?Glu?Thr?Thr?Gln?Ala?Ser?Ile?Thr?Phe?Thr

290 295 300

Ala?Ile?Ser?Glu?Arg?Glu

305 310

<210>3