CN101928714B - Haynaldia villosa ubiquitin ligase gene and protein coded by same - Google Patents

Abstract

The invention discloses an ubiquitin ligase gene Hv-PUB from Haynaldia villosa and protein coded by the ubiquitin ligase gene, belonging to the field of gene engineering. cDNA sequence of the Haynaldia villosa ubiquitin ligase gene (Hv-PUB) is SEQ ID NO. 1 and the gene-coded amino acid sequence is SEQ ID NO. 2. The gene is reported for the first time in Haynaldia villosa and induced by wheat powdery mildew to activate expression quickly, overexpression of the gene in Yangmai 158, a powdery mildew-susceptible wheat variety, can enhance the resistance of the Yangmai 158 to powdery mildew. As a key component in the disease-resisting course of Haynaldia villosa, Hv-PUB can serve as a target gene for the introduction of powdery mildew- susceptible wheat variety in order to enhance resistance to powder mildew; and simultaneously, finding out the molecular mechanism of the effect thereof helps understand the broad spectrum resistance mechanism of powder mildew.

Description

Cluster hair wheat ubiquitin ligase gene and encoded protein matter thereof

One, technical field:

The invention discloses the Hv-PUB gene of being cloned in the cluster hair wheat (Haynaldia villosa), the protein of this genes encoding has the constructional feature of U-box structural domain and PUB gene, belongs to the genetically engineered field.Raise in wheat sense Powdery Mildew kind that this gene of overexpression can improve the resistance of raising 158 pairs of white powder germs of wheat in the wheat 158.

Two, background technology:

Wheat powdery mildew is infected by wheat powdery mildew (Blumeria graminis f.sp.tritici) and causes; Be to be only second to one of main fungal disease of rust in China's Wheat Production, cultivate and promote disease-resistant varieties and be that to prevent and treat Powdery Mildew most economical, effective and be beneficial to the approach of environment protection.Genes involved in clone's mildew-resistance gene or the disease-resistant approach helps furtheing investigate disease-resistant wheat mechanism, and opens up new approaches and new way for the safer effective disease control novel method of development and utilization.

(Haynaldia villosa has another name called Dasypyrum villosum, 2n=14 to cluster hair wheat; VV) belonging to wheat family cluster hair wheat belongs to; Be a wild relatives of wheat, high resist powdery mildew of wheat, the powdery mildew resistance gene Pm 21 that is positioned on the cluster hair wheat 6V the short arm of a chromosome is a wide spectrum, efficient resistant gene (reference: Chen P D; Qi LL; Zhou B, Zhang S Z, Liu D J.Development and molecular cytogenetic analysisof wheat-Haynaldia villosa 6VS/6AL translocation lines specifyingresistance to powdery mildew.TAG; 1995, (91): 1125-1128.).Research Pm21 gene is brought into play transcription factor related in the resistant effect process and important defense response gene, and for the molecule mechanism of understanding resistance of wide spectrum, it is significant to the resistance of Powdery Mildew that the utilization genetic engineering means improves wheat.

Three, summary of the invention:

Technical problem:

The objective of the invention is to disclose one from the Hv-PUB gene of cluster hair wheat and coded protein thereof, this gene can be used as goal gene and imports common wheat, improves the powder mildew resistance of wheat, carries out the disease resistance improvement of wheat breed.In addition, through analyzing the molecular mechanism of Hv-PUB effect, can be the safer and more effective disease control novel method of exploration and open up new approaches.

Technical scheme:

Ubiquitin ligase gene of the present invention, from cluster hair wheat, called after Hv-PUB gene, its nucleotides sequence are classified SEQ ID NO.1 as.This Hv-PUB full length gene has long 1691 bases; Wherein there are 105 bases in 5 '-UTR district, and 3 '-UTR has 221 bases, the long 1365bp of ORFs (ORF) (like Fig. 9); 454 amino acid of encoding have Cys, Met, Pro and four conservative amino-acid residues of Gly at the U-Box structural domain.

The protein that this cluster hair wheat ubiquitin ligase gene is coded, called after Hv-PUB protein, its aminoacid sequence are SEQ ID NO.2.

Beneficial effect:

1, the invention discloses the ubiquitin ligase gene Hv-PUB of being cloned in the cluster hair wheat (Haynaldia villosa), be reported first in the cluster hair wheat.Can be used as goal gene and import common wheat, improve the powder mildew resistance of wheat, to carry out the wheat breed improvement.

2, utilize Hv-PUB gene of the present invention to make up plant expression vector as goal gene, wherein available any promotor is cauliflower mosaic virus (CAMV) 35S promoter, Ubiquitin promotor or other promotor for example.Can use selected marker for the evaluation of simplifying transformant and comprise enzyme, the enzyme of the compound that colour-change also capable of using (for example B-glucuronidase GUS) or luminous (for example luciferase) are discerned, also available unmarked selection antibiotics resistance.Method for transformation uses the sophisticated particle bombardment of wheat transformation technology.

Four, description of drawings

Fig. 1 .Hv-PUB Gene RT-PCR

0min, 5min, 15min, 30min, 1h, 2h, 4h, 24h, 48h represent that the white powder germ induced the sample of 0min, 5min, 15min, 30min, 1h, 2h, 4h, 24h, 48h

Fig. 2. with Contig25420-F and Contig25420-R is primer, and it is that DNA is the PCR that template is carried out that a cover of China spring, cluster hair wheat and wheat-haynaldia villosa translocation line 6VS/6AL and wheat-haynaldia villosa adds

Fig. 3. raise in wheat sense Powdery Mildew kind that this gene of overexpression can improve the resistance of raising 158 pairs of white powder germs of wheat in the wheat 158, the result is illustrated in the formation that the vegetable cell of raising wheat 158 overexpression PUB genes can be good at suppressing the powdery mildew haustorium.A figure does not change Hv-PUB inoculation powdery mildew spore development figure over to for raising in the wheat 158, B figure inoculates powdery mildew spore development figure for raising behind the overexpression Hv-PUB in the wheat 158

Fig. 4. common wheat karyomit(e) diagrammatic sketch

Fig. 5. cluster hair wheat karyomit(e) diagrammatic sketch

Fig. 6. the diagrammatic sketch of wheat-haynaldia villosa translocation line 6VS/6AL

Fig. 7. it is the diagrammatic sketch of DA6V that wheat-haynaldia villosa adds

Five, embodiment

1, utilizes the disease-resistant related gene of barley gene chip screening cluster hair wheat

Disease-resistant cluster hair wheat (public material; Chen P D; Qi L L, Zhou B, et al.Developmentand molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6ALtranslocation lines specifying resistance to powdery mildew.Theor ApplGenet; 1995; 91:1125-1128.) seed be sowed in the petridish and germinate, be transplanted to the basin alms bowl after showing money or valuables one carries unintentionally, shake off on seedling to induce mixing powdery mildew spore (taking from the mixing spore of field wheat powdery mildew under the natural condition of area, Nanjing) to tri-leaf period.Disease-resistant cluster hair wheat extracts RNA (the Trizol reagent with Invitrogen company extracts) balanced mix respectively and forms experimental group in the sampling in 24,48,72 hours of powdery mildew inoculation back; Non-inducer blade with induce sample to take a sample simultaneously, extract the RNA balanced mix respectively and form control group.The RNA sample of experimental group and control group is used Superscript ^TMThe II reverse transcription become eDNA (test kit is available from Gibco/BRL, Gaithersburg, MD USA), and further becomes cRNA in in-vitro transcription.The cRNA sample of experimental group and control group simultaneously with barley chip of expression spectrum Barley l GeneChip ( Http:// www.affymetrix.com/products/arrays/specific/barley.affx) hybridize, chip hybridization experiment " Shanghai biochip engineering center of country " is accomplished, experimental procedure with reference to Affymetrix company specification sheets " Expressed Analysis Technical Manual " ( Http:// www.affymetrix.com/support/technical/manual/expression manual.affx).Is standard screening up-regulated expression gene with experimental group signal and control group signal ratio greater than 2, obtains being numbered the disease-resistant related gene of Contig25420, is a ubiquitin ligase gene.Because than inducing the expression amount in the sample high non-, experimental group hybridization signal and control group hybridization signal ratio are 2 to this gene in inducing sample ^2.1So, judge that tentatively this gene and powder mildew resistance have closely related property.

2.Hv-PUB gene receives powdery mildew abduction delivering pattern

In order to verify the verity of gene chip data; According to a pair of primer of Contig25420 sequences Design (Contig25420-F:5 '-ccggtgatcgtgaaggcagat-3 ', Contig25420-R:5 '-tccaggttccaaaaatgctc-3 ') carry out sxemiquantitative RT-PCR and analyze.Be template, be that primer carries out sxemiquantitative RT-PCR and analyzes with the non-cDNA that induces, induces the mildew-resistance cluster hair wheat blade of 5min, 15min, 30min, 1h, 2h, 4h, 24h, 48h with Contig25420-F and Contig25420-R, with house-keeping gene Tubulin as confidential reference items (primer of amplification Tubulin gene is tubulinF:agaacactgttgtaaggctcaac and tubulin R:gagctttactgcctcgaacatgg).The PCR program is 94 ℃ of preparatory sex change 3min; 94 ℃ of sex change 30s, 55 ℃ of renaturation 1min, 72 ℃ are extended 2min, 23 circulations; 72 ℃ of 10min; 4 ℃ of preservations.PCR product electrophoresis on sepharose detects an amplified band in the cluster hair wheat sample, 468 bases of this sheet segment length reach 86% with the Contig25420 homology behind cloning and sequencing, names this gene fragment in the cluster hair wheat to be Hv-PUB.

Sxemiquantitative RT-PCR result show: the powdery mildew that is expressed in of Hv-PUB is induced during 30 minutes to 1 hour and is reached mxm., maintains lower level after slowly descending then, shows that this gene receives powdery mildew to induce the back to express (Fig. 1) fast in cluster hair wheat.The expression amount result that RT-PCR shows is consistent with the expression amount result that gene chip shows.

3.Hv-PUB the location on cluster hair wheat karyomit(e)

With Contig25420-F and Contig25420-R is primer, with China spring (public kind), 6VS/6AL translocation line (public, Chen P D; Qi L L; Zhou B, et al.Development andmolecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6ALtranslocation lines specifying resistance to powdery mildew.Theor ApplGenet, 1995; 91:1125-1128.), cluster hair wheat is (public; Chen P D, Qi L L, Zhou B; Et al.Development and molecular cytogenetic analysis of wheat-Haynaldiavillosa 6VS/6AL translocation lines specifying resistance to powdery mildew.Theor Appl Genet; 1995,91:1125-1128.), wheat-haynaldia villosa one cover add be DA1V-DA7V (public, see Sears; E.R.1953.Addition of the genome of Haynaldia villosato Triticum aestivum.Am.J.Bot.40:168-174) DNA is that template is carried out PCR; Amplify a special band from cluster hair wheat, and add the special band (Fig. 2) that only in DA6V, detects this cluster hair wheat in the system, explain on the 6V karyomit(e) of this PCR product from cluster hair wheat at a cover.In the 6VS/6AL translocation line, also amplify the specific amplified band (Fig. 2) in the cluster hair wheat.Because the 6AS karyomit(e) in the 6VS/6AL translocation line is by the 6VS chromosome substitution of cluster hair wheat, and from translocation line, can amplify specific band, so this PCR product is from 6VS karyomit(e).In sum, the Hv-PUB gene is positioned on the cluster hair wheat 6VS chromosome arm.(annotate: the karyomit(e) synoptic diagram of above-mentioned materials is seen Fig. 4,5,6,7)

4. the method in utilization screening library is cloned the Hv-PUB full length gene

With Contig25420-F and Contig25420-R is primer; From cluster hair wheat cDNA library (public, Yaping Chen, Huazhong Wang; Xiue Wang; Aizhong Cao, Peidu Chen.Cloning andexpression of peroxisomal ascorbate peroxidase gene from wheat.MolecularBiology Reports screens in 33:207-213) and comprises the segmental clone of Hv-PUB full length gene cDNA.Sequencing result shows; The Hv-PUB full length gene has long 1691 bases; Wherein there are 105 bases in 5 '-UTR district, and 3 '-UTR has 221 bases, the long 1365bp of ORFs (ORF) (like Fig. 9); 454 amino acid of encoding have Cys, Met, Pro and four conservative amino-acid residues of Gly at the U-Box structural domain.Nucleotide sequence and protein sequence with the Hv-PUB gene carry out the BLAST compare of analysis in ncbi database; Find behind Hv-PUB and paddy rice, Arabidopis thaliana, tobacco, the parsley pathogenic bacterium inducing that the PUB gene of expression has higher similarity fast, so be Hv-PUB with this unnamed gene.

5. overexpression Hv-PUB gene in raising wheat 158

The Hv-PUB gene is inserted pBI220.6 (public material; Ya-Ping Chen et al PlastidialGlutathione Reductase from Haynaldia villosa is an Enhancer of PowderyMildew Resistance in Wheat (Triticum aestiyum) .Plant and Cell Physiology; 2007; 48 (12): 1702-1712) MCS makes up the moment expression vector.Utilize the particle gun conversion method that Hv-PUB is transformed and raise wheat 158 blades; Shake off on blade to carry out mixing powdery mildew spore (taking from the mixing spore of field wheat powdery mildew under the natural condition of area, Nanjing) behind the 6h; Observe in microscopically after 24 hours; The result shows that contrast transforms the surperficial spore of pBI220.6 empty plasmid (Fig. 3 A) blade cell and can both normally sprout; Grow nascent germ tube and adhere to the spore germ tube, adhere to the spore germ tube terminal form to adhere to that spore tightly is attached at epidermal surface and form to the direction of epidermic cell wall invade nail and then form haustorium (shown in Fig. 3 A arrow); The spore that transforms the blade cell surface of pBI220.6-Hv-PUB also can grow nascent germ tube and invade nail with adhering to the spore germ tube and forming; But the trickle protuberance that has invading around following closely (is thickeied relevant with plant cell wall; Shown in Fig. 4 B arrow), powdery mildew can not form haustorium (like Fig. 3 B) normally.This shows, raise in wheat sense Powdery Mildew kind that this gene of overexpression can improve the resistance of raising 158 pairs of white powder germs of wheat in the wheat 158.

Sequence table

< 110>Agricultural University Of Nanjing

< 120>cluster hair wheat ubiquitin ligase genes and encoded protein matter thereof

< 130>specification sheets

<160>4

<170>PatentIn version 3.1

<210>1

<211>1691

<212>DNA

< 213>cluster hair wheat (Haynaldia villosa)

<220>

< 221>gene Hv-PUB

<222>(1)..(1691)

<223>

<400>1

ccacgcgtcc gcgtcagccg ccattccatc tcgtcgtcga tcggctccgg cacagatcat 60

cacgccagct cgaccgccgc tttcttctac gtgccgcgac agtccatggt cacgccgctg 120

ccccgcttcc gcgttcgcgc gttcggcggc gcggcgcgtg gcgcgccggc cgagataccg 180

ctcgccgtca ggcgggcgtg gcagcagcct gcgctggtcg ccgccgccga gttggagcct 240

tccgtgccga cccacttcct gtgcccgata tcgctcgaca tgatgcggga ccccgtgacg 300

gcgccgacgg ggatcacgta cgaccgggag agcgtggagg gatggctgga gcgcggccac 360

gccacgtgcc ccgtgaccgg ccggccgctg cggctggagg agctcgtccc taaccatgcc 420

acgaggaggg tgatccagga gtggtgcgtc gccaaccggg gactcggggt agagcgcgtg 480

ccgacgccac gcgtcccgat ctccgccttc gacgcgtccg agctcctggc ggccgtgtcc 540

gctgccgcga ggcgcgggga tgggccaagg tgccgggagc tggtcgcgag ggccagggcg 600

ctcgggaagg agagcgagcg caaccgccgg tgcttcgtgt ccgccagcgc cgcccgcacg 660

ctctcctcgg tcttctgcca tcttgccggt cagcgggtgg tgccagcgac ggccctagag 720

gagatcctgg cggcgttggt cgtgttctta cctcttgacg aggagtcgag gcgccacatt 780

gcctccccgg cgtcgctgga atccgtcgtc tctatcctct cccacagcga gcccctcgcg 840

cgggtcagcg ccgtcgtcgt tctccgcgag atcgcctcct catccgacag gcagtgcctc 900

gaggcgatgt caaagaccac cggcatatac gcggcgctcg tcaagctcct ggagaaaccc 960

gtctcgccgc aggccaccaa ggcggcgctg gtaaccgcgt actacctcgt catgcacacc 1020

gagctcgccg cgtcccccct cgtcgacctc ggcgcggtgc ggctcctcct cgagctgctg 1080

gtggacgccg acaagggcac gacggagaag gcgctggccg tgctggacag tctgctcctc 1140

acatgcaagg gccgcgacga ggcgtacgcg caggcgctgg ccgtgccggt gatcgtgaag 1200

cagatgcagc acgtgtccga catggcgacg gagttcgccg tgtcggcgct gtggcggctg 1260

tgcaagaact tcgcggcgga cggcggcggg tgcacggccg aggcgctgca ggtcggcgcg 1320

ttccagaagc tgctcctgct gctgcaggtg ggctgcgagg gcgtcaccaa ggagcgtgca 1380

agcgagctgc tcaggattct caatggatcc agggacggcg ccgagtgcat cgactcgctg 1440

gatttcaagg cgctcaagag acccttctga gtgtgcatat tggaacttgg ttacgatgtg 1500

gatagaacca tgcagacaca attaggttta gattctctct ttctttggaa gaactaccgt 1560

gctcatgggg gagtattttt ggaacctgga atatacggtt ccactcaaaa ttagcaaaga 1620

atgacatcta caagttgtga aaaaaatata tggaaagaac catccatgca acaggtaaaa 1680

aaaaaaaaaa a 1691

<210>2

<211>454

<212>PRT

< 213>cluster hair wheat (Haynaldia villosa)

<220>

< 221>Hv-PUB aminoacid sequence

<222>(1)..(454)

<223>

<400>2

Met Val Thr Pro Leu Pro Arg Phe Arg Val Arg Ala Phe Gly Gly Ala

1 5 10 15

Ala Arg Gly Ala Pro Ala Glu Ile Pro Leu Ala Val Arg Arg Ala Trp

20 25 30

Gln Gln Pro Ala Leu Val Ala Ala Ala Glu Leu Glu Pro Ser Val Pro

35 40 45

Thr His Phe Leu Cys Pro Ile Ser Leu Asp Met Met Arg Asp Pro Val

50 55 60

Thr Ala Pro Thr Gly Ile Thr Tyr Asp Arg Glu Ser Val Glu Gly Trp

65 70 75 80

Leu Glu Arg Gly His Ala Thr Cys Pro Val Thr Gly Arg Pro Leu Arg

85 90 95

Leu Glu Glu Leu Val Pro Asn His Ala Thr Arg Arg Val Ile Gln Glu

100 105 110

Trp Cys Val Ala Asn Arg Gly Leu Gly Val Glu Arg Val Pro Thr Pro

115 120 125

Arg Val Pro Ile Ser Ala Phe Asp Ala Ser Glu Leu Leu Ala Ala Val

130 135 140

Ser Ala Ala Ala Arg Arg Gly Asp Gly Pro Arg Cys Arg Glu Leu Val

145 150 155 160

Ala Arg Ala Arg Ala Leu Gly Lys Glu Ser Glu Arg Asn Arg Arg Cys

165 170 175

Phe Val Ser Ala Ser Ala Ala Arg Thr Leu Ser Ser Val Phe Cys His

180 185 190

Leu Ala Gly Gln Arg Val Val Pro Ala Thr Ala Leu Glu Glu Ile Leu

195 200 205

Ala Ala Leu Val Val Phe Leu Pro Leu Asp Glu Glu Ser Arg Arg His

210 215 220

Ile Ala Ser Pro Ala Ser Leu Glu Ser Val Val Ser Ile Leu Ser His

225 230 235 240

Ser Glu Pro Leu Ala Arg Val Ser Ala Val Val Val Leu Arg Glu Ile

245 250 255

Ala Ser Ser Ser Asp Arg Gln Cys Leu Glu Ala Met Ser Lys Thr Thr

260 265 270

Gly Ile Tyr Ala Ala Leu Val Lys Leu Leu Glu Lys Pro Val Ser Pro

275 280 285

Gln Ala Thr Lys Ala Ala Leu Val Thr Ala Tyr Tyr Leu Val Met His

290 295 300

Thr Glu Leu Ala Ala Ser Pro Leu Val Asp Leu Gly Ala Val Arg Leu

305 310 315 320

Leu Leu Glu Leu Leu Val Asp Ala Asp Lys Gly Thr Thr Glu Lys Ala

325 330 335

Leu Ala Val Leu Asp Ser Leu Leu Leu Thr Cys Lys Gly Arg Asp Glu

340 345 350

Ala Tyr Ala Gln Ala Leu Ala Val Pro Val Ile Val Lys Gln Met Gln

355 360 365

His Val Ser Asp Met Ala Thr Glu Phe Ala Val Ser Ala Leu Trp Arg

370 375 380

Leu Cys Lys Asn Phe Ala Ala Asp Gly Gly Gly Cys Thr Ala Glu Ala

385 390 395 400

Leu Gln Val Gly Ala Phe Gln Lys Leu Leu Leu Leu Leu Gln Val Gly

405 410 415

Cys Glu Gly Val Thr Lys Glu Arg Ala Ser Glu Leu Leu Arg Ile Leu

420 425 430

Asn Gly Ser Arg Asp Gly Ala Glu Cys Ile Asp Ser Leu Asp Phe Lys

435 440 445

Ala Leu Lys Arg Pro Phe

450

<210>3

<211>21

<212>DNA

< 213>synthetic

<220>

<221>Contig25420-F

<222>(1)..(21)

<223>

<400>3

ccggtgatcg tgaaggcaga t 21

<210>4

<211>20

<212>DNA

< 213>synthetic

<220>

<221>Contig25420-R

<222>(1)..(20)

<223>

<400>4

tccaggttcc aaaaatgctc 20

Claims (3)

1. ubiquitin ligase gene, from cluster hair wheat (Haynaldia villosa), called after Hv-PUB gene, its nucleotides sequence are classified SEQ ID NO.1 as.

2. the said ubiquitin ligase gene of claim 1 is being raised the powdery mildew resistance gene application in engineering of wheat 158.

3. the said ubiquitin ligase gene Hv-PUB of claim 1 encoded protein matter, called after Hv-PUB protein, its aminoacid sequence are SEQ ID NO.2.

Images