CN100395332C - L-sorbosone dehydrogenase, gene encoding same and use thereof - Google Patents
L-sorbosone dehydrogenase, gene encoding same and use thereof Download PDFInfo
- Publication number
- CN100395332C CN100395332C CNB2003101168317A CN200310116831A CN100395332C CN 100395332 C CN100395332 C CN 100395332C CN B2003101168317 A CNB2003101168317 A CN B2003101168317A CN 200310116831 A CN200310116831 A CN 200310116831A CN 100395332 C CN100395332 C CN 100395332C
- Authority
- CN
- China
- Prior art keywords
- seq
- ketone
- sorbic
- dehydrogenase
- kga
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention discloses an L-sorbosone dehydrogenase, a coding gene and applications thereof. The L-sorbosone dehydrogenase provided by the present invention is protein having the SEQ ID No. 2 amino acid residue sequence in the sequence table or protein derived from SEQ ID No. 2, having at least 80% homology with the SEQ ID No. 2 amino acid residue sequence in the sequence table and having the same activity with the SEQ ID No. 2. The coding gene of the L-sorbosone dehydrogenase has one of the following nucleotide sequences: 1), the SEQ ID No. 1 in the sequence table, 2), a polynucleotide of the SEQ ID No. 2 protein sequence in the coding sequence table, and 3) a DNA sequence coding the protein with the same functions and having more than 80% homology with the DNA sequence limited by the SEQ ID No. 1 in the sequence table. When an E. coli engineering bacterium carrying the coding gene of the L-sorbosone dehydrogenase of the present invention is jointly cultured with a 2-KGA converting bacterium, rSNDH of the present invention obviously improves the conversion rate of 2-KGA.
Description
Technical field
The present invention relates in the genetically engineered field a kind of L-sorbic ketone dehydrogenase and encoding gene thereof and expression method, application.
Background technology
The ancient dragon acid of 2-ketone group-L-(2-KGA) is the important intermediate of synthetic xitix (vitamins C), and known have multiple microorganism L-sorbyl alcohol/sorbose can be converted into 2-KGA.As used NRRL B-21627 (U.S. Pat 5834231) such as Stoddard, the DSM4025 that T.Hoshino etc. mentioned (European patent EP 9611500.8), (Chinese patents 96116464.6) such as SCB329 that Yin Guanglin etc. mention.
Have many pieces of bibliographical informations the L-sorbose can be converted into 2-KGA with microorganism, United States Patent (USP) 3907.639 discloses the microorganism that belongs to acetobactor, pseudomonas, Serratia, staphylococcus, gas bacillus, Alcaligenes, Penicillium notatum, candiyeast and gluconic acid bacterium and has had above-mentioned activity of conversion.The enzymic activity that Kitamura etc. (EuropeJ.Appl.Microbiol.2.1.1975) are reported in the L-sorb ketooxidase of finding among the living black subspecies IF03293 of bacillus of oxidizing glucose neither needs coenzyme also not need electron acceptor(EA), (Biotechnol.Bioeng 17.1485.1975) reports that also L-sorbic ketone dehydrogenase (SNDH) activity is present in pseudomonas putida ATCC21812 and bacillus of oxidizing glucose and gives birth to black subspecies IF03293 and point out NAD or NADP is not its coenzyme to Makover etc.The SNDH molecular weight that Fujiwara etc. (United States Patent (USP) 4902617) are found is 190000 ± 20000 dalton, form by 4 subunits, the source is oxidizing glucose acid bacterium, the SNDH that United States Patent (USP) 5085993 is found derives from pseudomonas putida, its molecular weight is about 47000 dalton, (Biotechnology and Bioengineering such as YashimasaSaito are only arranged at gene level, Vol, 58, NOS APRIL 20/May 5 1998) clone the SNDH gene in oxidizing glucose acid bacterium T-100, this SNDH is made up of 498 amino acid.
The contrast chemical synthesis is produced ascorbic seven step chemical reactions, and fermentation generates 2-KGA by sorbyl alcohol through 2 steps with microorganism, and generating vitamins C through methanol esterification again is present Chinese method in common.But used 3 kinds of microorganisms in the fermentation of 2 steps, promptly had 2 kinds of microorganisms to participate in by the L-sorbose in the conversion process of 2-KGA, one of them is that conversion L-sorbose is the acid-producing bacteria of 2-KGA.The oxidizing glucose acidfast bacilli that has production application to be worth is grown slower usually separately, the transformation efficiency of 2-KGA is lower, so what industrial production was used at present all is to adopt two bacterium symbiosis, as Bacillus subtilus, bacillus thuringiensis, bacillus megaterium etc. and acid-producing bacteria co-fermentation.And in actual production, still having considerable problem,, technology controlling and process low such as transformation efficiency be complexity etc. comparatively.
The innovation and creation content
The purpose of this invention is to provide a kind of L-sorbic ketone dehydrogenase and encoding gene thereof.
L-sorbic ketone dehydrogenase provided by the present invention, the name be called rSNDH, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences or with sequence table in SEQ ID №: 2 amino acid residue sequence has at least 80% homology and has the № with SEQ ID: 2 is identical active by SEQ ID №: 2 deutero-protein.
Described SEQ ID №: 2 derive from ancient imperial sour bacterium (Ketogulonigenium sp.) WB0104 (CCTCCNo.M203094) of ketone, are made up of 429 amino-acid residues.
Ancient imperial sour bacterium (Ketogulonigenium sp.) WB0104 of ketone is preserved in Chinese typical culture collection center (being called for short CCTCC) on November 24th, 2003, and preserving number is CCTCC No.M203094.
SEQ ID № in described and the sequence table: 2 amino acid residue sequence has at least 80% homology and has the № with SEQID: 2 is identical active by SEQ ID №: 2 deutero-protein are preferably the № with SEQ ID: 2 have at least 90% homology and have the № with SEQ ID: 2 is identical active by SEQ ID №: 2 deutero-protein especially are preferably the № with SEQ ID: 2 amino acid residue sequence is through the replacement of one or several amino-acid residue, disappearance or add and have the № with SEQ ID: 2 is identical active by SEQ ID №: 2 deutero-protein.
Described L-sorbic ketone dehydrogenase can be with sequence table in SEQ ID №: 1 sequence with at least 80% homology is expressed the protein that obtains in host bacterium intestinal bacteria or pichia spp.
A kind of encoding gene of L-sorbic ketone dehydrogenase, name is called rSNDH, is one of following nucleotide sequences:
1) the SEQ ID № in the sequence table: 1;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;
3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 80% above homology, and coding identical function protein DNA sequence, wherein, be preferably with sequence table in SEQ ID №: 1 dna sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.
Described SEQ ID №: 1 derives from ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCCNo.M203094 of ketone, and by 1290 based compositions, the open reading frame of this gene (ORF) is from 5 ' end the 1st to the 1290th bit base.
Contain expression carrier of the present invention and clone and all belong to protection scope of the present invention; utilize existing molecular biological method can obtain different expression vectors and clone (engineering bacteria): as, gene e. coli bl21 of the present invention (DE3), intestinal bacteria TOP10 or pichia spp X-33 contained.The above-mentioned engineering bacteria that also available ordinary method will contain gene of the present invention is fixed in the different carriers, the preparation immobilized cell.
L-sorbic ketone dehydrogenase of the present invention can be fixed on the upholders such as agarose, acrylamide, sodiun alginate the preparation immobilized enzyme.
Second purpose of the present invention provides a kind of method of the L-of expression sorbic ketone dehydrogenase.
The method of expression L-sorbic ketone dehydrogenase provided by the present invention, be to be that the encoding gene of the L-sorbic ketone dehydrogenase that obtains of template amplification imports the expressive host bacterium with ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCC of ketone No.M203094 genomic dna, obtain positive colony, cultivate positive colony, express the L-sorbic ketone dehydrogenase.
Wherein, ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCC of ketone No.M203094 genomic dna can extract according to a conventional method.With ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCCNo.M203094 of ketone genomic dna is that a pair of primer of template amplification L-sorbic ketone dehydrogenase gene can be SEQ ID №: 3 and SEQ ID №: 4, SEQ ID №: 5 and SEQ ID №: 6 or SEQ ID №: 7 and SEQ ID №: 8.
Wherein, SEQ ID №: 3 by 26 based compositions, SEQ ID №: 4 by 24 based compositions, SEQ ID №: 5 by 32 based compositions, SEQ ID №: 6 by 24 based compositions, SEQ ID №: 7 by 35 based compositions, SEQ ID №: 8 by 24 based compositions.
Described positive colony can be bacillus coli DH 5 alpha, e. coli bl21 (DE3), intestinal bacteria TOP10 or the pichia spp X-33 that contains L-sorbic ketone dehydrogenase encoding gene.
L-sorbic ketone dehydrogenase of the present invention does not rely on coenzyme NAD, but the existence of coenzyme NAD can improve the transformation efficiency of this enzyme, and this enzyme is 5.0-9.0 with the PH scope that L-sorb ketone is converted into 2-KGA, and the suitableeest is 7.5.
The present invention is by measuring the whole genome sequence of ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCC of ketone No.M203094, through gene annotation, dope and the synthetic relevant key gene-L-sorbic ketone dehydrogenase gene (rSNDH) of the ancient dragon acid of 2-ketone group-L-.It is very low that its dna sequence dna and all known L-sorbic ketone dehydrogenase gene orders are compared homology, translate into albumen Hou Yu Red look non-sulfur bacteria (Rhodobacter sphaeroides) has 68% homology, with pseudomonas syringae SNDH 53% homology is arranged, with rhizobium melioti SNDH 50% homology is arranged, and do not have homology substantially with the SNDH in the bacterium oxidizing glucose acidfast bacilli with another kind of production of vitamin C.All can be with molecular biology method is produced this genetic expression in different carriers and host albumen (enzyme) at the external 2-ketone group-L-ancient imperial sour (2-KGA) that effectively L-sorb ketone is converted into, no matter the SNDH (inclusion body of any formal representation, secretory protein, fusion rotein) all has a SNDH enzymic activity external, simultaneously, carry the E.coli engineering bacteria of rSNDH encoding gene of the present invention and 2-KGA transformed bacteria when cultivating altogether, rSNDH of the present invention significantly improves the transformation efficiency of 2-KGA, and rSNDH encoding gene of the present invention is the key gene during 2-KGA synthesizes.Can utilize the existing 2-KGA of L-sorbic ketone dehydrogenase gene pairs of the present invention to produce bacterium transforms, directive breeding, improve the output of 2-KGA, as being inserted existing 2-KGA, L-sorbic ketone dehydrogenase gene of the present invention or its mutant or fragment produce in the bacterium genome, to strengthen the activity of L-sorbic ketone dehydrogenase, or express L-sorbic ketone dehydrogenase gene of the present invention with molecular biology method, utilize immobilized enzyme method or immobilized cell method at external Synthetic 2-KGA, or the synthetic L-sorbic ketone dehydrogenase gene pairs of the present invention protein of answering is used for the production of 2-KGA, reduces the production cost of 2-KGA, improve the transformation efficiency of 2-KGA, minimizing is to the pollution of environment, reduce the demand of production process to the energy, improve the quality of product.The present invention has important prospects for commercial application.
Description of drawings
Fig. 1 is the electrophoretogram of the pcr amplification product of L-sorbic ketone dehydrogenase gene
Fig. 2 is the SDS-PAGE collection of illustrative plates of L-sorbic ketone dehydrogenase gene expression product in e. coli bl21 (DE3)
Fig. 3 is the SDS-PAGE collection of illustrative plates of L-sorbic ketone dehydrogenase gene expression product in intestinal bacteria TOP10
Fig. 4 is the SDS-PAGE collection of illustrative plates of L-sorbic ketone dehydrogenase gene expression product in pichia spp X-33
The activity curve of the rSNDH of the positive clone of Fig. 5 intestinal bacteria TOP10 amalgamation and expression
The Chelating-SFF chromatography purification result of the rSNDH of the positive clone of Fig. 6 intestinal bacteria TOP10 amalgamation and expression
Fig. 7 is the enzymic activity of rSNDH and the relation curve of pH
Fig. 8 is the rSNDH enzyme reacted for 0 time under the coenzyme existence condition a HPLC collection of illustrative plates
Fig. 9 is the HPLC collection of illustrative plates that the rSNDH enzyme reacted under the coenzyme existence condition 5 hours
Figure 10 is the HPLC collection of illustrative plates of L-sorb ketone and the ancient imperial sour standard substance of 2-ketone group-L-
Figure 11 is not having 5 hours HPLC collection of illustrative plates of reaction under the coenzyme existence condition for the rSNDH enzyme
Figure 12 is that the rSNDH enzyme is at the mass spectrum that does not have under the coenzyme existence condition L-sorb ketone to be converted into 2-KGA
Figure 13 is the mass spectrum of 2-KGA standard substance
Embodiment
The acquisition of embodiment 1, L-sorbic ketone dehydrogenase gene rSNDH
North China Pharmaceutical Group Company Ltd's production of vitamin C ancient imperial sour bacterium (Ketogulonigeniumsp.) WB0104 of bacterial strain ketone CCTCC No.M203094, be used for fermentation method the L-sorbose is converted into the ancient dragon acid of 2-ketone group-L-, the latter is ascorbic important as precursors.Collect ancient imperial sour bacterium (Ketogulonigenium sp.) WB0104 (CCTCC No.M203094) of ketone of logarithmic phase, detect with the HPLC method and to contain the ancient dragon acid of 2-ketone group-L-in its culture supernatant, instrument and reagent used in this HPLC method have: two of Waters 515 high performance liquid phase pumps, Alltech 2000 type ELSD; Acetonitrile (HPLC level); Trifluoroacetic acid (analytical pure); Milli Q plus pure water.The ELSD atomization gas is N
2, flow velocity 2.51/min, 100 ℃ of drift tube temperatures; Chromatographic column is Thermo Quest APS2 4.6mmi.d. * 25cm 5 μ m; Moving phase: acetonitrile-0.1% trifluoroacetic acid aqueous solution (gradient), flow velocity 1.3ml/min.Sample size 20ul.Reference substance: L-sorbose, the ancient dragon acid of 2-ketone group-L.Extract genomic dna with bacterial genomes DNA extraction method (" the fine works molecular biology experiment guide " .39 of Science Press page or leaf), carry out genome sequence by full genome shotgun and measure (Fleischmann RD, Adams MD, et al.Science.1995.269 (5223): 496-512), carry out 35000 reactions altogether; The order-checking total length reaches 18M, is the nearly 6 times fraction of coverage of its chromosomal DNA.Use PHRED-PHRAP then, the GLIMMER software package splices note and carries out the ORF prediction according to the gene annotation result, prediction L-sorbic ketone dehydrogenase gene rSNDH sequence is SEQ ID №: 1, encode one and 68% homology is arranged by 429 amino Yu Red look non-sulfur bacterias (Rhodobacter sphaeroides) SNDH, with pseudomonas syringae SNDH 53% homology is arranged, with rhizobium melioti SNDH 50% homology is arranged, and do not have homology substantially with the SNDH in the bacterium oxidizing glucose acidfast bacilli with another kind of production of vitamin C.
The expression of embodiment 2, L-sorbic ketone dehydrogenase gene rSNDH
1, PET-11B (Strategene) expresses rSNDH
PET11B expresses primer:
5 ' primer: GACATATGAGCGTTCTGGCCAAATTC (SEQ ID №: 3)
3 ' primer: CAGGATCCTTACGCAGCGGAAATC (SEQ ID №: 4)
With ancient imperial sour bacterium (Ketogulonigenium sp.) WB0104 (CCTCC No.M203094) genomic dna of ketone is that template is carried out the PCR reaction, and containing final concentration in the 50 μ l systems is 1.5mmol/L MgCl
2, 0.2mmol/L dNTPs, 5 ' primer and the 3 ' primer of each 0.2 μ mol/L, 10mmol/L Tris-HCl, 2u TaqDNA polysaccharase; The PCR reaction conditions is: 94 ℃ 5 minutes; Carry out 30 circulations then under the following conditions: 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes; 72 ℃ 10 minutes.PCR product electrophoresis result shows that PCR product size is 1.3Kb as shown in Figure 1.Among the figure, molecular weight standard (marker) is followed successively by 250,500,750,1000,1500,2000,2500,3000,3500,4000,5000,6000,8000,10000 from small to large, and a is the PCR product electrophoresis result that PET11B expresses primer.
The PCR product reclaims purifying and pGEM-T-VECTOR T through electrophoresis
4Dna ligase connects, transform DH5 α then, the picking hickie is cut checking with the MINI plasmid extraction column extraction plasmid of QIAGEN and with enzyme, after finding out the pGEM-T-VECTOR-rSNDH plasmid of correct insertion, through NDEI/BAMHI, after enzyme was cut and agarose electrophoresis reclaims 1.3kb, PET11B was connected with expression vector, transform DH5 α, pave plate (containing AMP100 μ g/ml), picking is cloned and is cut evaluation with enzyme, gets positive colony plasmid PET11B-rSNDH.
Extract the plasmid in the positive colony (containing plasmid PET11B-rSNDH), transform and express with host e. coli BL21 (DE3).Choose single colony inoculation 37 ℃ of overnight incubation that in the 5mlLB substratum, (contain AMP100 μ g/ml), be inoculated into by 1% inoculum size and (contain AMP100 μ g/ml) in the 50mlLB substratum and be cultured to OD=0.6-1, add IPTG and induce (final concentration 1.0mmol/L), continue to cultivate 4 hours, centrifugal collection thalline carries out SDS-PAGE and detects, and the result as shown in Figure 2, show at 45000 dalton place to detect specific band, illustrate to detect L-sorbic ketone dehydrogenase expression of gene product.Among the figure, molecular weight standard (marker) two stripe size are respectively 60000,45000; A is for inducing preceding contrast, and b is the rSNDH that induces back PET11B to express, and the arrow indication is the purpose band.
2, PBAD/THIO-TOPO expresses SNDH
PBAD/TOPO THIOFUSION expression system (Invitrogen) is a kind of clonal expression system rapidly and efficiently, the PCR product can be directly used in the clone, handle without ligase enzyme, just can finish in 5 minutes and be connected to carrier and be used for expressing, and adopted THIOREDOXIN TRX Trx to express foreign protein as fusogenic peptide, make foreign protein with soluble activity form expression.Adopt the promotor of PBAD, use pectinose as inductor.
PBAD/THIO-TOPO expresses primer:
5 ' primer: GAGAATTCGATGAGCGTTCTGGCCAAATTCAC (SEQ ID №: 5)
3 ' primer: GATTACGCAGCGGAAATCCGCCAG (SEQ ID №: 6)
The PCR reaction conditions:
94 ℃ 5 minutes, (94 ℃ 1 minute, 59 ℃ 1 minute, 72 ℃ 2 minutes) 30 circulations, 72 ℃ 10 minutes.
The PCR reaction system:
With ancient imperial sour bacterium (Ketogulonigenium sp.) WB0104 (CCTCC No.M203094) genomic dna of ketone is that template is carried out the PCR reaction, and containing final concentration in the 50 μ l systems is 1.5mmol/L MgCl
2, 0.2mmol/L dNTPs, 5 ' primer and the 3 ' primer of each 0.2 μ mol/L, 10mmol/LTris-HCl, 2uTaqDNA polysaccharase.PCR product electrophoresis result shows that PCR product size is 1.3Kb as shown in Figure 1.Among the figure, b is the electrophoresis result that PBAD/THIO-TOPO expresses the primer PCR product.The PCR product directly is connected (clone's process is expressed test kit with reference to INVITORGEN PBAD/TOPO-THIOFUSION) with PBAD/THIO-TOPO, transform TOP10 then, choose single colony inoculation 37 ℃ of overnight incubation that in the 5mlLB substratum, (contain AMP100 μ g/ml), MINI plasmid extraction column with QIAGEN extracts plasmid and cuts checking with enzyme, after finding out the plasmid of correct insertion PBAD-rSNDH, be defined as positive colony.
Choose the positive colony list colony inoculation 37 ℃ of overnight incubation that in the 5mlLB substratum, (contain AMP100 μ g/ml), be inoculated into by 1% inoculum size and (contain AMP100 μ g/ml) in the 50mlLB substratum and be cultured to OD=0.6-1, induce (final concentration 0.02%) with pectinose, continue to cultivate 4 hours, centrifugal collection thalline carries out SDS-PAGE and detects, and the result as shown in Figure 3, show at 57000 dalton place to detect specific band, illustrate to detect L-sorbic ketone dehydrogenase expression of gene product.Among the figure, a is PBAD-rSNDH, and molecular weight standard (marker) is respectively 94000,67000,43000,30000 from big to small; The arrow indication is the purpose band.
3. express SNDH in the pichia spp yeast
(1) L-sorbic ketone dehydrogenase gene imports Yeast expression carrier
Adopt INVITROGEN pichia spp picz alpha expression system, be structured in the expression vector picz α A/SND that expresses rSNDH in the pichia spp.
The design primer is as follows:
5 ' primer: CACTCGAGAAAAGA ATGAGCGTTCTGGCCAAATTC (SEQ ID №: 7)
3 ' primer: CACTCGAGTTACGCAGCGGAAATC (SEQ ID №: 8).
The PCR reaction conditions is as follows:
94 ℃ of 30 circulations then in 3 minutes (94 ℃ 1 minute, 62 ℃ 1 minute, 72 ℃ 2 minutes), 72 ℃ 10 minutes.
With ancient imperial sour bacterium (Ketogulonigenium sp.) WB0104 (CCTCC No.M203094) genomic dna of ketone is that template is carried out the PCR reaction, according to a conventional method the PCR product is connected pGEM-T-VECTOR then, select the hickie bacterium colony after the conversion, the upgrading grain, order-checking is identified.Order-checking is identified correct pGEM-T-rSNDH and picz α A plasmid DNA respectively with after the XHOI processing, and test kit reclaims the fragment of about 1200bp and 3.3kb, uses T
4Dna ligase connects, and connects product and transforms DH5 α competence bacteria, is coated in LB flat board (containing ZEOCIN 25 μ g/ml).Extract plasmid, enzyme is cut evaluation.Select the closure recombinant plasmid picz α A-rSNDH all correct, extract plasmid, be used to transform pichia spp with the QIAGENMIDI plasmid extraction kit with inserting size.
(2) linearizing of recombinant plasmid
Behind recombinant plasmid 20 μ g picz α A-rSNDH usefulness SacI single endonuclease digestion, water is extended to 300 μ l systems, isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting 1 time, on reset and add 1/10 volume 3M NaAc and 2.5 times of volume dehydrated alcohol deposit D NA, after 70% washing with alcohol, vacuum is drained, and is dissolved in 20 μ l TE.
(3) preparation of competence yeast host cell
Inoculation Pichia anomala expression host bacterium X-33 is in 5ml YPD substratum, and 30 ℃ of joltings are spent the night, and forward to next day in the fresh YPD substratum of 500ml, and 30 ℃ of joltings are cultured to A
600nm≈ 1.3-1.5,4 ℃ of centrifugal 5min of 5000rpm abandon supernatant, with ice-cold aqua sterilisa of 500ml, 250ml and the resuspended washing thalline of the ice-cold 1M sorbyl alcohol of 20ml, cell are resuspended in the ice-cold 1M sorbyl alcohol of 1ml respectively, are prepared into competence.
(4) electricity transforms
100 μ l competent cells are mixed with the linearizing recombinant plasmid of 5-10 μ g; change 0.2cm electricity revolving cup over to; ice bath 5min; in Bio-Rad Gene Pulser electroporation 1500V, 25 μ F, electricity transforms under the 200 Ω conditions; add 1ml ice bath 1M sorbyl alcohol immediately; getting 100 μ l coats YPDS and contains ZEOCIN (Invitrogen) 100 μ g/ml and select to hatch 2-3d, transformant to occur for 30 ℃ on the flat board.
(5) the direct PCR of positive colony detects
Inoculation transformant list bacterium colony is in 10 μ l sterilized waters, add 5 μ l lyticases (5U/ μ l), 30 ℃ of jolting 10min, place liquid nitrogen gas phase 1min, the back thaw under the room temperature directly as template, carry out PCR with a pair of detection primer α-Factor and 3 ' AOX1 (Invitrigen easy select Pichia Expression Kit Manual) and detect, the result detects L-sorbic ketone dehydrogenase gene.
(6) express experiment
Inoculation transformant list bacterium colony is cultivated in 50mlBMGY and is cultured to A based on 30 ℃
600nmDuring ≈ 4.0, mend methyl alcohol every day, ammoniacal liquor, abduction delivering 6d, the centrifugal collection supernatant of sample, SDS-PAGE analyzes, and the result shows at 45000 dalton place to detect specific band as shown in Figure 4, illustrates to detect L-sorbic ketone dehydrogenase expression of gene product.Among the figure, the arrow indication is rSNDH, and molecular weight standard is followed successively by 94000,67000,43000,30000,20100.
1, with NAD is coenzyme, enzyme assay
1, with NAD is coenzyme, enzyme assay
(Agric, Biol, Chem, 55,363-370,1991) such as reference literature (Agri.Biol.Chem.54 (5) 1211-1218,1990) and SugiSANA are that substrate, NAD are electron acceptor(EA) with L-sorb ketone, measure the absorbance value at wavelength 340nm place.What set up is substrate with L-sorb ketone, be the enzyme property measuring method while still alive of coenzyme with NAD: primitive reaction liquid is by L-sorb ketone 2.0mg, NAD 0.4mg, PB 50mM, pH7.0 forms, under 25 ℃ of water bath condition, add three kinds of thick each 10ul of enzyme 0.1mg/ml of L-sorbic ketone dehydrogenase (rSNDH) that expression system is expressed among the embodiment 2 respectively, cumulative volume 820ul, positive colony yeast X-33 chooses clear liquid, positive colony e. coli bl21 (DE3) and TOP10 thalline broken wall remove supernatant, measure the velocity of variation of 340nm place photoabsorption, measurement result shows that the rSNDH of various forms expression all has activity, wherein in the activity of the rSNDH of positive colony intestinal bacteria TOP10 amalgamation and expression as shown in Figure 5, show that merging rSNDH has enzyme property while still alive, enzyme activity is 0.1217u/mg.Thick enzymic activity (48.5mu/mg) far above reported in literature.(enzyme activity unit is defined as the required enzyme amount of per minute catalytic reduction 1uMol NAD.Show that after measured this enzyme is 5.0-9.0 with the PH scope that L-sorb ketone is converted into 2-KGA, wherein the suitableeest effect PH is 7.5, as shown in Figure 7.
2.rSNDH vitro conversion to L-sorb ketone
By the Chelating-SFF chromatography rSNDH of positive colony intestinal bacteria TOP10 amalgamation and expression is carried out purifying, wherein chromatography column: 1.6 * 10cm, affine ion: Ni
2+, chromatography condition: 50mM PB damping fluid, pH7.0, imidazoles (Imidazole) gradient.Purification result as shown in Figure 6, the arrow indication is the rSNDH of purifying, molecular weight is about 57000, molecular weight standard is followed successively by 94000,67000,43000,30000,20100.
Carried out the vitro conversion test of rSNDH according to a conventional method, reaction system: damping fluid: 50mMPB, pH8.0, L-sorb ketone: 5mg/ml, rSNDH enzyme: 0.08mg/ml, NAD:0.5mg/ml to L-sorb ketone.37 ℃ were reacted 5 hours, and product 2-KGA is with the quantitative assay of HPLC method, and the result shows that rSNDH is converted into 2-KGA external with L-sorb ketone shown in Fig. 8,9,10 and 11, and the existence of coenzyme NAD improves the transformation efficiency of 2-KGA effectively.The standard substance concentration of 2-KGA is among the figure: 2mg/ml; The standard substance concentration of L-sorb ketone is: 2mg/ml; Under the condition that no coenzyme exists, the generation concentration of 2-KGA is: 0.86mg/ml; Under the condition that has coenzyme to exist, the generation concentration of 2-KGA is: 1.42mg/ml.Wherein no NAD is participated in generation (electron spray ionisation source: ESI, electron spray(ES) voltage: 3.0KV, the electrospray interface dry gas: N of the conversion test of reaction with LS-MS checking 2-KGA
2, flow velocity: 250L/hr, the desolventizing temperature: 190 ℃, collision induced dissociation voltage: 30V, ion source temperature: 120 ℃), the result proves the characteristic absorbance of 2-KGA shown in Figure 12 and 13.
The ancient imperial sour bacterium WB0104 of embodiment 4, the host who expresses rSNDH and ketone cultivates altogether
With the ancient imperial sour bacterium WB0104 kind liquid of cultured ketone and contain or the E.coli TOP10 that do not have a PBAD-rSNDH plasmid mix (10: 1) altogether 3ml (containing L-sorbose 2.0%) be inoculated in the 20ml fermention medium, fermentation flask substratum: L-sorbose 8.0%, yeast extract paste 0.2%, corn steep liquor 2.0%, urea 1.2%, KH
2PO
40.1%, MgSO
4.7H
2O0.01%, light calcium carbonate 0.5%.At 29 ℃, cultivate under the 200rpm condition, measure about ancient imperial acid content, 40h sampling at 24h and survey fermentating liquid volume, measure L-sorbose (anthrone method) and 2-ketone group-L-Gu imperial acid content (HPLC method), determine fermentation termination sample time according to L-sorbose content, and calculate final transformation efficiency.The result is as shown in table 1, shows that the expression of rSNDH significantly improves the transformation efficiency of 2-KGA.
Ancient imperial sour bacterium WB0104 of table 1 ketone and PBAD-rSNDH are to the conversion of L-sorbose
| 24h produces acid (mg/ml) | 40h produces acid (mg/ml) | Terminal point acid (mg/ml) | Residual sugar (mg/ml) | Volume (ml) | Transformation efficiency (%) | Cycle (h) | |
| Ancient imperial sour bacterium WB0104 of ketone and PBAD- |
34.95 | 61.65 | 64.32 | 0.83 | 23.3 | 83.78 | 44 |
| Ancient imperial sour bacterium WB0104 of ketone and PBAD-rSNDH top10 (adding pectinose) at 5h | 36.77 | 63.39 | 67.25 | 0.51 | 23.6 | 88.72 | 43 |
| Ancient imperial sour bacterium WB0104 of ketone and top10 (adding pectinose) at 5h | 33.82 | 60.73 | 63.94 | 0.65 | 23.4 | 83.64 | 44 |
Annotate: the final concentration of pectinose is 0.02%
Sequence table
<160>8
<210>1
<211>1290
<212>DNA
＜213〉the ancient imperial sour bacterium WB0104 (Ketogulonigenium sp.) of ketone
<400>1
atgagcgttc tggccaaatt cacttccatc gtcggcggcg tcatggtgct gctgcgtcgc 60
ggtcagacgc ctgcgcaaca ggcctttggc gcaacgccca gcatcccgcc tgcgcgcgaa 120
cagggcatta tgaccctgaa aatgcccagc gccaaaggct gggagccggg gcacaagccc 180
gtcgccgcac cgggtttgca ggtgaatgcc tatgccatgg gccttgacca tccgcgctgg 240
ctgcatgtgc tggacaatgg cgatgtactg gtggccgaaa gctcgaacaa ggcgcgcaag 300
ccgcgtagtt tcatggatca cgcacaggtc gcgacgatgc gccgtgccgg cgcgctgggc 360
gaaagcgcga accggattac ccgcctgagc gatccggcgg gcacgggcac ggcgagtgat 420
agccgcgtgt tcttgcagga tctgaaccaa cccttcggca tggccgtggt gggggatcgt 480
ttctttgtcg gcaataccga tggtgtggtc gcctttgctt tcgatacggc cacgcagcag 540
gctgttggcg ctggcgccaa actggtggat ttcaaacctg gtggccactg gacacgcagc 600
ctgctggcct cgcaggatgg gcgcaagctc tatgcgggcg tcggttcgct gtcgaatatc 660
ggtgatcaag gtatggaggc cgaagaaggc cgcgccgccg tttgggagct ggatctggac 720
accggcgccg cgcgcatctt tgcgggcggt ctgcgcaatg ccgtcggcct tgcatgggag 780
ccgacgaccg gcgccctctg gaccgtggtg aacgagcgcg acgggctggg cgacgagacc 840
ccgcccgact acctgacatc ggtgcaggac ggcggctttt atggctggcc ctatagctat 900
tgggacaaga tcgtcgatga tcgcgtgccg caagacgcag gcctggtcgc ccgttcgatc 960
acgcccgatt acgcgctggg cgggcatacc gcgtcgctgg gcctgtgctg gatgccagcg 1020
ggcacactgc cggggctgcc ggacgggatg gtgatcggtc agcacggctc atggaaccgc 1080
gcgaaactca gcggctataa ggtggtcttt gtgccgtttg aaaatggccg cccctcgggc 1140
cccagcgtcg atctgctgtc gggctttttg tcggatgatg aaaagcaatc ctatggccgc 1200
ccggtggggg ttgtcgtcgg gccggatcag cgatccattc tggtcgccga tgatgtcggc 1260
aatgcgatct ggcggatttc cgctgcgtaa 1290
<210>2
<211>429
<212>PRT
＜213〉the ancient imperial sour bacterium WB0104 (Ketogulonigenium sp.) of ketone
<400>2
Met Ser Val Leu Ala Lys Phe Thr Ser Ile Val Gly Gly Val Met Val
1 5 10 15
Leu Leu Arg Arg Gly Gln Thr Pro Ala Gln Gln Ala Phe Gly Ala Thr
20 25 30
Pro Ser Ile Pro Pro Ala Arg Glu Gln Gly Ile Met Thr Leu Lys Met
35 40 45
Pro Ser Ala Lys Gly Trp Glu Pro Gly His Lys Pro Val Ala Ala Pro
50 55 60
Gly Leu Gln Val Asn Ala Tyr Ala Met Gly Leu Asp His Pro Arg Trp
65 70 75 80
Leu His Val Leu Asp Asn Gly Asp Val Leu Val Ala Glu Ser Ser Asn
85 90 95
Lys Ala Arg Lys Pro Arg Ser Phe Met Asp His Ala Gln Val Ala Thr
100 105 110
Met Arg Arg Ala Gly Ala Leu Gly Glu Ser Ala Asn Arg Ile Thr Arg
115 120 125
Leu Ser Asp Pro Ala Gly Thr Gly Thr Ala Ser Asp Ser Arg Val Phe
130 135 140
Leu Gln Asp Leu Asn Gln Pro Phe Gly Met Ala Val Val Gly Asp Arg
145 150 155 160
Phe Phe Val Gly Asn Thr Asp Gly Val Val Ala Phe Ala Phe Asp Thr
165 170 175
Ala Thr Gln Gln Ala Val Gly Ala Gly Ala Lys Leu Val Asp Phe Lys
180 185 190
Pro Gly Gly His Trp Thr Arg Ser Leu Leu Ala Ser Gln Asp Gly Arg
195 200 205
Lys Leu Tyr Ala Gly Val Gly Ser Leu Ser Asn Ile Gly Asp Gln Gly
210 215 220
Met Glu Ala Glu Glu Gly Arg Ala Ala Val Trp Glu Leu Asp Leu Asp
225 230 235 240
Thr Gly Ala Ala Arg Ile Phe Ala Gly Gly Leu Arg Asn Ala Val Gly
245 250 255
Leu Ala Trp Glu Pro Thr Thr Gly Ala Leu Trp Thr Val Val Asn Glu
260 265 270
Arg Asp Gly Leu Gly Asp Glu Thr Pro Pro Asp Tyr Leu Thr Ser Val
275 280 285
Gln Asp Gly Gly Phe Tyr Gly Trp Pro Tyr Ser Tyr Trp Asp Lys Ile
290 295 300
Val Asp Asp Arg Val Pro Gln Asp Ala Gly Leu Val Ala Arg Ser Ile
305 310 315 320
Thr Pro Asp Tyr Ala Leu Gly Gly His Thr Ala Ser Leu Gly Leu Cys
325 330 335
Trp Met Pro Ala Gly Thr Leu Pro Gly Leu Pro Asp Gly Met Val Ile
340 345 350
Gly Gln His Gly Ser Trp Asn Arg Ala Lys Leu Ser Gly Tyr Lys Val
355 360 365
Val Phe Val Pro Phe Glu Asn Gly Arg Pro Ser Gly Pro Ser Val Asp
370 375 380
Leu Leu Ser Gly Phe Leu Ser Asp Asp Glu Lys Gln Ser Tyr Gly Arg
385 390 395 400
Pro Val Gly Val Val Val Gly Pro Asp Gln Arg Ser Ile Leu Val Ala
405 410 415
Asp Asp Val Gly Asn Ala Ile Trp Arg Ile Ser Ala Ala
420 425
<210>3
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>3
gacatatgag cgttctggcc aaattc 26
<210>4
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>4
caggatcctt acgcagcgga aatc 24
<210>5
<211>32
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
gagaattcga tgagcgttct ggccaaattc ac 32
<210>6
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
gattacgcag cggaaatccg ccag 24
<210>7
<211>35
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
cactcgagaa aagaatgagc gttctggcca aattc 35
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
cactcgagtt acgcagcgga aatc 24
Claims (14)
1. a L-sorbic ketone dehydrogenase is by SEQ ID № in the sequence table: the protein that 2 amino acid residue sequences are represented.
2. L-sorbic ketone dehydrogenase according to claim 1 is characterized in that: described L-sorbic ketone dehydrogenase is with SEQ ID № in the sequence table: 1 expresses the protein that obtains in host bacterium intestinal bacteria or pichia spp.
3. the encoding gene of a L-sorbic ketone dehydrogenase is one of following nucleotide sequences:
1) the SEQ ID № in the sequence table: 1;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences.
4. contain the described expression carrier of claim 3.
5. the clone that contains the described gene of claim 3.
6. clone according to claim 5 is characterized in that: described cell is intestinal bacteria or the pichia spp that contains L-sorbic ketone dehydrogenase encoding gene.
7. clone according to claim 6 is characterized in that: described cell is an immobilized cell.
8. method of expressing the L-sorbic ketone dehydrogenase, be to be the encoding gene SEQ ID № of the L-sorbic ketone dehydrogenase that obtains of template amplification with ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCC of ketone No.M203094 genomic dna: 1 imports the expressive host bacterium, obtain positive colony, cultivate positive colony, express the L-sorbic ketone dehydrogenase.
9. method according to claim 8 is characterized in that: described is that a pair of primer of template amplification L-sorbic ketone dehydrogenase gene is SEQ ID № in the sequence table with ancient imperial sour bacterium (Ketogulonigenium sp.) the WB0104 CCTCC of ketone No.M203094 genomic dna: 3 and SEQ ID №: 4, SEQ ID №: 5 and SEQ ID №: 6 or SEQ ID №: 7 and SEQ ID №: 8.
10. method according to claim 8 is characterized in that: described positive colony is bacillus coli DH 5 alpha, e. coli bl21 (DE3), intestinal bacteria TOP10 or the pichia spp X-33 that contains L-sorbic ketone dehydrogenase gene.
11. claim 1 or 2 described L-sorbic ketone dehydrogenases are in the application that L-sorb ketone is converted in the 2-KGA process.
12. the encoding gene of the described L-sorbic ketone dehydrogenase of claim 3 is in the application that L-sorb ketone is converted in the 2-KGA process.
13. the described expression vector of claim 4 is in the application that L-sorb ketone is converted in the 2-KGA process.
14. claim 5 or 6 or 7 described clones are in the application that L-sorb ketone is converted in the 2-KGA process.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101168317A CN100395332C (en) | 2003-11-28 | 2003-11-28 | L-sorbosone dehydrogenase, gene encoding same and use thereof |
| PCT/CN2004/001356 WO2005052160A1 (en) | 2003-11-28 | 2004-11-26 | A L-sorbosone dehydrogenase as well as the encoding gene and the use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101168317A CN100395332C (en) | 2003-11-28 | 2003-11-28 | L-sorbosone dehydrogenase, gene encoding same and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1621518A CN1621518A (en) | 2005-06-01 |
| CN100395332C true CN100395332C (en) | 2008-06-18 |
Family
ID=34624439
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2003101168317A Expired - Fee Related CN100395332C (en) | 2003-11-28 | 2003-11-28 | L-sorbosone dehydrogenase, gene encoding same and use thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN100395332C (en) |
| WO (1) | WO2005052160A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE112012002557B4 (en) | 2011-06-20 | 2018-05-09 | Tianjin University | Process for the preparation of 2-keto-L-gulonic acid |
| CN102676552A (en) * | 2012-05-25 | 2012-09-19 | 江南大学 | Novel L-sorbosone dehydrogenase gene and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1120350A (en) * | 1993-03-08 | 1996-04-10 | 藤泽药品工业株式会社 | Novel L-sorbose dehydrogenase and novel L-sorbosone dehydrogenase obtained from gluconobacter oxydans T-100 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5352599A (en) * | 1988-01-14 | 1994-10-04 | Hoffmann-La Roche Inc. | Co-enzyme-independent L-sorbosone dehydrogenase of gluconobacter oxydans: isolation, characterization, and cloning and autologus expression of the gene |
| CN1073155C (en) * | 1994-02-25 | 2001-10-17 | 藤泽药品工业株式会社 | Process for producing 2-keto-L-gulonic acid |
| AU2001251342A1 (en) * | 2000-04-05 | 2001-10-23 | Archer-Daniels-Midland Company | Ketogulonigenium endogenous plasmids |
| WO2003008588A2 (en) * | 2001-07-13 | 2003-01-30 | Basf Aktiengesellschaft | Method for producing 2-keto-l-gulonic acid and vitamin c while using l-sorbose dehydrogenase and l-sorbosone dehydrogenase |
-
2003
- 2003-11-28 CN CNB2003101168317A patent/CN100395332C/en not_active Expired - Fee Related
-
2004
- 2004-11-26 WO PCT/CN2004/001356 patent/WO2005052160A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1120350A (en) * | 1993-03-08 | 1996-04-10 | 藤泽药品工业株式会社 | Novel L-sorbose dehydrogenase and novel L-sorbosone dehydrogenase obtained from gluconobacter oxydans T-100 |
Non-Patent Citations (2)
| Title |
|---|
| Taxonomic characterization of Ketogulonigenium vulgaregen.nov.,sp.nov. and Ketogulon. Urbance JW.Int J Syst Evol Microbiol.,Vol.51 . 2001 |
| Taxonomic characterization of Ketogulonigenium vulgaregen.nov.,sp.nov. and Ketogulon. Urbance JW.Int J Syst Evol Microbiol.,Vol.51 . 2001 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1621518A (en) | 2005-06-01 |
| WO2005052160A1 (en) | 2005-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101357015B1 (en) | Recombinant microorganisms for increased production of organic acids | |
| CN101693896B (en) | Aldehyde dehydrogenase gene | |
| KR102140597B1 (en) | Acid Resistant Yeast Inhibited Ethanol Production and Method for Preparing Lactic Acid Using The Same | |
| CN101748069B (en) | Recombinant blue-green algae | |
| CN104593407A (en) | Pichia stipitis gene expression system as well as construction and application thereof | |
| CN100395332C (en) | L-sorbosone dehydrogenase, gene encoding same and use thereof | |
| CN101085987B (en) | L-sorbinose dehydrogenase and its coding gene and uses | |
| EP0231354B1 (en) | Production of a vitamin c precursor using genetically modified organisms | |
| CA1305438C (en) | Production of a vitamin c precursor using genetically modified organisms | |
| CN102732538B (en) | Novel high-temperature-resisting lipase gene and coding product thereof | |
| CN114736918B (en) | Recombinant escherichia coli for producing salidroside by integrated expression and application thereof | |
| CN102146123A (en) | Gluconobacter oxydans-pyrroloquiniline quinone (PQQ) synthetic protein system and gene cluster for coding same | |
| Lee et al. | Process optimization for large-scale production of TGF-α-PE40 in recombinant Escherichia coli: effect of medium composition and induction timing on protein expression | |
| CN101177686B (en) | Acetonic acid oxidase gene, recombinant expression plasmid and transformation strains thereof | |
| CN109097315B (en) | Genetically engineered bacterium for high-yield lipopeptide and construction method and application thereof | |
| JP2009089649A (en) | Diaphorase gene of clostridium kluyveri and its application | |
| CN104561081A (en) | Expression system of yeast (Candida amazonensis) capable of utilizing xylose | |
| CN114934027B (en) | L-sorbose dehydrogenase mutant capable of improving 2-KLG yield | |
| EP1543135B1 (en) | Process for producing l-ascorbic acid | |
| CN112522231B (en) | Acyltransferase, and coding gene and application thereof | |
| CN110295204B (en) | Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation | |
| CN102108343B (en) | L-idonate dehydrogenase and coding gene and use thereof | |
| CN115161299A (en) | 158-bit mutant aldehyde ketone reductase mutant and application thereof | |
| CN109880809A (en) | A kind of genetic engineering bacterium and preparation method thereof producing low temperature glucose oxidase | |
| KR20200093495A (en) | Acid Resistant Yeast Inhibited Ethanol Production and Method for Preparing Lactic Acid Using The Same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Hebei Welcome Pharmaceutical Co., Ltd. Assignor: Huabei Pharmaceutical Group Co., Ltd.|National Institue For Viral Disease Control and Prevention, Chinese Center For Disease Control and Prevention Contract fulfillment period: 2008.10.24 to 2013.10.24 Contract record no.: 2008990001013 Denomination of invention: L-sorbosone dehydrogenase, gene encoding same and use thereof Granted publication date: 20080618 License type: Exclusive license Record date: 20081030 |
|
| LIC | Patent licence contract for exploitation submitted for record |
Free format text: EXCLUSIVE LICENSE; TIME LIMIT OF IMPLEMENTING CONTACT: 2008.10.24 TO 2013.10.24; CHANGE OF CONTRACT Name of requester: HEBEI WEIERKANG PHARMACEUTICAL CO., LTD. Effective date: 20081030 |
|
| ASS | Succession or assignment of patent right |
Owner name: NORTH CHINA PHARMACUETICAL GROUP NEW DRUG RESEARCH Free format text: FORMER OWNER: NORTH CHINA PHARMACEUTICAL GROUP COMPANY LTD. Effective date: 20090619 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20090619 Address after: No. 388 Heping East Road, Hebei, Shijiazhuang: 050015 Co-patentee after: National Institue For Viral Disease Control and Prevention, Chinese Center For Disease Control and Prevention Patentee after: North China Pharmaceutical Group new drug research and Development Co., Ltd. Co-patentee after: Hebei Welcome Pharmaceutical Co., Ltd. Address before: No. 388 Heping East Road, Hebei, Shijiazhuang: 050015 Co-patentee before: National Institue For Viral Disease Control and Prevention, Chinese Center For Disease Control and Prevention Patentee before: North China Pharmaceutical Refco Group Ltd |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080618 Termination date: 20191128 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |