CN102108343B

CN102108343B - L-idonate dehydrogenase and coding gene and use thereof

Info

Publication number: CN102108343B
Application number: CN2009102653088A
Authority: CN
Inventors: 吴洪涛; 修建新; 杨丽霞; 朱欣杰; 崔永涛; 黄艳敏; 米造吉; 谢萍; 孙君伟; 李锦�; 贾茜
Original assignee: HEBEI WELCOME PHARMACEUTICAL CO Ltd; NCPC New Drug Research and Development Co Ltd
Current assignee: HEBEI WELCOME PHARMACEUTICAL CO Ltd; NCPC New Drug Research and Development Co Ltd
Priority date: 2009-12-29
Filing date: 2009-12-29
Publication date: 2013-03-13
Anticipated expiration: 2029-12-29
Also published as: CN102108343A

Abstract

The invention relates to L-idonate dehydrogenase, which is a protein represented by an amino acid residue sequence SEQ ID No.2 in a sequence table or a protein which is derived from the protein with represented by the SEQ ID No.2 and has 80 percent homology with the protein represented by the SEQ ID No.2 in the sequence table and has the same activity with the protein represented by the SEQ ID No.2. The invention also relates to the coding gene of the L-idonate dehydrogenase, the expression vector and cell line of the coding gene, and the use of the coding gene, the expression vector and the cell line in the process of converting L-sorbose into2-keto-l-gluconic acid (2-KGA).

Description

A kind of L-idose desaturase and encoding gene and application

Technical field

The present invention relates to the genetically engineered field, be specifically related to a kind of L-idose desaturase and encoding gene thereof and expression method, application.

Background technology

Vitamins C is very important and requisite nutritional factor concerning the mankind.Vitamins C also is used for animal-feed, although some farming animals can synthesise vitamins C in health.In the past few decades, from D-Glucose vitamins C has been carried out industrial production by the Reihcstein method of generally acknowledging.Only have a step (D-glucitol is to the conversion of L-sorbose) to be undertaken by microbial transformation in this technique, other step is all undertaken by chemical mode.Ascorbic chemical manufacturing process has many defectives, for example high energy consumption and use in a large number organic and inorganic reagent.Therefore, in the many decades in the past, people studying more economically always and environmental protection produce ascorbic method with microbial transformation.

KGA (2-KGA) is the important intermediate of synthetic xitix (vitamins C).Known have multiple-microorganism L-sorbyl alcohol/sorbose can be converted into 2-KGA, such as used NRRLB-21627 (US Patent No. 5834231) such as Stoddard, the DSM4025 that T.Hoshino etc. mention (European patent EP 9611500.8), (the Chinese patent CN96116464.6) such as SCB329 that Yin Guanglin etc. mention.There is bibliographical information the L-sorbose can be converted into 2-KGA with microorganism, for example, US Patent No. 3907.639 discloses the microorganism that belongs to acetobactor, pseudomonas, Serratia, staphylococcus, gas bacillus, Alcaligenes, Penicillium notatum, candiyeast and gluconic acid bacterium and has had above-mentioned activity of conversion.

The contrast chemical synthesis is produced ascorbic seven step chemical reactions, and fermentation generates 2-KGA by sorbyl alcohol through 2 steps with microorganism, and generating vitamins C through methanol esterification again is the method that present old China hand uses.But used 3 kinds of microorganisms in the fermentation of 2 steps, namely had 2 kinds of microorganisms to participate in by the L-sorbose in the conversion process of 2-KGA, one of them is that conversion L-sorbose is the ketone 2-KLG bacterium of 2-KGA.But ketone 2-KLG bacterium usually separately growth is slower, and the transformation efficiency of 2-KGA is lower, all is to adopt two bacterium symbiosis so industrial production uses at present, such as Bacillus subtilus, bacillus thuringiensis, bacillus megaterium etc. and ketone 2-KLG bacterium co-fermentation.Therefore, in actual production, there is considerable problem, comparatively complicated etc. such as low conversion rate, technology controlling and process.

Summary of the invention

Ketone 2-KLG bacterium is being converted into the L-sorbose in the process of 2-KGA, wherein the key enzyme of 2-KGA bypass metabolism---L-idose desaturase can be converted into 2-KGA the L-idonic acid, this pathways metabolism is disadvantageous for the production of 2-KGA, has reduced the productive rate of 2-KGA.The present invention adopts the method for homologous recombination to replace normal L-idose dehydrogenase gene on the ketone 2-KLG bacterium genome with the L-idose dehydrogenase gene of external sudden change inactivation, gene to coding L-idose desaturase in the ketone 2-KLG bacterium knocks out, make the L-idose dehydrogenase gene permanent deactivation in the Host Strains, blocked the pathways metabolism of 2-KGA to the L-idonic acid, so that the 2-KGA that has produced no longer is metabolised to the L-idonic acid, improved output and the quality of 2-KGA.

One of purpose of the present invention provides a kind of L-idose desaturase and encoding gene thereof.

L-idose desaturase provided by the present invention (rIDH) is to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences or with sequence table in SEQ ID №: 2 amino acid residue sequence has at least 80% homology and has the № with SEQ ID: 2 identical activity by SEQ ID №: 2 protein of deriving.L-idose desaturase molecular weight of the present invention is 35,730 dalton.

Described SEQ ID №: 2 derive from ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S, are comprised of 343 amino-acid residues.Wherein, ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S is preserved in Chinese Typical Representative culture collection center on December 16th, 2009, and (address: Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University), preserving number is CCTCC NO:M209304.

SEQ ID № in described and the sequence table: 2 amino acid residue sequence has at least 80% homology and has the № with SEQ ID: 2 identical activity by SEQ ID №: 2 protein of deriving are preferably the № with SEQ ID: 2 have at least 90% homology and have the № with SEQ ID: 2 identical activity by SEQ ID №: 2 protein of deriving especially are preferably the № with SEQ ID: 2 amino acid residue sequence is through the replacement of one or several amino-acid residue, disappearance or add and have a № with SEQ ID: 2 identical activity by SEQ ID №: 2 protein of deriving.

Described L-idose desaturase can be SEQ ID № in the sequence table: 1 dna sequence dna or with sequence table in SEQ ID №: 1 dna sequence dna with at least 80% homology is expressed the protein that obtains in Host Strains intestinal bacteria or pichia spp.

The encoding gene of L-idose desaturase provided by the invention is one of following nucleotide sequences:

1) the SEQ ID № in the sequence table: 1;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 80% above homology, and coding identical function protein DNA sequence, wherein, be preferably with sequence table in SEQ ID №: 1 dna sequence dna that limits has 90% above homology, and the identical function protein DNA sequence of encoding.

Described SEQ ID №: 1 derives from ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S CCTCC NO:M209304, by 1032 based compositions, the open reading frame of this gene (ORF) is from 5 ' end the 1st to the 1029th bit base.

The expression vector and the clone that contain gene of the present invention all belong to protection scope of the present invention; utilize existing molecular biological method can obtain different expression vectors and clone (engineering bacteria), as contain the e. coli bl21 (DE3) of gene of the present invention.Also the available ordinary method above-mentioned engineering bacteria that will contain gene of the present invention is fixed in the different carriers preparation immobilized cell.

In addition, also available ordinary method is fixed on L-idose desaturase of the present invention on the upholders such as agarose, acrylamide, sodiun alginate, the preparation immobilized enzyme.

Second purpose of the present invention provides a kind of method of the L-of expression idose desaturase.

The method of expression L-idose desaturase provided by the present invention, the encoding gene that is the L-idose desaturase that will obtain take ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S CCTCC NO:M209304 genomic dna as template amplification imports the expressive host bacterium, obtain positive colony, cultivate positive colony, express L-idose desaturase.

Can use cDNA, mRNA or genomic dna as template, use suitable Oligonucleolide primers, for example according to SEQ ID №: 3 and SEQ ID №: 4 nucleotide primer, according to the pcr amplification technology, obtain nucleic acid defined above by nucleic acid amplification, namely with sequence table in SEQ ID №: 1 dna sequence dna that limits has 80% above homology, and the identical function protein DNA sequence of encoding.The nucleic acid of amplification can be cloned into suitable carrier thus, and by dna sequence analysis it is characterized.Wherein, ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S CCTCC NO:M209304 genomic dna, cDNA, mRNA can obtain according to a conventional method.Wherein, SEQ ID №: 3 by 28 based compositions, SEQ ID №: 4 by 28 based compositions.

Described positive colony can be bacillus coli DH 5 alpha, e. coli bl21 (DE3) or the pichia pastoris phaff (Pichia pastoris) that contains L-idose dehydrogenase coding genes.

L-idose desaturase of the present invention depends on coenzyme PMS, and this enzyme belongs to the redox enzyme family, and the PH scope that the L-idonic acid is converted into 2-KGA is 5.0-9.0, and the suitableeest is 7.5.

Particularly, the present invention relates to:

1) a kind of L-idose desaturase, the protein that SEQ ID NO:2 amino acid residue sequence represents in the sequence table, or with sequence table in SEQ ID NO:2 sequence have at least 80% homology and have the № with SEQ ID: 2 identical activity by SEQ ID №: 2 protein of deriving.

2) according to item 1) described L-idose desaturase, be with sequence table in SEQ ID NO:2 sequence have at least 90% homology and have the № with SEQ ID: 2 identical activity by SEQ ID №: 2 protein of deriving.

3) according to item 1) described L-idose desaturase, be SEQ ID № in the sequence table: 1 dna sequence dna or with sequence table in SEQ ID №: 1 dna sequence dna with at least 80% homology is expressed the protein that obtains in Host Strains intestinal bacteria or pichia spp.

4) a kind of encoding gene of L-idose desaturase is one of following nucleotide sequences:

1. the SEQ ID № in the sequence table: 1;

2. SEQ ID № during code sequence is tabulated: the polynucleotide of 2 amino acid residue sequences;

3. with sequence table in SEQ ID №: 1 dna sequence dna has at least 80% homology and coding identical function protein DNA sequence.

5) contain 4) expression vector of described gene.

6) contain 4) clone of described gene.

7) according to item 6) described clone, it is intestinal bacteria or the pichia spp that contains L-idose dehydrogenase coding genes.

8) according to item 7) described clone, it is immobilized cell.

9) a kind of method of expressing L-idose desaturase, the encoding gene that is the L-idose desaturase that will obtain take ketone 2-KLG bacterium CCTCC NO:M209304 genomic dna as template amplification imports the expressive host bacterium, obtain positive colony, cultivate positive colony, express L-idose desaturase.

10) according to item 9) described method, the primer of wherein said amplification step is SEQ ID № in the sequence table: 3 and SEQ ID №: 4.

11) according to item 9) described method, wherein positive colony is bacillus coli DH 5 alpha or the e. coli bl21 (DE3) that contains L-idose dehydrogenase coding genes.

12) clone of the arbitrary described L-of the containing idose dehydrogenase coding genes of expression vector, claim 6～8 of 1～3 arbitrary described L-idose desaturase, the encoding gene of L-idose desaturase claimed in claim 4, the L-of containing idose dehydrogenase coding genes claimed in claim 5 is converted into application in the 2-KGA process at the L-sorbose.

RIDH encoding gene of the present invention is an important gene during 2-KGA synthesizes, can utilize L-idose dehydrogenase gene of the present invention that existing 2-KGA is produced bacterium transforms, directive breeding, improve the output of 2-KGA, as L-idose dehydrogenase gene of the present invention is carried out genetic modification by the method for gene knockout to existing 2-KGA generation bacterium, or express L-idose dehydrogenase gene of the present invention with molecular biology method, utilize immobilized enzyme method or immobilized cell method at external synthetic 2-KGA, or protein corresponding to synthetic L-idose dehydrogenase gene of the present invention is used for the production of 2-KGA, the production cost of reduction 2-KGA, improve the transformation efficiency of 2-KGA, minimizing is to the pollution of environment, reduce production process to the demand of the energy, improve the quality of product.

The present invention measures by the whole genome sequence to ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S CCTCCNO:M209304, through gene annotation, dope the enzyme gene synthetic relevant with KGA-L-idose dehydrogenase gene.All can be at the external KGA (2-KGA) that effectively the L-idonic acid is converted into molecular biology method produces this genetic expression in different carriers and host albumen (enzyme), no matter the L-idose desaturase (occlusion body of any formal representation, secretory protein, fusion rotein) all has a L-idose dehydrogenase activity external.On the other hand, the present invention utilizes molecular biology method, the L-idose dehydrogenase gene of ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome SCCTCC NO:M209304 is knocked out, and the genetic engineering bacterium that makes up is carried out the upper tank of small-scale test, corresponding to starting strain, the transformation efficiency of 2-KGA has improved 1-2%.

Description of drawings

Fig. 1 is the electrophoretogram of the pcr amplification product of L-idose dehydrogenase gene, and wherein, 1 is L-idose dehydrogenase gene PCR product, 2 is 1kb ladder, and molecular weight standard (marker) is followed successively by 250bp, 500bp from small to large, 750bp, 1000bp, 1500bp, 2000bp, 2500bp, 3000 bp, 3500bp, 4000bp, 5000bp, 6000bp, 8000bp, 10000bp.

Fig. 2 is the SDS-PAGE collection of illustrative plates of L-idose dehydrogenase gene expression product in e. coli bl21 (DE3), wherein, from left to right: 1,2,3,4,5,7,8 for expressing with e. coli bl21 (DE3) (containing plasmid PET-39b-IDH) full cell lysate SDS-PAGE electrophoretic band after inducing; 6 molecular weight standards of attaching most importance to; 9,10 for inducing front full cell lysate SDS-PAGE electrophoretic band.

Fig. 3 is the SDS-PAGE electrophoretogram of Chelating-SFF chromatography after to the rIDH purifying of positive colony e. coli bl21 (DE3) amalgamation and expression, wherein, the 1 molecular weight Marker that attaches most importance to, 2 is 40% (NH ₄) ₂SO ₄Precipitation, 3 was the thick pure enzyme of affinity column.

Fig. 4 is the electrophoretogram that L-idose dehydrogenase gene knocks out pcr amplification product, and wherein, 1 knocks out the PCR product for L-idose dehydrogenase gene, 2 is 1kb ladder, and molecular weight standard (marker) is followed successively by 250bp, 500bp from small to large, 750bp, 1000bp, 1500bp, 2000bp, 2500bp, 3000bp, 3500bp, 4000bp, 5000bp, 6000bp, 8000bp, 10000bp.

Fig. 5 identifies collection of illustrative plates for realizing the bacterium colony PCR that L-idose dehydrogenase gene knocks out, and the point sample order from left to right is 32,35,39,40,41,45,50,98, positive control, ketone 2-KLG bacterium genome, negative control, 1Kb ladder.

Embodiment

The molecular biology that the present invention uses operates general bacterial strain, be such as bacillus coli DH 5 alpha, e. coli bl21 (DE3) and pichia pastoris phaff (Pichia pastoris) etc. commercial, pGEM-T-VECTOR, T ₄Dna ligase is available from Promega company, and expression vector PET-39b is available from Strategene company, and other organic and inorganic chemical reagent is commercial.

The acquisition of embodiment 1L-idose dehydrogenase gene

Collect ketone 2-KLG bacterium (Ketogulonogenium vulgarum) the Welcome S (CCTCC NO:M209304) of logarithmic phase, with bacterial genomes DNA extraction method (fine works molecular biology experiment guide, the third edition, F. the work such as Ao Sibai, Science Press, 1998, the 39th page) the extraction genomic dna, carry out genome sequence determination (Fleischmann RD by full genome shotgun, Adams MD, etal.Science.1995.269 (5223): 496-512), carry out altogether 35000 reactions; The order-checking total length reaches 18M, is the nearly 6 times fraction of coverage of its chromosomal DNA.Then use PHRED-PHRAP, GLIMMER software package splicing note, and carry out the ORF prediction.According to the gene annotation result, prediction L-idose dehydrogenase gene sequence is SEQ ID №: 1.

The expression of embodiment 2L-idose dehydrogenase gene

1, PET-39b (Strategene) expresses rIDH

PET-39b expresses primer:

5 ' primer: catatgAAAGCCATTGTCATCCATGCCG (SEQ ID №: 3)

3 ' primer: ctcgagGGCAAAGGCGATCTGCGTCTTG (SEQ ID №: 4)

Carry out the PCR reaction take ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S (CCTCC NO:M209304) genomic dna as template, contain the MgCl2 that final concentration is 1.5mmol/L in the 50 μ l systems, 0.2mmol/L dNTPs, 5 ' primer and the 3 ' primer of each 0.2 μ mol/L, the Tris-HCl of 10mmol/L, the TaqDNA polysaccharase of 2u; The PCR reaction conditions is: 94 ℃ 5 minutes; Then carry out under the following conditions 30 circulations: 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes; 72 ℃ 10 minutes.PCR product electrophoresis result shows that PCR product size is 1.032Kb as shown in Figure 1.

The PCR product reclaims purifying through electrophoresis, with pGEM-T-VECTOR T ₄Dna ligase connects, then transform bacillus coli DH 5 alpha, the picking hickie, MINI plasmid extraction post with QIAGEN extracts plasmid and cuts checking through the NdeI/XhoI enzyme, after finding out the pGEMT-IDH plasmid of correct insertion, cut and after agarose electrophoresis reclaims the gene fragment of 1.032kb through the NdeI/XhoI enzyme, PET-39b is connected with expression vector, transform bacillus coli DH 5 alpha, pave plate (containing AMP100g/ml), picking is cloned and is cut evaluation with the NdeI/XhoI enzyme, gets positive colony plasmid PET-39b-IDH.

Extract plasmid PET-39b-IDH, transform e. coli bl21 (DE3).Choose single colony inoculation 37 ℃ of overnight incubation that in the 5mlLB substratum, (contain Kan 100 μ g/ml), be inoculated into by 1% inoculum size and (contain Kan 100 μ g/ml) in the 50mlLB substratum and be cultured to OD ₆₀₀=0.6-1 adds IPTG and induces (final concentration 1.0mmol/L), continues to cultivate 4 hours, and centrifugal collection thalline carries out SDS-PAGE and detects, and the result as shown in Figure 2.Show at 36828 dalton place to detect specific band, the expression product that detects L-idose dehydrogenase gene is described.

The functional verification of embodiment 3L-idose desaturase

1, enzyme assay

(Agric, the Biol such as reference literature (Agri.Biol.Chem.54 (5) 1211-1218,1990) and SugiSANA, Chem, 55,363-370,1991), utilize the enzymic activity of the method detection L-idose desaturase of spectrophotometric determination absorbancy.Foundation is with 2-KGA, D-glucitol, the L-sorbose is substrate, activity determination method take DCIP as developer: in first EP pipe, the reaction soln that adds 1ml, the DCIP (2 that comprises 0.1mM, 6-dichlorophenol indophenol, 2.6-Dichlorophenol indophenol), 0.1mM PMS (phenazine methosulphate, phenazine methosulfate), the substrate of 125mM, the Tris-HCLbuffer of 50mM (pH8.0), 10 μ l enzymes (affinity chromatography is slightly pure), comprise other all reactants except substrate in second pipe, return to zero during in order to Spectrophotometric Assays.First pipe adds enzyme at last, adds latter two pipe and carries out simultaneously at once spectrophotometric analysis, and the reading by the first pipe obtains enzymic activity numerical value.After measured, the result is as shown in table 1, and L-idose desaturase is corresponding to 2-KGA, D-glucitol, L-sorbose substrates enzymes active respectively 30.6units/mg, 0units/mg, 0units/mg.1 unit of enzyme is defined as the enzyme amount of catalysis 1 μ mol DCIP in 1 minute.

The activity of the rIDH of table 1 positive colony e. coli bl21 (DE3) amalgamation and expression

2, rIDH is to the vitro conversion of 2-KGA

By the Chelating-SFF chromatography rIDH of positive colony e. coli bl21 (DE3) amalgamation and expression is carried out purifying, purification result as shown in Figure 3, the rIDH molecular weight of purifying is about 36828 dalton, and molecular weight standard is followed successively by 94000,67000,43000,30000,20100.During purifying, balance liquid is the Tris-HCL of 50mM, the NaCl of 100mM; Elutriant is the Tris-HCL of 50mM, the NaCl of 100mM, the imidazoles of 500mM.The thalline of centrifugal collection is resuspended with balance liquid, carrying out ultrasonic bacteria breaking, and ultracentrifugation is collected supernatant, upper prop.Be not adsorbed onto impurity on the affinity adsorbent with balance elutriant flush away after the loading, by wash-out, namely imidazole concentration is 100mM to target protein when 20% elutriant concentration.

Carried out according to a conventional method the vitro conversion test of rIDH to 2-KGA, reaction system: damping fluid: 50mMTris-Hcl, pH8.0, coenzyme (PMS, NAD): 0.5mg/ml, substrate are respectively 2-KGA, D-glucitol, L-sorbose, add respectively the ultrasonic liquid that fermentation restructuring L-idose desaturase is expressed thalline in reaction system, the centrifugal supernatant of ultrasonic liquid is slightly carried the rIDH enzyme.30 ℃ were reacted 4 hours, with the quantitative assay of HPLC method, the result is as shown in table 2, shows the ultrasonic liquid of fermentation restructuring L-idose desaturase expression thalline, the centrifugal supernatant of ultrasonic liquid is slightly carried the rIDH enzyme external equal can in the situation that coenzyme PMS, NAD exist 2-KGA the conversion.D-glucitol, L-sorbose then there is not catalytic activity.

Table 2rIDH is to the vitro conversion of 2-KGA, D-glucitol and L-sorbose

Knocking out of embodiment 4L-idose dehydrogenase gene

The gene knockout primer:

5 ' primer: ggatccCCTCTAGATAATTGCTGACCG (SEQ ID №: 5)

3 ' primer: aagcttGGTTCTGGCATAAGATTTTGGC (SEQ ID №: 6)

Carry out the PCR reaction take ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S (CCTCC NO:M209304) genomic dna as template, contain the MgCl that final concentration is 1.5mmol/L in the 50 μ l systems ₂, the dNTPs of 0.2mmol/L, 5 ' primer and the 3 ' primer of each 0.2 μ mol/L, the Tris-HCl of 10mmol/L, the TaqDNA polysaccharase of 2u; The PCR reaction conditions is: 94 ℃ 5 minutes; Then carry out under the following conditions 30 circulations: 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 3 minutes; 72 ℃ 10 minutes.PCR product electrophoresis result shows that PCR product size is 3.174Kb as shown in Figure 4.

The PCR product is used T through electrophoresis recovery purifying and PMD18 (Dalian is precious biological) ₄Dna ligase connects, then transform DH5 α, the picking hickie, MINI plasmid extraction post with QIAGEN extracts plasmid, and cut checking with the BamHI/HindIII enzyme, after finding out the PMD18-IDH-kick plasmid of correct insertion, cut and agarose electrophoresis recovery 3.174Kb gene fragment through the BamHI/HindIII enzyme.Be connected with the plasmid pSY18mob after cutting through the BamHI/HindIII enzyme, transform DH5 α, pave plate (containing Kan50 μ g/ml), picking is cloned and is cut evaluation with the BamHI/HindIII enzyme, gets positive colony plasmid pSY18mob-IDH-kick.Resulting positive plasmid after cutting with the NaeI enzyme, downcuts the 1.067Kb band, and agarose electrophoresis reclaims 7.828 bands.Reclaim product T ₄Dna ligase carries out then transforming bacillus coli DH 5 alpha from connecting, and the picking hickie is paved plate (containing Kan50 μ g/ml), and picking is cloned and cut evaluation with the BamHI/HindIII enzyme, gets positive colony plasmid pSY18mob-IDH-kick-NaeI.

Preparation ketone 2-KLG bacterium (Ketogulonogenium vulgarum) Welcome S (CCTCC NO:M209304) electricity turns competence: the inoculum size inoculation ketone 2-KLG bacterium glycerine pipe with 1% is in the 50mlLB substratum, 200rpm shakes and spends the night, to logarithmic growth middle and later periods OD ₆₀₀=0.3.Bacterial classification after the activation is equally with 1% inoculum size, and transferred species is in the 200mlLB substratum, and overnight incubation is to logarithmic growth OD in mid-term ₆₀₀About=0.2.Collect thalline, wash 2 times, 10% glycerine is washed the glycerine that is resuspended in 1ml 10% after 1 time.Get the 40ul bacteria suspension, add 1ug pSY18mob-IDH-kick-NaeI plasmid, carry out electricity and transform.Add the 1mlSOC substratum after the electric shock, activate after 2 hours, be coated with flat board (containing Kan50 μ g/ml), grew about 7 days, obtain positive colony.

Well-grown clonal expansion is cultivated on the picking resistant panel, carry out the deadly experiment of sucrose, screening realizes the ketone 2-KLG bacterium of secondary exchange, be the ketone 2-KLG bacterium of realizing gene knockout to the Kan sensitivity and to the insensitive bacterial strain of sucrose, and utilize the method for PCR to verify that electrophoresis result is seen Fig. 5.

Embodiment 5 fermentation tests

Ketone 2-KLG bacterium after L-idose dehydrogenase gene knocks out on a small scale (2L) upper tank experiment shows, with respect to starting strain, the output increased of 2-KGA about 2.2%, see Table 3.

Ketone 2-KLG bacterium and starting strain fermenting experiment result after table 3L-idose dehydrogenase gene knocks out

Tank has confirmed to operate by the novel gene of molecular biology method to this patent on the small-scale, can be used in the production of 2-KGA, reduces the production cost of 2-KGA, improves the transformation efficiency of 2-KGA, reduces production process to the demand of the energy.

Sequence table

＜110〉North China Pharmacuetical Group New Drug Research ﹠ Development Co., Ltd

＜120〉a kind of L-idose desaturase and encoding gene and application

<160>6

<210>1

<211>1032

<212>DNA

＜213〉ketone 2-KLG bacterium Welcome S (Ketogulonogenium vulgarum)

<400>1

atgaaagcca ttgtcatcca tgccgcgcat gacctgcgcg ttgaagatcg ccccgacgag 60

gccgtcggcg cgggccaggt gaaaatcgcc cttgccgcag gcgggatctg tggatcggat 120

ctgcattatt acaaccacgg cggtttcggc gcggtgcgcc tgcgcgagcc gatggtgctg 180

gggcatgagg tttccggcca tatcaccgaa ctgggcgcgg gtgtcgccgg ccttgcggtg 240

ggcgatctgg tggcggtctc gccctcgcgc ccctgcgggt cctgtgccta ttgttatgaa 300

gggctgccga atcattgtct gaatatgcgc ttttacggct cggccatgcc attcccgcat 360

attcagggcg cgttccgcca agtgctggtc gccgatgcca gtcaatgtgc gcgggccgag 420

ggcttgagcg caggcgaggc tgcgatggcc gaaccgctcg cggtctgcct gcatgccaca 480

cggcgcgcgg gtgatctggt cggcaaacgc gtgctggtga caggctgcgg cccgattggc 540

ctcctctcga tcctggccgc ccgacgcgca ggcgcggccg agattgttgc cgtcgatatc 600

tcggatttca cgctgcaaat ggcgcgccgt gtgggcgcgg atgtgacggt caatacggcg 660

accgaccctg atggcctgac gggttttgcc gcgggcaagg gcacgttcga cgtgctatac 720

gaatgcaccg gcgtcgccgc cgccgtcatt ccagcgattg cgacgatgcg cccgcgcggg 780

atcattatgc aactgggtct gggcggcgat atggcgctgc cgatggtgat gctgacgtcc 840

aaggaactcg acctgcgcgg ctcgttccgc tttcacagcg agttcgccat cggcgtcgat 900

ctgatgcgca aggggttgat cgacgtcaag ccgctgatca ccgccacctt gccactggat 960

caggccgagg ctgcgtttcg cctggccgcc gaccgtagcc aagcgatcaa gacgcagatc 1020

gcctttgcct ga

<210>2

<211>343

<212>PRT

＜213〉ketone 2-KLG bacterium Welcome S (Ketogulonogenium vulgarum)

<400>2

Met Lys Ala Ile Val Ile His Ala Ala His Asp Leu Arg Val Glu Asp

1 5 10 15

Arg Pro Asp Glu Ala Val Gly Ala Gly Gln Val Lys Ile Ala Leu Ala

20 25 30

Ala Gly Gly Ile Cys Gly Ser Asp Leu His Tyr Tyr Asn His Gly Gly

35 40 45

Phe Gly Ala Val Arg Leu Arg Glu Pro Met Val Leu Gly His Glu Val

50 55 60

Ser Gly His Ile Thr Glu Leu Gly Ala Gly Val Ala Gly Leu Ala Val

65 70 75 80

Gly Asp Leu Val Ala Val Ser Pro Ser Arg Pro Cys Gly Ser Cys Ala

85 90 95

Tyr Cys Tyr Glu Gly Leu Pro Asn His Cys Leu Asn Met Arg Phe Tyr

100 105 110

Gly Ser Ala Met Pro Phe Pro His Ile Gln Gly Ala Phe Arg Gln Val

115 120 125

Leu Val Ala Asp Ala Ser Gln Cys Ala Arg Ala Glu Gly Leu Ser Ala

130 135 140

Gly Glu Ala Ala Met Ala Glu Pro Leu Ala Val Cys Leu His Ala Thr

145 150 155 160

Arg Arg Ala Gly Asp Leu Val Gly Lys Arg Val Leu Val Thr Gly Cys

165 170 175

Gly Pro Ile Gly Leu Leu Ser Ile Leu Ala Ala Arg Arg Ala Gly Ala

180 185 190

Ala Glu Ile Val Ala Val Asp Ile Ser Asp Phe Thr Leu Gln Met Ala

195 200 205

Arg Arg Val Gly Ala Asp Val Thr Val Asn Thr Ala Thr Asp Pro Asp

210 215 220

Gly Leu Thr Gly Phe Ala Ala Gly Lys Gly Thr Phe Asp Val Leu Tyr

225 230 235 240

Glu Cys Thr Gly Val Ala Ala Ala Val Ile Pro Ala Ile Ala Thr Met

245 250 255

Arg Pro Arg Gly Ile Ile Met Gln Leu Gly Leu Gly Gly Asp Met Ala

260 265 270

Leu Pro Met Val Met Leu Thr Ser Lys Glu Leu Asp Leu Arg Gly Ser

275 280 285

Phe Arg Phe His Ser Glu Phe Ala Ile Gly Val Asp Leu Met Arg Lys

290 295 300

Gly Leu Ile Asp Val Lys Pro Leu Ile Thr Ala Thr Leu Pro Leu Asp

305 310 315 320

Gln Ala Glu Ala Ala Phe Arg Leu Ala Ala Asp Arg Ser Gln Ala Ile

325 330 335

Lys Thr Gln Ile Ala Phe Ala

340

<210>3

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

catatgaaagccattgtcatccatgccg 28

<210>4

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

ctcgagggcaaaggcgatctgcgtcttg 28

<210>5

<211>27

<212>DNA

＜2l3〉artificial sequence

<220>

<223>

<400>5

ggatcccctctagataattgctgaccg 27

<210>6

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>6

aagcttggttctggcataagattttggc 28

Claims

1. a L-idose desaturase is the protein that SEQ ID NO:2 amino acid residue sequence represents in the sequence table.

2. L-idose desaturase according to claim 1 is that the dna sequence dna shown in the SEQ ID NO:1 is expressed in Host Strains intestinal bacteria or pichia spp and obtained in the sequence table.

3. the encoding gene of a L-idose desaturase is the polynucleotide of SEQ ID NO:2 amino acid residue sequence in the code sequence tabulation.

4. the encoding gene of L-idose desaturase according to claim 3 is the dna sequence dna shown in the SEQ ID NO:1 in the sequence table.

5. the expression vector that contains the described gene of claim 3.

6. the clone that contains the described gene of claim 3.

7. clone according to claim 6, it is intestinal bacteria or the pichia spp that contains the encoding gene of the described L-idose of claim 3 desaturase.

8. clone according to claim 7, it is immobilized cell.

9. method of expressing L-idose desaturase, that the dna sequence dna shown in the SEQ ID NO:1 imports the expressive host bacterium in the sequence table that will obtain take ketone 2-KLG bacterium CCTCC NO:M209304 genomic dna as template amplification, obtain positive colony, cultivate positive colony, express L-idose desaturase.

10. method according to claim 9, the primer of wherein said amplification step is SEQ ID NO:3 and SEQ ID NO:4 in the sequence table.

11. method according to claim 9, wherein positive colony is bacillus coli DH 5 alpha or the e. coli bl21 (DE3) that contains the dna sequence dna shown in the SEQ ID NO:1 in the ordered list.

12. block the method that 2-KGA is converted into the L-idonic acid, improves 2-KGA output for one kind, it is characterized in that: at first, the encoding gene of the L-idose desaturase shown in SEQ ID NO:1 in the sequence table in the ketone 2-KLG bacterium CCTCC NO:M209304 genome nucleotide sequence is knocked out, obtain the genetic engineering bacterium that L-idose dehydrogenase gene knocks out; Then, the genetic engineering bacterium that this L-idose dehydrogenase gene is knocked out is used for the fermentative production of 2-KGA.