CA3175648A1 - Method and portable device for detection of nucleic sequences in suspected coronavirus samples - Google Patents

Abstract

Present invention refers to method and portable device(1) for detection and identification of specific sequences of nucleic acids in different samples, by utilisation of reverse transcription technique and/or isothermal amplification, using specific oligonucleotide primers of target region(s) to detect, whereby the amplification of the same is conducted in indirect and non- specific form, or direct and specific, using discriminatory amplification reagents, which signal, colourimetric/fluorescent, is recorded by device (1) where reaction is carried out. Device is controlled by a mobile application(9), also recording data acquired by device (1) analyses, stores it in remote server in cloud (10), which analyses global set of all data allowing global analysis of for example, evolution of epidemics. Invention is useful for detection and identification of relevant nucleic sequences for different types of diagnostic in different clinical, pharmaceutical, veterinary, food, environmental, biotechnological, biosafety areas, particularly useful in quick, low-cost diagnostics, and at point of care, of SARS-CoV-2 virus.

Description

2 METHOD AND PORTABLE DEVICE FOR DETECTION OF NUCLEIC
SEQUENCES IN SUSPECTED CORONAVIRUS SAMPLES
Technical domain of the invention The present invention refers to a method and a portable device for the detection and identification of specific nucleic acids sequences in different types of samples, by means of an optimised reverse transcriptase technique and/or isothermal amplification, using specific oligonucleotide primers of the target region(s) to detect, whereby the amplification of the same is conducted in an indirect and non-specific manner, or direct and specific, using discriminatory amplification reagents, which signal, colourimetric or fluorescent, is recorded by a portable device where the reaction is carried out, having useful application for different types of diagnostics in different clinical, pharmaceutical, veterinary, food, environmental, biotechnological, or biosafety areas.
Background of the invention The polymerase chain reaction (PCR) is a common and indispensable technique for clinical molecular biology laboratories, allowing one or more copies of a DNA segment to be exponentially amplified, generating millions of copies of a determined DNA sequence. The technique depends on thermal cycles, involving the exposure of the reagents to repeated heating and cooling cycles, which also demands the use of expensive and sophisticated equipment to reach said cycles in a controlled and reproducible manner. Since its invention, this technique has evolved considerably, allowing increasingly broad applications. One of these advances was the development of the real-time PCR which allows the analysis of the PCR
growth curve in real time, based on the monitoring of the exponential production of the PCR product. For the referred quantitative monitoring, there are two main approaches: (i) indirect, which resorts to the use of a double-stranded DNA
intercalating dye which fluorescence increases with the replication of the double strands of the DNA however, in a non-specific manner; and (ii) direct, which uses the incorporation of: a TaqMan probe, based on the activity of :0 5' nuclease of the polymerase and which nowadays is the basis for many homogenic qualitative and quantitative tests; or a hairpin probe, taking advantage of the separation between fluorophore and quencher caused by the specific hybridisation of the probe with the amplified target.
However, the diagnostics by means of the normal or real-time PCR suffers from limitations which prohibits it from being applied to Point-of-Care diagnostics (PoC). Namely, they require specialised and costly staff and equipment, take several hours to provide a result and are easily susceptible to being inhibited by contaminants that are frequently present in the samples to be analysed (such as, for example, haemoglobin, salts, chelators, alcohols, among others) this being the main reason for the failure in amplification even in the presence of sufficient copies of target nucleic acid to amplify, leading to false negatives.
Particularly, the real-time PCR technology adds the limitation that a multiplex reaction is limited to the detection capacity of the apparatus, and further, that a high technical and knowledge capacity are needed to develop a new test, which is not available in a commercial kit.
In view of these limitations, several groups have developed alternative technologies for amplification of nucleic acids as a manner to overcome the limiting steps of the PCR and real-time PCR.

3 In this sense, the development of a reverse transcription process and isothermal amplification, as described in the present invention, reveals itself to be particularly interesting, since it can facilitate the integration in simple systems for diagnostics in points of interest, for example, medical clinics or places with less financial means (PoC devices). As a rule, the isothermal amplification techniques are based on polymerases with higher tolerance to inhibitors, which usually inhibit the :0 PCR, making the reaction more robust. On the other hand, when using an isothermal temperature, the apparatuses that carry out the reaction become less complex and less costly.
For example, the portable device of this invention is a fraction (<1/200) of the cost of a real-time PCR device.
Isothermal amplification technologies Currently there are a series of isothermal amplification techniques.
-> Loop-mediated isothermal amplification (LAMP) LAMP is a DNA amplification technique. The RT-LAMP
combines LAMP with a reverse transcription step to allow RNA
detection. This technique is isothermal, being executed at a constant temperature and does not require a thermal cycler.
In LAMP the target sequence is amplified at a constant temperature of 60-65 C using several sets of oligonucleotide primers and a polymerase with high strand-displacement, as well as the replication capacity. The amplified product can be detected by photometry, measuring the turbidity caused by the precipitate in solution, which is produced as a secondary product of the amplification, or by colour change of pH
sensitive dye, which varies as a consequence of the polymerase activity during the amplification. This allows detection of the amplification to the naked eye with a simple apparatus. The reaction can be detected in real time

4 measuring the turbidity or by fluorescence, using for such intercalating fluorophores such as SYTOTm 9. Other fluorophores such as SYBRTM green can be used to create a visible colour change without the need for expensive detection equipment. As the fluorophore molecules intercalate with the DNA, there is a correlation with the amplification of the same, therefore the LAMP can be quantitative.
LAMP is a relatively new DNA amplification technique :0 that due to its simplicity and low cost can bring several benefits. LAMP can be used in field studies and PoC tests.
The LAMP technique has shown more robust results regarding the inhibitors of the normal PCR reactions in blood samples, which allows the application of the technique in cases where the optimum extraction of DNA and RNA is not possible.
In terms of limitations, LAMP is less versatile than PCR since, although it is primarily useful as a detection tool, it does not allow all the other molecular biology techniques of PCR. Since LAMP uses 4 to 6 target regions for the oligonucleotide primers it is also extremely difficult to design oligonucleotide primers for the technique. One of the consequences of such a cocktail of oligonucleotide primers is the increase in non-specific amplifications, and consequent false positives, which by using a DNA strand-displacement polymerase without exonuclease activity does not allow the use of Taqman probes, for example, nor do the indirect methods allow said false positives to be discriminated. However, in the present invention, the use of specific oligonucleotide probes marked with fluorescence so that they have self-quenching which is cancelled when the hybridisation with the loop zones of the amplification product of the LAMP reaction allows us to monitor in a specific manner the sample amplification and thus avoid the false positives that are common in this technique.

Helicase-Dependent Amplification (HDA) HDA uses a helicase enzyme to generate single-stranded templates for hybridisation of oligonucleotide primers and subsequent extension of the oligonucleotide primer by a

5 polymerase. Apart from not requiring a thermal cycler, the HDA offers several advantages over other isothermal DNA
amplification methods, having a simple reaction scheme and being an isothermal reaction, which can be carried out at a single and constant temperature during the entire process.
These properties offer a great potential for the development of simple portable devices for DNA diagnostic to be used in loco and in PoC.
The prior optimisation of the oligonucleotide primers and the buffers is necessary for execution of the protocol.
Usually, this optimisation is made by PCR, leading to the need to use a separate system to carry out the real amplification.
Despite the great advantage of HDA in not requiring a thermal cycler, and therefore, allowing the research to be carried out outside the laboratory, a large part of the work required to detect potentially dangerous microorganisms is carried out in the environment of a research laboratory/hospital. Currently, the mass diagnostics of a large number of samples cannot be reached by HDA, while the PCR reactions carried out in a thermal cycler that can contain plates of samples from several wells allow the amplification and detection of the intended target DNA a from a maximum of 96 samples at a time. The cost of purchasing reagents for HDA is also relatively expensive in comparison with the reagents for the PCR reagents (Vincent M et al (2004) EMBO, 5(8):795-800. Veltkamp HW et al (2020) Micromachines (Basel) 11(3):238; Patent US7282328B2).
)=. Rolling Circle Amplification (RCA)

6 RCA is a unidirectional nucleic acid replication process that can rapidly synthesize multiple copies of circular molecules of DNA or RNA, such as plasmids, the genomes of bacteriophages and the circular RNA genome of viruses.
RCA was developed as a simplified version of the Rolling Circle Replication, an isothermal DNA amplification technique. The RCA mechanism is widely used in molecular biology and biomedical nanotechnology, particularly in the :0 field of biosensing (as a method for signal amplification).
RCA was used successfully to detect the existence of viral and bacterial DNA from clinical samples, which is extremely beneficial for the rapid diagnostic of infectious diseases.
It was also used as a method for on-chip signal amplification, for nucleic acid microarrays (both for DNA as for RNA). The RCA technique can also be applied to the construction of DNA nanostructures and DNA hydrogels. The RCA products can also be used as templates for periodic assembly of nano species or proteins, synthesis of metallic nanowires and formation of nano-islands.
RCA is a highly versatile DNA amplification tool, widely used in many fields where the limitations of sensitivity and/or specificity, preparation of laborious samples and/or signal amplification procedures had previously prevented the use of other tools.
Up until now, the vast majority of research in RCA is focused on biotechnology and biology applications. However, it seems reasonable that the methodology also finds an increasing use in nanotechnology, since many DNA and RNA
nanostructures require relatively large or long repetitive structures.
Strand Displacement Amplification (SDA)/Multiple Displacement Amplification (MDA)

7 MDA and SDA are DNA amplification techniques without resorting to PCR. These methods can rapidly amplify minimum DNA sample quantifies sufficient for a genomic analysis. The reaction starts by annealing random hexamer oligonucleotide primers to the template: the DNA synthesis is carried out by a high-fidelity enzyme at a constant temperature.
In comparison with the conventional PCR amplification techniques, MDA generates larger sized products with a lower error frequency. This method has been actively used in "whole :0 genome amplification- (WGA) and it is a promising method for single cell genome sequencing genetic studies. SDA is an isothermal in vitro technique for amplification of nucleic acids, based on the Hind-I capacity of cutting the non-modified strand of a form of hemi-phosphorothioate from the recognised location thereof and the capacity of the exonuclease-deficient klenow (exo-klenow) to extend the 3' end and dislocate the DNA strand downstream. The exponential amplification results from the coupling of the sense and anti-sense reactions wherein the displaced strands of a sense reaction serve as target for an anti-sense reaction and vice-versa.
These techniques have some limitations such as Allelic dropout (ADO), preferential amplification and oligonucleotide primer-oligonucleotide-primer interactions.
These limitations reduce the precision of the genotyping.
Recombinase Polymerase Amplification (RPA) RPA is an isothermal alternative to the PCR reaction.
By adding a reverse transcriptase enzyme to an RPA reaction, we can detect both RNA and DNA, without the need for a separate step to produce cDNA. As it is isothermal, RPA uses much simpler equipment than the FOR. By having an optimum temperature from 37 to 42 00 and having the capacity to amplify, although more slowly, at room temperature means

8 that the RPA reactions can, in theory, be rapidly executed, simply holding the tube. This makes RPA an excellent candidate for the development of low cost, quick and PoC
mode molecular tests.
The published scientific literature generally lacks the detailed comparison of the performance of the isothermal amplification techniques, such as RPA, HDA and LAMP, one regarding the other, usually comparing one sole isothermal technique to a standard PCR test. This makes it difficult to :0 evaluate the merits of the techniques independently from the claims of the manufacturers, inventors, or proponents.
Furthermore, it is difficult to dissociate the performance characteristics of any amplification technique from the design of the oligonucleotide primers: a -good" set of oligonucleotide primers for a target RPA can provide amplification more rapidly or more sensitive detection than the oligonucleotide LAMP -bad" primer, for the same target.
As occurs with the PCR and any other amplification technique, there is obviously a publication bias, with sets of oligonucleotide primers having poor performance rarely being considered worthy of being reported.
Transcription Mediated Amplification (TMA)/Nucleic Acid Sequenced Based Amplification (NASBA) Both TMA and NASBA are isothermal amplification reactions that imitate the replication of the retroviral RNA. Both are specific for target RNA sequences and have achieved popularity since they demonstrated a wide range of applications to detect pathogen agents in clinical, environmental, and food samples. Both have commercially available kits. As an alternative to the RT-PCR for RNA
amplification, the NASBA and the TMA have the advantage of not requiring a thermal cycler protocol. Both techniques use RNA polymerase to produce RNA from a promoter created in the

9 region of oligonucleotide primers and a reverse transcriptase, to produce DNA from RNA templates. For the TMA, the reverse transcriptase itself degrades the initial RNA template as it synthesizes the complementary DNA thereof.
For NASBA, this RNA amplification technique was improved, with the introduction of a third enzymatic activity, the RNase H, to destroy the RNA from the CDNA without the step of heat denaturation. During the reaction, the oligonucleotide forward primer binds with any target RNA
:0 present in a sample. The reverse transcriptase enzymes and RNase H, together with the reverse oligonucleotide primer, produce a dsDNA with the target sequence and a T7 promoter.
The polymerase of RNA dependent on DNA T7 uses this dsDNA to produce many RNA complementary strands to the original target RNA. After this initial phase of NASBA, each recently synthesised RNA can be copied in a cyclic phase, resulting in an exponential amplification of the RNA that is complementary to the target. Thus, the thermal cycling step was eliminated, generating an isothermal amplification method named self-sustained sequence replication. The final products of NASBA and TMA can be detected using gel electrophoresis and colourimetric test.
SARS-CoV-2 diagnostics The new coronavirus named "SARS-CoV-2" was detected for the first time in China in December 2019 and, since 11 March 2020, has been classified as a pandemic by the WHO, causing a respiratory disease called "COVID-19". The coronaviruses are a large family of common viruses in people and in many different species of animals, including camels, cattle, cats, and bats. The animal coronaviruses rarely can infect human beings and subsequently transmit themselves among people such as the MERS-CoV, SARS-CoV and now this new virus SARS-CoV-2.

While we are still learning how it disseminates and the severity of the disease that it causes, this new COVID-19 disease has rapidly spread to more than 100 locations throughout the world. On April 30th, 2020, 3.17 million cases 5 were confirmed in the world, with 958 thousand recovered cases and 225 thousand deaths. In fact, the dissemination outside China surpassed the cases of continental China, and the EU and America are the new epicentres of the disease.
Currently the diagnostic of the COVID-19 disease, :0 caused by the SARS-CoV-2 virus is performed mainly by the molecular pathway, and the chosen diagnostic means for this type of diagnostic is a real-time PCR, there being a series of commercial kits available (for example, cobas SARS-CoV-2 (Roche), TaqPath COVID-19 Combo Kit (Thermo Fisher), lcopy COVID-19 QPCR Kit (1DROP Inc), Abbott Real-time SARS-COV-2 (Abbott)).
It is only possible to carry out this method in a laboratory environment and with specialised staff, further involving a series of care taken in the choice of sample on the part of the health professionals, given the high level of infection of this virus, which makes the entire diagnostic process extremely costly and time-consuming - on average, the result of the analysis takes 72 hours to be revealed, in a large part also due to the lack of reagents and costly real-time FCR equipment.
In response to a clear need to improve the existing diagnostic methods and systems for the detection and identification of SARS-Cov-2, the applicant had the objective of developing a new technology system and method for an integrated portable device to improve the clinical diagnostic, allowing the specific and sensitive detection to the presence of the virus of the family Coronaviridae, particularly the Coronavirus species of the severe acute respiratory syndrome 2 (SARS-Cov-2) in any biological samples.
In the present invention, the portable device that was developed allows the rapid detection (-30 minutes) of the presence of the virus (SARS-Cov-2) in several types of samples, whereby it may be used by any person (layperson in this field) and as it is portable, allowing this test to be carried out virtually anywhere. All of this eliminates the risk of contagion between the potentially infected person and the health professionals who before were involved in the :0 process of collection and analysis of the samples.
Notwithstanding, the tracking of positive results by the health entities is also able to be performed in real time, since the diagnostic is made by means of a mobile device which communicates with the portable device and sends all the information to a remote server in the cloud.
This also allows the prevention measures to be carried out in a more rapid manner, without precedents, which will help to reduce considerably the risk of propagation of the disease, and consequently, that it reaches the levels of pandemic which we are currently reaching. The reduced cost, both in terms of reagents and equipment also allows a larger dissemination and availability of the test in areas where currently the laboratorial tests by PCR in real time cannot be carried out.
Recently, there are also the so-called rapid test cassettes, which allow an immunologic diagnostic of the disease within 5 to 15 minutes and in a visual manner (without resorting to equipment). However, these tests only allow an immunity response to be evaluated and do not directly detect the presence of the virus, being solely viable for late cases of the disease (4 to 7 days after the symptoms). In the case of molecular tests, such as in the present invention, it is possible to execute the diagnostic from 2-5 days before the first symptoms, whereby it also allows the viral load of the disease to be detected directly, which is the most relevant factor for determining the potential of infecting other people. Consequently, the immunologic tests will never replace the molecular tests for this disease. Furthermore, said rapid tests have shown quite a low level of reliability, being capable of failing in up to 80% of the cases.
At the PoC level, there are two systems for the diagnostic of COVID-19, namely, the Spartan Cube COVID-19 :0 System (Spartan Bioscience) and the Xpert Xpress SARS-CoV-2 (Cepheid). However, these devices are not entirely PoC since they do not have the autonomy to execute the tests in a remote manner.
In the present invention, the portable device comprises a battery, and the truly small dimension thereof (in other words, it fits in a coat pocket), makes it truly portable for PoC.
Summary of the invention The present invention refers to an integrated system and method for the detection and identification of specific sequences of nucleic acids in different types of samples with the presence of a portable device (1) controlled by a mobile application (9) which records the data acquired by the portable device (1), analyses and stores it in a remote server in a cloud (10) and method for the detection and identification of specific nucleic acid sequences in different types of samples. The mobile application (9) also records the data acquired by the portable device (1), analyses and stores it in a remote server in a cloud (10) wherein the latter, in turn, analyses the global set of all the data in order to allow the global analysis of, for example, the evolution of epidemics.

Brief description of the figures Figure 1. Scheme of the components of the portable device (1) controlled by a mobile application (9) and connected directly or indirectly to a remote server in a cloud (10).
Figure 2. Example of a test with a negative sample :0 carried out and monitored on the portable device (1), for the Gene N, using a specific oligonucleotide probe marked with fluorophore FAN. The intensity of the fluorescence is maintained unaltered throughout the entire test, demonstrating that the reverse transcription and isothermal amplification did not occur, due to the absence of the target viral RNA.
Figure 3. Example of a test with a positive sample carried out and monitored on the portable device (1), for the Gene N, using a specific oligonucleotide probe marked with fluorophore FAN. An exponential increase in the intensity of the fluorescence is verified from -1100seconds, a consequence of the reverse transcription and isothermal amplification, disputed by the presence of the target viral RNA.
General description of the invention The present invention refers to an integrated system for the detection and identification of specific sequences of nucleic acids in suspected coronavirus samples with the presence of a portable device (1) controlled by a mobile application (9) which records the data acquired by the portable device (1), analyses and stores it in a remote server in a cloud (10). The detection and identification of the specific sequences of nucleic acids in suspected coronavirus samples is carried out by means of an optimised reverse transcriptase and/or isothermal amplification technique, using specific oiigonucleotide primers of the target region(s) to detect, whereby the amplification of the same is carried out in an indirect and non-specific manner, or direct and specific, using discriminatory amplification reagents, which signal, colourimetric or by fluorescence, is recorded by a portable device (1) where the reaction is :0 executed, being controlled by a mobile application (9) and connected directly or indirectly to a remote server in a cloud (10), and having useful application for different types of diagnostic in different clinical, pharmaceutical, veterinary, food, environmental, biotechnological, and biosafety areas.
The present invention further refers to a method for the detection and identification of the referred specific nucleic acid sequences in suspected coronavirus samples.
The method for the detection and identification of nucleic acid sequences, based on reverse transcription and/or isothermal amplification of one or more genomic regions, with real-time discrimination of the amplified fragments and using a portable device (1), whether from purified samples of nucleic acids or directly from presumably contaminated samples with said nucleic acids, characterised by the following steps:
a) Collection and processing of the sample to be analysed;
b) Addition of collected sample to a container (2) containing the reagents for reverse transcription and/or isothermal amplification and for real-time discrimination of the amplification;
c) Addition of the container (2) to the portable device (1) which will thermostatically heat the container to carry out the reverse transcription and/or isothermal amplification, and will record the signals which discriminate the amplification;
d) Transmission of the signals recorded by the portable device (1) to the mobile application (9) and/or directly to the remote server in a cloud (10);
e) Analysis of the signals recorded by the device (i) for determination of the final result: detection or non-detection of the target nucleic acid sequences :0 in the sample.
f) Recording of the final result in the remote server in a cloud (10), to enable remote access and general analysis of the control of the geography of epidemics and/or pandemics.
The present invention is useful for the detection and identification of relevant nucleic sequences for different types of diagnostic in different pharmaceutical, veterinary, food, environmental, biotechnological, or biosafety areas, being particularly useful in the rapid diagnostic, with low cost and a point of interest for the SARS-CoV-2 virus.
The nucleic acid sequences to be detected with the said method are sequences of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
The sequences of nucleic acids are of human, animal and/or pathogen origin, including bacteria, fungi, virus, or other microorganisms.
The sequences of nucleic acids belong to a virus, according to the Baltimore classification, Group I - double-stranded DNA viruses (ex. Adenovirus, herpes virus, Poxvirus), Croup II - single-stranded DNA viruses (ex.
Parvoviruses), Group III - double-stranded RNA viruses (Ex.
Reovirus), Group IV - positive sense single-stranded RNA
viruses (ex. Coronavirus, Picornavirus, Togavirus), Group V

- negative or anti-sense single-stranded RNA viruses (ex.
Orthomyxovirus, rhabdovirus), Group VI
single-stranded positive RNA viruses with a DNA intermediate in the formation of proteins (retrovirus), or Group VII - double-stranded DNA
viruses with an RNA intermediate in the replication (Hepadnavirus).
In one embodiment, the sequences of nucleic acids belong to a virus of the Coronaviridae family, and, particularly, to the severe acute respiratory syndrome coronavirus 2 (SARS-:0 Cov-2).
The reverse transcription can be carried out using a polymerase DNA enzyme with reverse transcriptase activity, such as HIV-1, M-MLV, AMV, among others.
The polymerase DNA enzyme with reverse transcriptase activity can, or not, be coupled reversibly to an aptamer, which inhibits its activity at temperatures below 40 C.
The isothermal amplification can be executed using an isothermal amplification method, such as: Loop-mediated isothermal amplification (LAMP), Helicase-Dependent Amplification (HDA), Rolling Circle Amplification (RCA), Strand Displacement Amplification (SDA), Multiple Displacement Amplification (MDA), Recombinase Polymerase Amplification (RPA), Transcription Mediated Amplification (TMA), Nucleic Acid Sequenced Based Amplification (NASBA), among others.
Addition of the collected sample to a container (2) containing the reagents for reverse transcription and/or isothermal amplification and for real-time discrimination of the amplification.
Addition of the container (2) to the portable device (1), which will thermostatically heat the container (2).
The isothermal amplification by the LAMP method is carried out using a thermostable polymerase DNA enzyme with strand displacement activity, such as the Bst enzyme, among others.
The thermostable polymerase DNA enzyme with strand displacement activity can, or not, be reversibly coupled to an aptamer, which inhibits the activities thereof at temperatures lower than 40 C.
The thermostable polymerase DNA enzyme with strand displacement activity can also have reverse transcriptase activity, allowing carrying out the reverse transcription and isothermal amplification with just one enzyme, such as :0 the Bst enzyme, among others.
The reaction mixture of the reverse transcription amplification and/or isothermal amplification can be comprised of a combination of oligonucleotide primers, dNTPs, thermostable polymerase DNA with strand displacement activity and/or polymerase DNA enzyme with reverse transcriptase activity, buffer optimised for the activity of the polymerase DNA enzymes, and reagent for discrimination in real time of the amplified fragments.
The reverse transcription and/or isothermal amplification is carried out at a temperature from 37 'C to 70 C, preferably at 65 C, during an interval of more than

10 minutes, preferably between 30 to 60 minutes.
The real-time discrimination of the amplified fragments can be made in an indirect or direct form using one or more reagents.
The indirect real-time discrimination of the amplified fragments is made using a pH colourimetric indicator agent, such as phenol red, among others, or a DNA intercalating fluorescent reagent, such as SYBR green, among others.
The direct real-time discrimination of the amplified fragments is made using one or more oligonucleotide probes with complementary specific sequence to one or more region(s) of the relatively conserved amplified fragment (s) The oligonucleotide probes are conjugated with a fluorophore, such as, for example, FAM, HEX, ROX or Cy5, or similar, and/or a quencher, such as, for example, DABCYL, EHQ-1, BHQ-2, BHQ-3, or similar, or a combination of both.
The oligonucleotide probes are RNA, DNA, LNA or PNA
probes.
The reverse transcription reaction and/or isothermal amplification results from the addition of a sample of extracted and purified RNA or DNA of samples presumably containing target nucleic acids, such as oral swabs, :0 nasopharynx or nasal samples, blood, urine, saliva, sputum, faeces, environmental or food samples, or from surface contact, among others, or with the direct addition without extraction and purification of the RNA or DNA of these same samples to the reaction amplification mixture.
The collection of samples to be analysed can be performed using a swab, syringe, collection tube or any other device designed for collection of samples.
The method is characterised by the presence and consequent reverse transcription and/or isothermal amplification of a target sequence resulting in an alteration in colourimetric or fluorescence intensity, detected by the spectrophotometric sensor(s) (7) of the portable device (1).
Collection of samples in general In the present invention, the collection of different types of samples potentially containing viral particles of SARS-CoV-2 or the exposed viral RNA itself, can be carried out in several manners, depending on the type of sample:
a) Samples from the human or animal upper respiratory tract, including:
- Exudate from the nasopharynx, collected by swab and placed in tube containing up to 3mL of medium for transport of viruses, or saline solution, or another solution liable to lyse the viral particles and/or preserve the viral RNA

intact. In particular, the swab must be inserted in one of the nostrils parallel to the palate until a slight resistance is felt. Leave the swab for a few seconds for absorption of the secretions. Gently remove with a rotating movement and repeat the collection in the other nostril.
- Oropharyngeal exudate, collected by swab and placed in tube containing up to 3mL of medium for transport of viruses, or saline solution, or another solution liable to lyse the viral particles and/or preserve the viral RNA
:0 intact. In particular, the swab must be inserted in the oral cavity and rubbed against the pharyngeal wall and the oropharyngeal pillars.
It is also possible to combine the collection of the nasopharynx exudate with that of the oropharyngeal, whereby in this case, the collection must begin by the oropharynx and pass, next, to the nasopharynx following the previous instructions.
- The nasopharyngeal aspirate or nasal wash, collected by a sterile container of samples of aspirate/nasal wash.
b) Samples from the lower human or animal respiratory tract, including:
- Endotracheal aspirate, collected by sterile container for liquid samples.
- Broncho alveolar lavage, collected by sterile container for liquid samples.
- Expectoration, collected by sterile container of liquid samples.
c) Samples of human or animal faeces, collected with a spatula for sterile container for faeces samples.
d) Samples of human or animal urine, collected by sterile container for urine samples.
e) Samples of human or animal blood, collected by capillary or syringe for sterile dry tube.
f) Environmental samples, including rain, fluvial or wastewater, or soil, collected by sterile container by the appropriate methods.
5 g) Food samples, including food and the containers thereof, collected by sterile container by the appropriate methods.
h) Surface samples, such as from contact surfaces or objects, collected by swab and placed in tube containing up :0 to 3mL of medium for transporting viruses, or saline solution, or another solution liable to lyse the viral particles and/or preserve the viral RNA intact. In particular, the swab must be swabbed over the surface, trying to collect a sample from a good part of the surface to be 15 analysed.
In the cases of samples collected by swab, a synthetic fibre swab with a plastic stick must be used, or any other that does not inhibit the reverse transcription reaction and/or isothermal amplification or which can potentially 20 degrade the viral RNA sample.
In all the cases, the samples can be used for extraction and purification of viral RNA, using traditional extraction and purification methods for nucleic acids or commercial kits for the purpose. Alternatively, a fraction of the sample can be placed in an aqueous solution containing a buffer and one or more RNases inhibitor(s), whereby the lysing of the viral particles for release of the viral RNA for subsequent analysis can occur by means of osmotic, mechanical and/or temperature Iysis during the isothermal amplification process.
Reverse transcription and isothermal amplifications In the present invention, the reverse transcription and amplification reactions of the cDNA resulting from the reverse transcription are carried out in just one step.
Furthermore, the amplification is made in an isothermal manner to be compatible with the reverse transcription reaction. As such, different isothermal amplification techniques can be used:
= Loop-mediated isothermal amplification (LAMP) = Helicase-Dependent Amplification (HDA) = Rolling Circle Amplification (RCA) = Strand Displacement Amplification (SDA) :0 = Multiple Displacement Amplification (MDA) = Recombinase Polymerase Amplification (RPA) = Transcription Mediated Amplification (TMA) = Nucleic Acid Sequenced Based Amplification (NASBA) In turn, the discrimination of the real-time amplification can be carried out in two ways:
- Indirect detection In the indirect detection, the amplification is carried out in an unspecific manner, whether by monitoring a variable that is associated with the target template amplification (for example, variation of the pH of the reaction, turbidity, etc.), or by means of the colourimetric or intercalating fluorescent reagents to double-stranded DNA produced throughout the reaction (when in presence of a positive template). However, this indirect way is not desirable since it may report false positive results, which can occur if there is non-specific amplification of the template or even of the oligonucleotide primer dimers.
- Direct detection In direct detection, the amplification is carried out in a specific manner, using specific oligonucleotide probes which specifically hybridise in a region of the amplified zone, producing an alteration to the signal that is proportional to the amplified DNA. Within these probes there are three approaches which can be considered to monitor the reverse transcription and/or isothermal amplification.
Namely, Specific conjugated oligonucleotide probes with self-quenched fluorophore;
Specific conjugated oligonucleotide probes with a fluorophore at one of the ends and a quencher at the opposite end, whether in hairpin or linear form (for the cases where the polymerase DNA has exonuclease activity);
D Combination of a specific conjugated oligonucleotide probe with a fluorophore and a specific conjugated nucleotide probe with a quencher, which sequences are contiguous to approximate the fluorophore to the quencher in case both hybridize specifically with the amplified DNA.
The reverse transcription and/or isothermal amplification can be made with the intention of amplifying and detecting only one region or several simultaneously, using a multiplex approach to this end. Furthermore, in the multiplex approach, one of the regions can serve as internal control of the sample, for example, by using as the target organism maintenance genes to be tested (ex. human, animal, bacterial, viral, among others), such as for example the actin gene, GAPDH or ubiquitin. Alternatively, or if the sample to be tested does not originate from an organism (such as for example, surface or environmental samples), can be added to the collected sample, or directly in the reaction mixture, by spiking a control target sequence, such as, for example, actin genes, GAPDH or ubiquitin, or another synthetic target.
Detailed description of the invention The present invention refers to an integrated system for the detection and identification of specific sequences of nucleic acids in suspected coronavirus samples with the presence of a portable device (1) controlled by a mobile application (9) which records the data acquired by the portable device (1), analyses and stores it in a remote server in a cloud (10).
Additionally, the present invention further refers to a method for the detection and identification of the referred :0 specific sequences of nucleic acids in samples that are suspected to contain coronavirus which cover the portable device (1), the mobile application (9) and the remote server in a cloud (10), which work together as a system.
Portable device The present invention comprises a portable device (1) which is complementary to the method, the purpose of which is to control the test and record the data which allow an analysis for the determination of a last result to be established.
For this purpose, the device (1) comprises one or more of the following components:
a) A microcontroller (MCU) (5) with integrated Wi-Fi and/or Bluetooth, such as for example, an ESP32, the purpose of which is to control the different components and administrate all the information generated by some of the components which generate data that is useful to the test, namely, by the temperature sensor (6) and spectrophotometric sensor(s) (7), all managed by a firmware. The firmware controls the different components of the device (1), particularly:
- it maintains an isothermal temperature during the course of the test;
- it controls the lighting sources and records the spectral variations during the course of the test;
- it communicates bi-directionally with the mobile application by means of Bluetooth or Wi-Fi, or with a remote server in a cloud by Wi-Fl.
b) One or more spectrophotometric sensor(s) (7), which allow the emission of photons to be quantified differentially in different wavelengths of the UV, visible and/or infrared spectrum, preferably with a resolution less than or equal to 40nm. They capture and :0 analyse photons in different wavelengths of the UV, visible and/or infrared spectrum, that reflect the signal generated by the reagent(s) for real-time discrimination of the amplified fragments. In the case of indirect detection by colourimetric change, the detection is performed by subtraction of the photons, usually from white light, generated by the lighting system at 1800 from the spectrophotometric sensor, and which are absorbed by the sample present in the reaction container.
In the case of indirect detection or direct by fluorescence, the detection is performed after excitation of the fluorophores using the lighting sources at 90 from the spectrophotometric sensor (7), and consequent detection by the spectrophotometric sensor (7) of the emission of photons generated by the excited fluorophore(s). In this case there may be differences detected in the fluorescence of one or more fluorophores in the reaction container (2), simultaneously, resorting to the individual reading of the different regions of the UV, visible and/or infrared spectrum and using one or more excitation sources (lighting sources at 90 #1 and #2) (3).
These sensors (7) can be of the photovoltaic, photodiode, photoresistor, or phototransistor type, and may be coupled to light filters, for example a band-pass filter, to better define the spectral detection zone.
All the photons detected by the spectrophotometric sensor(s) (7) are communicated to the MCU (5) by 5 electronic means.
c) One or more lighting sources (3), the purpose of which is to help the spectrophotometric sensor(s) (7) read the colourimetric or fluorescence changes, by means of the absorption of the light thereof emitted by the reagent (s) :0 used in the real-time discrimination of the amplified fragments.
These lighting sources (3) can be of the incandescent type, light-emitting diode (LED), laser (light amplification by stimulated emission of radiation) or 15 any other source for emitting photons, and may be coupled to light filters, for example band-pass filter, to better define the spectral zone of the emission, emitting photons with a wavelength that is compatible with the selective excitation of the fluorophores of the probes, 20 or in a broad visible spectrum.
d) A heat source (8), the purpose of which is to heat the reaction container (2) to an optimum temperature for the DNA polymerase enzymes to work. This source (8) can be constituted by one or more resistor(s), Peltier module 25 or any other heat source that is capable of reaching 100 'C and a minimum of 4 0C above room temperature.
e) A temperature sensor (6), the purpose of which is to measure the temperature generated by the heat source (8) so that, with the help of the MCU (5), it is possible to "thermostatise" the heating of the reaction container (2) at the optimum temperature for the DNA polymerase enzymes to work, further guaranteeing that the inactivation temperature thereof is not reached inadvertently. The temperature sensor (6) is of the thermistor type (NTC or PTC), thermoresistance (RTD), thermocouple (ex. PT100 or PT1000) or based on a semiconductor, among others, with the capacity to measure between 0 and 100 C, with a resolution between 0.01 and 5 C.
f) Battery (4), the purpose of which is to charge and operate the portable device (1) in an autonomous manner for a period of time, which allows for the execution of at least one test.
:0 The battery (4) is charged by DC charging, which can also charge the device (1) alternatively to the battery (4).
The rechargeable battery (4) can be constituted by ion-aluminium, -lithium, -potassium or -magnesium, carbon, of flow (vanadium or zinc), lead-acid or polymer based, among others.
The portable device (1) is controlled by a mobile application (9) connected to a remote server in a cloud (10) so that there is transmission of data and commands between the portable device (1), the mobile application (9) and the remote server in a cloud (10). Optionally, the portable device (1) can also connect itself directly to the remote server in a cloud (10) for data transmission.
Once the user has started the test, by means of the mobile application (9), the reaction mixture is incubated in the portable device (1) at a constant temperature between 37 C and 70 C for 30 minutes, and this time can be extended up to 90 minutes, or even 120 minutes, according to the isothermal amplification technique used.
The monitoring of the amplification of the sample is carried out indirectly using fluorescent intercalating reagents (ex. SYBRTM green) and/or directly using the specific oligonucleotide probes marked with fluorophore (ex. FAM, HEX, ROX or Cy5, or similar), using the respective source of lighting (3) as excitation source of the fluorophore and its emission recorded by the spectrophotometric sensor (7) in different wavelengths of the visible/infrared UV spectrum (315 to 1400nm, in 40nm intervals at most). Alternatively, the same sensor (7) may also monitor alterations to the colour of the reaction mixture, as a form of determining indirectly whether amplification occurred or not.
The entire process is started and controlled using a :0 mobile application (9), which analyses the data of the spectrophotometric sensor (7) throughout the time to determine the final result.
Mobile application The present invention further comprises a mobile application (9) which connects with the portable device (1) by means of Bluetooth or, optionally by means of Wi-Fi.
The mobile application (9) for control of the portable device (1) is compatible with Android or i0S, or any other operating system for a mobile device.
The mobile application (9) carries out the processing of the data generated by the portable device (1) and communication of same to the remote server in a cloud (10).
The application (9) allows for making the record of the test by using the camera of the mobile device to record the barcode associated to the reagent tube which contains the reaction mixture, to be able to record the reference of the test that it will process. With this reference, the mobile application (9) communicates with the remote server in a cloud (10) in order to collect the parameters of the test (time, temperature, data to be analysed, cut-off for analysis, etc.) and transfers these parameters to the portable device (1) to be able to start the test.

The mobile application (9) also allows for recording the user ID, the sample ID and to attribute a sole ID to the test (which is attributed by the remote server in a cloud (10)). Optionally, the application (9) also records the location of the test to allow a geographic follow-up of epidemics/pandemics, while safeguarding the anonymity of the personal data of the user.
Once the test is processed in the portable device (1) this transfers to the application (9) the data collected by :0 the spectrophotometric sensor (7) during the course of the test. This data will be analysed by the mobile application (9), which will consider positive, a sample of which the variation in fluorescence intensity in the respective wavelengths of emission of the fluorophore used is higher than 10% of the initial signal of fluorescence, and when this occurs in a time less than 1600 seconds (this cut-off may vary between 700 and 3000, according to the test in question). The monitoring can also be made in multiplex, using more than one specific oligonuoleotide probe marked with different fluorophores (ex. FAM, HEX, ROX or Cy5, or similar) which can be monitored in distinct wavelengths (ex.
520nm, 556nm, 602nm, 670nm, among others).
Remote server in a cloud (10) The present invention further comprises a remote server in a cloud (10) which stores and processes the data from all the tests in a centralised manner as well as the parameters used (reaction time, reaction temperature, data to be recorded, intervals of data to be recorded, parameters for analysis of the results, among others) for each of the tests that can be carried out on the portable device (1). The server (10) further attributes, by means of the mobile application (9), one sole ID for each one of the tests, associating this ID with the results and other information (sample ID, location of test, user, among others). The server (10) can also include an artificial intelligence algorithm for a dynamic analysis of all the data united therein, as well as timely alerting the respective health entities. All the data in the server (10) is encrypted to safeguard the cyber-security of all the data stored and being transmitted between server and mobile application (9) and/or portable device (1).
:0 Detailed description of the invention - Collection and processing of sample In this invention, the sample to be analysed is usually collected with a swab and placed in a tube containing up to 3mL of medium for transport of viruses, or saline solution, or another solution capable of lysing the viral particles and/or preserving the viral DNA intact. Next, a fraction (between 1 and 40 microlitres) of this aqueous medium is added to the reaction mixture previously prepared and provided to the final user. Alternatively, the collected samples can be processed for the extraction and purification of the viral RNA, using traditional extraction and purification methods for nucleic acids or commercial kits for this purpose, resuspending the purified nucleic acids in distilled water (Type-I) free of ribonucleases, being subsequently used a fraction for analysis (between 1 and 40 microlitres) of these purified resuspended nucleic acids.
- Lamp oligonucleotide primers In this invention there are defined sets of oligonucleotide primers for the reverse transcription and isothermal amplification by the LAMP method, from different genomic regions relatively preserved of SARS-CoV-2. Namely, for the region:

Table 1. RNA templates relative to regions of the genome of the coronavirus severe acute respiratory syndrome 2 (SARS-CoV-2).
SEQ ID No. Description 1 ORFlab Region 2 Gene S Region 3 ORF3a Region 4 Gene E Region 5 Gene M Region 6 ORF6 Region 7 ORF7a Region 8 ORF7b Region 9 ORF8 Region 10 Gene N Region

11 ORF10 Region Table 2. Oligonucleotide primers for reverse transcription and isothermal amplification of the regions of the genome of the coronavirus severe acute respiratory syndrome 2 (EARS-CoV-2).
SEQ Descrip- Sequence ID tion No.

12 ORF1a-F3 5f- CTGCACCTCATGGTCATGTT -3'

13 ORF1a-53 5f- AGCTCGTCGCCTAAGTCAA -3'

14 ORFla-FIP 5'- GAGGGACAAGGACACCAAGTGTATGGTTGAGCTGGTAGCAGA -3'

15 ORFla-BIP 5f- CCAGTGGCTTACCGCAAGGTTTTAGATCGGCGCCGTAAC-3'

16 ORFla-LF 5f- CCGTACTGAATGCCTTCGAGT -3' SEQ Descrip- Sequence ID tion No.

17 ORFla-LB 5r- TTCGTAAGAACGGTAATAAAGGAGC -3'

18 ORF1ab-F3 5'- TGCCTCAACTTGAACAGC -3'

19 ORF1ab-B3 5'- TTCATAAGGATCAGTGCCAAG -3' ORFlab- 5'- CACCAAGTGTCTCACCACTACGGCACCTCATGGTCATGTTAT -3' FIP
ORFlab- 5'-CTCATGTGGGCGAAATACCAGTCCACCAGCTCCTTTATTACC-3' BIP
22 ORFlab-LF 5f- ACCGTACTGAATGCCTTCG -3' 23 ORFlab-LB 5f- GGCTTACCGCAAGGTTCT -3' 24 RdRp-F3 5f- TGCTCTCAACATACAATGCT -3' RdRp-B3 5'- TCCTGTTAACTCATCATGTAGC -3' 26 RdRp-FIP 5'- CAAAACAGCCGGCCCCTAACAGGGTGATGATTATGTGTAC -3' 27 RdRp-BIP 5f- TGATTGAACGGTTCGTGTCTTTAGACATCAGCATACTCCTGA-3' 28 RdRp-LF 5f- GGATTCTTGATGGATCTGGGT -3' 29 RdRp-LB 5'- AGCTATAGATGCTTACCCACTT -3' GeneS-F3 5'- TGGTGGTGTCAGTGTTATAAC -3' 31 GeneS-B3 5'- GTAGGCAATGATGGATTGACTA -3' 32 GeneS-FIP 5'- ACACGCCAAGTAGGAGTAAGTTCAGGATGTTAACTGCAGAGA-3' 33 GeneS-BIP 5r- ACGTGCAGGCTUITTAATAGGGCGCATATACCTGCACCAAT-3' 34 GeneS-LE 5r- GATCTGCATGAATAGCAACAGG -3' GeneS-LB 5f- GCTGAACATGTCAACAACTCAT -3' 36 ORF3a-F3 5'- CATTACTTCAGGTGATGGCA -3' 37 ORF3a-B3 5'- ACGCTAGTAGTCGTCGTC -3' 38 ORF3a-FIP 5f-CATGITCAACACCAGIGTCTGICACAGITACTICACTICAGACT-3' 39 ORF3a-BIP 5f-TGAGCCTGAAGAACATGTCCAACATTACTGGATTAACAACTCCG-3' ORF3a-LF 5f- TTGAGTTGAGTACAGCTGGTAA -3' SEQ Descrip- Sequence ID tion No.
41 ORF3a-LB 5'- ACACAATCGACGGTTCATC -3' 42 GeneE-F3 5'- ATGAACCGACGACGACTA -3' 43 GeneE-B3 5'- GATCAGGAACTCTAGAAGAATTCAG -3' 44 GeneE-FIP 5'- ACCTGTCTCTTCCGAAACGAATGTAGCGTGCCTTIGTAAGC-3' 45 GeneE-BIP 5f-TCTTGCTITCGTGGTATTCTTGCTAATATTGCAGCAGTACGCA-3' 46 GeneE-LF 5'- AGTACATAAGTTCGTACTCATCAGC -3' 47 GeneE-LB 5f- TTACACTAGCCATCCTTACTGC -3' 48 GeneM-F3 5'- TGGCACTATTCTGACCAGA -3' 49 GeneM-B3 5f- ACTGCTACTGGAATGGTCT -3' 50 GeneM-FIP 5f- GGTCCTTGATGTCACAGCGTGTGATCCTTCGTGGACATC-3' 51 GeneM-BIP 5f- TGTIGCTACATCACGAACGCTCCTGAG1CACCTGCTACA-3' 52 GeneM-LF 5f- TAGATGGIGTCCAGCAATACG-3' 53 GeneM-LB 5'- CAAATTGGGAGCTTCGCAG-3' 54 0R56-F3 5f- TAGGACGCTGTGACATCA-3' 55 ORF6-B3 5'- GTAACCTGAAAGTCAACGAGA-3' 56 ORF6-FIP 5'- CCTGAGTCACCTGCTACACGTCACTGTTGCTACATCACG-3' 57 ORF6-BIP 5'-GTCGCTACAGGATTGGCAACTATCACTTACTGTACAAGCAAAGC-3' 58 ORF6-LF 5'- CTGCGAAGCTCCCAATTTG -3' 59 ORF6-LB 5'- ACACAGACCATTCCAGTAGC -3' 60 ORF7a-F3 5'- TGATAACACTCGCTACTTGTG -3' 61 ORF7a-B3 5'- CACTATTGCCGCAACAATAAG -3' 62 ORF7a-FIP 5'- GAGTGCTAAAGCAAGTCAGTGCGCTCTTCTGGAACATACGAG-3' 63 ORF7a-BIP 5f- TCCTGACGGCGTAAAACACGGAACTICCTCTTGTCTGATGAA-3' 64 ORF7a-LF 5'- GAGGATGAAATGGTGAATTGCC -3' 65 ORF7a-LB 5f- CTATCAGTTACGTGCCAGATCA -3' SEQ Descrip- Sequence ID tion No.
66 ORF7b-F3 5r- TTGTTGCGGCAATAGTGT -3r 67 ORF7b-B3 5'- ACCGATATCGATGTACTGAATG -3' 68 ORF7b-FIP 5'- TGTTCGTTTAGGCGTGACAAGTTAGCCTTTCTGCTATTCCTTG-3' 69 ORF7b-BIP 5r-ACAGTCATGTACTCAACATCAACCACATCCACGCACAATTCAATT-3r 70 ORF7b-LF 5f- GCAGTTCAAGTGAGAACCAA -3' 71 ORF7b-LB 5'- CCGTGTCCTATTCACTTCTATTCT -3' 72 ORF8-F3 5f- TAGGAATCATCACAACTGTAGC -3' 73 0R58-33 5r- CACGAACGTCATGATACTCTAA -3r 74 ORF8-FIP 5r-TCCACGCACAATTCAATTAAAGGTGAGTCATGTACTCAACATCAA-3r 75 ORF8-BIP 5-GAGGCTGGTTCTAAATCACCCATTACAACGCACTACAAGACTAC-3' 76 ORF8-LF 5f- AGAATAGAAGTGAATAGGACACGG -3' 77 0R58-LB 5f- AATTGCCAGGAACCTAAATTGG -3' 78 GeneN-F3 5'- TGGCTACTACCGAAGAGCT -3' 79 GeneN-B3 5f- TGCAGCATTGTTAGCAGGAT -3' 80 GeneN-FIP 5'- TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGTGGTGG -3' 81 GeneN-BIP 5'- AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT -3' 82 GeneN-LF 5r- GGACTGAGATCTTTCATTTTACCGT -3' 83 GeneN-LB 5'- ACTGAGGGAGCCTTGAATACA -3r 84 GeneN-F3 5'- TCCTGCTAACAATGCTGC -3' 85 GeneN-B3 5r- TCTCAAGCTGGTTCAATCTG -3r 86 GeneN-FIP 5'- AACGAGAAGAGGCTTGACTGCTCAAGGAACAACATTGCCA -3' 87 GeneN-BIP 5'- CICATCACGTAGICGCAACAGTATTGCCAGCCATTCTAGC -3' 88 GeneN-LF 5f- CCTTCTGCGTAGAAGCCTT -3' 89 GeneN-LB 5'- AATTCAACTCCAGGCAGCA -3' 90 ORF1C-F3 5f- GTGACTCTTCTTCCTGCTG -3' SEQ Descrip- Sequence ID tion No.
91 ORF10-53 5'- ATAGGCAGCTCTCCCTAG -3' 92 ORF1C-FIP 5'-GAATICATICTGCACAAGAGTAGACCATGAGCAGTGCTGACTC-3' 93 ORF1C-BIP 5'-TAGGGAGGACTTGAAAGAGCCACATTGTTCACTGTACACTCG-3' 94 ORF1C-LF 5'- GTGTGGTCTGCATGAGTT -3' 95 ORF1C-LB 5f- CCACGCGGAGTACGAT -3' - Specific oligonucleotide probes In this invention a set of oligonucleotide probes conjugated internally with a fluorophore was defined, which is self-quenched in the isolated form thereof, and which sequences hybridize in specific preserved zones of different genomic regions of the SARS-CoV-2, located in the fragment amplified by LAMP, whereby they work by including as oligonucleotide primers of direct or reverse loop, according to region. By hybridising with the complementary region, the fluorophore ceases to self-quench, increasing the emission of fluorescence thereof. Namely, these are the probes for each region:
Table 3. Probes for specific discrimination of the reverse transcription and/or isothermal amplification of regions of the genome of the coronavirus severe acute respiratory syndrome 2 (SARS-CoV-2).
SEQ ID Region Sequence No.
96 ORFla 5'- GACCGTACTGAATGCCTT*CG -3' 97 ORFlab 5'- ACCGTACTGAATGCCTT*CG -3' 98 RdRp 5'- CTATAGATGCTTACCCACTT*AC -3' 99 GeneS 5'- TGAACATGTCAACAACTCATAT*GA -3' 100 0RF3a 5'- ACACAATCGACGGTTCAT*C -3' 101 ORF6 5'- CTGCGAAGCTCCCAATT*TG -3' 102 ORF7a 5'- CTATCAGTTACGTGCCAGAT*CA -3' 103 ORF7b 5'- CCGTGTCCTATTCACTTCTATT*CT -3' 104 OR58 5'- AATTGCCAGGAACCTAAATT*GG -3' 105 GeneN 5'- ACTGAGGGAGCCTTGAAT*AC -3' 106 GeneN 5'- AACTCCAGGCAGCAGT*AG -3' 107 OR510 5'- GIGGICTGCATGAGTTT*AG -3' 108 GeneE 5'- TTACACTAGCCATCCTTACT*GC -3' 109 GeneM 5'- TAGATGGIGTCCAGCAAT*AC -3' CBS.: *dT conjugated internally with a fluorophore.
- Lamp reaction The mixture of the LAMP reaction was optimised for the 5 method for detection and identification of SARS-Cov-2 by means of the present invention, containing: 1.6 M of each nucleotide primer FIP and BIP; 0.2 M of each nucleotide primer F3 and 33; 0.4 M of each nucleotide primer LF or LB
and of each specific oligonucleotide probe LB or LF, 10 according to the region to be analysed; 1.4mM of each dNTP;
320 U/ml Bst DNA Polymerase; 500 U/mL Reverse Transcriptase;

20 mM Tris-HC1 pH 8.8 @25 C; 8mM (NH4)2SO4; 10mM MgSO4; 50 mM KC1; and 0.1% Tweene 20.
15 Table 4. Combination of oligonucleotide primers for the reverse transcription and/or isothermal amplification of regions of the genome of the coronavirus severe acute respiratory syndrome 2 (SARS-CoV-2).
Amplified RNA template Oligonucleotide primers region ORFla Region SEQ ID No. 1 SEQ ID No. 12, 13, 14, 15, 16, 17 ORFlab Region SEQ ID No. 1 SEQ ID No. 18, 19, 20, 21, 22, 23 RbRp Region SEQ ID No. 1 SEQ ID No. 24, 25, 26, 27, 28, 29 Gene S Region SEQ ID No. 2 SEQ ID No. 30, 31, 32, 33, 34, 35 ORF3a Region SEQ ID No. 3 SEQ ID No. 36, 37, 38, 39, 40, 41 Gene E Region SEQ ID No. 4 SEQ ID No. 42, 43, 44, 45, 46, 47 Gene M Region SEQ ID No. 5 SEQ ID No. 48, 49, 50, 51, 52, 53 ORF6 Region SEQ ID No. 6 SEQ ID No. 54, 55, 56, 57, 58, 59 ORF7a Region SEQ ID No. 7 SEQ ID No. 60, 61, 62, 63, 64, 65 ORF7b Region SEQ ID No. 8 SEQ ID No. 66, 67, 68, 69, 70, 71 ORF8 Region SEQ ID No. 9 SEQ ID No. 72, 73, 74, 75, 76, 77 SEQ ID No. 78, 79, 80, 81, 82, 83 Gene N Region SEQ ID No. 10 or SEQ ID No. 84, 85, 86, 87, 88, 89 ORF10 Region SEQ ID No. 11 SEQ ID No. 90, 91, 92, 93, 94, 95 Table 5. Combination of specific oligonucleotide probe conjugated with fluorophore and in substitution of one of the oligonucleotide primers (in case it is used in the reverse transcription and/or isothermal amplification) for discrimination of the reverse transcription and/or isothermal amplification of regions of the genome of the coronavirus severe acute respiratory syndrome 2 (SARS-CoV-LC) 2) in real time.
Amplified region Probe Substituting the oligonucleotide primer Region ORFla SEQ ID No. 96 SEQ ID No. 16 ORFlab Region SEQ ID No. 97 SEQ ID No. 22 RbRp Region SEQ ID No. 98 SEQ ID No. 29 Gene S Region SEQ ID No. 99 SEQ ID No. 35 Amplified region Probe Substituting the oligonucleotide primer ORF3a Region SEQ ID No. 100 SEQ ID No. 41 ORF6 Region SEQ ID No. 101 SEQ ID No. 58 ORF7a Region SEQ ID No. 102 SEQ ID No. 65 ORF7b Region SEQ ID No. 103 SEQ ID No. 71 ORF8 Region SEQ ID No. 104 SEQ ID No. 77 Gene N Region SEQ ID No. 105 SEQ ID No. 83 Gene N Region SEQ ID No. 106 SEQ ID No. 89 ORF10 Region SEQ ID No. 107 SEQ ID No. 94 Gene E Region SEQ ID No. 108 SEQ ID No. 47 Gene M Region SEQ ID No. 109 SEQ ID No. 52 The final volume of the reaction mixture used is of 20 L, considering a sample volume of 8 L. However, the final volume of the reaction mixture can be proportionally adjusted between 5 to 100 L. Optionally, to avoid evaporation of the reaction mixture during the test, 20 L of mineral oil or liquid wax are added. To carry out the reaction test, PCR
tubes of 0.2mL are used as a reaction container, and tubes from 0.1 mL to 0.5mL may also be used.
The reaction mixture was incubated in the portable device (1) at a constant temperature of 65 C for 30 minutes.
At the end of that time, the data from the spectrophotometric sensor (7) was sent to the mobile application (9) and analysed. The sample of which the variation in the fluorescence intensity in the respective wavelength(s) of the emission of fluorophore used (FAN), was higher by 10%
from the initial fluorescence signal, and occurred in a time less than 1600 seconds, has been considered as positive.
These results were subsequently confirmed by electrophoresis in agarose gel (2% in TAE lx at 6V/cm) and Sanger sequencing.
References - patent US7972830B2; Saiki, R, Gelfand, D., Stoffel, S., Scharf, S., Higuchi, R., Horn, C., Mullis, K., Erlich, H. (1988). - "Primer-directed enzymatic amplification of DNA
with a thermostable DNA polymerase". Science. 239 (4839):
487-491. doi:10.1126/science.2448875. PMID 2448875;
- Garibyan L, Avashia N (2013). 'Polymerase Strand :0 Reaction". Journal of Investigative Dermatology. 133 (3): 1-4. doi:10.1038/jid.2013.1;
- Zhou, Y H; Zhang, X P; Ebright, R H (1991). "Random mutagenesis of gene-sized DNA molecules by use of PCR with Taq DNA polymerase".
-Nucleic Acids Research. 19 (21): 6052.
doi:10.1093/nar/19.21.6052 - Alaeddini, Reza (2012). "Forensic implications of PCR
inhibition¨A review". Forensic Science International:
Genetics. 6 (3): 297-305. doi:10.1016/j.fsigen.2011.08.006 -Bustin SA et al (2009). "The MIQE guidelines: minimum information for publication of quantitative real-time PCR
experiments". Clinical Chemistry. 55 (4): 611-622.
doi:10.1373/clinchem.2008.112797;
- Logan, Julie, Edwards, Kirstin & Saunders, Nick, eds.
(2009). Real-Time FCR: Current Technology and Applications.
Caister Academic Press. ISBN 978-1-904455-39-4;
- Ponchel F et al (2003) "Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TagMan test for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions". BMC Biotechnol. 3:
18. doi:10.1186/1472-6750-3-18 - Notomi T et al (2000). "Loop-mediated isothermal amplification of DNA". Nucleic Acids Res. 28 (12): 63e-63.
doi:10.1093/nar/28.12.e63;

- Nagamine K et al (2002) "Accelerated reaction by loop-mediated isothermal amplification using loop primers". Mol.
Cell. Probes. 16 (3): 223-9. doi:10.1006/mcpr.2002.0415;
Tanner NA et al (2012).
- "Simultaneous multiple target detection in real-time loop-mediated isothermal amplification". BioTechnigues. 53 (2): 81-9. doi:10.2144/0000113902;
- Mori Y et al (2004) "Real-time turbidimetry of LAMP
reaction for quantifying template DNA÷. J. Biochem. Biophys.
LO Methods. 59 (2): 145-57. doi:10.1016/1.jbbm.2003.12.005;
- Zhang Y et al (2020) "Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP", medRxiv, 2020.02.26.20028373.
doi:
10.1101/2020.02.26.20028373;
- patents W02017108663A1, US6410278B1 - Vincent M et al (2004)÷ Helicase-dependent isothermal DNA amplification" EMBO, 5(8):795-800. doi:
10.1038/sj.embor.7400200;
- Veltkamp HW et al (2020) "Disposable DNA Amplification Chips with Integrated Low-Cost Heaters" Micromachines (Basel), 11(3):238 doi:
10.3390/mi11030238; patent - Monsur AM et al (2014) "Rolling circle amplification:
a versatile tool for chemical biology, materials science and medicine. Chemical Society Reviews. 43(10):3324-41.
doi:10.1039/C3CS60439J;
- Joffroy B et al (2018) "Rolling circle amplification shows a sinusoidal template length-dependent amplification bias.- Nucleic Acids Res.
46(2):538-545.
doi:10.1093/nar/gkx1238;
- Mohsen MC, Kool ET. The (2016) "Discovery of Rolling Circle Amplification and Rolling Circle Transcription-. Acc Chem Res.
49(11):2540-2550.
doi:10.1021/acs.accounts.6b00417;

- patent US6221603B1 - Walker GT et al (1992) "Strand displacement amplification--an isothermal, in vitro DNA amplification technique". Nucleic Acids Research, 20(7):1691-1696. doi:
5 10.1093/nar/20.7.1691;
- Blanco L et al (1989) "Highly efficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetrical mode of DNA
replication". The Journal of Biological Chemistry. 264 (15):
8935-40;
:0 -Chen M et al. (2015) "Comparison of multiple displacement amplification (MDA) and multiple annealing and looping-based amplification cycles (MALBAC) in single-cell sequencing". PLoS One, 10(4):e0124990 doi:10.1371/journal.pone.0124990;
15 - patent US5712124A
-Piepenburg 0. et al (2006) "DNA Detection Using Recombination Proteins". PLOS Biology. 4 (7): e204.
doi:10.1371/journal.pbio.0040204;
- Zhao G et al (2018) Development of a recombinase 20 polymerase amplification combined with a lateral flow dipstick test for rapid detection of the Mycoplasma bovis.
BMC Vet Res. 2018;14(1):412. doi:10.1186/s12917-018-1703-x;
- patent EP2438196A1 - Wroblewski JK et al (2006). Comparison of 25 transcription-mediated amplification and PCR test results for various genital specimen types for detection of Mycoplasma genitalium. J Olin Microbiol, 44(9):3306-3312.
doi:10.1128/JCM.00553-06;
- patent EP0629/06B1 (2020) Laboratory testing for coronavirus disease 2019 (COVID-19) in suspected human cases: interim guidance, 2 March 2020

Claims (35)

41

1. A portable device (1) for the detection and identification of specific nucleic acid sequences in suspected coronavirus samples comprising a reaction container (2), a battery (4), a temperature sensor (6), characterised in that it further comprises:
a) one or more spectrophotometric sensors (7);
b) one or more illumination sources (3);
lo c) one heat source (8);
d) one microcontroller (5) with integrated Wi-Fi and/or Bluetooth containing a firmware;
e) wherein the reaction container (2) contains a suspected coronavirus sample and reverse 7_5 transcription and/or isothermal amplification reagents for real-time discrimination of the amplification.

2. The portable device (1) according to claim 1, 20 characterised in that the samples come from the higher or lower respiratory tract, nasopharyngeal aspirate, or nasal wash, from faeces, saliva, samples of human or animal urine, environmental samples, food samples.

25 3. The portable device (1) according to the preceding claims, characterised in that the suspected coronavirus sample is RNA or DNA extracted and purified from samples presumably containing target nucleic acids, such as oral swabs, nasopharyngeal or nasal, blood, urine, saliva, 30 sputum, faeces, environmental samples or food, or from contact surface, among others, or with the direct addition without extraction and purification of RNA or DNA from these same samples.

4. The portable device (I) according to the preceding claims, characterised in that the reverse transcription and/or isothermal amplification reagents and for real-time discrimination comprise one or more of the SEQ ID No. 12 to 109.

5. The portable device (1) according to the preceding claims, characterised in that the one or more spectrophotometric sensors (7) are configured to lo differentially quantify the emission of photons in different wavelengths between 315 to 1400 nm, preferably with a resolution less than or equal to 40nm.

6. The portable device (1) according to the preceding claims, characterised in that the one or more spectrophotometric sensors (7) are of the photovoltaic, photodiode, photoresist or photctransistor type, and may be coupled to light filters, for example, a band-pass filter.

7. The portable device (1) according to the preceding claims, characterised in that the heat source (8) is constituted by one or more resistors, Peltier module, or any other heat source which reaches at least 100 C and at minimum 4 C above room temperature.

8. The portable device (1) according to the preceding claims, characterised in that the one or more sources of illumination (3) are incandescent, light-emitting diode or laser.

9. The portable device (I) according to the preceding claims, characterised in that the one or more sources of illumination (3) are coupled to light filters.

10. The portable device (1) according to the preceding claims, characterised in that the temperature sensor (6) is of the thermistor, thermoresistance, thermocouple type, or based on a semiconductor.

11. A mobile application (9) characterised in that it is connected to the portable device (1) defined in claims 1-10 by means of Bluetooth or by means of Wi-Fi.

12. A remote server in a cloud (10) characterised in that it is connected to the mobile application (9) defined in claim 11 and/or to the portable device (1) defined in claims 1-10 by means of Wi-Fi.

13. A system for the detection and identification of specific sequences of nucleic acids in suspected coronavirus samples characterised in that it comprises the portable device defined in claims 1-10, the mobile application (9) defined in claim 11 and the remote server in a cloud (10) defined in claim 12.

14. A method for the detection and identification of specific sequences of nucleic acids based on the reaction from reverse transcription and/or isothermal amplification of one or more genomic regions, with real-time discrimination of the amplified fragments in suspected coronavirus samples using the portable device (1) defined in claims 1-10, the mobile application (9) defined in claim 11 and the remote server in a cloud (10) defined in claim 12, characterised in that it comprises the following steps:
a) Collection and processing of sample to be analysed;
b) Addition of collected sample to a reaction container (2) containing the reaction mixture with the reagents for the reverse transcription and/or isothermal amplification reaction;
c) Addition of reaction container (2) containing the sample to be analysed to the portable device (1), followed by thermostatic heating of the container (2) and subsequent reverse transcription and/or isothermal amplification reaction with recording of the discriminating signals of isothermal amplification in the portable device (1);
d) Transmission of the referred recorded signals by one or more spectrophotometric sensors (7) of the portable device (1) to a remote server in a cloud (10) by means of Bluetooth or Wi-Fi;
e) Analysis of signals recorded by the portable device (1) in the mobile application (9) for determination of the final results, positive or negative, wherein positive indicates the presence of the nucleic acid sequences that are the target in the sample;
f) Recording of the final result maintained in the remote server in a cloud (10).

15. The method according to claim 14, characterised in that the samples come from the higher or lower respiratory tract, nasopharyngeal aspirate, or nasal wash, from faeces, saliva, samples of human or animal urine, environmental samples, food samples.

16. The method according to claims 14-15, characterised in that the reverse transcription and/or isothermal amplification reaction is carried out with the addition of a RNA or DNA sample extracted and purified from samples presumably containing target nucleic acids, such as oral swabs, nasopharynx or nasal, blood, urine, saliva, sputum, faeces, environmental or food samples, or from contact surfaces, among others, or with the direct addition without extraction and purification of the RNA or DNA from these same samples, to the reaction amplification mixture.

17. The method according to claims 14-16, characterised in 5 that the specific nucleic acid sequences to be detected are sequences of deoxyribonucleic acid or ribonucleic acid originating from virus.

18. The method according to claims 14-17, characterised in 10 that the virus is selected from: Adenovirus, herpes virus, Poxvirus, Parvoviruses, Reovirus, Coronavirus, Picornavirus, Togavirus, Orthomyxovirus, Rhabdovirus, retrovirus, Hepadnavirus, among others.

15 19. The method according to claims 14-18, characterised in that the nucleic acid sequences belong to the virus of the Coronaviridae family, particularly the species of the severe acute respiratory syndrome, SARS-Cov-2.

20 20. The method according to claims 14-19, characterised in that the reverse transcription reaction is carried out using a polymerase DNA enzyme with reverse transcriptase activity, such as HTV-1, M-MLV, AMV, among others.

25 21. The method according to claims 14-20, characterised in that the reaction mixture is a combination of oligonucleotide primers, dNTPs, thermostable polymerase DNA enzyme with strand displacement activity and/or polymerase DNA enzyme with reverse transcriptase activity, buffer for the activity 30 of the polymerase DNA enzymes and reagent for real-time discrimination of the amplified fragments.

22. The method according to claims 14-21, characterised in that the polymerase DNA enzyme with reverse transcriptase activity is reversibly coupled to an aptamer which inhibits the activities thereof at temperatures lower than 40 C.

23. The method according to claims 14-22, characterised in that the oligonucleotide primer sequences comprise one or more of SEQ. ID No. 12 to 95.

24. The method according to claims 14-23, characterised in that the reverse transcription reaction and/or isothermal lo amplification is carried out at a temperature of 37 - 70 C, for at least 10 minutes up to 120 minutes.

25. The method according to claims 14-24, characterised in that the reverse transcription reaction and/or isothermal amplification is carried out at a preferred temperature of 65 C for 30 minutes.

26. The method according to claims 14-25, characterised in that the real-time discrimination of the amplified fragments is carried out in indirect or direct manner.

27. The method according to claim 26, characterised in that the real-time indirect discrimination of the amplified fragments of DNA is carried out using a colourimetric pH
indicator reagent, such as, phenol red, among others, or an intercalating DNA reagent, such as SYBRTM green.

28. The method according to claim 26, characterised in that the real-time direct discrimination of the amplified fragments of DNA is carried out using one or more specific oligonucleotide probes conjugated with a fluorophore, and/or a quencher, or a combination of both.

29. The method according to claim 28, characterised in that the fluorophore is FAM, HEX, ROX or Cy5, or similar, and the quencher being DABCYL, BHQ-1, BHQ-2, BHQ-3, or similar.

30. The method according to claim 28, characterised in that the oligonucleotide probes belong to SEQ. ID No. 96 to 109.

31. The method according to claims 14-30, characterised in that the transmission of the recorded signals of the one or more spectrophotometric sensors (7) of the portable device lo (1) is carried out to a mobile application (9) via Bluetooth and/or Wi-Fi.

32. The method according to claims 14-31, characterised in that the mobile application (9) for control of the portable device (1) is compatible with Android or i0S, or any other operating system of a mobile device.

33. The method according to claims 14-32, characterised in that the signals recorded in the portable device (1) are stored and processed in a remote server in a cloud (10).

34. The method according to claims 14-33, characterised in that the signals recorded and generated by the portable device (1) are processed by the mobile application (9) and transmitted to a remote server in a cloud (10).

35. The method according to claims 14-34, characterised in that the final result is positive for a variation in the fluorescence intensity in the wavelengths of the emission of fluorophore higher than 10% of the initial fluorescence signal and occurs in less than 1600 seconds.