CA3059246A1 - New method for visual quantitative detection of dual heavy metal ions - Google Patents

Abstract

Provided is a visual quantitative method for heavy metals, comprising an in vitro nucleic acid amplification and detection method, wherein during in vitro nucleic acid amplification, an ultra-fast PCR reaction is carried out by using primers composed successively of a complementary sequence, a linker arm, a complementary sequence, and a nucleic acid sequence that specifically amplifies the target to be tested, and during detection, self-assembly color development is realized by using a hairpin sequence composed of a complementary sequence and G-quadruplex.

Description

NEW METHOD FOR VISUAL QUANTITATIVE DETECTION OF DUAL HEAVY
METAL IONS
This application claims the priority to Chinese Patent Application No.
201810129689.6 titled "METHOD FOR VISUAL AND QUANTITATIVE DETECTION OF TWO HEAVY
METAL IONS " and filed with the Chinese State Intellectual Property Office on February 08, 2018, which is incorporated herein by reference in its entirety.
FIELD
[0001] The present disclosure relates to the technical field of biological detection, specifically to a method and biosensor for detecting dual heavy metal ions.
BACKGROUND

[0002] Mercury in nature exists mainly in three forms, including elemental mercury (Hg), organic mercury (alkyl mercury, phenyl mercury), and inorganic mercury (He and Hg2+ salts and their complexes), and mercury can perform biological and chemical conversion between various forms. It is the only metal present in liquid form at room temperature. The physical shape of mercury is silver-white, and it has a melting point of -38.87 C, a boiling point of 356.6 C, a density of 13.59 g/cm 3, and the element symbol is Hg. Silver has an elemental state but generally exists in a silver ore in a combined state. It has a white shiny form with a melting point of 961.78 C, a boiling point of 2212 C, a density of 10.49 g/cm 3, and the element symbol is Ag.

[0003] Traditional detection methods for Hg2+ and Ag+ mainly include atomic absorption spectroscopy (AAS), atomic fluorescence spectrometry (AFS), inductively coupled plasma mass spectrometry, electrochemical analysis, atomic absorption spectrophotometry, etc. These methods have high sensitivity, wide detection range, and are suitable for multiple sample analysis.
However, the use of large equipment needs higher maintenance cost and professional operations which increase the cost of detections. At the same time, the pre-treated process of samples is - -13790822.1 complicated, and a part of the samples need to be treated with corrosive reagent; and the detecting period is long. Due to the above disadvantages, the conventional methods are not suitable for the on-site analysis lack of precision instruments, etc., which is difficult to meet the requirements of actual analysis.
SUMMARY

[0004] The detection method and the biosensor established by the present disclosure overcome the deficiencies of the existing detection techniques and realize accurate, rapid, simple and efficient detection and analysis of heavy metals, and it is a novel method for detecting two heavy metals, which is cheap, fast, sensitive and specific.

[0005] The present disclosure aims to provide a method for detecting a metal comprising nucleic acid amplification in vitro, wherein the reaction system of nucleic acid amplification in vitro comprises a downstream primer, a template, and at least two upstream primers; each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template.

[0006] The template at least comprises a complementary sequence G, a complementary 13790822.1 sequence H and a sequence I, wherein the complementary sequence G and the complementary sequence H are respectively complementary and/or reverse complementary to the nucleotide sequence of the at least two upstream primers capable of specifically amplifying the template;
and the nucleotide sequence of the sequence I is the same as the nucleotide sequence of the downstream primer capable of specifically amplifying the template.

[0007] The complementation includes complementation or reverse complementation as defined by the conventional art or common general knowledge, and/or performing complementation or reverse complementation according to complementary principles as defined by the conventional art or common general knowledge.

[0008] The polymerase includes a polymerase that can be used for in vitro nucleic acid amplification.

[0009] The nucleotide sequence capable of specifically amplifying the template includes a primer designed according to a characteristic sequence of the template; the characteristic sequence includes the characteristic sequence defined by the conventional art or common general knowledge; and the design methods are recorded by the conventional art or common general knowledge.

[0010] The A, B, G, H, and I are only used to distinguish different complementary sequences or sequences, and are not used for sorting.

[0011] Specifically, the method further comprises at least one of the following 1) to 3):

[0012] 1) the nucleic acid amplification in vitro includes ultra-rapid PCR, wherein the reaction process of the ultra-rapid PCR comprises: 90-98 C for 2-6s and 50-60 C for 2-8s, for 20-40 cycles in total;

[0013] specifically, the reaction process of the ultra-rapid PCR comprises: 95 C for 2s and 58 C for 3s for 30 cycles in total;

[0014] more specifically, the concentration of the upstream primer and the downstream primer in the reaction system of the ultra-rapid PCR is more than 10 times of the concentration of the normal PCR, even more specifically, 20 times; the reaction system of the ultra-rapid PCR further comprises a DNA polymerase, and the concentration of the DNA polymerase is more than 10 13790822.1 times of the concentration of the normal PCR, specifically, 60 times;

[0015] 2) the linking arm comprises a compound having a long-chain structure;
and

[0016] 3) the nucleotide sequence capable of binding to the metal to be detected includes a nucleotide sequence containing thymine or cytosine.

[0017] Specifically, the method further comprises at least one of the following 1) to 8):

[0018] 1) one of the at least two upstream primers includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;

[0019] 2) one of the at least two upstream primers includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2;

[0020] 3) one of the at least two upstream primers includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;

[0021] 4) one of the at least two upstream primers includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5;

[0022] 5) the downstream primer includes the nucleotide sequence set forth in SEQ ID NO: 3;

[0023] 6) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
3;

[0024] 7) the template includes the nucleotide sequence set forth in SEQ ID
NO: 6; and

[0025] 8) the template includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more 13790822.1 nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6.

[0026] The same function refers to enabling the amplification of the template.

[0027] Specifically, the linking arm is oxyethyleneglycol bridge, and the chemical structure of oxyethyleneglycol is:
(3,--I
0=--P-0-I .

[0028] More specifically, one of the at least two upstream primers comprises:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTC TCTTT
CCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT or TGAGGTAGTAGG
TTGTATAGTT- oxyethyleneglycol bridge -AACTATACAACCTACTACCTCATTTTT
TTTTTTGCACATAACACCCC .

[0029] Even more specifically, the at least two upstream primers comprise:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTCTCTTTC
CCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT and TGAGGTAGTAGG
TTGTATAGTT- oxyethyleneglycol bridge -AACTATA CAACCTACTACCTCATT ______________ Fri TTTTTTGCACATAACACCC.

[0030] Specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker comprises biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer; and the labeling method belongs to a conventional art; and more specifically, the downstream primer is Biotin-TCATCGCACCGTCAAAGGAACC.

[0031] Specifically, the method further comprises a color reaction based on nucleic acid self-assembly, wherein the reaction system of the color reaction based on nucleic acid self-assembly comprises a hairpin sequence, wherein the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or 13790822.1 more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F
are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A
and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other.

[0032] The numbering of the sequences is used to distinguish different hairpin sequences, not for sorting; the C, D, E, and F are only used to distinguish different complementary sequences, not for sorting.

[0033] Specifically, the hairpin sequence comprises one of the following 1) to 4):

[0034] 1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID NO: 7 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 7 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 7;

[0035] 2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID NO: 8 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 8 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 8;

[0036] 3) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID NO: 9 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and

[0037] 4) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID NO: 10 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.

[0038] The same function refers to: the upstream primer can open the hairpin structure of the 13790822.1 hairpin sequence 1 by base complementation, and the hairpin sequence 1 can realize a self-extension of the nucleotide chain under the action of TDT enzyme; the hairpin sequence 2 can open the hairpin structure of the hairpin sequence 1 by base complementation; the hairpin sequence 1 and the hairpin sequence 2 can mutually cyclically open each other's hairpin structure and connect to each other; the hairpin sequence 1 can realize the self-extension of the nucleotide chain under the action of TDT enzyme at the same time in a linking body formed by the hairpin sequence 1 and the hairpin sequence 2.

[0039] Specifically, the color reaction based on nucleic acid self-assembly further comprises at least one of the following 1) to 2):

[0040] 1) mixing at least one reaction system prepared by the method according to the present disclosure with at least one hairpin sequence of the method according to the present disclosure, and incubating at 37 C for 20 min; adding TdT enzymatic reaction system to react at 37 C for min, and heating at 75 C for 10 min; adding hemin and G-quadruplex inducing buffer and incubating at 37 C for 20min; and adding ABTS2- and hydrogen peroxide for color reaction;
15 [0041] specifically, before adding TdT enzyme to the reaction system, the purification step is further comprised; specifically, the purification step comprises attaching biotin to the downstream primer and then purifying target product with biotin through the binding of biotin and streptavidin;
and [0042] 2) in the reaction system of the color reaction based on nucleic acid self-assembly, the 20 final concentration of each of the hairpin sequence 1 and the hairpin sequence 2 is 21..M.
[0043] Specifically, the method further comprises at least one of the following 1) to 4):
[0044] 1) determining whether a target to be detected is in an object to be detected by color change of the final reaction system; specifically, when the color of the reaction system changes, the object to be detected contains the target to be detected; more specifically, when the color of the reaction system changes to blue-green, the object to be detected contains the target to be detected;
[0045] 2) calculating the concentration of the target to be detected in the object to be detected by a method of preparing a standard curve according to the color of the final reaction system;

13790822.1 [0046] 3) detecting two or multiple ions by increasing the types of the upstream primer, hairpin sequence 1, and hairpin sequence 2;
[0047] specifically, for two or multiple detection, the microarray method can be used to determine whether the object to be detected contains the target to be detected or contains several targets to be detected; the microarray method comprises separately applying the different kinds of hairpin sequences in different wells to perform reaction, and then determining whether the target to be detected or several targets to be detected is contained according to the reaction result: when the color of the reaction solution changes or turns blue-green, it is determined that the target to be detected is presented; the total number of wells in which the color change or the blue-green color is generated is the total number of types of the target to be detected contained in the sample to be detected;
[0048] the types of the hairpin sequence 1 comprises: the complementary sequence C in the hairpin sequence 1 is the same type of hairpin sequence as the hairpin sequence complementary or reverse complementary to the complementary sequence A and/or B in the upstream primer, otherwise, the sequences are different types of hairpin sequence 1; and the upstream primers having identical nucleotide sequences are the same upstream primer;
[0049] 4) purifying the in vitro nucleic acid amplification product before the color reaction based on nucleic acid self-assembly; and [0050] specifically, the purification is carried out by a kit purification or magnetic bead purification; the purification comprises removing other impurities other than the in vitro nucleic acid amplification products and hairpin sequence linking products in the reaction system.
[0051] The other object of the present disclosure is to provide a kit and/or a biosensor for detecting a metal, the kit and/or the biosensor comprises at least one of the following 1) to 6):
[0052] 1) at least two upstream primers, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected;

13790822.1 the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A
and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
[0053] 2) a template, wherein the template at least comprises a complementary sequence G, a complementary sequence H and a sequence I, wherein the complementary sequence G and the complementary sequence H are respectively complementary and/or reverse complementary to the nucleotide sequence of the at least two upstream primers capable of specifically amplifying the template; and the nucleotide sequence of the sequence I is the same as the nucleotide sequence of the downstream primer capable of specifically amplifying the template;
[0054] 3) a downstream primer, a template and at least two upstream primers, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template; and the downstream primer 13790822.1 comprises the nucleotide sequence capable of specifically amplifying the template;
[0055] 4) at least two upstream primers and a hairpin sequence, wherein [0056] each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template; and [0057] the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
[0058] 5) at least two upstream primers, a template and a hairpin sequence, wherein [0059] each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream 13790822.1 primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
[0060] the template at least comprises a complementary sequence G, a complementary sequence H and a sequence I, wherein the complementary sequence G and the complementary sequence H are respectively complementary and/or reverse complementary to the nucleotide .. sequence of at least two upstream primers capable of specifically amplifying the template; and the nucleotide sequence of the sequence I is the same as the nucleotide sequence of the downstream primer capable of specifically amplifying the template; and [0061] the hairpin sequence comprises hairpin sequence I and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
6) a downstream primer, a template, at least two upstream primers and a hairpin sequence, wherein - II -13790822.1 [0062] each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
[0063] the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
[0064] the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
[0065] specifically, the nucleotide sequence capable of binding to the metal to be detected includes a nucleotide sequence containing thymine or cytosine;
[0066] specifically, one of the at least two upstream primers comprises at least one of the following 1) to 4):

13790822.1 [0067] 1) a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
[0068] 2) a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID
NO: 2 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2;
[0069] 3) a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
[0070] 4) a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID
NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5;
[0071] specifically, the downstream primer includes the nucleotide sequence set forth in SEQ
ID NO: 3 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
[0072] specifically, the template includes the nucleotide sequence set forth in SEQ ID NO: 6, and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6;
[0073] specifically, the linking arm comprises the compound having a long-chain structure;
[0074] specifically, the linking arm is oxyethyleneglycol bridge, and the chemical formula of oxyethyleneglycol is:

13790822. 1 0==-P-0-I .
[0075] Specifically, one of the at least two upstream primers comprises:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCT
CTCTTTCCCTCTCTCTCTCTGTGAAA'FTATCGCCACGTTCGGTTTT
or TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge -AACTATA
CAACCTACTACCTCATTTTTTTTTTTGCACATAACACCCC.
[0076] Specifically, the at least two upstream primers comprise:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTC
TCTTTCCCTCTCTCTCTCTGTGAAATTATCGC
CACGTTCGGTTTT and TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge- AACTATACA
ACCTACTACCTCAITI ______ TTTTIFTTTGCACATAACACCCC.
[0077] Specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker comprises biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer; and the labeling method belongs to a conventional art; more specifically, the downstream primer is Biotin-TCATCGCACCGTCAAAGGAACC.
[0078] Specifically, the hairpin sequence comprises at least one of the following 1) to 4):
[0079] 1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID NO: 7 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 7 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 7;
[0080] 2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID NO: 8 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 8 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 8;

13790822.1 [0081] 3) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID NO: 9 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and [0082] 4) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID NO: 10 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.
[0083] The complementation includes complementation or reverse complementation as defined by the conventional art or common general knowledge, and/or performing complementation or reverse complementation according to complementary principles as defined by the conventional art or common general knowledge.
[0084] The polymerase includes a polymerase that can be used for in vitro nucleic acid amplification.
[0085] The nucleotide sequence capable of specifically amplifying the template specifically includes a primer sequence designed according to a characteristic sequence of the template; the characteristic sequence includes the characteristic sequence defined by the conventional art or common general knowledge; and the design includes the design method recorded by the conventional art or common general knowledge.
[0086] A, B, G, H, and I are only used to distinguish different complementary sequences or sequences, not for sorting.
[0087] Specifically, the kit and /or the biosensor comprise at least two upstream primers, and at least one of the following 1) to 8):
[0088] 1) one of the at least two upstream primers includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
[0089] 2) one of the at least two upstream primers includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2 by substituting, adding and/or deleting one or more 13790822. 1 nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2;
[0090] 3) one of the at least two upstream primers includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
[0091] 4) one of the at least two upstream primers includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5;
[0092] 5) the downstream primer includes the nucleotide sequence set forth in SEQ ID NO: 3;
[0093] 6) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
3;
[0094] 7) the template includes the nucleotide sequence set forth in SEQ ID
NO: 6; and [0095] 8) the template includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6.
[0096] The same function refers to enabling the amplification of the template.
[0097] Specifically, the linking arm comprises a compound having a long-chain structure.
[0098] Specifically, the linking arm is oxyethyleneglycol bridge, and the chemical structure of oxyethyleneglycol is:
0=P-0"

13790822.1 [0099] More specifically, one of the at least two upstream primers comprises:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTC
TCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT
or TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge -AACTATAC
AACCTACTACCTCATTTTTTTTTTTGCACATAACACCCC.
[0100] Specifically, the at least two upstream primers comprise:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTC
TCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTITT
and TGAGGTA GTAGGTTGTATAGTT- oxyethyleneglycol bridge -AACTATAC
AACCTACTACCTCAT=TTTTTTGCACATAACACCCC.
[0101] Specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker comprises biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer; and the labeling method belongs to a conventional art; and more specifically, the downstream primer is Biotin-TCATCGCACCGTCAAAGGAACC.
[0102] Specifically, the kit and/or the biosensor further comprise a hairpin sequence, wherein the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D
and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other.
[0103] The hairpin sequence comprises one of the following 1) to 4):
[0104] 1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID NO: 7 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID

13790822.1 NO: 7 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 7;
[0105] 2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID NO: 8 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 8 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 8;
[0106] 3) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID NO: 9 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and [0107] 4) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID NO: 10 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.
[0108] Specifically, the kit and/or the biosensor further include at least one of TDT reaction buffer, dATP, dGTP, TdT enzyme, hemin, G-quadruplex inducing buffer, ABTS2-, hydrogen peroxide, home-made XP beads, and magnetic beads modified with streptavidin on the surface.
[0109] Specifically, the kit and/or the biosensor comprise the following 1) to 5):
1) TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge -AAC
TATACAACCTACTACCTCATTTTTTTTITTGCACATAACACCCC;
2) AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTCTCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTIT ;
3) the nucleotide sequence set forth in SEQ ID NO: 6;
4) the nucleotide sequence set forth in SEQ ID NO: 3; and 5) the nucleotide sequence set forth in SEQ ID NO: 7; the nucleotide sequence set forth in SEQ ID NO: 8; the nucleotide sequence set forth in SEQ ID NO: 9; the nucleotide sequence set forth in SEQ ID NO: 10.

13790822.1 [0110] The chemical structure of oxyethyleneglycol is:
[0111] The present disclosure aims to provide a method for detecting Ag+, the method comprises amplifying nucleic acid in vitro, wherein the reaction system of nucleic acid amplification in vitro comprises a upstream primer, a downstream primer and a template; the upstream primer comprises: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification.
[0112] The polymerase includes a polymerase that can be used for in vitro nucleic acid amplification.
[0113] The downstream primer comprises: the nucleotide sequence set forth in SEQ ID NO: 3, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3.
[0114] The template comprises: the nucleotide sequence set forth in SEQ ID NO:
6, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6.
[0115] The same function refers to enabling the amplification of the template.

13790822.1 [0116] The linking arm comprises a compound having a long-chain structure.
[0117] Specifically, the linking arm is oxyethyleneglycol, and the chemical structure of oxyethyleneglycol is:
o o (:) 0=P¨ a (1) 1 .
[0118] Specifically, the upstream primer is TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol bridge -AACTATACAACCTACTACCTCATTTTTTTTT
TTGCACATAACACCCC.
[0119] Specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker comprises biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer; and the labeling method belongs to a conventional art; and more specifically, the downstream primer is Biotin-TCATCGCACCGTCAAAGGAACC.
[0120] Specifically, the method further comprising at least one of the following 1) to 2):
[0121] 1) the amplifying nucleic acid in vitro comprises ultra-rapid PCR, wherein the reaction process of the ultra-rapid PCR comprises: 90-98 C for 2-6s and 50-60 C for 2-8s, for 20-40 cycles in total;
[0122] specifically, the reaction process of the ultra-rapid PCR comprises: 95 C for 2s and 58 C for 3s for 30 cycles in total;
[0123] more specifically, the concentration of the upstream primer and the downstream primer in the reaction system of the ultra-rapid PCR is more than 10 times of the concentration of the normal PCR, even more specifically, 20 times; the reaction system of the ultra-rapid PCR further comprises a DNA polymerase, and the concentration of the DNA polymerase is more than 10 times of the concentration of the normal PCR, specifically, 60 times;
[0124] 2) the method further comprises a color reaction based on nucleic acid self-assembly, 13790822.1 wherein the reaction system of the color reaction based on nucleic acid self-assembly comprises a hairpin sequence, wherein the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F;
and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other.
[0125] The numbering of sequences is used to distinguish different hairpin sequences, not for sorting; C, D, E, and F are only used to distinguish different complementary sequences, not for sorting.
[0126] Specifically, the hairpin sequence comprises at least one of the following 1) to 2):
[0127] 1) the hairpin sequence 1 comprising the nucleotide sequence set forth in SEQ ID NO: 9, and/or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and [0128] 2) the hairpin sequence 2 comprising the nucleotide sequence set forth in SEQ ID NO:
10, and/or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.
[0129] Specifically, the method further comprises: mixing the reaction system and the hairpin sequence according to at least one method for detecting Ag+ according to the present disclosure, and incubating at 37 C for 20 min; adding TdT enzymatic reaction system to react at 37 C for 20 min, and heating at 75 C for 10 min; adding hemin and G-quadruplex inducing buffer and incubating at 37 C for 20min; and adding ABTS2- and hydrogen peroxide for color reaction.

13790822.1 [01301 Specifically, before adding TdT enzyme to the reaction system, the purification step is further comprised; specifically, the purification step comprises attaching biotin to the downstream primer and then purifying target product with biotin through the binding of biotin and avidin.
[0131] Specifically, in the reaction system of the color reaction based on nucleic acid self-assembly, the final concentration of each of the hairpin sequence 1 and the hairpin sequence 2 is 21,1.M.
[0132] Determine the present of target to be detected in the object to be detected by the color change of the final reaction system.
[0133] Specifically, when the color of the reaction system changes, the object to be detected contains the target to be detected; more specifically, when the color of the reaction system changes to blue-green, the object to be detected contains the target to be detected.
[0134] The concentration of the target to be detected in the object to be detected is calculated by a method of preparing a standard curve according to the color of the final reaction system [0135] Before the color reaction based on nucleic acid self-assembly, purification of the in vitro nucleic acid amplification product is performed.
[0136] Specifically, the purification is carried out by a kit purification or magnetic bead purification; the purification comprises removing other impurities other than the in vitro nucleic acid amplification products and hairpin sequence linking products in the reaction system.
[0137] The present disclosure further aims to provide a kit and/or a biosensor for detecting Ag+, and the kit and/or the biosensor comprise at least one of the following 1) to 4):
[0138] 1) a upstream primer, wherein the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;

13790822.1 [0139] 2) a upstream primer, a downstream primer and a template, wherein [0140] the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
[0141] the downstream primer includes: the nucleic acid sequence set forth in SEQ ID NO: 3, or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
[0142] the template includes: the nucleic acid sequence set forth in SEQ ID
NO: 6, or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6;
[0143] 3) a upstream primer and a hairpin sequence, wherein [0144] the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
[0145] the hairpin sequence includes: hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D
and three or 13790822.1 more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
[0146] 4) a upstream primer, a downstream primer, a template and a hairpin sequence, wherein [0147] the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
[0148] the downstream primer includes: the nucleic acid sequence set forth in SEQ ID NO: 3, or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
[0149] the template includes: the nucleic acid sequence set forth in SEQ ID
NO: 6, or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6; and [0150] the hairpin sequence includes: hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D
and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' 13790822.1 terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other.
[0151] The polymerase comprises a polymerase that can be used for in vitro nucleic acid amplification.
[0152] The same function refers to enabling the amplification of the template.
[0153] The linking arm comprises a compound having a long-chain structure.
[0154] Specifically, the linking arm is oxyethyleneglycol bridge, and the chemical formula of oxyethyleneglycol is:
_o o _________________________________________________________ ¨P¨ 0-j) [0155] Specifically, the upstream primer is TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol bridge -AACTATACAACCTACTACCTCArM
____________ TTTTT
TTGCACATAACACCCC.
[0156] Specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker comprises biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer.
[0157] The labelling method is conventional art; more specifically, the downstream primer is Biotin-TC ATCGCACCGTCAAAGGAACC.
[0158] The numbering of sequences is used to distinguish different hairpin sequences, not for 13790822.1 sorting; C, D, E, and F are only used to distinguish different complementary sequences, not for sorting.
[0159] Specifically, the hairpin sequence comprises at least one of the following 1) to 2):
[0160] 1) the hairpin sequence 1 includes the nucleic acid sequence set forth in SEQ ID NO: 9 and/or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and [0161] 2) the hairpin sequence 2 includes the nucleic acid sequence set forth in SEQ ID NO: 10 and/or the nucleic acid sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.
[0162] The same function comprises: the upstream primer can open the hairpin structure of the hairpin sequence 1 by base complementation, and the hairpin sequence I realize a self-extension of the nucleotide chain under the action of the TDT enzyme; the hairpin sequence 2 can open the hairpin structure of the hairpin sequence 1 by base complementation; the hairpin sequence 1 and the hairpin sequence 2 can mutually cyclically open each other's hairpin structure and connect to each other; the hairpin sequence 1 can realize the self-extension of the nucleotide chain under the action of the TDT enzyme at the same time in a linking body formed by the hairpin sequence 1 and the hairpin sequence 2.
[0163] Specifically, the kit and/or the biosensor comprise the following 1) to 4):
[0164] 1) TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge -AA
CTATACAACCTACTACCTCATTTTTTTTTTTGCACATAACACCCC;
[0165] 2) the nucleotide sequence set forth in SEQ ID NO: 6;
[0166] 3) the nucleotide sequence set forth in SEQ ID NO: 3;
[0167] 4) the nucleotide sequence set forth in SEQ ID NO: 7, the nucleotide sequence set forth in SEQ ID NO: 8, the nucleotide sequence set forth in SEQ ID NO: 9, and the nucleotide sequence set forth in SEQ ID NO: 10;

13790822.1 wherein, the chemical structure of oxyethyleneglycol is:
o o cp-o ¨P-0-[0168] Specifically, the kit and/or the biosensor further includes at least one of TDT reaction buffer, dATP, dGTP, TdT enzyme, hemin, G-quadruplex inducing buffer, ABTS2-,hydrogen peroxide, home-made XP beads, and magnetic beads modified with streptavidin on the surface.
[0169] The present disclosure further aims to provide the use of at least one of any of the methods according to the present disclosure, and at least one of any of the kits and/or biosensors according to the present disclosure.
[0170] Specifically, the use comprises at least one of the following 1) to 4):
[0171] 1) detecting metals;
[0172] 2) producing products for use in metal detection and/or related products;
[0173] 3) detecting two or multiple metals; and [0174] 4) producing products for use in two or multiple metal detection and/or related products.
[0175] Specifically, the metal includes Hg2+ and/or Ag .
[0176] Optionally, any one of the uses does not include the diagnosis and treatment of the disease described in Article 25 of the Chinese Patent Law.
[0177] A novel dual colorimetric sensing method based on ultra-rapid PCR is established by the present disclosure:
[0178] (1) an ultra-rapid PCR system is established, which reduces the traditional PCR time from about 3 hours to 2.5 minutes, significantly reducing the time spent on PCRs;
[0179] (2) the ultra-rapid PCR system is equipped with an enzyme-linked nucleic acid self-assembly color module, which solves the problem, that the traditional PCR
is difficult to 13790822.1 visualize and quantitatively detect; and [0180] (3) the dual ultra-rapid PCR system is equipped with a dual enzyme-linked nucleic acid self-assembly color module to realize ultra-rapid, quantitative and visual detection of two heavy metals.
[0181] According to a specific embodiment of the present disclosure, a novel dual colorimetric sensing method is provided based on dual ultra-rapid PCR for use in a visualized and ultrasensitive detection of Hg2+ and Ag+. A dual amplification primer for ultra-rapid polymerase chain reaction (PCR) is designed based on a mercury ion thymine mismatch and a silver ion cytosine mismatch, and through the primer which can bind to the enzyme-linked nucleic acid self-assembly color module, an emerging method for nucleic acid detection based on mismatched mercury ion and silver ion dual target function is integrated and established.
[0182] The present disclosure has the following beneficial effects:
[0183] 1) the detection method and the biosensor established by the present disclosure are faster and more sensitive than the conventional method, and have the advantages of high specificity, high sensitivity, reliable detection results, etc., and can simplify the analysis and .
detection steps, shorten the analysis time, and more importantly make the online real-time detection possible, easy to carry and field work, and has very good application prospect in the field of heavy metal rapid detection;
[0184] 2) the detection method and the biosensor established by the present disclosure can simultaneously realize the dual specific detection of Hg2+ and Ag+, the detection has good specificity, high sensitivity, reliable detection result, can be discerned by the naked eye, and the detection process is quick and convenient, which are of great significance in daily monitoring or market screening and other aspects. Specifically, the sensitivity experiment results show that the detection method and the biosensor established by the present disclosure have a detection limit of 1.3 pM for Hg2+ and a detection limit of 2.5 pM for Ag+, and the detection sensitivity is high;
[0185] the specificity experiment results show that the detection method and biosensor established by the present disclosure do not cross-react with Cu2+ and Mg2+, and can realize dual specific detection of Hg2+ and Ag+ at the same time; the experiment results of spike recovery 13790822.1 detection indicate that the detection values of the detection method established by the present disclosure for Hg2+ and Ag+ are close to the actual value of standard substance added, and the detection results are reliable and accurate; and [0186] 3) the detection method and the biosensors established by the present disclosure solve the problem that the traditional PCR is difficult to visualize and quantitatively detect, and realize the ultra-rapid, quantitative and visual detection of the dual heavy metals Hg2+ and Ag+.
BRIEF DESCRIPTION OF DRAWINGS
[0187] Figure 1 is a schematic diagram showing the structure of ultra-rapid PCR device.
[0188] Figure 2 are the results of verification of the amplification of the dual ultra-rapid PCR;
wherein, lane 1 is the result of only adding Ag+ in the reaction system; lane 2 is the result of only adding Hg2+ in the reaction system; lane 3 and lane 4 are the results of adding Hg2+ and Ag+ at the same time in the reaction system; lane 5 is the result of a negative control (without Hg2+ and Ag+
added to the reaction system); Figure 2a is an image showing the result after magnetic bead purification; Figure 2b is an image showing the comparison results before and after the magnetic bead purification, wherein lane 3 is the result without the magnetic bead purification, and lane 4 is the result with the magnetic bead purification.
[0189] Figure 3 is a standard curve of Hg2+.
[0190] Figure 4 is a standard curve of Ag+.
[0191] Figure 5 is the result of a specificity experiment, wherein 1 is well 1, 2 is well 2, 3 is well 3, 4 is well 4; a is the result of detecting the sample containing Hg2+
and Cu2+; b is the result of detecting the sample containing Ag+ and Mg2+; and c is the result of detecting the sample containing Hg2+ and Ag+.
DETAILED DESCRIPTION
[0192] The experimental methods used in the following examples are conventional methods unless otherwise specified.

13790822.1 [0193] The molecular biology experimental methods not specifically described in the following examples are all carried out according to the specific methods listed in the book "Molecular Cloning: A Laboratory Manual" (third edition) by J. Sambrook, or carried out according to the instructions of kits and products.
[0194] The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1. Establishment of a dual colorimetric sensing method based on ultra-rapid PCR for detecting two heavy metals of Hg2+ and Ag .
I. Experimental materials [0195] The nucleotide sequences of primers designed in this example are shown in Table 1 and Sequence Listing.
Table 1 Primers Sequences (from 5' to 3') AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol Primer 1 bridge-CTCTCTCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT
Primer2 Biotin-TCATCGCACCGTCAAAGGAACC
TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol Primer3 bridge-AACTATACAACCTACTACCTCATTIT'FTTITTTGCACATAACACCCC
TCATCGCACCGTCAAAGGAACCTCAGTATCAGTGCTATACGTCGATCAGTACCCC
Template TGTTATGTGCAAAAAAAAAAATTTTCCGAACGTGGC GATAATTTC AC
Hairpinl CTCTCTCTTTCCCTCTCTCTCTCTCGGGGCAGAGAGAGAGAGGGAAAGTCTCT
Hairpin2 AGAGAGAGAGAGGGAAAGAGAGAGCTTTCCCTCTCTCTCTCTGCCCCG
Hairpin3 ACTTTGAACTATACAACCTACTTGAGGTAGTAGG'FTGTATAGTTGTTTC
Hairpin4 AGTAGGTTGTATAGTTCAAAGTAACTATACAACCTACTACCTCA
[0196] In Table 1, the nucleotide sequence on the left side of the linking arm 13790822.1 (oxyethyleneglycol bridge) of the upstream primer Primer 1 is the nucleotide sequence set forth in SEQ ID NO: 1 in Sequence Listing, and the nucleotide sequence on the right side of the linking arm is the nucleotide sequence set forth in SEQ ID NO: 2 in Sequence Listing, and the chemical structure of linking arm is :
s.
¨0.
=
[0197] In Table 1, the downstream primer Primer 2 is obtained by labeling biotin on the first nucleotide at the 5' of the nucleic acid set forth in SEQ ID NO: 3 in Sequence Listing.
[0198] In Table 1, the nucleotide sequence on the left side of the linking arm (oxyethyleneglycol bridge) of the upstream primer Primer 3 is the nucleotide sequence set forth in SEQ ID NO: 4 in Sequence Listing, and the nucleotide sequence on the right side of the linking arm is the nucleotide sequence set forth in SEQ ID NO: 5 in Sequence Listing, and the chemical structure of the linking arm is the same as the chemical structure of the linking arm of Primer 1.
[0199] In Table 1, the nucleotide sequence of the template is the nucleotide sequence set forth in SEQ ID NO: 6 in Sequence Listing.
[0200] In Table 1, the hairpin sequences 1 to 4 (Hairpin 1,Hairpin 2,Hairpin 3,Hairpin 4) are the nucleotide sequences respectively set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 in Sequence Listing.
[0201] The sequences listed in Table 1 are all artificially synthesized.
[0202] SYBR Gold nucleic acid dye, terminal deoxynucleotidyl transferase(TdT), 10 X TdT
buffer, deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), dNTP, Ex Taq DNA polymerase, 10 X Taq buffer, hemin, mercury (III) chloride, silver nitrate, magnetic bead Sera-mag SpeedBeads, Magnetic bead Dynabeads MyOne Streptavidin Ti, and nucleic 13790822.1 acid molecular weight marker ultra-low range DNA ladder are purchased from Thermo Scientific Life Technologies. Water used in experiment is obtained from Milli-Q water purification system.
II. Construction of ultra-rapid PCR device [0203] The main structure of the ultra-rapid PCR device is shown in Figure 1, and its specific structure, connection method, working principle and working process are described below.
[0204] Light Cycler model capillary (20 1AL, 04 929 292 001, Roche) was used as a PCR
sample chamber for ultra-rapid PCR device. The samples were respectively collected at one end of each capillary by rapid centrifugation, and the capillary with the sample was fixed to the plastic holder after centrifugation. The plastic holder was connected to a stepper motor (42JSF630AS-1000, Just Motioin Control) which drove the capillary sample chamber fixed on the plastic holder to cyclically switch between a high-temperature water bath at 95 C and a medium-temperature water bath at 58 C to realize reaction temperature change and control during the ultra-rapid PCR. The stepper motor was powered by a switching power supply (S-100-24, Elecall), and the frequency or time control of the above-mentioned cyclic conversion of the stepper motor was realized by a DC servo motor driver (YZ-ACSD60, Moving) and Labview (version 2014). Temperature measurement was achieved by using a thermocouple encapsulated in a capillary. The amplification and linearization of the thermocouple signal were carried out using a temperature transmitter (SBWR-2260, K, Yuancheng) and processed using the Arduino UNO v1.0 chip. The Arduino UNO chip converted the received analog signal into a digital signal, which was then executed for calculation by the Arduino IDE
(version 1.8.1) module.
III. Establishment of dual ultra-rapid PCR
[0205] 1) Preparing a dual ultra-rapid PCR system, which is shown in Table 2.
Table 2 Reaction component Final concentration Template 0.05 jiM
Ex Taq DNA polymerase 1.5 U/mL
Hg2+/Ag+ 100 nM

13790822.1 Primer-1 2 jAM
Primer-2 4 j.tM
Primer-3 2 RM
dNTP 250 jAM
10xEx Taq Buffer 1xEx Taq Buffer ddH20 Up to 10 jiL
[0206] Four groups of reactions were performed, wherein the reaction system of the negative control group was without adding Hg2+ and Ake; only Agf was added in the reaction system of the experimental group 1; only Hg2+ was added in the reaction system of the experimental group 2; Hg2+ and Ag+ were added simultaneously in the reaction system of the experimental group 3, wherein a parallel experiment of the experimental group 3 was performed.
Primer 1, Primer 2 and Primer 3 were respectively the primers Primer 1, Primer 2 and Primer 3 described in the above Table 1.
[0207] 2) Reaction process of the dual ultra-rapid PCR
[0208] According to Table 2, 10 j.tL of the reaction system was prepared on ice, and then quickly placed in the ultra-rapid PCR device constructed in the step II for temperature control.
The temperature control and cycle number are shown in Table 3.
Table 3 Reaction Reaction time temperature 95 C 2s 30cyc1es, 2.5min in total 58 C 3s [0209] After completing the ultra-rapid reaction, the magnetic beads "home-made XP beads"
synthesized in the laboratory were used to purify the reaction system according to the size of the product fragment, and only the amplified product with metal ion binding was obtained.
[0210] The magnetic beads "home-made XP beads" synthesized in the laboratory were obtained by treating magnetic bead Sera-magSpeedBeads with PEG-8000, NaCl, Tris-HC1 and EDTA
according to the literature: Tian, Jingjing, et al "Visual Single Cell Detection of Dual-Pathogens based on Multiplex Super PCR (MS-PCR) and Asymmetric Tailing HCR (AT-HCR)."
Sensors 13790822.1 and Actuators B: Chemical (2018). Available online 3 January 2018.
[0211] 3) Verification the amplification results of dual ultra-rapid PCR
[0212] After completing the above dual ultra-rapid PCR, agarose gel electrophoresis pre-stained with 2% ethidium bromide was used to verify the amplification of the dual ultra-rapid .. PCR system, and the conditions of electrophoresis: 120 V for 25 min, and photographing system:
Molecular Imager Gel Doc XR (Bio-Rad).
[0213] The verification result of the dual ultra-rapid PCR amplification is shown in Figure 2.
The results of Figure 2a show that the dual ultra-rapid PCR and the reaction process established by the present disclosure achieve template amplification when Hg2+ and Ag+ are respectively .. present or exist simultaneously; at the same time, it can be seen from the results of Figure 2b that the magnetic beads play a good role in removing impurities.
[0214] IV. Establishment of enzyme-linked nucleic acid self-assembly chromatic module and dual visual detection of Hg2+ and Ag+
[0215] 1) Sensitivity experiment [0216] Standard curves of Hg2+ and Ag+ were plotted: the four hairpin probes listed in Table 1:
Hairpin 1, Hairpin 2, Hairpin 3, Hairpin 4 were dissolved in ultrapure water to a concentration of 100 p.M, heated at 95 C for 5 min, and then slowly cooled to room temperature; the reaction according to the dual ultra-rapid PCR system and the reaction process (including the magnetic bead purification step) described in the above step III were completed except that only the Hg2+
or only the Ag+ was added to the reaction system described in Table 2, and the final concentrations of Hg2+ in different reaction systems were 10 pM, 100 pM, 200 pM, 300 pM, 500 pM, 800 pM, 1000 pM, respectively; the final concentrations of Ag+ were 10 pM, 100 pM, 200 pM, 400 pM, 800 pM, 1000 pM, respectively; in addition, Primer-3 in Table 2 was not added in the reaction system with Hg2+, and Primer 1 was not added in the reaction system with Ag+.
[0217] After the completion of the reaction in multiple systems with different concentrations of Hg2+ or Ag+, Hairpin 1, Hairpin 2 prepared in ultrapure water above were added to the reaction system with Hg2+ before reaction, and Hairpin 3, Hairpin 4 prepared in ultrapure water above were added to the reaction system with Ag+ before reaction, then an self-assembly buffer (8 mM

13790822.1 Na2HPO4, 2.5 mM NaH2PO4, 0.15 M NaC1, 2 mM MgCl2, pH 7.4) was respectively added to each reaction system to make the total volume of each reaction system to 50 1.t1., and each hairpin probe at a final concentration of 2 M; the obtained reaction systems were incubated at 37 C for 20 mM to obtain HCR products; then the magnetic beads with the surface modification of one layer of avidin (Dynabeads MyOneTM Streptavidin Ti) was used to bind to biotinylated HCR
double-stranded product, and impurities such as hairpin probes not attached to the HCR
double-stranded product were removed, and finally the magnetic beads were removed by high-salt elution to obtain a purified HCR product.
[0218] A functional nucleic acid self-assembly system catalyzed by TdT enzyme was established, which comprised: 1 X TDT reaction buffer (purchased from Thermo Fisher Scientific), 0.4 mM dATP, 0.6 mM dGTP, 20 U/ IlL of TdT enzyme and 50 lit of purified HCR
product were reacted at 37 C for 20 mM, and heated at 75 C for 10 min to terminate enzymatic reaction to form a G-rich sequence; 10 RI, of the enzymatic reaction product was taken, and 1 A
of hemin stock solution (10 M), 32 !IL of G-quadruplex inducing buffer (100 mM
2-(4-morpholine) ethanesulfonic acid (MES), 40 mM KCl, 0.05% Triton X-100, pH
5.5), 23 ptI, of ultrapure water were added and incubated at 37 C for 20 min to form G-quadruplex; 8 pt of ABTS2- stock solution (20 mM) and 8 ptI., of hydrogen peroxide (H202) stock solution (20 mM) were added and incubated at room temperature in the dark for 5 min.
[0219] After the reaction was completed, the OD value of the reaction solution was measured at 415 nm by a spectrophotometer, and the respective standard curves of Hg2+ and Ag+ were plotted, and the results were shown in Figure 3 and Figure 4.
[0220] Determination of the minimum detection limit: according to the obtained standard curve and the 3a principle, the detection limit of Hg2+ was 1.3 pM, and the detection limit of Ag+ was 2.5 pM, indicating that the detection method established by the present disclosure has a high sensitivity.
[0221] 2) Accuracy experiment [0222] Recovery of standard substrate experiment: the reaction was completed according to the dual ultra-rapid PCR and the reaction process described in the above step III, the difference was:

13790822.1 only the final concentration of 400 pM Hg2+ was added to the reaction system described in Table 2, without adding Primer 3 and Ag+ in Table 2. After the reaction, the color was developed according to the steps described in the above sensitivity experiment, after completion, according to the prepared standard curve, the concentration of Hg2+ detected by the method established by the present disclosure was calculated to be (400 5.33) pM, which was close to the standard substrate added, indicating that the detection method established by the present disclosure has reliable detection result and high accuracy.
[0223] The reaction was completed according to the ultra-rapid PCR and the reaction process described in the above step III, the difference was: only the final concentration of 500 pM Ag+
was added to the reaction system described in Table 2, without adding Primer 1 and Hg2+ in Table 2. After the reaction, the color was developed according to the steps described in the above sensitivity experiment, after completion, according to the prepared standard curve, the concentration of Ag+ detected by the method established by the present disclosure was calculated, and the detection result was shown in Table 4.
[0224] The detection value (standard substrate recovery value) of the method established by the present disclosure in Table 4 is close to the standard substrate added, indicating that the detection method established by the present disclosure has reliable detection result and high accuracy.
Table 4 Standard Substrate Added Standard recoverya +SDb Sample (pM) (pM) Hg2+ 400 400 5.33 Ag+ 500 500 2.87 [0225] 3) Specificity experiment [0226] The experimental group with Hg2+ and Cu2+ at a final concentration of 500 pM added to the PCR ultra-rapid reaction system listed in Table 2 was counted as experimental group a; the experimental group with Ag+ and Mg2+ at a final concentration of 500 pM was counted as experimental group b; the experimental group with Hg2+ and Ag+ at a final concentration of 500 pM was counted as experimental group c; the dual ultra-rapid PCR according to the above step III

13790822.1 (except the type and concentration of metal ions in the system) were carried out in three groups (experimental group a, experimental group b, experimental group c), and four identical reactions were performed in each group.
[0227] The four hairpin probes listed in Table 1 above: Hairpin 1, Hairpin 2, Hairpin 3, Hairpin 4 were dissolved in ultrapure water to a concentration of 100 M, and heated at 95 C for 5 min, then slowly cooled to room temperature for later use.
[0228] Each reaction system (10 L system) which completed the dual ultra-rapid PCR was separately added to color reaction system. The first reaction system of each group (group a, group b, group c) was added to three wells (labeled with number 1), in which Hairpin 1 and Hairpin 2 were dissolved in ultrapure water in advance). The second reaction system of each reaction system was added to three wells (labeled with number 1), in which Hairpin 3 and Hairpin 4 were dissolved in ultrapure water in advance). The remaining two reaction systems of each reaction system were added to three wells (labeled with number 3) and another three wells (labeled with number 4) respectively. No hairpin was added to well 3 and well 4, as a negative control.
Self-assembly buffer solution (8 mM Na2HPO4, 2.5 mM NaH2PO4, 0.15 M NaCl, 2 mM
MgCl2, pH 7.4) was added to each well, and the final concentration of each hairpin probe was 2 M, and the volume of each well was 50 L. All the wells were incubated at 37 C for 20 min, and the resultants were purified by magnetic beads to obtain purified HCR products.
[0229] The above purified HCR product was separately added to the wells containing 1 x TDT
reaction buffer (purchased from Thermo Fisher Scientific), 0.4 mM dATP, 0.6 mM
dGTP, and 20 U/ L TdT enzyme, and reacted at 37 C for 20 min. The enzymatic reaction was terminated by heating at 75 C for 10 min to form a G-rich sequence; 1 L of hemin stock solution (10 M), 32 L. of G-quadruplex inducing buffer (100 mM 2-(4-morpholine) ethanesulfonic acid (MES), 40 mM KC1, and 0.05% Triton X-100, pH 5.5), and 23 L of ultrapure water were added to the enzymatic reaction system and incubated at 37 C for 20 min to form G-quadruplex; 8 L of ABTS2- stock solution (20 mM) and 8 of L hydrogen peroxide (H202) stock solution (20 mM) were added and incubated at room temperature in the dark for 5 min.
[0230] The experimental results were shown in Figure 5. The results of Figure 5 showed that the detection method and the biosensor established by the present disclosure do not cross-react 13790822.1 with Cu2+ and Mg2+, and can simultaneously realize the dual specific detection of Hg2+ and Agt [0231] The examples described above are only illustrative of the embodiments of the present disclosure, and the description thereof is more specific and detailed, but is not to be construed as limiting the scope of the present disclosure. However, any technical solution obtained by using equivalent replacement or equivalent transformation should fall within the protection scope of the present disclosure.

13790822.1 Sequence Listing <110> China Agricultural University <120> New Method for Visual Quantitative Detection of Dual Heavy Metal Ions <130> 0P180388 <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 24 <212> DNA
<213> Artificial Sequence <400> 1 agagagagag agggaaagag agag 24 <210> 2 <211> 50 <212> DNA
<213> Artificial Sequence <400> 2 ctctctcttt ccctctctct ctctgtgaaa ttatcgccac gttcggtttt 50 <210> 3 <211> 22 13790822.1 <212> DNA
<213> Artificial Sequence <400> 3 tcatcgcacc gtcaaaggaa cc 22 <210> 4 <211> 22 <212> DNA
<213> Artificial Sequence <400> 4 tgaggtagta ggttgtatag tt 22 <210> 5 <211> 47 <212> DNA
<213> Artificial Sequence <400> 5 aactatacaa cctactacct catttttttt tttgcacata acacccc 47 <210> 6 <211> 102 <212> DNA

13790822.1 <213> Artificial Sequence <400> 6 tcatcgcacc gtcaaaggaa cctcagtatc agtgctatac gtcgatcagt acccctgtta 60 tgtgcaaaaa aaaaaatttt ccgaacgtgg cgataatttc ac 102 <210> 7 <211> 53 <212> DNA
<213> Artificial Sequence <400> 7 ctctctcttt ccctctctct ctctcggggc agagagagag agggaaagtc tct 53 <210> 8 <211> 48 <212> DNA
<213> Artificial Sequence <400> 8 agagagagag agggaaagag agagctttcc ctctctctct ctgccccg 48 <210> 9 <211> 49 <212> DNA
<213> Artificial Sequence

-41-13790822.1 <400> 9 actttgaact atacaaccta cttgaggtag taggttgtat agttgtttc 49 <210> 10 <211> 44 <212> DNA
<213> Artificial Sequence <400> 10 agtaggttgt atagttcaaa gtaactatac aacctactac ctca 44

-42-13790822.1

Claims (10)

1. A method for detecting a metal, comprising nucleic acid amplification in vitro, wherein the reaction system of nucleic acid amplification in vitro comprises a downstream primer, a template, and at least two upstream primers;
each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other;
each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected;
the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer;
the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other;
the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template.

2. The method according to claim 1, further comprising at least one of the following 1) to 3):
1) the nucleic acid amplification in vitro includes ultra-rapid PCR, wherein the reaction process of the ultra-rapid PCR comprises: 90-98 °C for 2-6s and 50-60 °C for 2-8s, for 20-40 cycles in total;

2) the linking arm comprises a compound having a long-chain structure; and 3) the nucleotide sequence capable of binding to the metal to be detected includes a nucleotide sequence containing thymine or cytosine.

3. The method according to claims 1 and/or 2, further comprising at least one of the following 1) to 8):
1) one of the at least two upstream primers includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
2) one of the at least two upstream primers includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2;
3) one of the at least two upstream primers includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
4) one of the at least two upstream primers includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5;
5) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 3;
6) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
3;
7) the template includes the nucleotide sequence set forth in SEQ ID NO: 6;
and 8) the template includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6.

4. The method according to claims 1, 2 and/or 3, further comprising performing a color reaction based on nucleic acid self-assembly, wherein the reaction system of the color reaction based on nucleic acid self-assembly comprises a hairpin sequence, wherein the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence;
the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other.

5. The method according to claim 4, wherein the hairpin sequence comprises at least one of the following 1) to 4):
1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID
NO: 7 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 7 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 7;
2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID
NO: 8 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 8 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 8;
3) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID
NO: 9 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and 4) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID
NO: 10 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID
NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.

6. The method according to claims 4 and/or 5, wherein the color reaction based on nucleic acid self-assembly further comprises at least one of the following 1) to 2):
1) mixing at least one reaction system prepared by the method according to claims 1, 2 and/or 3 with at least one hairpin sequence defined in the method according to claims 4 and/or 5, and incubating the mixture at 37 °C for 20 min; adding TdT enzymatic reaction system to react at 37 °C for 20 min, and heating at 75°C for 10 min; adding hemin and G-quadruplex inducing buffer and incubating at 37 °C for 20min; and adding ABTS2- and hydrogen peroxide for color reaction; and 2) in the reaction system of the color reaction based on nucleic acid self-assembly, the final concentration of each of the hairpin sequence 1 and the hairpin sequence 2 is 21.1.M.

7. A kit and/or a biosensor for detecting a metal, wherein the kit and/or the biosensor comprises at least one of the following 1) to 6):
1) at least two upstream primers, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
2) a template, wherein the template at least comprises a complementary sequence G, a complementary sequence H and a sequence I, wherein the complementary sequence G and the complementary sequence H are respectively complementary and/or reverse complementary to the nucleotide sequence of the at least two upstream primers capable of specifically amplifying the template; and the nucleotide sequence of the sequence I is the same as the nucleotide sequence of the downstream primer capable of specifically amplifying the template;
3) a downstream primer, a template and at least two upstream primers, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
4) at least two upstream primers and a hairpin sequence, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template; and the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
5) at least two upstream primers, a template and a hairpin sequence, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
the template at least comprises a complementary sequence G, a complementary sequence H and a sequence I, wherein the complementary sequence G and the complementary sequence H are respectively complementary and/or reverse complementary to the nucleotide sequence of at least two upstream primers capable of specifically amplifying the template; and the nucleotide sequence of the sequence I is the same as the nucleotide sequence of the downstream primer capable of specifically amplifying the template; and the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
6) a downstream primer, a template, at least two upstream primers and a hairpin sequence, wherein each of the respective nucleotide sequences of the at least two upstream primers has at least one nucleotide different from the other; each upstream primer of the at least two upstream primers comprises a complementary sequence A, a linking arm, a complementary sequence B, a nucleotide sequence capable of specifically amplifying the template, and a nucleotide sequence capable of binding to the metal to be detected; the linking arm is provided between the complementary sequence A and the complementary sequence B, and the nucleotide sequence capable of specifically amplifying the template and the nucleotide sequence capable of binding to the metal to be detected are provided at 5' terminal or 3' terminal of the upstream primer; the nucleotide sequences of the complementary sequence A and the complementary sequence B are complementary and/or reverse complementary to each other; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
the downstream primer comprises the nucleotide sequence capable of specifically amplifying the template;
the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and 3 or more arbitrary nucleotides, wherein the 3 or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B, and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
specifically, the nucleotide sequence capable of binding to the metal to be detected includes a nucleotide sequence containing thymine or cytosine;

specifically, one of the at least two upstream primers comprises at least one of the following 1) to 4):
1) a primer obtained by linking the nucleotide sequences set forth in SEQ ID
NO: 1 and SEQ ID NO: 2 via the linking arm;
2) a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID
NO: 2 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2;
3) a primer obtained by linking the nucleotide sequences set forth in SEQ ID
NO: 4 and SEQ ID NO: 5 via the linking arm;
4) a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID
NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5;
specifically, the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 3 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
specifically, the template includes the nucleotide sequence set forth in SEQ
ID NO: 6, and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO:
6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6;
specifically, the linking arm comprises a compound having a long-chain structure;
specifically, the linking arm is oxyethyleneglycol bridge, and the chemical formula of oxyethyleneglycol is:

specifically, one of the at least two upstream primers includes:
AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTCTCTTTCCC
TCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT or TGAGGTAGTAGGTTG
TATAGTT- oxyethyleneglycol bridge -AACTATACAACCTACTACCTCATTITTTTITTT
GCACATAACACCCC;
specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker comprises biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer; and the labeling method belongs to a conventional art;
specifically, the hairpin sequence comprises at least one of the following 1) to 4):
1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID
NO: 7 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 7 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 7;
2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID
NO: 8 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 8 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 8;
3) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID
NO: 9 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and 4) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID
NO: 10 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ

ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10;
specifically, the kit and/or the biosensor comprises the following 1) to 5):
1) TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge -AACTATACAA
CCTACTACCTCATITTITITITTGCACATAACACCCC;
2) AGAGAGAGAGAGGGAAAGAGAGAG- oxyethyleneglycol bridge -CTCTCTCT
TTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTM;
3) the nucleotide sequence set forth in SEQ ID NO: 6;
4) Biotin-TCATCGCACCGTCAAAGGAACC; and 5) the nucleotide sequence set forth in SEQ ID NO: 7, the nucleotide sequence set forth in SEQ ID NO: 8, the nucleotide sequence set forth in SEQ ID NO: 9, and the nucleotide sequence set forth in SEQ ID NO: 10.

8. A method for detecting Ag+, comprising nucleic acid amplification in vitro, wherein the reaction system of nucleic acid amplification in vitro comprises a upstream primer, a downstream primer and a template;
the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
the downstream primer includes: the nucleotide sequence set forth in SEQ ID
NO: 3, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO:
3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
the template includes: the nucleotide sequence set forth in SEQ ID NO: 6, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6;
specifically, the method further comprises at least one of the following 1) to 2):
1) the nucleic acid amplification in vitro includes ultra-rapid PCR, wherein the reaction process of the ultra-rapid PCR comprises: 90-98 °C for 2-6s and 50-60 °C for 2-8s, for 20-40 cycles in total;
2) color reaction based on nucleic acid self-assembly, wherein the reaction system of the color reaction based on nucleic acid self-assembly comprises a hairpin sequence, wherein the hairpin sequence comprises hairpin sequence 1 and/or hairpin sequence 2; the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
specifically, the hairpin sequence comprises at least one of the following 1) to 2):
1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID
NO: 9, and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and 2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID
NO: 10, and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ

ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10.

9. A kit and/or a biosensor for detecting Ag+, comprising at least one of the following 1) to 4):
1) a upstream primer, wherein the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ 1D NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
2) a upstream primer, a downstream primer and a template, wherein the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
the downstream primer includes: the nucleotide sequence set forth in SEQ ID
NO: 3, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO:
3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
the template includes: the nucleotide sequence set forth in SEQ ID NO: 6, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6;
3) a upstream primer and a hairpin sequence, wherein the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
the hairpin sequence includes: hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
4) a upstream primer, a downstream primer, a template and a hairpin sequence, wherein the upstream primer includes: a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm, or a primer obtained by linking via the linking arm nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID NO: 5; the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification;
the downstream primer includes: the nucleotide sequence set forth in SEQ ID
NO: 3, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO:
3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 3;
the template includes: the nucleotide sequence set forth in SEQ ID NO: 6, or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 6; and the hairpin sequence includes: hairpin sequence 1 and/or hairpin sequence 2;
the hairpin sequence 1 comprises a complementary sequence C, a complementary sequence D and three or more arbitrary nucleotides, wherein the three or more arbitrary nucleotides are provided at the 5' terminal and/or the 3' terminal of the hairpin sequence; the hairpin sequence 2 comprises a complementary sequence E and a complementary sequence F; and the complementary sequence D and the complementary sequence F are complementary and/or reverse complementary to each other; the complementary sequence C is complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B , and the complementary sequence C and the complementary sequence E are complementary and/or reverse complementary to each other;
specifically, the linking arm comprises a compound having a long-chain structure;
more specifically, the linking arm is oxyethyleneglycol bridge, and the chemical formula of oxyethyleneglycol is:
specifically, the downstream primer is a primer labeled with immune marker, wherein the immune marker includes biotin, and the biotin is labeled on the first nucleotide at the 5' terminal of the downstream primer; and the labeling method belongs to a conventional art;
specifically, the hairpin sequence comprises at least one of the following 1) to 2):
1) the hairpin sequence 1 includes the nucleotide sequence set forth in SEQ ID
NO: 9 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9; and 2) the hairpin sequence 2 includes the nucleotide sequence set forth in SEQ ID
NO: 10 and/or the nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ
ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10;
specifically, the kit and/or the biosensor comprises the following 1) to 4):
1) TGAGGTAGTAGGTTGTATAGTT- oxyethyleneglycol bridge -AACTATACAA
CCTACTACCTCATTTITITTTITGCACATAACACCCC;
2) the nucleotide sequence set forth in SEQ ID NO: 6;
3) Biotin-TCATCGCACCGTCAAAGGAACC;
4) the nucleotide sequence set forth in SEQ ID NO: 7, the nucleotide sequence set forth in SEQ ID NO: 8, the nucleotide sequence set forth in SEQ ID NO: 9, and the nucleotide sequence set forth in SEQ ID NO: 10; and wherein, the chemical structure of oxyethyleneglycol is:

10. Use of the method according to claims 1, 2, 3, 4, 5, 6 and/or 8, and the kit and/or biosensor according to claims 7 and/or 9.