CN108315400A - A kind of visualization of heavy metal ion quantifies new detecting method - Google Patents

A kind of visualization of heavy metal ion quantifies new detecting method Download PDF

Info

Publication number
CN108315400A
CN108315400A CN201810142125.6A CN201810142125A CN108315400A CN 108315400 A CN108315400 A CN 108315400A CN 201810142125 A CN201810142125 A CN 201810142125A CN 108315400 A CN108315400 A CN 108315400A
Authority
CN
China
Prior art keywords
sequence
seq
nucleotide
nucleotide sequence
complementary series
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810142125.6A
Other languages
Chinese (zh)
Inventor
许文涛
罗云波
黄昆仑
杜再慧
田晶晶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN201810142125.6A priority Critical patent/CN108315400A/en
Publication of CN108315400A publication Critical patent/CN108315400A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a kind of colorimetric sensing new methods based on supper-fast PCR, are used for Hg2+Visualization super sensitivity detection.The new method is according to mercury ion thymidine mispairing, design supper-fast PCR (Polymerase Chain Reaction, PCR amplimer) and template, simultaneously by the primer in combination with enzyme-linked nucleic acid self assembly colour developing module, a kind of the functional nucleic acid new detecting method and biosensor of the emerging mercury ion target based on mispairing are established in integration.The detection method and biosensor that the present invention is established, it is more faster than conventional method, sensitiveer, has the advantages that high specificity, high sensitivity, reliable testing result, it can be with Simplified analysis detecting step, shorten analysis time, it is often more important that make it possible on-line real-time measuremen, easy to carry and field work, in heavy metal field of fast detection, there is extraordinary application prospect.

Description

A kind of visualization of heavy metal ion quantifies new detecting method
Technical field
The invention belongs to technical field of biological, and in particular to a kind of method and biosensor of detection heavy metal.
Background technology
Mercury seldom exists with the state of simple metal in nature, with mercuric sulphide, chlorine sulphur mercury ore, sulphur antimony mercury usually in mineral reserve The states such as mine exist.Mercury is a kind of heavy metal element having huge poison, with the continuous acceleration of Progress in industrialization, more and more mercury Gathered by food chain, it is more serious to the harm of human body.It is soaked by number of ways such as water, air, food, drug, cosmetics Enter human body, human body is damaged.Especially pregnant woman will pay special attention to avoid contact with mercury, because either organic mercury (methylates Mercury) and inorganic mercury the health of fetus can all be had an impact.
Traditional Hg2+Detection method includes mainly atomic absorption spectrography (AAS) (AAS), atomic fluorescence spectrometry (AFS), inductance Coupled plasma mass, electrochemical analysis method, atomic absorption spectrophotometry etc., the detection of these methods is sensitive, accurate, But generally require longer detection cycle and professional's operation.Due to organic dyestuff, the chemical sensor of albumen, DNA, film The advantages of, so that it is rapidly developed in terms of mercury detection and analysis, but there is also water solubility, sensitivity, stability, selectivity etc. are each The deficiency of aspect.It is applied to the continuous development of colorimetric method along with novel nano-material, largely compensates for tradition side The deficiency of method.Since colorimetric method is easy to operate, low to instrument requirements, obtained as a kind of method quickly, effectively detecting mercury Broad development.But traditional colorimetric detection mercury method still has certain limitation, such as complex for operation step, sensitivity and choosing The organic solvent that selecting property is bad, need to use easily pollutes the environment, therefore free of contamination, easy to be fast there is an urgent need to develop Speed, highly sensitive and high specific method meet the needs of trace meter mercury detection.
Invention content
The detection method and biosensor that the present invention establishes, overcome the deficiency of existing detection technique, realize counterweight That metal carries out is accurate, quickly, the detection and analysis that is simple and efficient, be a kind of cheap, quick, sensitive, high specificity, lowest detection 1.3pM is limited far below Hg in tap water as defined in the World Health Organization (WHO)2+Limited Doses 30nmol/L mercury ion detection New method.
It is an object of the present invention to provide a kind of detection methods of metal, and the method includes beyond body nucleic acids to expand skill At least one of art, the reaction system of the isothermal DNA amplification include following 1) -2)：
1) sense primer, the sense primer include：Complementary series A, linking arm, complementary series B, can specific amplification mould The nucleotide sequence of plate and the nucleotide that can be combined with metal to be measured；The linking arm is located at the complementary series A and complementary sequence Between arranging B, it is described can specific amplification template nucleotide sequence and the nucleotide that can be combined with metal to be measured on described Swim the 5 ' ends or 3 ' ends of primer；The complementation of the nucleotide sequence of the complementary series A and the complementary series B and/or reverse complemental； The linking arm includes the structure that can inhibit polymerase combination and/or the knot that can inhibit new chain extension in beyond body nucleic acid amplification procedure Structure；
2) template, the template include the nucleotide of the nucleotide phase complementation combined with metal to be measured；
Specifically, the reaction system of the isothermal DNA amplification further includes downstream primer；The downstream primer includes Can specific amplification template nucleotide sequence.
Specifically, the template further includes complementary series H and sequence I；Wherein, the complementary series H draws with the upstream In object can specific amplification template nucleotide sequence is complementary and/or reverse complemental；The nucleotide sequence of the sequence I and institute State in downstream primer can specific amplification template nucleotide sequence it is identical.
It is described complementary including complementary or reverse complemental defined in the prior art or common knowledge, and/or according to existing skill Principle of complementarity defined in art or common knowledge carries out complementary or reverse complemental.
The polymerase includes the polymerase that can be used for beyond body nucleic acid amplification.
It is described can the nucleotide sequence of specific amplification template specifically include drawing designed by the characteristic sequence according to template Object sequence；The characteristic sequence includes characteristic sequence defined in the prior art or common knowledge；The design includes existing skill Design method recorded in art or common knowledge.
Described A, B, H, I are served only for distinguishing different complementary series or sequence, are not used in sequence.
At least one of specifically, the method further includes following 1) -3)：
1) isothermal DNA amplification includes supper-fast PCR reactions, the reaction process packet of the supper-fast PCR reactions It includes：90-98 DEG C, 2-6s；50-60 DEG C, 2-8s；Total 20-40 cycle；
2) linking arm includes the compound for having backbone；
3) nucleotide that can be combined with metal to be measured specifically includes the nucleotide containing thymidine or cytimidine.
Specifically, the reaction process of the supper-fast PCR reactions includes：95 DEG C, 2s；58 DEG C, 3s；Totally 30 cycles；
Again specifically, the reaction system middle and upper reaches primer of supper-fast PCR reactions and downstream primer it is a concentration of common 10 times or more of PCR concentration；Also specifically, being 20 times；Further include DNA polymerizations in the reaction system of the supper-fast PCR reactions Enzyme, 10 times or more of a concentration of regular-PCR concentration of the archaeal dna polymerase, also specifically, being 60 times；)
At least one of specifically, the method further includes following 1) -4)：
1) when the reaction system of the isothermal DNA amplification includes the sense primer, the sense primer packet It includes：By SEQ ID № in sequence table：1 and SEQ ID №：What nucleotide sequence shown in 2 obtained after being connected by linking arm draws Object；
2) when the reaction system of the isothermal DNA amplification includes the sense primer, the sense primer packet It includes：By SEQ ID № in sequence table：1 and/or SEQ ID №：Nucleotide sequence shown in 2 is by one or several nucleotide Replace and/or lack and or add and with SEQ ID № in sequence table：1 and/or SEQ ID №：Nucleotide sequence shown in 2 has The primer obtained after thering is the nucleotide sequence of identical function to be connected by linking arm；
3) when the reaction system of the isothermal DNA amplification includes the template, the template includes：Sequence table Middle SEQ ID №：Nucleotide sequence shown in 4；
4) when the reaction system of the isothermal DNA amplification includes the template, the template includes：By sequence SEQ ID № in table：Nucleotide sequence shown in 4 by one or several nucleotide substitution and/or lack and or add and with SEQ ID № in sequence table：The nucleotide sequence with the same function of nucleotide sequence shown in 4.
Specifically, when the reaction system of the isothermal DNA amplification includes the downstream primer, the downstream is drawn Object includes：SEQ ID № in sequence table：Nucleotide sequence shown in 3, and/or by SEQ ID № in sequence table：Nucleosides shown in 3 Acid sequence by one or several nucleotide substitution and/or lack and or add and with SEQ ID № in sequence table：Shown in 3 Nucleotide sequence nucleotide sequence with the same function；
The function includes that the amplification of the template can be achieved.
Specifically, the linking arm is the chemistry knot of oxyethyleneglycol bridge, oxyethyleneglycol Structure is：
Specifically, the sense primer includes：AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol bridge-CTCTCTCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT
Specifically, the downstream primer further include marked in the downstream primer it is immune labeled；The immune labeled packet Include biotin；The biotin labeling is on 5 ' first nucleotide in end of the downstream primer；The labeling method belongs to existing There is technology；Again specifically, the downstream primer is Biotin-TCATCGCACCGTCAAAGGAACC；
Specifically, the method further includes nucleic acid self assembly chromogenic reaction, the reaction of the nucleic acid self assembly chromogenic reaction System includes hair fastener sequence, and the hair fastener sequence includes hair fastener sequence one and/or hair fastener sequence two, and the hair fastener sequence one is wrapped It includes：The arbitrary nucleotide of complementary series C, complementary series D and 3 or more, described 3 or more arbitrary nucleotide are located at the hair 5 ' the ends and/or 3 ' ends of card sequence；The hair fastener sequence two includes complementary series E and complementary series F；The complementary series D with Complementary series F complementations and/or reverse complemental；The complementary series C and the complementary series A and/or complementary series B complementations and/ Or reverse complemental, the complementary series C and complementary series E complementations and/or reverse complemental.
Described one and two, for distinguishing different hair fastener sequences, are not used in sequence；It is different that described C, D, E, F are served only for difference Complementary series, be not used in sequence.
At least one of specifically, the hair fastener sequence includes following 1) -4)：
1) the hair fastener sequence one includes SEQ ID № in sequence table：Nucleotide sequence shown in 5；
2) the hair fastener sequence two includes SEQ ID № in sequence table：Nucleotide sequence shown in 6；
3) the hair fastener sequence one includes by SEQ ID № in sequence table：Nucleotide sequence shown in 5 passes through one or several The substitution of a nucleotide and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 5 has identical The nucleotide sequence of function；
4) the hair fastener sequence two includes by SEQ ID № in sequence table：Nucleotide sequence shown in 6 passes through one or several The substitution of a nucleotide and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 6 has identical The nucleotide sequence of function.
The function includes：The sense primer can open the hairpin structure of the hair fastener sequence one by base complementrity, And the hair fastener sequence one can realize the extension of itself nucleotide chain under the action of TDT enzymes；The hair fastener sequence two can lead to Cross the hairpin structure that base complementrity opens the hair fastener sequence one；The hair fastener sequence one and hair fastener sequence two can be mutual by base The mutual hairpin structure of mutual partially unrolling is mended, and is interconnected with one another；What the hair fastener sequence one and hair fastener sequence two were formed In connector, hair fastener sequence one can also realize the extension of itself nucleotide chain under the action of TDT enzymes simultaneously.
Specifically, the nucleic acid self assembly chromogenic reaction further includes following 1) -2) described at least one：
1) it is described in reaction system and claim 4 and/or 5 claim 1,2 and/or 3 the methods to be prepared Hair fastener sequence mixing in method, 20min is incubated in 37 DEG C；TdT enzyme reaction systems are added, after 37 DEG C are reacted 20min, in 75 DEG C heating 10min；Then hemin and the buffer-induced liquid of tetra- serobilas of G- are added and is incubated 20min in 37 DEG C；Finally plus Enter ABTS2-Chromogenic reaction is carried out with hydrogen peroxide；
2) in the reaction system of the nucleic acid self assembly chromogenic reaction, the end of the hair fastener sequence one or hair fastener sequence two is dense Degree is 2 μM.
Further include purification step specifically, before the addition TdT enzyme reaction systems；Specifically, the purification step packet It includes by connecting biotin in the downstream primer, life is carried with the method purifying that close enzyme chain nucleic is combined using biotin The target product of object element.
At least one of specifically, the method further includes following 1) -4)：
1) judge whether contain object to be measured in determinand by the color change of end reaction system；
2) object to be measured in determinand is calculated to make the method for standard curve by the color of end reaction system Concentration；
3) dual or Multiple detection is realized by increasing the type of sense primer and hairpin one, hair fastener sequence two.
4) further include being purified to beyond body nucleic acid amplified production before nucleic acid self assembly chromogenic reaction.
Specifically, when the color of reaction system changes, judge to contain object to be measured in determinand；Again specifically, When the color of reaction system is blue-green, judge to contain object to be measured in determinand；
The type of the hairpin one includes：Complementary series C in the hairpin one and the same upstream The hairpin of complementary series A and/or B complementation or reverse complemental in primer is otherwise same kind of hairpin one is Different types of hairpin one；The identical sense primer nucleotide sequence is the same sense primer.
Specifically, the purifying includes kits or magnetic beads for purifying method；The purifying includes removal reaction system In other impurities in addition to beyond body nucleic acid amplified production and hair fastener sequence link product.
It is described it is a further object to provide a kind of kit and/or biosensor for detecting metal At least one of kit and/or biosensor include following 1) -2) described：
1) sense primer, the sense primer include：Complementary series A, linking arm, complementary series B, can specific amplification mould The nucleotide sequence of plate and the nucleotide that can be combined with metal to be measured；The linking arm is located at the complementary series A and complementary sequence Between arranging B, it is described can specific amplification template nucleotide sequence and the nucleotide that can be combined with metal to be measured on described Swim the 5 ' ends or 3 ' ends of primer；The complementation of the nucleotide sequence of the complementary series A and the complementary series B and/or reverse complemental； The linking arm includes the structure that can inhibit polymerase combination and/or the knot that can inhibit new chain extension in beyond body nucleic acid amplification procedure Structure；
2) template, the template include the nucleotide of the nucleotide phase complementation combined with metal to be measured.
It is described complementary including complementary or reverse complemental defined in the prior art or common knowledge, and/or according to existing skill Principle of complementarity defined in art or common knowledge carries out complementary or reverse complemental.
The polymerase includes the polymerase that can be used for beyond body nucleic acid amplification.
It is described can the nucleotide sequence of specific amplification template specifically include drawing designed by the characteristic sequence according to template Object sequence；The characteristic sequence includes characteristic sequence defined in the prior art or common knowledge；The design includes existing skill Design method recorded in art or common knowledge.
Described A, B are served only for distinguishing different complementary series or sequence, are not used in sequence.
The nucleotide that can be combined with metal to be measured specifically includes the nucleotide containing thymidine or cytimidine.
At least one of specifically, the kit and/or biosensor further include following 1) -5) described：
1) hair fastener sequence, the hair fastener sequence include hair fastener sequence one and/or hair fastener sequence two, and the hair fastener sequence one is wrapped It includes：The arbitrary nucleotide of complementary series C, complementary series D and 3 or more, described 3 or more arbitrary nucleotide are located at the hair 5 ' the ends and/or 3 ' ends of card sequence；The hair fastener sequence two includes complementary series E and complementary series F；The complementary series D with Complementary series F complementations and/or reverse complemental；The complementary series C and the complementary series A and/or complementary series B complementations and/ Or reverse complemental, the complementary series C and complementary series E complementations and/or reverse complemental.
Described one and two, for distinguishing different hair fastener sequences, are not used in sequence；It is different that described C, D, E, F are served only for difference Complementary series, be not used in sequence.
2) downstream primer, the downstream primer include can specific amplification template nucleotide sequence；
Specifically, when the reaction system of the isothermal DNA amplification includes the downstream primer, the downstream is drawn Object includes：SEQ ID № in sequence table：Nucleotide sequence shown in 3, and/or by SEQ ID № in sequence table：Nucleosides shown in 3 Acid sequence by one or several nucleotide substitution and/or lack and or add and with SEQ ID № in sequence table：Shown in 3 Nucleotide sequence nucleotide sequence with the same function；
The function includes that the amplification of the template can be achieved；
Specifically, the downstream primer further include marked in the downstream primer it is immune labeled；The immune labeled packet Include biotin；The biotin labeling is on 5 ' first nucleotide in end of the downstream primer；The labeling method belongs to existing There is technology；)
3) when the kit and/or biosensor include the sense primer, the sense primer includes：By sequence SEQ ID № in list：1 and SEQ ID №：The primer that nucleotide sequence shown in 2 obtains after being connected by linking arm；
4) when the kit and/or biosensor include the sense primer, the sense primer includes：By sequence SEQ ID № in list：1 and/or SEQ ID №：Nucleotide sequence shown in 2 by one or several nucleotide substitution and/ Or lack and or add and with SEQ ID № in sequence table：1 and/or SEQ ID №：Nucleotide sequence shown in 2 has identical The primer that the nucleotide sequence of function obtains after being connected by linking arm；
The function includes that the amplification of the template can be achieved；
The linking arm includes the compound for having backbone；
Specifically, the linking arm is the chemistry knot of oxyethyleneglycol bridge, oxyethyleneglycol Structure is：
5) when the kit and/or biosensor include the template, the template packet further includes complementary series H With sequence I；Wherein, in the complementary series H and sense primer can specific amplification template nucleotide sequence it is complementary and/or Reverse complemental；The nucleotide sequence of the sequence I in downstream primer can the nucleotide sequence of specific amplification template it is identical.
It is described complementary including complementary or reverse complemental defined in the prior art or common knowledge, and/or according to existing skill Principle of complementarity defined in art or common knowledge carries out complementary or reverse complemental.
It is described can the nucleotide sequence of specific amplification template specifically include drawing designed by the characteristic sequence according to template Object sequence；The characteristic sequence includes characteristic sequence defined in the prior art or common knowledge；The design includes existing skill Design method recorded in art or common knowledge.
Described H, I are served only for distinguishing different complementary series or sequence, are not used in sequence.
Specifically, the template includes：SEQ ID № in sequence table：Nucleotide sequence shown in 4；And/or by sequence table Middle SEQ ID №：Nucleotide sequence shown in 4 by one or several nucleotide substitution and/or lack and or add and and sequence SEQ ID № in list：The nucleotide sequence with the same function of nucleotide sequence shown in 4.
The function includes that the amplification of the template can be achieved；
At least one of specifically, the hair fastener sequence includes following 1) -4)：
1) the hair fastener sequence one includes SEQ ID № in sequence table：Nucleotide sequence shown in 5；
2) the hair fastener sequence two includes SEQ ID № in sequence table：Nucleotide sequence shown in 6；
3) the hair fastener sequence one includes by SEQ ID № in sequence table：Nucleotide sequence shown in 5 passes through one or several The substitution of a nucleotide and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 5 has identical The nucleotide sequence of function；
4) the hair fastener sequence two includes by SEQ ID № in sequence table：Nucleotide sequence shown in 6 passes through one or several The substitution of a nucleotide and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 6 has identical The nucleotide sequence of function.
The function includes：The sense primer can open the hairpin structure of the hair fastener sequence one by base complementrity, And the hair fastener sequence one can realize the extension of itself nucleotide chain under the action of TDT enzymes；The hair fastener sequence two can lead to Cross the hairpin structure that base complementrity opens the hair fastener sequence one；The hair fastener sequence one and hair fastener sequence two can be mutual by base The mutual hairpin structure of mutual partially unrolling is mended, and is interconnected with one another；What the hair fastener sequence one and hair fastener sequence two were formed In connector, hair fastener sequence one can also realize the extension of itself nucleotide chain under the action of TDT enzymes simultaneously.
Specifically, the kit and/or biosensor further include following 1) -5)：
1)AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol bridge- CTCTCTCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT；
2)Biotin-TCATCGCACCGTCAAAGGAACC；
3) SEQ ID № in sequence table：Nucleotide sequence shown in 4；
4) SEQ ID № in sequence table：Nucleotide sequence shown in 5；
5) SEQ ID № in sequence table：Nucleotide sequence shown in 6；
Wherein, the chemical constitution of oxyethyleneglycol is：
Specifically, the kit and/or biosensor further include TdT reaction buffers, dATP, dGTP, TdT enzyme, Hemin, the buffer-induced liquid of tetra- serobilas of G-, ABTS2-, hydrogen peroxide, home-made XP beads, surface modification At least one of the magnetic bead of one layer of close enzyme chain nucleic.
It is also another object of the present invention to provide any the method for the present invention, any kit of the present invention and/or The application of biosensor.
Specifically, the application includes following 1) -4) at least one of application：
1) metal is detected；
2) product for preparing detection metal and/or the application in Related product；
3) dual or multi-metal detection；
4) application in the product and/or Related product detected for dual or multi-metal is prepared.
Specifically, the metal includes Hg2+。
Optionally, any application does not include the diagnosing and treating side of the disease described in patent law of china Article 25 Method.
A kind of colorimetric sensing new method based on supper-fast PCR that the present invention establishes：
(1) this method establishes supper-fast PCR reaction systems, and the normal PCR process for taking 3 hours or so is reduced to 2.5 minutes, significantly reduce the used time of PCR reactions；
(2) supper-fast PCR reaction systems are carried enzyme-linked nucleic acid self assembly to develop the color module, solving that normal PCR is difficult to can Depending on changing the problem quantitatively detected；
(3) supper-fast PCR reaction systems are carried into enzyme-linked nucleic acid self assembly colour developing module, realizes the ultrafast of heavy metal Speed, quantitative, Visual retrieval.
The specific embodiment of the present invention provides a kind of colorimetric sensing new method based on supper-fast PCR, is used for Hg2+ Visualization super sensitivity detection.The new method designs supper-fast PCR according to mercury ion thymidine mispairing The amplimer of (Polymerase Chain Reaction, PCR), while by the primer in combination with enzyme-linked nucleic acid self assembly Develop the color module, and a kind of functional nucleic acid new detecting method of the emerging mercury ion target based on mispairing is established in integration.
The present invention has following advantageous effects：
1) detection method and biosensor that the present invention is established, it is more faster than conventional method, sensitiveer, have special Property strong, high sensitivity, reliable testing result the advantages that, analysis time can be shortened with Simplified analysis detecting step, it is often more important that Make it possible that on-line real-time measuremen, easy to carry and field work have extraordinary answer in heavy metal field of fast detection Use foreground.
2) detection method and biosensor that the present invention is established can be achieved at the same time to Hg2+Specific detection, detection Specific good, high sensitivity, testing result is reliable, can visually distinguish, detection process is efficient and convenient, in daily monitoring or city Field screening etc. is of great significance.Specifically, sensitivity experiment the result shows that, the detection method established of the present invention and life Object sensor is to Hg2+Detection be limited to 1.3pM, the high sensitivity of detection；Specific test the result shows that, the present invention is established Detection method and biosensor are to Cu2+No cross reaction is, it can be achieved that Hg2+Specific detection；Mark-on reclaims test experience knot Fruit shows the detection method that the present invention is established and biosensor to Hg2+Detected value close to practical mark-on value, detection knot Fruit is reliable, accuracy is high.
3) detection method and biosensor that the present invention is established, solve normal PCR and are difficult to visualize quantitative detection Problem, realize heavy metal Hg2+Supper-fast, quantitative, Visual retrieval.
Description of the drawings
Fig. 1 is the structure chart of supper-fast PCR device.
Fig. 2 is the expanding effect verification result figure of supper-fast PCR reactions；Wherein, swimming lane 1 is DNA molecular amount standard；Swimming lane 2 (do not add Hg for negative control in reaction system2+) result；Swimming lane 3, swimming lane 4 and swimming lane 5 are to add Hg in reaction system2+ Result.
Fig. 3 is Hg2+Canonical plotting.
Fig. 4 is specificity experiments result figure, wherein 1 be micropore 1,2 be micropore 2,3 be micropore 3,4 is micropore 4.
Specific implementation mode
Experimental method used in following embodiments is conventional method unless otherwise specified.
Do not make the experimental methods of molecular biology illustrated, equal reference in following embodiments《Molecular Cloning:A Laboratory guide》 Listed specific method carries out in one book of (third edition) J. Pehanorm Brookers, or is carried out according to kit and product description.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1, one kind are for detecting heavy metal Hg2+Supper-fast PCR colorimetric sensing new method foundation
(1) experiment material
The nucleotide sequence of primer designed by the present embodiment is shown in Table 1 and sequence table.
Table 1
In table 1, the nucleotide on the left of the linking arm (oxyethyleneglycol bridge) of sense primer Primer 1 Sequence is SEQ ID № in sequence table：Nucleotide sequence shown in 1, the nucleotides sequence on the right side of linking arm are classified as SEQ in sequence table ID №：The chemical constitution of nucleotide sequence shown in 2, linking arm is：
In table 1, downstream primer Primer 2 is by SEQ ID № in sequence table：First core of the nucleotide shown in 35 ' Thuja acid, which is marked, to be obtained after biotin.
In table 1, the nucleotides sequence of template Template is classified as SEQ ID № in sequence table：Nucleotide sequence shown in 4.
In table 1, hair fastener sequence 1-2 (Hairpin 1, Hairpin 2) is followed successively by SEQ ID № in sequence table respectively：5、 SEQ ID №：Nucleotide sequence shown in 6.
Listed sequence is artificial synthesized in table 1.
SYBR Gold nucleic acid dyes, terminal deoxy transferase (TdT), 10 × TdT buffer, deoxyadenosine triphosphate (dATP), triphosphoric acid deoxy-guanine (dGTP), dNTP, Ex Taq archaeal dna polymerases, 10 × Taq buffer, chlorine high ferro are blood red Element, mercury chloride, magnetic bead Sera-mag SpeedBeads, magnetic beadMyOneTMStreptavidin T1, nucleic acid Molecular weight standard ultra-low range DNA ladder are purchased from silent winged science and technology (the Thermo Scientific Life of match Technologies).Experimental water is all from Milli-Q pure water systems.
(2) supper-fast PCR device is built
The primary structure of supper-fast PCR device is as shown in Figure 1, its specific structure, connection type and operation principle, work Process includes：
Supper-fast PCR device uses the capillary (20uL, 04 929 292 001, Roche) of Light Cycler models As the sample rooms PCR, by way of rapid centrifugation, sample can gather each capillary one end, band after the completion of centrifugation respectively There is the capillary of sample to be fixed on plastic stent.Plastic stent is connected to stepper motor (42JSF630AS-1000, Just Motioin Control) on, high temperature of the capillary sample room at 95 DEG C being fixed on plastic stent is driven by the stepper motor Between water-bath and 58 DEG C of medium temperature water-bath recycle conversion, realize in supper-fast PCR reaction process reaction temperature variation and Control.The stepper motor is powered by Switching Power Supply (S-100-24, Elecall), using DC servo motor driver (YZ-ACSD60, Moving) and Labview (version 2014) realize stepper motor above-mentioned cycle conversion frequency or The control of time.Temperature measurement is realized using the thermocouple being encapsulated in capillary.The amplification and linearisation of thermocouple signal Processing procedure then using temperature transmitter (SBWR-2260, K, Yuancheng) transmit and using Arduino UNO v1.0 Chip is handled.The analog signal of the temperature received is converted into digital signal by Arduino UNO chips, then by Arduino IDE (version 1.8.1) module executes operation.
(3) supper-fast PCR reactions
1) supper-fast PCR reaction systems are prepared, are specifically shown in Table 2：
Table 2
4 groups of reactions are carried out, wherein do not add Hg in the reaction system of negative control group2+；In the reaction system of experimental group one Add Hg2+；Experimental group two and two repetitions that experimental group three is experimental group one are tested, and Hg is added in reaction system2+.In table 2 Primer Primer-1, Primer-2 be followed successively by primer Primer 1, Primer 2 described in above-mentioned table 1 respectively.
2) supper-fast PCR reaction process：
According to table 2,10 microlitres of reaction systems are prepared on ice, are immediately placed in the supper-fast PCR reactions that step (2) is built It is controlled into trip temperature in device, temperature control and recurring number are shown in Table 3：
Table 3
After the completion of supper-fast PCR reactions, the magnetic bead " home-made XP beads " synthesized using this laboratory is according to production The size of object segment purifies reaction system, obtains the product for only having metal ion to combine amplification.
This laboratory synthesis magnetic bead " home-made XP beads " be according to " magnetic bead Sera-mag SpeedBeads " into The processing of row PEG-8000, NaCl, Tris-HCl, EDTA obtain, and specific preparation method is shown in document：Tian,Jingjing,et al."Visual Single Cell Detection of Dual-Pathogens based on Multiplex Super PCR(MS-PCR)and Asymmetric Tailing HCR(AT-HCR)."Sensors and Actuators B: Chemical(2018).Available online 3 January 2018。
3) the expanding effect verification of supper-fast PCR reactions：
After completing above-mentioned supper-fast PCR reaction process, verified using the prestained agarose gel electrophoresis of 2% ethidium bromide The expanding effect of supper-fast PCR reaction systems, deposition condition：120V for 25min, camera system：Molecular Imager Gel Doc XR(Bio-Rad)。
The expanding effect verification result of supper-fast PCR reaction is shown in Fig. 2, Fig. 2 the result shows that：In Hg2+In the presence of, the present invention is built Vertical supper-fast PCR reaction systems and reaction process realize the amplification of template, while magnetic bead plays and goes to clean well The effect of matter.
(4) foundation of enzyme-linked nucleic acid self assembly colour developing module and Hg2+Visual retrieval
1) sensitivity experiment
Hg2+Standard curve drafting：
By 2 hairpin probes (HairpinProbe) listed by above-mentioned table 1：Hairpin 1, Hairpin 2 is respectively with super Pure water is dissolved to 100 μM, in 95 DEG C heat 5min, after be slowly dropped to room temperature；
According to the supper-fast PCR reaction systems and reaction process (including magnetic beads for purifying step) described in above-mentioned steps (three) Reaction is completed, unlike：Multigroup reaction system is established, i.e., according to reaction system listed by table 2, is separately added into through gradient dilution Hg2+So that Hg in differential responses system2+Final concentration be followed successively by 10pM, 100pM, 200pM, 300pM, 500pM, 800pM, 1000pM。
By the above-mentioned Hg added with various concentration2+Multiple reaction systems complete reaction after, in each reaction system respectively The ultra-pure water solution of the Hairpin 1 and Hairpin 2 of above-mentioned preparation is added, is then added in each reaction system respectively again Self assembly buffer solution (8mM Na2HPO4,2.5mM NaH2PO4,0.15M NaCl,2mM MgCl2, pH 7.4) so that it is each anti- It is 50 μ L to answer the total volume of system, and makes the final concentration of of each hairpin probe (HairpinProbe) in each reaction system 2μM；All reaction systems of gained in 37 DEG C be incubated 20min, obtain HCR (hybridization chain reaction, HCR, Cross chain reaction) product；Then the magnetic bead of the close enzyme chain nucleic of one layer of surface modification is reused MyOneTMStreptavidin T1 go the HCR double-stranded products of junction belt biotin labeling, removal to be not attached to HCR double-stranded products On the impurity such as hairpin probe, remove magnetic bead finally by high eluting salt, obtain HCR product after purification.
The functionalization nucleic acid self-assembly system of TdT enzymatics is established, system includes：(match is silent to fly 1 × TdT reaction buffers Technological product), 0.4mMdATP, 0.6mMdGTP, 20U/ μ LTdT enzymes and 50 μ L HCR product after purification react 20min in 37 DEG C Afterwards, 10min termination enzymatic reactions are heated in 75 DEG C forms rich G sequence；10 μ L enzymatic reaction products are taken, 1 μ L chlorine siderosis is added Red pigment (hemin) liquid storage (10 μM), 32 μ L G-, the tetra- buffer-induced liquid of serobila (100mM 2- (4-morpholine) Ethanesulfonic acid (MES), 40mMKCl, with 0.05%Triton X-100, pH 5.5), 23 μ L ultra-pure waters；In 37 DEG C be incubated 20min formed tetra- serobilas of G；8 μ L ABTS are added2-Liquid storage (20mM) and 8 μ L hydrogen peroxide (H2O2) liquid storage (20mM) in Room temperature, which is protected from light, is incubated 5min.
After the completion of reaction Hg is drawn in the OD values of 415nm using spectrophotometer detection reaction solution2+Standard curve, paint The results are shown in Figure 3 for system.
The determination of minimum detection limit：
According to the standard curve of drafting and 3 σ principles, Hg is determined2+Detection limit be respectively 1.3pM, illustrate the present invention built Vertical new detecting method high sensitivity.
2) accuracy is tested
Mark-on reclaims test experience：
According to described in above-mentioned steps (three) supper-fast PCR reaction systems and reaction process complete reaction, unlike： Multigroup reaction system is established, i.e., according to reaction system listed by table 2, is separately added into the Hg of final concentration of 100,400,500pM2+, instead It develops the color according to step described in above-mentioned sensitivity experiment after answering, after the completion, according to made standard curve, this is calculated The Hg that the established method of invention detects2+Concentration, testing result is shown in Table 4.
The detected value (mark-on reclaims value) for the new method that the present invention establishes in table 4 illustrates that the present invention is built close to mark-on amount Vertical new detecting method testing result is reliable, and accuracy is high.
Table 4
3) specificity experiments
4 reaction systems are established, i.e., will be added final concentration of 500pM's in the supper-fast reaction systems of PCR listed by table 2 Hg2+As experimental group one, while final concentration is added respectively it is the Hg of 500pM2+、Cu2+As experimental group two, final concentration is added For the Cu of 500pM2+It is both not added with Hg as experimental group three, negative control2+Also it is not added with Cu2+Conduct experimental group four, according to above-mentioned Described in step (3) supper-fast PCR reactions (in addition to the type and concentration of metal ion in system do corresponding replace, Qi Tajun Unanimously) reacted.
By 2 hairpin probes (Hairpin Probe) listed by above-mentioned table 1：Hairpin 1, Hairpin 2 is respectively with super Pure water is dissolved to 100 μM, and 5min are heated in 95 DEG C, after to be slowly dropped to room temperature spare.
4 reaction systems (10ul systems) for completing supper-fast PCR reactions are added separately to coloring reaction system i.e. 4 In micropore (ultra-pure water solution of Hairpin 1 and Hairpin 2 is dissolved in advance in 4 micropores).The reactant of experimental group one System is added in the micropore 1 that number is 1, and the reaction system of experimental group two is added in the micropore 2 that number is 2, experimental group three Reaction system is added in the micropore 3 that number is 3, and the reaction system of experimental group four is added in the micropore 4 that number is 4；Divide again Self assembly buffer solution (8mM Na are added not in each micropore2HPO4,2.5mM NaH2PO4,0.15M NaCl,2mM MgCl2, PH 7.4), and make final concentration of 2 μM of each hairpin probe (Hairpin Probe), each micropore is 50 microlitres, institute There is micropore to be incubated 20min in 37 DEG C, HCR purified products are obtained after purification respectively through magnetic bead.
Above-mentioned HCR purified products are added separately to containing 1 × TdT reaction buffers (the silent winged technological product of match), In the micropore of 0.4mMdATP, 0.6mMdGTP, 20U/ μ LTdT enzymes, after 37 DEG C are reacted 20min, heats 10min in 75 DEG C and terminate Enzymatic reaction forms rich G sequence；1 μ L hemin liquid storages (10 μM), the induction of 32 μ L G-, tetra- serobilas are added in enzymatic reaction product Buffer solution (100mM 2- (4-morpholine) ethanesulfonic acid (MES), 40mMKCl, with 0.05%Triton X-100, pH 5.5), 23 μ L ultra-pure waters；It is incubated 20min in 37 DEG C and forms tetra- serobilas of G；8 μ L ABTS are added2-Liquid storage (20mM) with 8 μ L hydrogen peroxide (H2O2) liquid storage (20mM) in room temperature be protected from light be incubated 5min.
Experimental result as shown in figure 4, Fig. 4 the result shows that the detection method established of the present invention and biosensor to Cu2+ No cross reaction is, it can be achieved that Hg2+Specific detection.
Embodiments of the present invention above described embodiment only expresses, the description thereof is more specific and detailed, but can not Therefore it is interpreted as the limitation to the scope of the claims of the present invention, as long as skill obtained in the form of equivalent substitutions or equivalent transformations Art scheme should all be fallen within the scope and spirit of the invention.
Sequence table
<110>China Agricultural University
<120>A kind of visualization of heavy metal ion quantifies new detecting method
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
agagagagag agggaaagag agag 24
<210> 2
<211> 50
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ctctctcttt ccctctctct ctctgtgaaa ttatcgccac gttcggtttt 50
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tcatcgcacc gtcaaaggaa cc 22
<210> 4
<211> 102
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tcatcgcacc gtcaaaggaa cctcagtatc agtgctatac gtcgatcagt acccctgtta 60
tgtgcaaaaa aaaaaatttt ccgaacgtgg cgataatttc ac 102
<210> 5
<211> 53
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ctctctcttt ccctctctct ctctcggggc agagagagag agggaaagtc tct 53
<210> 6
<211> 48
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agagagagag agggaaagag agagctttcc ctctctctct ctgccccg 48

Claims (10)

1. a kind of detection method of metal, which is characterized in that the method includes isothermal DNA amplification, the beyond body nucleic acid At least one of the reaction system of amplification technique includes following 1) -2)：
1) sense primer, the sense primer include：Complementary series A, linking arm, complementary series B, can specific amplification template Nucleotide sequence and the nucleotide that can be combined with metal to be measured；The linking arm be located at the complementary series A and complementary series B it Between, it is described can specific amplification template nucleotide sequence and the nucleotide that can be combined with metal to be measured be located at the sense primer 5 ' end or 3 ' end；The complementation of the nucleotide sequence of the complementary series A and the complementary series B and/or reverse complemental；The company It includes the structure that can inhibit polymerase combination and/or the structure that can inhibit new chain extension in beyond body nucleic acid amplification procedure to connect arm；
2) template, the template include the nucleotide of the nucleotide phase complementation combined with metal to be measured.
At least one of 2. according to the method described in claim 1, it is characterized in that, the method further includes following 1) -3)：
1) isothermal DNA amplification includes supper-fast PCR reactions, and the reaction process of the supper-fast PCR reactions includes： 90-98 DEG C, 2-6s；50-60 DEG C, 2-8s；Total 20-40 cycle；
2) linking arm includes the compound for having backbone；
3) nucleotide that can be combined with metal to be measured specifically includes the nucleotide containing thymidine or cytimidine.
3. according to the method described in claim 1 and/or 2, which is characterized in that the method further includes following 1) -4) in extremely Few one kind：
1) when the reaction system of the isothermal DNA amplification includes the sense primer, the sense primer includes：It will SEQ ID № in sequence table：1 and SEQ ID №：The primer that nucleotide sequence shown in 2 obtains after being connected by linking arm；
2) when the reaction system of the isothermal DNA amplification includes the sense primer, the sense primer includes：It will SEQ ID № in sequence table：1 and/or SEQ ID №：Nucleotide sequence shown in 2 passes through the substitution of one or several nucleotide And/or lack and or add and with SEQ ID № in sequence table：1 and/or SEQ ID №：Nucleotide sequence shown in 2 has phase The primer that the nucleotide sequence of congenerous obtains after being connected by linking arm；
3) when the reaction system of the isothermal DNA amplification includes the template, the template includes：SEQ in sequence table ID №：Nucleotide sequence shown in 4；
4) when the reaction system of the isothermal DNA amplification includes the template, the template includes：It will be in sequence table SEQ ID №：Nucleotide sequence shown in 4 by one or several nucleotide substitution and/or lack and or add and and sequence SEQ ID № in table：The nucleotide sequence with the same function of nucleotide sequence shown in 4；
Specifically, when the reaction system of the isothermal DNA amplification includes the downstream primer, the downstream primer packet It includes：SEQ ID № in sequence table：Nucleotide sequence shown in 3, and/or by SEQ ID № in sequence table：Nucleotides sequence shown in 3 Row by one or several nucleotide substitution and/or lack and or add and with SEQ ID № in sequence table：Nucleosides shown in 3 Acid sequence nucleotide sequence with the same function；
Specifically, the linking arm is the chemical constitution of oxyethyleneglycol bridge, oxyethyleneglycol For：
Specifically, the sense primer includes：AGAGAGAGAGAGGGAAAGAGAGAG-oxyethylenegl ycol bridge-CTCTCTCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT；
Specifically, the downstream primer further include marked in the downstream primer it is immune labeled；It is described immune labeled including life Object element；The biotin labeling is on 5 ' first nucleotide in end of the downstream primer；Again specifically, the downstream primer is Biotin-TCATCGCACCGTCAAAGGAACC。
4. according to the method described in claim 1,2 and/or 3, which is characterized in that the method further includes nucleic acid self assembly colour developing Reaction, the reaction system of the nucleic acid self assembly chromogenic reaction includes hair fastener sequence, and the hair fastener sequence includes hair fastener sequence one And/or hair fastener sequence two, the hair fastener sequence one include：The arbitrary nucleotide of complementary series C, complementary series D and 3 or more, Described 3 or more arbitrary nucleotide is located at the 5 ' ends and/or 3 ' ends of the hair fastener sequence；The hair fastener sequence two includes complementation Sequence E and complementary series F；The complementary series D and complementary series F complementations and/or reverse complemental；The complementary series C and institute It states complementary series A and/or complementary series B complementations and/or reverse complemental, the complementary series C and complementary series E is complementary And/or reverse complemental.
5. according to the method described in claim 4, it is characterized in that, the hair fastener sequence includes following 1) -4) at least one Kind：
1) the hair fastener sequence one includes SEQ ID № in sequence table：Nucleotide sequence shown in 5；
2) the hair fastener sequence two includes SEQ ID № in sequence table：Nucleotide sequence shown in 6；
3) the hair fastener sequence one includes by SEQ ID № in sequence table：Nucleotide sequence shown in 5 passes through one or several cores The substitution of thuja acid and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 5 has identical function Nucleotide sequence；
4) the hair fastener sequence two includes by SEQ ID № in sequence table：Nucleotide sequence shown in 6 passes through one or several cores The substitution of thuja acid and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 6 has identical function Nucleotide sequence.
6. according to the method described in claim 4 and/or 5, which is characterized in that under the nucleic acid self assembly chromogenic reaction further includes State 1) -2) described at least one：
1) it is reaction system and claim 4 and/or 5 the methods claim 1,2 and/or 3 the methods to be prepared In hair fastener sequence mixing, in 37 DEG C be incubated 20min；TdT enzyme reaction systems are added, after 37 DEG C are reacted 20min, are added in 75 DEG C Hot 10min；Then hemin and the buffer-induced liquid of tetra- serobilas of G- are added and is incubated 20min in 37 DEG C；It is eventually adding ABTS2-Chromogenic reaction is carried out with hydrogen peroxide；
2) in the reaction system of the nucleic acid self assembly chromogenic reaction, the final concentration of the hair fastener sequence one or hair fastener sequence two is equal It is 2 μM.
7. a kind of kit and/or biosensor for detecting metal, which is characterized in that the kit and/or biology At least one of sensor includes following 1) -2) described：
1) sense primer, the sense primer include：Complementary series A, linking arm, complementary series B, can specific amplification template Nucleotide sequence and the nucleotide that can be combined with metal to be measured；The linking arm be located at the complementary series A and complementary series B it Between, it is described can specific amplification template nucleotide sequence and the nucleotide that can be combined with metal to be measured be located at the sense primer 5 ' end or 3 ' end；The complementation of the nucleotide sequence of the complementary series A and the complementary series B and/or reverse complemental；The company It includes the structure that can inhibit polymerase combination and/or the structure that can inhibit new chain extension in beyond body nucleic acid amplification procedure to connect arm；
2) template, the template include the nucleotide of the nucleotide phase complementation combined with metal to be measured.
8. kit according to claim 7 and/or biosensor, which is characterized in that the kit and/or biology At least one of sensor further includes following 1) -5) described：
1) hair fastener sequence, the hair fastener sequence include hair fastener sequence one and/or hair fastener sequence two, and the hair fastener sequence one includes： The arbitrary nucleotide of complementary series C, complementary series D and 3 or more, described 3 or more arbitrary nucleotide are located at the hair fastener 5 ' the ends and/or 3 ' ends of sequence；The hair fastener sequence two includes complementary series E and complementary series F；The complementary series D with mutually Complementary series F complementations and/or reverse complemental；The complementary series C and the complementary series A and/or complementary series B it is complementary and/or Reverse complemental, the complementary series C and complementary series E complementations and/or reverse complemental；
2) downstream primer, the downstream primer include can specific amplification template nucleotide sequence；
3) when the kit and/or biosensor include the sense primer, the sense primer includes：By sequence table Middle SEQ ID №：1 and SEQ ID №：The primer that nucleotide sequence shown in 2 obtains after being connected by linking arm；
4) when the kit and/or biosensor include the sense primer, the sense primer includes：By sequence table Middle SEQ ID №：1 and/or SEQ ID №：Nucleotide sequence shown in 2 passes through the substitution of one or several nucleotide and/or lacks Lose and/or addition and with SEQ ID № in sequence table：1 and/or SEQ ID №：Nucleotide sequence shown in 2 has identical function Nucleotide sequence connected by linking arm after obtained primer；
5) when the kit and/or biosensor include the template, the template packet further includes complementary series H and sequence Arrange I；Wherein, in the complementary series H and sense primer can specific amplification template nucleotide sequence it is complementary and/or reversed It is complementary；The nucleotide sequence of the sequence I in downstream primer can the nucleotide sequence of specific amplification template it is identical；
Specifically, the template includes：SEQ ID № in sequence table：Nucleotide sequence shown in 4；And/or it will be in sequence table SEQ ID №：Nucleotide sequence shown in 4 by one or several nucleotide substitution and/or lack and or add and and sequence SEQ ID № in table：The nucleotide sequence with the same function of nucleotide sequence shown in 4；
At least one of specifically, the hair fastener sequence includes following 1) -4)：
1) the hair fastener sequence one includes SEQ ID № in sequence table：Nucleotide sequence shown in 5；
2) the hair fastener sequence two includes SEQ ID № in sequence table：Nucleotide sequence shown in 6；
3) the hair fastener sequence one includes by SEQ ID № in sequence table：Nucleotide sequence shown in 5 passes through one or several cores The substitution of thuja acid and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 5 has identical function Nucleotide sequence；
4) the hair fastener sequence two includes by SEQ ID № in sequence table：Nucleotide sequence shown in 6 passes through one or several cores The substitution of thuja acid and/or lack and or add and with SEQ ID № in sequence table：Nucleotide sequence shown in 6 has identical function Nucleotide sequence；
Specifically, the downstream primer includes：SEQ ID № in sequence table：Nucleotide sequence shown in 3, and/or by sequence table Middle SEQ ID №：Nucleotide sequence shown in 3 by one or several nucleotide substitution and/or lack and or add and and sequence SEQ ID № in list：The nucleotide sequence with the same function of nucleotide sequence shown in 3；
Specifically, the linking arm is the chemical constitution of oxyethyleneglycol bridge, oxyethyleneglycol For：
Specifically, the downstream primer further include marked in the downstream primer it is immune labeled.
9. kit according to claim 8 and/or biosensor, which is characterized in that the kit and/or biology Sensor further includes following 1) -5)：
1)AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol bridge- CTCTCTCTTTCCCTCTCTCTCTCTGTGAAATTATCGCCACGTTCGGTTTT；
2)Biotin-TCATCGCACCGTCAAAGGAACC；
3) SEQ ID № in sequence table：Nucleotide sequence shown in 4；
4) SEQ ID № in sequence table：Nucleotide sequence shown in 5；
5) SEQ ID № in sequence table：Nucleotide sequence shown in 6；
Wherein, the chemical constitution of oxyethyleneglycol is：
10. claim 1,2,3,4,5 and/or 6 the methods, claim 7,8 and/or 9 the kit and/or biology pass The application of sensor.
CN201810142125.6A 2018-02-11 2018-02-11 A kind of visualization of heavy metal ion quantifies new detecting method Pending CN108315400A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810142125.6A CN108315400A (en) 2018-02-11 2018-02-11 A kind of visualization of heavy metal ion quantifies new detecting method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810142125.6A CN108315400A (en) 2018-02-11 2018-02-11 A kind of visualization of heavy metal ion quantifies new detecting method

Publications (1)

Publication Number Publication Date
CN108315400A true CN108315400A (en) 2018-07-24

Family

ID=62902939

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810142125.6A Pending CN108315400A (en) 2018-02-11 2018-02-11 A kind of visualization of heavy metal ion quantifies new detecting method

Country Status (1)

Country Link
CN (1) CN108315400A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111154843A (en) * 2020-04-07 2020-05-15 中国农业大学 Quantitative detection method based on overspeed PCR and functional nucleic acid color development
CN111693518A (en) * 2019-03-14 2020-09-22 重庆工商大学 Mercury ion detection method

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103667448A (en) * 2013-11-05 2014-03-26 中国科学院深圳先进技术研究院 Difunctional aptamer detection kit and detection method
CN105256033A (en) * 2015-10-22 2016-01-20 西安交通大学 Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof
CN106086188A (en) * 2016-06-22 2016-11-09 西安交通大学 DNA structure probe based on nucleic acid constant-temperature amplification technology for detection mercury ion

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103667448A (en) * 2013-11-05 2014-03-26 中国科学院深圳先进技术研究院 Difunctional aptamer detection kit and detection method
CN105256033A (en) * 2015-10-22 2016-01-20 西安交通大学 Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof
CN106086188A (en) * 2016-06-22 2016-11-09 西安交通大学 DNA structure probe based on nucleic acid constant-temperature amplification technology for detection mercury ion

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TIAN ET AL.: "Visual single cell detection of dual-pathogens based on multiplexsuper PCR (MS-PCR) and asymmetric tailing HCR (AT-HCR)", 《SENSORS AND ACTUATORS B 》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111693518A (en) * 2019-03-14 2020-09-22 重庆工商大学 Mercury ion detection method
CN111693518B (en) * 2019-03-14 2022-08-05 重庆工商大学 Mercury ion detection method
CN111154843A (en) * 2020-04-07 2020-05-15 中国农业大学 Quantitative detection method based on overspeed PCR and functional nucleic acid color development

Similar Documents

Publication Publication Date Title
Lie et al. A lateral flow biosensor for detection of nucleic acids with high sensitivity and selectivity
Yoon et al. LoMA-B: a simple and versatile lab-on-a-chip system based on single-channel bisulfite conversion for DNA methylation analysis
CN102634586B (en) Decoding and sequencing method by real-time synthesis of two nucleotides into deoxyribonucleic acid (DNA)
CN105899947A (en) Assay test device, kit and method of using
CN108342456A (en) A kind of visualization of dual heavy metal ion quantifies new detecting method
Gao et al. Ultrafast, universal and visual screening of dual genetically modified elements based on dual super PCR and a lateral flow biosensor
CN109913565B (en) Kit, primer pair, probe and method for detecting vibrio parahaemolyticus
CN105331710A (en) Nucleic acid isothermal amplification detection kit for Salmonella and detection method
CN104561275A (en) Vibrio parahaemolyticus isothermal amplification detection kit and detection method
CN108315400A (en) A kind of visualization of heavy metal ion quantifies new detecting method
CN105296642A (en) Isothermal amplification detection kit for pork derived component nucleic acid and detection method
CN108588284A (en) Method based on the controllable self assembly biological barcode detection HTLV-II DNA of enzymatic
CN103898240B (en) Detect the primer of dengue virus and somatotype thereof, probe and method
JP2009296948A (en) Primer for pcr, method for detecting target nucleic acid and method for detecting target biomolecule
CN105368943A (en) Kit and method for identifying mycobacterium strains
CN109929936B (en) Fluorescence labeling multiplex amplification kit for detecting human Y chromosome rapid mutation STR locus and application
CN106884039B (en) A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene
CN106319079A (en) Method for detecting 22q11.2 copy number deletion
CN102605088B (en) Method for rapidly detecting copy number variation of alpha-globin gene cluster
CN106319091B (en) The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses
CN108642164A (en) MiRNA capture probes, separation expand integrated detection method and detection kit
CN105296643A (en) Isothermal amplification detection kit and detection method for duck meat derived component nucleic acid
CN112961908A (en) Visual detection method of annular RNA in extracellular vesicle
CN108642190B (en) Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers
CN105331734A (en) Food pathogenic bacterium detection kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180724