CN106884039B - A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene - Google Patents
A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene Download PDFInfo
- Publication number
- CN106884039B CN106884039B CN201510941253.3A CN201510941253A CN106884039B CN 106884039 B CN106884039 B CN 106884039B CN 201510941253 A CN201510941253 A CN 201510941253A CN 106884039 B CN106884039 B CN 106884039B
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- bla
- primer pair
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of gene chip kits for detecting gramnegative bacterium drug resistant gene.It containing the primer pair group for being useful for detection gramnegative bacterium drug resistant gene in kit provided by the present invention, is made of 10 primer pairs, sequence is sequence 1 20 in sequence table；Simultaneously also containing the hybridization hybrid chip for being fixed with 10 ssDNA probes shown in sequence 21 30 in the kit.Kit provided by the invention supports high throughput, quickly and accurately detects multiple gramnegative bacterium drug resistant genes, screening is carried out to Chinese population, it can effectively act as Accurate Diagnosis, the effects that drug resistance is traced to the source, drug resistance control, so as to antibiotic usage amount, reduce drug resistance and generate.
Description
Technical field
The invention belongs to nucleic acid amplification technologies fields, are related to a kind of gene core for detecting gramnegative bacterium drug resistant gene
Piece kit.
Background technology
Bacterial resistance gene detection has important clinical significance.In clinical diagnosis there are the dosage of antibiotic is big, high starting point,
The defects of type is more random, generation and prevalence so as to cause drug resistance strain.It is still more passed currently used for drug resistant gene detection
System is subject to PCR (PCR) amplification accordingly after substantially having physiological and biochemical test, serological test, drug sensitive test etc.
The method of gene, and above-mentioned detection method needs the time long, method operation is loaded down with trivial details, report result is slow, flux is low, and often first reflects
Strain is made, the follow-up tests such as susceptibility could be carried out accordingly, thus is difficult in adapt to the needs of clinical treatment.Therefore it develops quick
High-throughput molecular diagnostic techniques detection, can assist quick diagnosis, instruct promptly and accurately medication.
Biochip technology is to rapidly develop a simultaneously ripe new and high technology in life science in recent years, mainly
Be by micro-processing technology and microelectric technique solid phase chip surface construction miniature biochemical analysis system, it can be achieved that right
Accurate, quick, bulk information the detection of cell, protein, nucleic acid and other a variety of biotic components.Biochip it is main
Feature is high-throughput, micromation and automation.
Invention content
First purpose of the present invention is to provide a kind of primer pair group for being used to detect gramnegative bacterium drug resistant gene.
The primer pair group provided by the present invention for being used to detect gramnegative bacterium drug resistant gene, by following 10 primers
To composition：
1) primer pair shown in following (a1) or (a2), is denoted as primer pair 1：
(a1) primer pair being made of two single strand dnas shown in sequence in sequence table 1 and sequence 2；
(a2) by by sequence in sequence table 1 and sequence 2 by the substitution of one or several nucleotide and/or missing and/or
What two single strand dnas after addition shown in gained sequence formed, and the primer identical with primer pair function described in (a1)
It is right；
2) primer pair shown in following (b1) or (b2), is denoted as primer pair 2：
(b1) primer pair being made of two single strand dnas shown in sequence in sequence table 3 and sequence 4；
(b2) by by sequence in sequence table 3 and sequence 4 by the substitution of one or several nucleotide and/or missing and/or
What two single strand dnas after addition shown in gained sequence formed, and the primer identical with primer pair function described in (b1)
It is right；
3) primer pair shown in following (c1) or (c2), is denoted as primer pair 3：
(c1) primer pair being made of two single strand dnas shown in sequence in sequence table 5 and sequence 6；
(c2) by by sequence in sequence table 5 and sequence 6 by the substitution of one or several nucleotide and/or missing and/or
What two single strand dnas after addition shown in gained sequence formed, and the primer identical with primer pair function described in (c1)
It is right；
4) primer pair shown in following (d1) or (d2), is denoted as primer pair 4：
(d1) primer pair being made of two single strand dnas shown in sequence in sequence table 7 and sequence 8；
(d2) by by sequence in sequence table 7 and sequence 8 by the substitution of one or several nucleotide and/or missing and/or
What two single strand dnas after addition shown in gained sequence formed, and the primer identical with primer pair function described in (d1)
It is right；
5) primer pair shown in following (e1) or (e2), is denoted as primer pair 5：
(e1) primer pair being made of two single strand dnas shown in sequence in sequence table 9 and sequence 10；
(e2) by by sequence in sequence table 9 and sequence 10 by the substitution of one or several nucleotide and/or missing and/or
What two single strand dnas after addition shown in gained sequence formed, and the primer identical with primer pair function described in (e1)
It is right；
6) primer pair shown in following (f1) or (f2), is denoted as primer pair 6：
(f1) primer pair being made of two single strand dnas shown in sequence in sequence table 11 and sequence 12；
(f2) by by sequence in sequence table 11 and sequence 12 by the substitution of one or several nucleotide and/or missing and/
Or two single strand dnas composition after addition shown in gained sequence, and with primer pair function described in (f1) is identical draws
Object pair；
7) primer pair shown in following (g1) or (g2), is denoted as primer pair 7：
(g1) primer pair being made of two single strand dnas shown in sequence in sequence table 13 and sequence 14；
(g2) by by sequence in sequence table 13 and sequence 14 by the substitution of one or several nucleotide and/or missing and/
Or two single strand dnas composition after addition shown in gained sequence, and with primer pair function described in (g1) is identical draws
Object pair；
8) primer pair shown in following (h1) or (h2), is denoted as primer pair 8：
(h1) primer pair being made of two single strand dnas shown in sequence in sequence table 15 and sequence 16；
(h2) by by sequence in sequence table 15 and sequence 16 by the substitution of one or several nucleotide and/or missing and/
Or two single strand dnas composition after addition shown in gained sequence, and with primer pair function described in (h1) is identical draws
Object pair；
9) primer pair shown in following (i1) or (i2), is denoted as primer pair 9：
(i1) primer pair being made of two single strand dnas shown in sequence in sequence table 17 and sequence 18；
(i2) by by sequence in sequence table 17 and sequence 18 by the substitution of one or several nucleotide and/or missing and/
Or two single strand dnas composition after addition shown in gained sequence, and with primer pair function described in (i1) is identical draws
Object pair；
10) primer pair shown in following (j1) or (j2), is denoted as primer pair 10：
(j1) primer pair being made of two single strand dnas shown in sequence in sequence table 19 and sequence 20；
(j2) by by sequence in sequence table 19 and sequence 20 by the substitution of one or several nucleotide and/or missing and/
Or two single strand dnas composition after addition shown in gained sequence, and with primer pair function described in (j1) is identical draws
Object pair.
Wherein, the primer pair 1 is used to expand blaDHA-1Gene；The primer pair 2 is used to expand blaOXA-23Gene；Institute
Primer pair 3 is stated for expanding blaOXA-24Gene；The primer pair 4 is used to expand blaOXA-58Gene；The primer pair 5 is used to expand
Increase blaKPC-1Gene；The primer pair 6 is used to expand blaIMP-4Gene；The primer pair 7 is used to expand blaVIM-8Gene；Institute
Primer pair 8 is stated for expanding blaNDM-1Gene；The primer pair 9 is used to expand blaCTX-M-1Gene；The primer pair 10 is used for
Expand blaCTX-M-9Gene.
Second object of the present invention is to provide a kind of for detecting the complete single-stranded of gramnegative bacterium drug resistant gene
DNA。
The complete single stranded DNA provided by the present invention for being used to detect gramnegative bacterium drug resistant gene, specifically by probe
Group and primer pair group composition；The probe groups are made of following 10 ssDNA probes：In sequence table shown in sequence 21
SsDNA probe 1；SsDNA probe 2 in sequence table shown in sequence 22；SsDNA probe in sequence table shown in sequence 23
3；SsDNA probe 4 in sequence table shown in sequence 24；SsDNA probe 5 in sequence table shown in sequence 25；In sequence table
SsDNA probe 6 shown in sequence 26；SsDNA probe 7 in sequence table shown in sequence 27；In sequence table shown in sequence 28
SsDNA probe 8；SsDNA probe 9 in sequence table shown in sequence 29；Single stranded DNA in sequence table shown in sequence 30 is visited
Needle 10.
Wherein, the ssDNA probe 1 is used to detect the amplification of the primer pair 1；The ssDNA probe 2 is used
In the amplification for detecting the primer pair 2；The ssDNA probe 3 is used to detect the amplification of the primer pair 3；Institute
SsDNA probe 4 is stated for detecting the amplification of the primer pair 4；The ssDNA probe 5 is used to detect the primer
To 5 amplification；The ssDNA probe 6 is used to detect the amplification of the primer pair 6；The ssDNA probe 7
For detecting the amplification of the primer pair 7；The ssDNA probe 8 is used to detect the amplification of the primer pair 8；
The ssDNA probe 9 is used to detect the amplification of the primer pair 9；The ssDNA probe 10 is used to detect described draw
Object to 10 amplification.
Third object of the present invention is to provide a kind of kit for being used to detect gramnegative bacterium drug resistant gene.
The kit provided by the present invention for being used to detect gramnegative bacterium drug resistant gene, contains the primer pair
Group and hybridization hybrid chip；The hybridization hybrid chip is prepared according to the method included the following steps：It is " NH by general formula2-
(T)n3 kinds of single-stranded detection probes of hybridization probe sequence " are fixed to aldehyde group modifiedization by amino with reacting for aldehyde radical respectively
On solid phase carrier (such as slide), the hybridization hybrid chip is obtained；(T) in the general formulanRepresent n continuous T, n be more than etc.
In 5, and the integer less than or equal to 30；Correspond to 10 kinds of hybridization probe sequences of 10 kinds of single-stranded detection probes in the general formula
Respectively as shown in sequence 21-30 in sequence table.
As needed, the random primer through fluorescent marker is also contained in the kit；The sequence of the random primer
For 5 '-NX- 3 ', N represent any one of A, G, C and T, 6≤X≤15, and X as integer (such as X=9), NXRepresent X continuously
Deoxyribonucleotide.
Random primer of the above through fluorescent marker is for the amplified production to the primer pair in the primer pair group
Carry out fluorescent marker.As needed, the random primer through fluorescent marker can not also be used glimmering to amplified production progress
Signal, but using other methods.5 ' the ends progress of a primer of each primer pair is glimmering in primer pair group as will be described
Signal (such as TAMRA), the primer being fluorescently labeled are present on the single stranded DNA that can be hybridized in amplified production by correspondent probe
Primer.
Hybridization solution can also be contained in the kit；Contain the unrelated single stranded DNA through fluorescent marker point in the hybridization solution
Son；The unrelated single strand dna is the non-single strand dna from the gramnegative bacterium drug resistant gene.
The preparation method of the hybridization hybrid chip further include by surface chemistry Quality Control probe QC, and/or hybridization Quality Control probe PC,
And/or negative control probe BC reacts the solid phase carrier (such as slide) fixed to aldehyde group modifiedization by amino and aldehyde radical
On step；
The surface chemistry Quality Control probe QC, the hybridization Quality Control probe PC and the negative control probe are single-stranded spy
Needle；Through amido modified, the other end has fluorescent marker (such as Hex) for one end of the surface chemistry Quality Control probe QC；The hybridization
One end of Quality Control probe PC can hybridize through amido modified with the unrelated single strand dna in the hybridization solution；Described the moon
One end of property control probe BC is through amido modified, and with any single strand dna from the bacterial resistance gene not
It can hybridization.
Further, in the present invention, structure compositions of the surface chemistry Quality Control probe QC from 5 ' ends to 3 ' ends is " NH2-
TCACTTGCTTCCGTTGAGG-Hex”；Structure compositions of the hybridization Quality Control probe PC from 5 ' ends to 3 ' ends is " NH2-
TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT”；The negative control probe BC from 5 ' end to 3 ' end structure composition be
“NH2-TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT”。
The application of the primer pair group or the complete single stranded DNA or the kit in following (a) or (b) also belongs to
Protection scope of the present invention：
(a) detect or assist detection gramnegative bacterium drug resistant gene (non-diagnostic purpose) or prepare for detect or
The product of auxiliary detection gramnegative bacterium drug resistant gene；
(b) it detects or assists thin (non-diagnostic purpose) bacterium of the detection containing gramnegative bacterium drug resistant gene or prepare
For detecting or assisting to detect the product of the bacterium containing gramnegative bacterium drug resistant gene.
In the present invention, the gramnegative bacterium drug resistant gene is concretely at least one of following：blaDHA-1
Gene, blaOXA-23Gene, blaOXA-24Gene, blaOXA-58Gene, blaKPC-1Gene, blaIMP-4Gene, blaVIM-8Gene,
blaNDM-1Gene, blaCTX-M-1Gene and blaCTX-M-9Gene.
The blaDHA-1The GenBank accession number of gene is EF406115.1 (update：2007-8-17)；It is described
blaOXA-23The GenBank accession number of gene is JN665073.1 (update：2011-11-7)；The blaOXA-24Gene
GenBank accession number is JN207494.1 (update：2011-11-27)；The blaOXA-58The GenBank accession number of gene is
EU107372.1(update：2007-9-11)；The blaKPC-1The GenBank accession number of gene is AF297554.1
(update：2001-3-26)；The blaIMP-4The GenBank accession number of gene is AF244145.1 (update：2001-2-
27)；The blaVIM-8The GenBank accession number of gene is AY524987.1 (update：2004-11-5)；The blaNDM-1Base
The GenBank accession number of cause is JF503991.1 (update：2012-12-11)；The blaCTX-M-1The GenBank of gene is stepped on
Record number is AJ416342.1 (update：2008-10-23)；The blaCTX-M-9The GenBank accession number of gene is
AJ416345.1(update：2005-4-15).
Correspondingly, contain the blaDHA-1The bacterium of gene concretely Klebsiella Pneumoniae；Contain the blaOXA-23Base
The bacterium of cause concretely Acinetobacter bauamnnii；Contain the blaOXA-24The bacterium of gene concretely Acinetobacter bauamnnii；Contain
There is the blaOXA-58The bacterium of gene concretely Acinetobacter bauamnnii；Contain the blaKPC-1The bacterium of gene is concretely
Klebsiella Pneumoniae or pseudomonas aeruginosa；Contain the blaIMP-4The bacterium of gene concretely Acinetobacter bauamnnii；Contain
The blaVIM-8The bacterium of gene concretely Klebsiella Pneumoniae or Acinetobacter bauamnnii；Contain the blaNDM-1Gene
Bacterium concretely escherichia coli；Contain the blaCTX-M-1The bacterium of gene concretely proteus mirabilis；Contain
The blaCTX-M-9The bacterium of gene concretely escherichia coli.
The application of the primer pair group or the complete single stranded DNA in the kit is prepared also belongs to the guarantor of the present invention
Protect range.
The present invention studies the gramnegative bacterium drug resistant gene of very big sample size.Kit provided by the invention
It supports high throughput, quickly and accurately detects multiple gramnegative bacterium drug resistant genes, screening is carried out to Chinese population, can be had
The effects that effect ground plays Accurate Diagnosis, drug resistance is traced to the source, drug resistance control so as to antibiotic usage amount, reduces drug resistance generation.
Description of the drawings
Fig. 1 is the dot matrix arrangement schematic diagram (i.e. chip probe schematic layout pattern) of hybridization hybrid chip.Represent unlocked any spy
Needle.
Fig. 2 is the specific analysis result for detecting the kit of gramnegative bacterium drug resistant gene.The figure corresponds to
Chip probe schematic layout pattern it is as shown in Figure 1.Wherein, the corresponding reference material DNA plasmid of chip testing result shown in A is ZL-
CTX-M-1 (corresponding blaCTX-M-1Gene)；The corresponding reference material DNA plasmid of chip testing result shown in B is (right for ZL-CTX-M-9
Answer blaCTX-M-9Gene)；The corresponding reference material DNA plasmid of chip testing result shown in C is ZL-DHA-1 (corresponding blaDHA-1Base
Cause)；The corresponding reference material DNA plasmid of chip testing result shown in D is ZL-IMP-4 (corresponding blaIMP-4Gene)；Chip shown in E
The corresponding reference material DNA plasmid of testing result is ZL-KPC-1 (corresponding blaKPC-1Gene)；Chip testing result shown in F is corresponding
Reference material DNA plasmid is ZL-NDM-1 (corresponding blaNDM-1Gene)；The corresponding reference material DNA plasmid of chip testing result shown in G
For ZL-OXA-23 (corresponding blaOXA-23Gene)；The corresponding reference material DNA plasmid of chip testing result shown in H is ZL-OXA-24
(corresponding blaOXA-24Gene)；The corresponding reference material DNA plasmid of chip testing result shown in I is ZL-OXA-58 (corresponding blaOXA-58
Gene)；The corresponding reference material DNA plasmid of chip testing result shown in J is ZL-VIM-8 (corresponding blaVIM-8Gene).
Fig. 3 is the chip testing result figure of three parts of clinical samples.The corresponding chip probe schematic layout pattern such as Fig. 1 institutes of the figure
Show.Wherein, A is No. 1 clinical sample；B is No. 2 clinical samples；C is No. 3 clinical samples.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1, for detecting the preparation of the kit of gramnegative bacterium drug resistant gene and its use
First, for detecting the assembling of the kit of gramnegative bacterium drug resistant gene and preparation
1st, for the primer and hybridization probe of 10 gramnegative bacterium drug resistant gene designs
The primer designed for 10 gramnegative bacterium drug resistant genes and single-stranded hybridization probe particular sequence such as 1 He of table
Shown in table 2.
Table 1 is for the primer of 10 gramnegative bacterium drug resistant gene designs
Table 2 is for the single-stranded hybridization probe of 10 gramnegative bacterium drug resistant gene designs
| Number | Detect gene | GenBank | Probe title | Sequence (5 ' -3 ') |
| 1 | blaDHA-1 | EF406115.1 | DHA-574 | TTGCTGACTGCACGGATCCT (sequence 21) |
| 2 | blaOXA-23 | JN665073.1 | OXA23-139 | CCCGAGTCAGATTGTTCAAG (sequence 22) |
| 3 | blaOXA-24 | JN207494.1 | OXA24-673 | GTTACTCCACAGGTAGGTTG (sequence 23) |
| 4 | blaOXA-58 | EU107372.1 | OXA58-120 | CGATCAGAATGTTCAAGCGC (sequence 24) |
| 5 | blaKPC-1 | AF297554.1 | KPC-335 | TGACAACAGGCATGACGGTG (sequence 25) |
| 6 | blaIMP-4 | AF244145.1 | IMP_573 | AGAAGCTTGGCCAAAGTCCG (sequence 26) |
| 7 | blaVIM-8 | AY524987.1 | VIM_368 | TTGATGTCCTTCGGGCGGCT (sequence 27) |
| 8 | blaNDM-1 | JF503991.1 | NDM1-214 | GCAGTCGCTTCCAACGGTTT (sequence 28) |
| 9 | blaCTX-M-1 | AJ416342.1 | CTXM1-648 | CAATACCACCGGTGCAGCGA (sequence 29) |
| 10 | blaCTX-M-9 | AJ416345.1 | CTXM9-433 | AGCCTGCCGATCTGGTTAAC (sequence 30) |
2nd, hybridization probe is fixed on hybridization hybrid chip
Hybridization hybrid chip is the substrate for being respectively fixed with 10 kinds of single-stranded detection probes.Each detection probe is all that one section of amino is repaiied
The oligonucleotide probe of decorations, the general formula of 10 kinds of single-stranded detection probes is " NH2- TTTTTTTTTTTTTTT- hybridization probes sequence ",
Wherein " hybridization probe sequence " is 10 kinds of single-stranded hybridization probes shown in sequence 20-30 in table 2 ".Each detection probe is used respectively
Gene sampling liquid (Capitalbio Corporation Co., Ltd.'s product, catalog number CP.440010) dissolves, final concentration of 10 μ
M, (Capitalbio Corporation Co., Ltd.'s product, catalog number are the slide of point system to aldehyde radicalization modification in triplicate
CP.420022 on), so as to which 10 kinds of probes are fixed on hybridization hybrid chip with reacting for aldehyde radical by amino.In addition, again by
Surface chemistry Quality Control probe QC, hybridization Quality Control probe PC and negative control probe BC are again secured to miscellaneous by the reacting of amino and aldehyde radical
It hands on chip.QC is that one end is marked with Hex, and the other end has amido modified single strand oligonucleotide probes, for observing core
Piece point sample and fixed efficiency, the structure composition from 5 ' ends to 3 ' ends are NH2-TCACTTGCTTCCGTTGAGG-Hex.PC is
One section of amido modified single strand oligonucleotide probes can divide with the unrelated single stranded DNA through fluorescent marker added in hybridization solution
Sub (C-PC) hybridization, for the Quality Control of hybrid process, the structure composition from 5 ' ends to 3 ' ends is NH2-
TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT.BC is one section of amido modified oligonucleotide probe, with hybridizing in system
All sequences to be detected will not hybridize, for observe whether there is Non-specific hybridization, from 5 ' end to 3 ' end structure composition be
NH2-TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT.Fig. 1 is the dot matrix arrangement schematic diagram of hybridization hybrid chip.
3rd, for detecting the composition of the kit of gramnegative bacterium drug resistant gene
It is provided by the present invention that for detecting gramnegative bacterium drug resistant gene, (10 kinds i.e. involved in Tables 1 and 2 are removed from office
Gram-negative bacteria drug resistant gene) kit contain：
(1) 10 primer pairs in step 1 shown in table 1；
(2) 10 kinds of detection probes and surface chemistry Quality Control probe QC, hybridization Quality Control probe PC and the moon are fixed in step 2
The hybridization hybrid chip of property control probe BC；
(3) random primer through fluorescent marker；The sequence of the random primer is 5 '-N9- 3 ', N are represented in A, G, C and T
Any, N9Represent 9 continuous deoxyribonucleotides.
(4) hybridization solution；Contain the unrelated single strand dna (C-PC) through fluorescent marker, nucleotide in the hybridization solution
Sequence is 5 '-ATCACTTGCTTCCGTTGAGG-3 '.
2nd, for detecting the application method of the kit of gramnegative bacterium drug resistant gene
1st, sample PCR (PCR) expands
The DNA sample solution for taking 1 μ L to be measured using it as template, is respectively adopted 10 primer pairs shown in table 1 and carries out PCR
Amplification.20 μ L PCR amplification systems are as follows：10 × PCR buffer (contain Mg2+)2μL；2.5mM dNTP 1.6μL；10 μM of upstreams
0.5 μ L of primer；10 μM of 0.5 μ L of downstream primer；1 μ L of template；5U/μL rTaq0.2μL；Moisturizing is to 20 μ L.PCR amplification program is such as
Under：94℃5min；(94℃30s；55℃30s；72 DEG C of 1min) 30 cycles；72℃10min.PCR is obtained 10 after reaction
Part pcr amplification product.
2nd, the fluorescent marker of pcr amplification product
Each pcr amplification product takes 5 μ L, is added in different sample cells, and a concentration of 100 μ of 3 μ L are added in each sample cell
M through TAMRA fluorescent markers 9N random primers (nucleotides sequence is classified as 5 '-N9-3 ', and N represents any one of A, G, C and T,
N9 represents 9 continuous deoxyribonucleotides, specially Sangon Biotech's product), moisturizing
To 19 μ L, mixing, brief centrifugation are shaken；95 DEG C of denaturation are placed on ice, add in 6 μ L fluorescent marker reaction systems mix (compositions：
10×Klenow Buffer 2.5μL；1 μ L of 5U/ μ L Klenow enzymes；2.5mM dNTP 2.5μL).Fluorescence mark is carried out by program
Note, program are as follows：37℃90min；70℃10min.10 parts of TAMRA fluorescent mark products are obtained.
3rd, the purifying of TAMRA fluorescent mark products
The Nucleo Spin Gel and PCR Clean-up kits (production produced using Macherey-Nagel companies
Product article No.：REF740609*250), the TAMRA fluorescent mark products obtained to step 2 purify, and concrete operations are according to reagent
Box specification carries out.
4th, hybridize
The unrelated single strand dna (5 '-ATCACTTGCTTCCGTTGAGG-3 ') through TAMRA fluorescent markers will be contained
Hybridize buffer (Capitalbio Corporation Co., Ltd.'s product, catalog number CP.440030) in 50 DEG C of thawings, preparation 10
Part hybrid mixed liquid (5 μ L of the wherein 15 μ L of TAMRA fluorescent mark products solution of step 3 after purification, hybridization buffer), will match
The 10 parts of hybrid mixed liquid made are added on the hybridization hybrid chip in step 12, and every part of hybrid mixed liquid correspondence one is complete miscellaneous
Chip is handed over, 95 DEG C of denaturation 3min are placed on ice immediately, and 50 DEG C of water-bath hybridization 2h.
5th, it cleans
With two kinds of different washing lotion (washing lotion I：2 × SSC, 0.2%SDS are preheated to 50 DEG C；Washing lotion II：0.2 × SSC, preheating
To 50 DEG C) be respectively washed 4min according to the sequence of washing lotion II after first washing lotion I after, it is clear that chip is placed on SlideWasher_8 chips
It washes in instrument, selects centrifuging process, centrifugation (or centrifuge 1000rpm centrifugations 2min), drying.
6th, scanner uni result judgement
Scanning (selection green channel, setting are completed using rich Austria's crystalline substance core LuxScan 10K micro-array chip scanners
The parameter area of " Power " is 50-90 and the parameter area of " PMT " is 500-900), and according to scanning result according to such as lower section
Method determines in DNA sample to be measured whether to contain containing 10 kinds of gramnegative bacterium drug resistant genes involved in table 1 and specifically
Any or which kind in 10 kinds of gramnegative bacterium drug resistant genes：For detecting certain gramnegative bacterium drug resistant gene
If fixed position of the probe on chip detect fluorescence signal, judge in corresponding DNA sample to be measured containing pair
The gramnegative bacterium drug resistant gene answered；Otherwise corresponding gramnegative bacterium drug resistant gene is not contained then.In addition, scanning
Software can assign different colours according to the fluorescence signal intensity detected in the process, and color is gradually increased by blue to white, signal
By force, and then it can tentatively judge the height of target gramnegative bacterium drug resistant gene content in DNA sample to be measured.
Embodiment 2, for detecting the specificity of the kit of gramnegative bacterium drug resistant gene and sensitivity determination
First, the preparation of reference material DNA plasmid
1st, contain blaDHA-1The structure of the plasmid of gene target segment
By blaDHA-1Gene (GenBank：EF406115.1, update：DNA shown in 1-1113 2007-8-17)
Segment is connected on pGEM-T Easy Vector carriers (promega Products), obtains recombinant plasmid ZL-DHA-1.And it passes through
Sequence verification is correct.
2nd, contain blaOXA-23The structure of the plasmid of gene target segment
By blaOXA-23Gene (GenBank：JN665073.1, update：DNA shown in 97-899 2011-11-7)
Segment is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-OXA-23.It is and correct through sequence verification.
3rd, contain blaOXA-24The structure of the plasmid of gene target segment
By blaOXA-24Gene (GenBank：JN207494.1, update：4168-4882 institutes 2011-11-27)
Show that DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtain recombinant plasmid ZL-OXA-24.And through sequence verification just
Really.
4th, contain blaOXA-58The structure of the plasmid of gene target segment
By blaOXA-58Gene (GenBank：EU107372.1, update：DNA shown in 42-835 2007-9-11)
Segment is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-OXA-58.It is and correct through sequence verification.
5th, contain blaKPC-1The structure of the plasmid of gene target segment
By blaKPC-1Gene (GenBank：AF297554.1, update：Shown in 154-1003 2001-3-26)
DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-KPC-1.It is and correct through sequence verification.
6th, contain blaIMP-4The structure of the plasmid of gene target segment
By blaIMP-4Gene (GenBank：AF244145.1, update：DNA pieces shown in 1-470 2001-2-27)
Section is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-IMP-4.It is and correct through sequence verification.
7th, contain blaVIM-8The structure of the plasmid of gene target segment
By blaVIM-8Gene (GenBank：AY524987.1, update：DNA shown in 89-798 2004-11-5)
Segment is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-VIM-8.It is and correct through sequence verification.
8th, contain blaNDM-1The structure of the plasmid of gene target segment
By blaNDM-1Gene (GenBank：JF503991.1, update：2012-12-11) 118437-119168
Shown DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-NDM-1.And through sequence verification just
Really.
9th, contain blaCTX-M-1The structure of the plasmid of gene target segment
By blaCTX-M-1Gene (GenBank：AJ416342.1, update：567-1373 institutes 2008-10-23)
Show that DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtain recombinant plasmid ZL-CTX-M-1.And through sequence verification just
Really.
10th, contain blaCTX-M-9The structure of the plasmid of gene target segment
By blaCTX-M-9Gene (GenBank：AJ416345.1, update：Shown in 218-958 2005-4-15)
DNA fragmentation is connected on pGEM-T Easy Vector carriers, obtains recombinant plasmid ZL-CTX-M-9.And through sequence verification just
Really.
2nd, it is analyzed for detecting the specificity of the kit of gramnegative bacterium drug resistant gene
10 kinds of reference material DNA plasmids that step 1 is built are diluted to a concentration of 104Copy/μ L, respectively with dilution after
10 kinds of reference material DNA plasmids for DNA sample to be measured, then operated according to 1 step 2 of embodiment, detect DNA samples to be measured
Whether containing purposeful gramnegative bacterium drug resistant gene in product, specific determination method is referring to 1 step 26 of embodiment.
The results are shown in Figure 2, is only to secure corresponding inspection as seen from the figure for each reference material DNA plasmid
The point of probing needle is able to detect that apparent fluorescence signal, other points do not detect fluorescence signal.It should be the result shows that the present invention
What is provided has stronger specificity for detecting the kit of gramnegative bacterium drug resistant gene.
3rd, for detecting the sensitivity analysis of the kit of gramnegative bacterium drug resistant gene
10 kinds of reference material DNA plasmids that above-mentioned steps one are built are subjected to gradient dilution respectively, concentration is obtained and is followed successively by 104
Copy/μ L, 103Copy/μ L, 102Copy/μ L, 101The dilution of copy/μ L.Respectively with 10 kinds of reference materials of different dilutions
Whether DNA plasmid is DNA sample to be measured, then operated according to 1 step 2 of embodiment, detect in DNA sample to be measured and contain
Purpose gramnegative bacterium drug resistant gene, specific determination method is referring to 1 step 26 of embodiment.
As a result it shows：For each reference material DNA plasmid, a concentration of 104Copy/μ L, 103Copy/μ L, 102It copies
The point of corresponding detection probe can detect apparent fluorescence signal during shellfish/μ L；Only a concentration of 101The reference material DNA of copy/μ L
Plasmid does not detect fluorescence signal.It should be the result shows that provided by the present invention be used to detect gram-positive bacterium drug resistant gene
Kit have higher sensitivity.
The detection of embodiment 3, actual clinical sample
First, clinical sample type
The present embodiment uses clinical sample to come from the sticky fester in people wound of The People's Hospital of Peking University's acquisition (originally
The voluntary principle of this picker), totally three parts.
2nd, in clinical sample DNA sample extraction
1st, the clinical sample 1-3mL of step 1 is taken；
2nd, the NaOH of 4 times of volumes 4% (4g/100mL) is added in, is shaken up, is placed at room temperature for 30min liquefaction；
3rd, take 0.5mL liquefy after fester and 0.5ml 4% (4g/100mL) NaOH, room temperature, 10min；
4th, 12 000rpm centrifuge 15min；
5th, supernatant is abandoned, adds sterile saline 1mL, mixing, 12 000rpm centrifugations 5min；
6th, supernatant is abandoned, precipitation is extracted for DNA；
7th, (Capitalbio Corporation Co., Ltd.'s product, catalog number are 50 μ L nucleic acid extractions liquid of addition
CP.360090), fully shaking mixing makes precipitation suspend completely；
8th, suspension is transferred in nucleic acid extraction pipe, screws pipe lid, be put into instrument for extracting nucleic acid or vortex concussion instrument most
Big rotating speed concussion 5min；
9th, 95 DEG C of metal bath heating 5min；
10th, 5000rpm centrifuges 1min, supernatant is transferred in 1.5mL centrifuge tubes, -20 DEG C save backup.
3rd, the detection of actual clinical sample
It is DNA sample to be measured by three parts of clinical sample DNA that step 2 obtains, is then carried out according to 1 step 2 of embodiment
Whether operation is detected containing purposeful gramnegative bacterium drug resistant gene in DNA sample to be measured, and specific determination method is referring to implementation
1 step 26 of example.
The results are shown in Figure 3, and three parts of sample hybridization signals are clear and single as seen from the figure.Through being compared with probe location, 1
Detection obtains signal as drug resistant gene bla in number clinical sampleCTX-M-9And blaKPC-1；Detection obtains signal in No. 2 clinical samples
For drug resistant gene blaOXA-23、blaOXA-58And blaVIM-8；Detection obtains signal as drug resistant gene bla in No. 3 clinical samplesCTX-M-1
And blaDHA-1。
In order to further determine the accuracy of above testing result of the present invention, the present inventor is by three parts of clinical samples
Pcr amplification product carried out agarose gel electrophoresis and sequence verification, as a result confirm：No. 1 clinical sample is only with primer pair
The amplified production of CTX-M9-F/CTX-M9-R and KPC-F/KPC-R has apparent electrophoretic band, and the amplification of other primer pairs
Product does not detect apparent electrophoretic band, further to primer pair CTX-M9-F/CTX-M9-R and KPC-F/KPC-R
Amplified production sequencing finds that its sequence respectively just is blaCTX-M-9Gene (GenBank：AJ416345.1, update：
218-958 2005-4-15) and blaKPC-1Gene (GenBank：AF297554.1, update：2001-3-26)
154-1003；No. 2 clinical samples are only with primer pair OXA23-F/OXA23-R, OXA58-F/OXA58-R and VIM-F/VIM-
The amplified production of R has apparent electrophoretic band, and the amplified production of other primer pairs does not detect apparent electrophoresis strip
Further hair is sequenced to the amplified production of primer pair OXA23-F/OXA23-R, OXA58-F/OXA58-R and VIM-F/VIM-R in band
Its existing sequence respectively just is blaOXA-23Gene (GenBank：JN665073.1, update：97- 2011-11-7)
899, blaOXA-58Gene (GenBank：EU107372.1, update：42-835 2007-9-11) and blaVIM-8Base
Because of (GenBank：AY524987.1, update：2004-11-5) 89-798；No. 3 clinical samples are only with primer pair
The amplified production of CTX-M1-F/CTX-M1-R and DHA-F/DHA-R has apparent electrophoretic band, and the amplification of other primer pairs
Product does not detect apparent electrophoretic band, further to primer pair CTX-M1-F/CTX-M1-R and DHA-F/DHA-R
Amplified production sequencing finds that its sequence respectively just is blaCTX-M-1Gene (GenBank：AJ416342.1, update：
567-1373 2008-10-23) and blaDHA-1Gene (GenBank：EF406115.1, update：2007-8-17)
1-1113.Result proof utilizes the testing result of kit of the present invention accurately and reliably.
Claims (11)
1. for detecting the complete single stranded DNA of gramnegative bacterium drug resistant gene, it is made of probe groups and primer pair group；
The primer pair group is made of following 10 primer pairs：As two single stranded DNAs shown in sequence in sequence table 1 and sequence 2
The primer pair 1 of molecular composition；The primer pair 2 being made of two single strand dnas shown in sequence in sequence table 3 and sequence 4；By
Sequence 5 and the primer pair 3 of two single strand dnas composition shown in sequence 6 in sequence table；By sequence in sequence table 7 and sequence 8
The primer pair 4 of shown two single strand dnas composition；As two single stranded DNAs shown in sequence in sequence table 9 and sequence 10 point
Molecular primer pair 5；The primer pair 6 being made of two single strand dnas shown in sequence in sequence table 11 and sequence 12；By
Sequence 13 and the primer pair 7 of two single strand dnas composition shown in sequence 14 in sequence table；By sequence in sequence table 15 and sequence
The primer pair 8 of two single strand dnas composition shown in row 16；It is single-stranded as two shown in sequence in sequence table 17 and sequence 18
The primer pair 9 of DNA molecular composition；The primer being made of two single strand dnas shown in sequence in sequence table 19 and sequence 20
To 10；
The probe groups are made of following 10 ssDNA probes：SsDNA probe 1 in sequence table shown in sequence 21；Sequence
SsDNA probe 2 in table shown in sequence 22；SsDNA probe 3 in sequence table shown in sequence 23；Sequence 24 in sequence table
Shown ssDNA probe 4；SsDNA probe 5 in sequence table shown in sequence 25；It is single-stranded shown in sequence 26 in sequence table
DNA probe 6；SsDNA probe 7 in sequence table shown in sequence 27；SsDNA probe 8 in sequence table shown in sequence 28；Sequence
SsDNA probe 9 in list shown in sequence 29；SsDNA probe 10 in sequence table shown in sequence 30.
2. complete single stranded DNA according to claim 1, it is characterised in that：The bacterial resistance gene be it is following in extremely
Few one kind：blaDHA-1Gene, blaOXA-23Gene, blaOXA-24Gene, blaOXA-58Gene, blaKPC-1Gene, blaIMP-4Gene,
blaVIM-8Gene, blaNDM-1Gene, blaCTX-M-1Gene and blaCTX-M-9Gene.
3. for detecting the kit of gramnegative bacterium drug resistant gene, contain primer pair group and hybridization hybrid chip；
The primer pair group is made of following 10 primer pairs：As two single stranded DNAs shown in sequence in sequence table 1 and sequence 2
The primer pair 1 of molecular composition；The primer pair 2 being made of two single strand dnas shown in sequence in sequence table 3 and sequence 4；By
Sequence 5 and the primer pair 3 of two single strand dnas composition shown in sequence 6 in sequence table；By sequence in sequence table 7 and sequence 8
The primer pair 4 of shown two single strand dnas composition；As two single stranded DNAs shown in sequence in sequence table 9 and sequence 10 point
Molecular primer pair 5；The primer pair 6 being made of two single strand dnas shown in sequence in sequence table 11 and sequence 12；By
Sequence 13 and the primer pair 7 of two single strand dnas composition shown in sequence 14 in sequence table；By sequence in sequence table 15 and sequence
The primer pair 8 of two single strand dnas composition shown in row 16；It is single-stranded as two shown in sequence in sequence table 17 and sequence 18
The primer pair 9 of DNA molecular composition；The primer being made of two single strand dnas shown in sequence in sequence table 19 and sequence 20
To 10；
The hybridization hybrid chip is prepared according to the method included the following steps：It is " NH by general formula2-(T)nHybridization probe
10 kinds of single-stranded detection probes of sequence " are fixed to reacting for aldehyde radical on the solid phase carrier of aldehyde group modifiedization respectively by amino,
Obtain the hybridization hybrid chip；(T) in the general formulanRepresent n continuous T, n be more than or equal to 5, it is and whole less than or equal to 30
Number；Corresponding to 10 kinds of hybridization probe sequences of 10 kinds of single-stranded detection probes respectively such as sequence in sequence table in the general formula
Shown in 21-30.
4. kit according to claim 3, it is characterised in that：Also contain in the kit through the random of fluorescent marker
Primer；The sequence of the random primer is 5 '-NX- 3 ', N represent that any one of A, G, C and T, 6≤X≤15, and X are integer,
NXRepresent X continuous deoxyribonucleotides.
5. kit according to claim 3 or 4, it is characterised in that：Also contain hybridization solution in the kit；It is described miscellaneous
It hands over and contains the unrelated single strand dna through fluorescent marker in liquid；The unrelated single strand dna is derived from the gram to be non-
The single strand dna of negative bacteria drug resistant gene.
6. kit according to claim 5, it is characterised in that：The preparation method of the hybridization hybrid chip is further included surface
Chemical Quality Control probe QC, hybridization Quality Control probe PC and negative control probe BC are fixed to the aldehyde by amino with reacting for aldehyde radical
Step on the solid phase carrier of base modificationization；
The surface chemistry Quality Control probe QC, the hybridization Quality Control probe PC and the negative control probe are single-stranded probe；
Through amido modified, the other end has fluorescent marker for one end of the surface chemistry Quality Control probe QC；
One end of the hybridization Quality Control probe PC can be divided through amido modified with the unrelated single stranded DNA in the hybridization solution
Son hybridization；
One end of the negative control probe BC through amido modified, and with from any single-stranded of the bacterial resistance gene
DNA molecular cannot hybridize.
7. kit according to claim 6, it is characterised in that：The surface chemistry Quality Control probe QC is held from 5 ' ends to 3 '
Structure composition be " NH2-TCACTTGCTTCCGTTGAGG-Hex”；
Structure compositions of the hybridization Quality Control probe PC from 5 ' ends to 3 ' ends is " NH2-
TTTTTTTTTTTTCCTCAACGGAAGCAAGTGAT”；
Structure compositions of the negative control probe BC from 5 ' ends to 3 ' ends is " NH2-
TTTTTTTTTTTTGTTGCTTCTGGAATGAGTTTGCT”。
8. kit according to claim 3 or 4, it is characterised in that：The bacterial resistance gene be it is following at least
It is a kind of：blaDHA-1Gene, blaOXA-23Gene, blaOXA-24Gene, blaOXA-58Gene, blaKPC-1Gene, blaIMP-4Gene,
blaVIM-8Gene, blaNDM-1Gene, blaCTX-M-1Gene and blaCTX-M-9Gene.
9. in the complete single stranded DNA or claim 3-8 described in claims 1 or 2 any kit at following (a) or
(b) application in：
(a) product for detecting or assisting detection gramnegative bacterium drug resistant gene is prepared；
(b) product for detecting or assisting to detect the bacterium containing gramnegative bacterium drug resistant gene is prepared.
10. application according to claim 9, it is characterised in that：The bacterial resistance gene is at least one of following：
blaDHA-1Gene, blaOXA-23Gene, blaOXA-24Gene, blaOXA-58Gene, blaKPC-1Gene, blaIMP-4Gene, blaVIM-8
Gene, blaNDM-1Gene, blaCTX-M-1Gene and blaCTX-M-9Gene.
11. the answering in any kit in claim 3-8 is prepared of the complete single stranded DNA described in claims 1 or 2
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510941253.3A CN106884039B (en) | 2015-12-16 | 2015-12-16 | A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510941253.3A CN106884039B (en) | 2015-12-16 | 2015-12-16 | A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106884039A CN106884039A (en) | 2017-06-23 |
| CN106884039B true CN106884039B (en) | 2018-07-06 |
Family
ID=59174878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510941253.3A Active CN106884039B (en) | 2015-12-16 | 2015-12-16 | A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106884039B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108559785A (en) * | 2018-07-19 | 2018-09-21 | 中国疾病预防控制中心传染病预防控制所 | Primer combination, probe, kit and Carbapenems Drug-resistant genes blaVIM detection method |
| CN109628620B (en) * | 2019-01-22 | 2023-05-05 | 南方医科大学南方医院 | Primers, method and kit for detecting OXA-23 family and OXA-51 family genotypes by full-sequence fluorescent PCR |
| CN112941214B (en) * | 2021-03-29 | 2023-04-11 | 中国农业大学 | Primer group for gram-negative bacterium drug-resistant gene high-throughput amplicon sequencing and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1687459A (en) * | 2005-04-15 | 2005-10-26 | 北京博奥生物芯片有限责任公司 | Authenticating gram positive bacteria species and method for testing drug resistant gene and dedicating kit |
| CN1840693A (en) * | 2006-01-18 | 2006-10-04 | 北京博奥生物芯片有限责任公司 | Method for detecting drug resistant gene of gramnegative bacterium and its special chip and kit |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011138402A1 (en) * | 2010-05-05 | 2011-11-10 | Check-Points Holding B.V. | Assays, compositions and methods for detecting drug resistant micro-organisms |
-
2015
- 2015-12-16 CN CN201510941253.3A patent/CN106884039B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1687459A (en) * | 2005-04-15 | 2005-10-26 | 北京博奥生物芯片有限责任公司 | Authenticating gram positive bacteria species and method for testing drug resistant gene and dedicating kit |
| CN1840693A (en) * | 2006-01-18 | 2006-10-04 | 北京博奥生物芯片有限责任公司 | Method for detecting drug resistant gene of gramnegative bacterium and its special chip and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106884039A (en) | 2017-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106884037A (en) | A kind of gene chip kit of detection bacterium drug resistant gene | |
| CN103937896B (en) | A kind of SNP classifying methods and kit | |
| EP0688873A2 (en) | Fast DNA assay for the detection of chinolon resistant staphylococcus aureus in clinical material | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| JP2006518194A5 (en) | ||
| CN104328167B (en) | Can the genetic chip of ten kinds of Main Pathogenic Bacterias of parallel detection mastitis for milk cows and detection method | |
| CN101619352A (en) | Double-probe gene mutation detecting method based on allele special amplification as well as special chip and kit thereof | |
| CN108184327A (en) | For identifying the composition of drug resistant M and method | |
| CN106884039B (en) | A kind of gene chip kit for detecting gramnegative bacterium drug resistant gene | |
| CN110079592A (en) | For detecting the probe and method of gene mutation and known, unknown gene fused type high-flux sequence targeted capture target area | |
| KR20100061438A (en) | Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray | |
| JP2002537824A (en) | Bacterial identification | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| CN102719537A (en) | Multidrug-resistant mycobacterium tuberculosis non-fluorescent DNA (deoxyribonucleic acid) microarray detection method and kit | |
| KR101814740B1 (en) | Method for Detection of Food Poisoning Bacteria By Using Gene Amplification and Kit for Use in The Same Method | |
| CN108642169A (en) | Detect ten kinds of trimethoprim class Drug-resistant genetic methods and used kit | |
| CN102676646A (en) | Reverse dot-blot hybridization gene chip and production method thereof | |
| CN106884038A (en) | A kind of gene chip kit for detecting gram-positive bacterium drug resistant gene | |
| JP2001299354A (en) | Nucleic acid for detecting bacterium belonging to genus mycobacterium | |
| RU2583924C1 (en) | METHOD FOR MULTIPLEX PCR DETECTION OF Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens AND Eggerthella spp. IN CLINICAL MATERIAL | |
| US10093988B2 (en) | Universal primers and the use thereof for the detection and identification of amphibia/fish species | |
| CN117987578B (en) | Microfluidic chip for simultaneously detecting pathogenic escherichia coli, salmonella and drug resistance genes and application thereof | |
| CN102191329A (en) | Kit for detecting genes related to severe depressions and preparation method thereof | |
| KR101910172B1 (en) | Method for Detection of Food Poisoning Bacteria By Using Gene Amplification and Kit for Use in The Same Method | |
| JP2004290171A (en) | Molecular biological identification technique of microorganism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |