CA3059288C - Novel colorimetric sensing method for dual pathogen - Google Patents

Novel colorimetric sensing method for dual pathogen Download PDF

Info

Publication number
CA3059288C
CA3059288C CA3059288A CA3059288A CA3059288C CA 3059288 C CA3059288 C CA 3059288C CA 3059288 A CA3059288 A CA 3059288A CA 3059288 A CA3059288 A CA 3059288A CA 3059288 C CA3059288 C CA 3059288C
Authority
CA
Canada
Prior art keywords
seq
set forth
staphylococcus aureus
nucleotide sequence
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CA3059288A
Other languages
French (fr)
Other versions
CA3059288A1 (en
Inventor
Yunbo LUO
Wentao Xu
Kunlun HUANG
Jingjing TIAN
Zaihui DU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Publication of CA3059288A1 publication Critical patent/CA3059288A1/en
Application granted granted Critical
Publication of CA3059288C publication Critical patent/CA3059288C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Provided in the present application is a novel colorimetric sensing method for a dual pathogen, comprising an in vitro nucleic acid amplification and a detection method, where the in vitro nucleic acid amplification uses a primer consisting sequentially of complementary sequences, a connecting arm, complementary sequences, and a nucleic acid sequence of a specifically amplified target to be tested for a superfast PCR reaction, and the detection uses a hairpin sequence consisting of complementary sequences and a G-quadruplex to implement self-assembly color development.

Description

NOVEL COLORIMETRIC SENSING METHOD FOR DUAL PATHOGEN
FIELD
[0001] The present disclosure relates to the technical field of biological detection, specifically to a novel colorimetric sensing method for dual pathogen.
BACKGROUND
[0002] The traditional bacterial detection method is mainly based on the physiological and biochemical characteristics of bacteria. After the steps of pre-enrichment, selective plate separation and biochemical identification, it takes 5-7 days from sampling to determination. The detection period is long, the operation is cumbersome and the workload is large. It has been more than half a century since the specificity of the antigen-antibody reaction has been used to identify bacteria, but the screening of microbial antibodies is cumbersome and the specificity of the final detection is not high. The continuous improvement and development of molecular biology detection technology has overcome the problems of tedious and time-consuming experimentation of traditional detection methods and led to the rapid development of rapid detection methods for microorganisms, but the disadvantage of molecular biology methods is that the results are not visualized, making the results analysis not easy.
SUMMARY
[0003] The novel colorimetric sensing method established by the present disclosure overcomes the deficiencies of the existing detection technologies and realizes accurate, rapid, simple and - -13826743.1 efficient detection and analysis of microorganisms.
[0004] The present disclosure aims to provide a detection method, comprising nucleic acid amplification in vitro, wherein the reaction system of the nucleic acid amplification in vitro comprises a upstream primer and a downstream primer, wherein the upstream primer comprises a complementary sequence A, a linking arm, a complementary sequence B, and a nucleotide sequence capable of specifically amplifying a target to be detected;
the linking arm is provided between the complementary sequence A and complementary sequence B, and the nucleotide sequence capable of specifically amplifying the target to be detected is provided at 5' terminal or 3' terminal of the upstream primer;
the nucleotide sequence of the complementary sequence A and the nucleotide sequence of the complementary sequence B are complementary and/or reverse complementary to each other;
the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the target to be detected.
[0005] The A and B are only used to distinguish different complementary sequences, and are not used for sorting.
[0006] The complementation includes complementation or reverse complementation as defined by the conventional art or common general knowledge, and/or performing complementation or reverse complementation according to complementary principles as defined by the conventional art or common general knowledge.
[0007] The polymerase includes a polymerase that can be used for the in vitro nucleic acid amplification.

13718731.2
[0008] The nucleotide sequence capable of specifically amplifying the target to be detected comprises a primer sequence designed according to a characteristic sequence of the target to be detected; the characteristic sequence comprises the characteristic sequence defined by the conventional art or common general knowledge; and the design comprises the design method recorded by the conventional art or common general knowledge.
[0009] Specifically, the method further comprising at least one of the following 1) to 2):
1) the nucleic acid amplification in vitro includes ultra-rapid PCR, wherein the reaction process of the ultra-rapid PCR comprises: 90-98 C for 2-6s and 50-60 C for 2-8s, for 20-40 cycles in total;
specifically, the reaction process of the ultra-rapid PCR reaction comprises:
95 C for 4s;
58 C for 6s; and a total of 30 cycles;
specifically, the concentration of the upstream primer and the downstream primer in the reaction system of the ultra-rapid PCR reaction is more than 10 times of the concentration of the regular PCR; specifically, the concentration is 20 times; the reaction system of the ultra-rapid PCR reaction further comprises a DNA polymerase, and the concentration of the DNA
polymerase is more than 10 times of the concentration of the regular PCR, more specifically, the concentration is 60 times; and 2) the linking arm comprises a compound having a long-chain structure.
[0010] More specifically, the linking arm is oxyethyleneglycol, and the chemical structure of oxyethyleneglycol is:
0-P _____________________________________________________________ 0 (I)
[0011] Specifically, the method further comprising at least one of the following 1) to 8):
1) the upstream primer includes a primer obtained by linking the nucleotide sequences set 13718731.2 forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
2) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 3;
3) the upstream primer includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 1 and/or SEQ ID NO: 2 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID
NO: 2;
4) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
3;
5) the upstream primer includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
6) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 6;
7) the upstream primer includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID
NO: 5; and 8) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
6.
[0012] The "function" refers to realizing specific amplification or detecting the target to be detected.
[0013] More specifically, the upstream primer is:
AGA GAGAGAGAGGGAAAGAGAGAG- ox yethyleneglycol-CTCTCTCTTTCCCTCTCT
CTCTCTTTITTGTGAAATTATCGCCACGTTCGGGCAA and/or TGAGGTAGTAGGTTGTATAGTT-oxyethylenegl ycol-AACTATACAAC CTACTACCTCA

13718731.2 AAAAAAAAAAAGCACATAACAAGCG.
[0014] The upstream primers can be synthesized commercially, and the preparation method thereof belongs to conventional art.
[0015] Another object of the present disclosure is to provide a detection method, comprising a color reaction based on nucleic acid self-assembly, wherein the reaction system of the color reaction based on nucleic acid self-assembly comprises a hairpin sequence which comprises all or a part of a nucleotide sequence containing a G-quadruplex forming nucleotide sequence, a complementary sequence C, and a complementary sequence D, wherein the all or a part of the nucleotide sequence containing a G-quadruplex forming nucleotide sequence is provided at 5' terminal and/or 3' terminal of the hairpin sequence;
the complementary sequence C and the complementary sequence C of the other hairpin sequence are complementary and/or reverse complementary to each other; and the complementary sequence D and the target to be detected or the nucleotide sequence linked to the target to be detected are complementary and/or reverse complementary.
[0016] The C and D are only used to distinguish different complementary sequences, and are not used for sorting.
[0017] The G-quadruplex forming nucleotide sequence comprises the G-quadruplex forming nucleotide sequence as defined by the conventional art or common general knowledge.
Specifically, the G-quadruplex forming nucleotide sequence comprises the sequence capable of self-assembling to form a G-quadruplex structure having an activity similar to horseradish peroxidase, and the G-quadruplex structure, under the induction of hemin, catalyzes ABTS2- and H202 to form ABTS- , which makes the reaction solution blue-green.
[0018] Specifically, the hairpin sequence can cleave the G-quadruplex forming nucleotide sequence at a ratio of 25% and/or 75%, and the cleaved sequences are respectively added at the 5' terminal and/or the 3' terminal of the hairpin sequence; more specifically, a T base is further added after the cleaving; the T base is added at the 5' terminal and/or the 3' terminal of the cleaved sequence.
[0019] Specifically, the G-quadruplex forming nucleotide sequence includes the nucleotide 13718731.2 sequences set forth in SEQ ID NO: 7 and/or SEQ ID NO: 8.
[0020] Specifically, the complementary sequence D may be complementary and/or reverse complementary to the complementary sequence A and/or complementary sequence B
according to the present disclosure.
[0021] More specifically, the hairpin sequence comprises at least one of the following 1) to 4):
I) the nucleotide sequence set forth in SEQ ID NO: 9 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ II) NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9;
2) the nucleotide sequence set forth in SEQ ID NO: 10 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10;
3) the nucleotide sequence set forth in SEQ ID NO: 11 and/or a nucleotide sequence which is .. modified from the nucleotide sequence set forth in SEQ ID NO: 11 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 11; and 4) the nucleotide sequence set forth in SEQ ID NO: 12 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 12 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 12.
[0022] More specifically, the color reaction based on nucleic acid self-assembly further comprises at least one of the following 1) to 2):
1) the reaction condition of the color reaction based on nucleic acid self-assembly comprises a step of incubating at 37 C for 20 mm; and 2) the final concentration of the hairpin sequence in the reaction system of the color reaction based on nucleic acid self-assembly is 2 M.
[0023] Another object of the present disclosure is to provide a detection method, comprising first amplifying the target to be detected by any of the methods according to the present 13718731.2 disclosure, and then detecting the target to be detected by any of the methods according to present disclosure.
[0024] Specifically, in the method, the complementary sequence D according to the present disclosure and the complementary sequence A and/or complementary sequence B
according to the present disclosure are complementary or reverse complementary.
[0025] Specifically, the method further comprising at least one of the following 1) to 4):
1) determining whether an object to be detected contains the target to be detected by a color change of final reaction system;
specifically, when the color of the reaction system changes, the object to be detected is determined to contain the target to be detected; more specifically, when the color of the reaction system turns blue-green, the object to be detected is determined to contain the target to be detected;
2) calculating the concentration of the target to be detected in the object by a method of plotting standard curve according to the color of the final reaction system;
3) amplifying the detection signal of the target to be detected by increasing the type of hairpin sequence in the reaction system;
specifically, for each additional hairpin sequence, the signal is amplified 2-4 times;
4) achieving dual or multiple detection by increasing the type of upstream primer or downstream primer, and simultaneously increasing the type of hairpin sequence in the reaction system.
[0026] Specifically, when the detection is for dual or multiple detection, the microarray method can be used to determine whether the object to be detected contains the target to be detected or contains several targets to be detected. The microarray method comprises separately placing the different types of hairpin sequences in different wells to perform reactions, and then determining whether the sample contains the target to be detected or several targets to be detected according to the reaction results. When the color of the reaction liquid changes or turns blue-green, it is determined that the target to be detected is present; the total number of wells in which the color 13718731.2 change or the blue-green color is generated is the total number of targets which are contained in the sample to be detect.
[0027] The types of hairpin sequence: if the complementary sequence D is complementary or reverse complementary to the complementary sequence A and/or B in the same upstream primer, then they are the same type of hairpin sequence. Otherwise, the sequence is different type of hairpin sequence; and the upstream primers having identical nucleotide sequences are the same upstream primers.
[0028] The types of the upstream primer or the downstream primer: a primer pair that can amplify the same target to be detected are the same type of upstream primer or downstream primer; otherwise, the primer pair that can amplify different targets to be detected are different types of upstream primer or downstream primer.
[0029] Another object of the present disclosure is to provide a kit and/or a biosensor, comprises at least one of the following 1) to 2):
1) the upstream primer and the downstream primer, the upstream primer comprises a complementary sequence A, a linking arm, a complementary sequence B, and a nucleotide sequence capable of specifically amplifying a target to be detected, wherein the linking arm is provided between the complementary sequence A and complementary sequence B, and the nucleotide sequence capable of specifically amplifying the .. target to be detected is provided at 5' terminal or 3' terminal of the upstream primer;
the nucleotide sequence of the complementary sequence A and the nucleotide sequence of the complementary sequence B are complementary and/or reverse complementary to each other;
the linking arm comprises a moeity capable of inhibiting polymerase binding and/or a .. moeity capable of inhibiting new strand extension during in vitro nucleic acid amplification; and the downstream primer comprises the nucleotide sequence capable of specifically amplifying the target to be detected; and 13718731.2 2) a hairpin sequence comprising all or a part of a nucleotide sequence containing a G-quadruplex forming nucleotide sequence, a complementary sequence C, and a complementary sequence D, wherein the all or a part of a nucleotide sequence containing a G-quadruplex forming nucleotide sequence is provided at 5' terminal and/or 3' terminal of the hairpin sequence;
the complementary sequence C and the complementary sequence C of the other hairpin sequence are complementary and/or reverse complementary; and the complementary sequence D and the target to be detected or the nucleotide sequence linked to the target to be detected are complementary and/or reverse complementary.
[0030] The complementation includes complementation or reverse complementation as defined by the conventional art or common general knowledge, and/or performing complementation or reverse complementation according to complementary principles as defined by the conventional art or common general knowledge.
[0031] The polymerase includes a polymerase that can be used for the in vitro nucleic acid amplification.
[0032] The nucleotide sequence capable of specifically amplifying the target to be detected specifically comprises a primer sequence designed according to a characteristic sequence of the target to be detected; the characteristic sequence comprises the characteristic sequence defined by the conventional art or common general knowledge; and the design comprises the design method recorded by the conventional art or common general knowledge.
[0033] Specifically, the linking arm comprises a compound having a long-chain structure.
[0034] More specifically, the linking arm is oxyethyleneglycol, and the chemical structure of oxyethyleneglycol is:

13718731.2 o OP -o-
[0035] Specifically, the upstream primer and the downstream primer comprise at least one of the following 1) to 8):
1) the upstream primer includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
2) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 3;
3) the upstream primer includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 1 and/or SEQ ID NO: 2 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID
NO: 2;
4) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
3;
5) the upstream primer includes a primer obtained by linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
6) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 6;
7) the upstream primer includes a primer obtained by linking, via the linking arm, nucleotide sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 4 and/or SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides and have the same function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID
NO: 5; and 8) the downstream primer includes a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or deleting one or 13718731.2 more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO:
6.
[0036] The "function" refers to realizing specific amplification or detecting the target to be detected.
[0037] More specifically, the upstream primer is:
AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol-CTCTCTCTTTCCCTCTCT
CTCTCTTTTTTGTGAAATTATCGCCACGTTCGGGCAA =
and/or TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol-AACTATACAACC
TACTACCTCAAAAAAAAAAAAGCACATAACAAGCG.
[0038] The C and D are only used to distinguish different complementary sequences, and are not used for sorting.
[0039] The G-quadruplex forming nucleotide sequence comprises the G-quadruplex forming nucleotide sequence as defined by the conventional art or common general knowledge.
Specifically, the G-quadruplex forming nucleotide sequence comprises the sequence capable of self-assembling to form a G-quadruplex structure having an activity similar to horseradish peroxidase, and the G-quadruplex structure, under the induction of hemin, catalyzes ABTS2- and H202 to form ABTS- , which makes the reaction solution blue-green.
[0040] Specifically, the hairpin sequence can cleave the G-quadruplex forming nucleotide sequence at a ratio of 25% and/or 75%, and the cleaved sequences are respectively added at the 5' terminal and/or the 3' terminal of the hairpin sequence; more specifically, a T base is further added after the cleaving; the T base is added at the 5' terminal and/or the 3' terminal of the cleaved sequence.
[0041] Specifically, the G-quadruplex forming nucleotide sequence includes the nucleotide sequences set forth in SEQ ID NO: 7 and/or SEQ ID NO: 8.
[0042] Specifically, the complementary sequence D is complementary or reverse complementary to the complementary sequence A and/or B.
[0043] More specifically, the hairpin sequence comprises at least one of the following 1) to 4):
1) the nucleotide sequence set forth in SEQ ID NO: 9 and/or a nucleotide sequence which is 13718731.2 modified from the nucleotide sequence set forth in SEQ ID NO: 9 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 9;
2) the nucleotide sequence set forth in SEQ ID NO: 10 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 10 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 10;
3) the nucleotide sequence set forth in SEQ ID NO: 11 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 11 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ ID NO: 11; and 4) the nucleotide sequence set forth in SEQ ID NO: 12 and/or a nucleotide sequence which is modified from the nucleotide sequence set forth in SEQ ID NO: 12 by substituting, adding and/or deleting one or more nucleotides and has the same function as the nucleotide sequence set forth in SEQ NO: 12.
[0044] Specifically, the kit and/or the biosensor comprises the following 1) to 3):
1) AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol bridge - CTCTCT
CTTTCCCTCTCTCTCTCTTTTTTGTGAAATTATCGCCACGTTCGGGCAA
and/or TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol bridge - AACTATACAACCTACTA
CCTCAAAAAAAAAAAAGCACATAACA;
2) TCATCGCACCGTCAAAGGAACC and/or GATAAAGAAGAAACCAGCAG; and 3) at least one of the nucleotide sequences set forth in SEQ ID NO:9, SEQ ID
NO:10, SEQ
ID NO:11, and SEQ ID NO:12;
wherein, the chemical structure of oxyethyleneglycol is:

13718731.2 0=-P ____________________________________________________________ 0
[0045] Another object of the present disclosure is to provide the use of any one of the methods according to the present disclosure, and any one of the kits and/or the biosensors according to the present disclosure.
[0046] Specifically, the use comprises at least one of the following 1) to 4):
1) detecting microorganisms;
2) preparing products for use in microorganism detection and/or related products;
3) detection of dual or multiple microorganisms; and 4) preparing products for use in dual or multiple microbial detection and/or related products.
to .. [0047] Specifically, the microorganisms include Salmonella and/or Staphylococcus aureus.
[0048] Optionally, the use does not include the diagnosis and treatment of the disease described in Article 25 of the Chinese Patent Law.
[0049] A novel dual colorimetric sensing method based on ultra-rapid PCR is established by the present disclosure:
(1) this method establishes an ultra-rapid PCR reaction system that reduces the traditional PCR process, which takes about 3 hours, to 5 minutes, significantly reducing the time spent on PCR reactions;
(2) the ultra-rapid PCR reaction system is equipped with an enzyme-linked color module based on nucleic acid self-assembly, which not only amplifies the reaction signal again to facilitate the ultra-sensitive detection of pathogenic bacteria but also solves the problem that the traditional PCR results are difficult to visually detect; and (3) color reaction system is set in wells and sorted by microarray to solve the problem of 13718731.2 dual detection for pathogenic bacteria.
[0050] In one embodiment of the present disclosure, amplification primers for ultra-rapid polymerase chain reaction (PCR) are designed based on virulence genes of Salmonella and Staphylococcus aureus, and a color module based on nucleic acid self-assembly is combined to integrate and establish a novel dual colorimetric sensing method based on ultra-rapid PCR for ultrasensitive detection of Salmonella and Staphylococcus aureus.
[0051] The present disclosure has the following beneficial technical effects:
1) the detection method and the biosensor established by the present disclosure are faster and more sensitive than the conventional method, and have the advantages of high specificity, high sensitivity, reliable detection results, etc., and can simplify the analysis and detection steps, shorten the analysis time, and more importantly make the online real-time detection possible, easy to carry and field work, and has very good application prospect in the field of microbial detection including food safety and rapid detection;
2) the detection method and the biosensor established by the present disclosure can simultaneously realize the dual specific detection of Salmonella and Staphylococcus aureus, the detection has good specificity, high sensitivity, reliable detection result, can be discerned by the naked eye, and the detection process is quick and convenient, which are of great significance in daily monitoring or market screening and other aspects. Specifically, the detection sensitivity of the detection method and the biosensor established by the present disclosure for detecting Salmonella and Staphylococcus aureus are 10 cfu/mL and 10 cfu/mL, respectively; in addition, the specificity experiment results show that the detection method and biosensor established by the present disclosure do not cross-react with Shigella and Escherichia coli, and can realize dual specific detection of Salmonella and Staphylococcus aureus at the same time;
and 3) the color module based on nucleic acid self-assembly according to the present disclosure is a non-enzymatic reaction, the reaction system component is simpler, the reaction process is simpler, the step of terminating the enzymatic reaction is reduced, and the constant temperature reaction simplifies the requirement for the enzymatic reaction temperature, and the economic cost is significantly reduced, the reaction time is shortened to help to meet the requirements of fast and simple detection.

13718731.2 BRIEF DESCRIPTION OF DRAWINGS
[00521 Figure 1 is a schematic diagram showing the structure of ultra-rapid PCR device.
[0053] Figure 2 is the result of verification of the amplification effect of the dual ultra-rapid PCR reaction. Lane 1 is a negative control without product purification (a dual ultra-rapid PCR
reaction system without the addition of genomic samples of Salmonella and Staphylococcus aureus); lane 2 is a positive sample with product purification (a dual ultra-rapid PCR reaction system with the addition of genomic samples of Salmonella and Staphylococcus aureus); lane 3 is a negative control with product purification (a dual ultra-rapid PCR reaction system without the addition of genomic samples of Salmonella and Staphylococcus aureus); and lane 4 is a positive sample with product purification (a dual ultra-rapid PCR reaction system with the addition of genomic samples of Salmonella and Staphylococcus aureus).
[0054] Figure 3 is a standard curve for Salmonella.
[0055] Figure 4 is a standard curve for Staphylococcus aureus.
DETAILED DESCRIPTION
[0056] The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0057] The molecular biology experimental methods not specifically described in the following examples are all carried out according to the specific methods listed in the book "Molecular Cloning: A Laboratory Manual" (third edition) by J. Sambrook, or carried out according to the instructions of kits and products.
[0058] The materials and reagents used in the following examples are commercially available unless otherwise specified.
Example 1: establishment of a dual colorimetric sensing method based on ultra-rapid PCR for 16514131.1 Date Recue/Date Received 2021-02-24 detecting Salmonella and Staphylococcus aureus I. Experimental materials [00591 The strain information used in this example is shown in Table 1, the designed nucleotide sequence of primers are shown in Table 2 and Sequence Listing.
Table 1 Bacteria name Latin name Strain number Salmonella Salmonella spp. CGMCC 1.0090 Staphylococcus aureus Staphylococcus aureus ATCC 25923 Table 2 Primer Name Sequence (from 5' to 3') AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol Primer 1 bridge-CTCTCTCTTTCCCTCTCTCTCTCTTTTTTGTGAAATTATCGCCA
CGTTCGGGCAA
Primer 2 TCATCGCACCGTCAAAGGAACC
TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol Primer 3 bridge-AACTATACAACCTACTACCTCAAAAAAAAAAAAGCACATAAC
AAGCG
Primer 4 GATAAAGAAGAAACCAGCAG
AGGGCGGGTGGGTCTCTCTCTTTCCCTCTCTCTCTCTCGGCAGAGAGA
Hairpin 1 GAGAGGGAAAGT GGGT
TGGGTAGAGAGAGAGAGGGAAAGAGAGAGCTTTCCCTCTCTCT
Hairpin 2 CTCTGCCGTGGGTAGGGCGGG
AGGGCGGGTGGGTAGTAGGTTGTATAGTTCAAAGTAACTATACAACCT
Hairpin 3 ACTACCTCATGGGT
TGGGTACTTTGAACTATACAACCTACTTGAGGTAGTAGGTTGTATAGTT
Hairpin 4 TGGGTAGGGCGGG
[0060] In Table 2, the nucleotide sequence on the left side of the linking arm (oxyethyleneglycol bridge) of the upstream Primer 1 is the nucleotide sequence set forth in SEQ
ID NO: 1, and the nucleotide sequence on the right side of the linking arm is the nucleotide sequence set forth in SEQ ID NO: 2, and the chemical structure of the linking arm is :

16514131.1 Date Recue/Date Received 2021-02-24 ) 100611 In Table 2, the nucleotide sequence of the downstream Primer 2 is the nucleotide sequence set forth in SEQ ID NO: 3.
[0062] In Table 2, the nucleotide sequence on the left side of the linking arm (oxyethyleneglycol bridge) of the upstream Primer 3 is the nucleotide sequence set forth in SEQ
ID NO: 4, and the nucleotide sequence on the right side of the linking arm is the nucleotide sequence set forth in SEQ ID NO: 5, and the chemical structure of the linking arm is the same as the chemical structure of the linking arm of Primer 1.
100631 In Table 2, the nucleotide sequence of the downstream Primer 4 is the nucleotide sequence set forth in SEQ ID NO: 6.
100641 In Table 2, each of the hairpin sequences 1 to 4 (Hairpin 1, Hairpin 2, Hairpin 3, Hairpin 4) is a G-quadruplex sequence by cleaving two G-quadruplex forming nucleotide sequences at a ratio of 25% and/or 75% and respectively adding to two terminals of the Hairpin Probe, and T
base is added to protect the cleaved G-quadruplex sequences. The two G-quadruplex forming nucleotide sequences are the nucleotide sequence AGGG CGGG TGGG TGGG set forth in SEQ
ID NO: 7 and the nucleotide sequence TGGG TGGG TAGGG CGGG set forth in SEQ ID
NO: 8.
The "initiator" can promote nucleic acid self-assembly, so that the cleaved G-quadruplex get close to each other in distance, and under the induction of hemin, the G-quadruplex functional structure having an activity similar to horseradish peroxidase is formed to catalyze the color development of the reaction between ABTS2- and H202. Specifically, in Table 2, the nucleotide sequence of the hairpin sequence Hairpin 1 is the nucleotide sequence set forth in SEQ ID NO: 9;
the nucleotide sequence of the hairpin sequence Hairpin 2 is the nucleotide sequence set forth in SEQ ID NO: 10; the nucleotide sequence of the hairpin sequence Hairpin 3 is the nucleotide sequence set forth in SEQ ID NO: 11; and the nucleotide sequence of the hairpin sequence 16514131.1 Date Recue/Date Received 2021-02-24 Hairpin 4 is the nucleotide sequence set forth in SEQ ID NO: 12.
100651 The sequences listed in Table 2 are all artificially synthesized.
100661 Ex Taq DNA polymerase, 10 X Ex Taq Buffer (20 mM Mg2+ Plus) and dNTP
Mixture (2.5 mM) are purchased from TAKaRa. Hemin and 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS2-) are purchased from Sigma-Aldrich Chemical Co. Experimental water is obtained from Milli-Q water purification system. All other reagents are purchased from China National Pharmaceutical Group Corporation.
II. Construction of ultra-rapid PCR device [0067] The main structure of the ultra-rapid PCR device is shown in Figure 1.
The specific structure, connection method, working principle and working process include:
Light Cycler model capillary (20 tL, 04 929 292 001, Roche) is used as a PCR
sample chamber of the ultra-rapid PCR device, the samples are collected at one terminal of each capillary by rapid centrifugation, and the capillary with the sample is fixed to the plastic holder after centrifuging. The plastic holder is connected to a stepper motor (42JSF630A5-1000, Just Motioin Control) which drives the capillary sample chamber fixed on the plastic holder to switch between a high-temperature water bath at 95 C and a medium-temperature water bath at 58 C cyclically to realize reaction temperature change and control during the ultra-rapid PCR
reaction. The stepper motor is powered by a switching power supply (S-100-24, Elecall), and the frequency or time control of the above-mentioned cyclic conversion of the stepper motor is realized by a DC
servo motor driver (YZ-ACSD60, Moving) and Labview (version 2014). Temperature measurement is achieved by using a thermocouple encapsulated in a capillary.
The amplification and linearization of the thermocouple signal are carried out using a temperature transmitter (SBWR-2260, K, Yuancheng) and processed using the Arduino UNO v1.0 chip. The Arduino UNO chip converts the received analog signal into a digital signal, which is then subjected to calculation by the Arduino IDE (version 1.8.1) module.
III. Dual ultra-rapid PCR reaction 16514131.1 Date Recue/Date Received 2021-02-24 [0068] 1) Preparation of a dual ultra-rapid PCR reaction system, which is shown in Table 3:
Table 3 Reaction component Final concentration Template 0.05 [tM
Ex Taq DNA polymerase 1.5 U/mL
Primer-1 2 [tM
Primer-2 2 [tM
Primer-3 2 [tM
Primer-4 2 [tM
dNTP 250 [tM
10 xEx Taq Buffer 1 xEx Taq Buffer ddH20 Up to 10 [tL
[0069] Salmonella and Staphylococcus aureus bacteria were cultured overnight in LB medium for activation, and genomic DNA of Salmonella and Staphylococcus aureus was respectively extracted from the culture by using bacterial genomic DNA extraction kit (New Industry), and 1 [IL each of the extracted genomic DNA samples was taken to mix as a template in Table 3.
Primers 1 to 4 (Primer 1, Primer 2, Primer 3, Primer 4) in Table 3 were primers 1 to 4 (Primer 1, Primer 2, Primer 3, Primer 4) listed in Table 2 above.
100701 2) Reaction process of the dual ultra-rapid PCR
According to Table 3, 10 [t1 of the reaction system was prepared on ice, and it was quickly placed in the ultra-rapid PCR reaction device constructed in part II for temperature control. The temperature control and cycle number are shown in Table 4:
Table 4 Reaction Reaction time temperature 95 C 4s 30 cycles, 5min in total 58 C 6s [0071] 3) Verification of amplification results for dual ultra-rapid PCR
reactions 16514131.1 Date Recue/Date Received 2021-02-24 After the completion of the above dual ultra-rapid PCR reaction, agarose gel electrophoresis with 2% ethidium bromide pre-staining was used to verify the amplification result of the dual ultra-rapid PCR reaction system.
Electrophoresiscondition: 130 V for 25 min Photographing system: Molecular Imager Gel Doc XR (Bio-Rad).
PCR product purification kit (Sangon Biotech) was used to remove primer dimers, unreacted primers and reaction impurities.
[0072] The verification result of the amplification result of the dual ultra-rapid PCR reaction is shown in Figure 2. Figure 2 shows that the dual ultra-rapid PCR reaction system achieves an effective amplification of two types of pathogenic bacteria; and the purification of the PCR
product purification kit effectively removes primer dimers, unreacted primers and reaction impurities.
IV. Establishment of color module based on nucleic acid self-assembly and visual detection of dual pathogen 100731 1) Sensitivity experiment [0074] Standard curves of Salmonella and Staphylococcus aureus were plotted.
The four hairpin probes listed in Table 2 above: Hairpin 1, Hairpin 2, Hairpin 3, Hairpin 4 were dissolved in ultrapure water to 100 [tM, heated at 95 C for 5 min, and then slowly cooled down to room temperature.
[0075] Salmonella and Staphylococcus aureus bacteria were cultured overnight in LB medium for activation. The culture was subjected to a gradient dilution and then plate culture for counting.
Salmonella or Staphylococcus aureus broth at concentrations of 101 cfu/ml, 102 cfu/ml, 103 cfu/mL, 104 cfu/mL, and 105 cfu/mL were subjected to genomic DNA extraction by using the bacterial genomic DNA extraction kit (New Industry). The genomic DNA samples extracted from the same concentration of Salmonella broth and Staphylococcus aureus broth were mixed (according to a volume ratio of 1:1, i.e. 1 pL of each) as a template, and a dual ultra-rapid PCR
reaction was carried out according to the dual ultra-rapid PCR reaction described in the above part III. The reaction system (10 Ill) after the completion of the reaction was equally divided into 16514131.1 Date Recue/Date Received 2021-02-24 2 portions: one of which was added with the ultrapure aqueous solutions of Hairpin 1 and Hairpin 2 produced above, and the other was added with the ultrapure aqueous solutions of Hairpin 3 and Hairpin 4 produced above. Self-assembly buffer (8 mM Na2HPO4, 2.5 mM NaH2PO4, 0.15 M
NaCl, 2 mM MgCl2, pH 7.4) was added respectively to the above two portions, and the final concentration of each Hairpin Probe was 2 pM, and both reaction systems were 10 pl. Both reaction systems were incubated at 37 C for 20 min, and the nucleic acid self-assembly product was obtained.
[0076] The color system based on nucleic acid self-assembly was established.
10 pL of nucleic acid self-assembly reaction product was taken and added with 1 pL of hemin stock solution (10 pM), 32 pL G-quadruplex inducing buffer (100 mM 2-(4-morpholine) ethanesulfonic acid (IVIES), 40 mM KC1, with a volume percentage of 0.05% Triton X-100, pH 5.5), and 23 pL
of ultrapure water, the mixture was incubated at 37 C for 20 min; 8 pL of ABTS2- stock solution (20 mM) and 8 pL of hydrogen peroxide (H202) stock solution (20 mM) were added to the mixture and then incubated at room temperature in the dark for 5 min. After the reaction was completed, the OD value of the reaction solution at 415 nm was measured by a spectrophotometer, and the respective standard curves of Salmonella and Staphylococcus aureus were plotted, and the results are shown in Figure 3 and Figure 4.
100771 According to the obtained standard curve and the 3a principle, the detection limits of Salmonella and Staphylococcus aureus were determined to be 10 cfu/mL and 10 cfu/mL, indicating that the new detection method established by the present disclosure has a high sensitivity.
100781 The method of plotting the standard curve and determining the detection limit were carried out according to the method described in the literature Macdougall, D., Crummett, W.B., 1980. Anal. Chem. 52(14), 2242-2249.
[0079] 2) Accuracy experiment [0080] Standard substance recovery test:
100811 The Salmonella broth with the concentration of 10 cfu/mL and the Staphylococcus aureus broth with the concentration of 10 cfu/mL were respectively detected by a traditional plate 16514131.1 Date Recue/Date Received 2021-02-24 detection method and the new method established by the present disclosure, and the detection results are shown in Table 5. The average number of colony detected by the new detection method established by the present disclosure (the detection process was consistent with the sensitivity experiment process described above, and the only difference was that the extracted genomic DNA samples were from Salmonella broth and Staphylococcus aureus broth having a concentration of 10 cfu/mL. After extraction, 1 [EL of each sample was taken and mixed as the template) was similar to the average number of colony detected by the traditional plate detection, indicating that the new detection method established by the present disclosure has high accuracy.
Table 5 Plate detection New method Bacteria name Average number of colony Average number of colonya+SDb (cfu/mL) (cfu/mL) Salmonella 9.70 10.30 1.33 Staphylococcus aureus 10.42 9.81 0. 87 100821 3) Specificity experiment [0083] Salmonella, Staphylococcus aureus, Shigella and Escherichia coli were cultured overnight in LB medium for activation to prepare 10 cfu/mL of Salmonella broth, 10 cfu/mL of Staphylococcus aureus broth, 100 cfu/ mL of Shigella broth, and 100 cfu/mL of Escherichia coli broth, and genomic DNA samples were extracted from different broth by bacterial genomic DNA
extraction kit (New Industry). Each of the genomic DNA samples extracted from Salmonella broth and Shigella broth was taken 1 [EL to mix as a template, which was labeled as the reaction system 1; each of the genomic DNA samples extracted from the Escherichia coli broth and Staphylococcus aureus broth was taken 1 [EL to mix as a template, which was labeled as the reaction system 2; and each of the genomic DNA samples extracted from the Salmonella broth and Staphylococcus aureus broth was taken 1 [IL to mix as a template, which was labeled as the reaction system 3. Dual ultra-rapid PCR reaction of the three reaction systems was carried out according to the dual ultra-rapid PCR reaction (all the same except the template is replaced accordingly) described above in the above part III.

16514131.1 Date Recue/Date Received 2021-02-24 [0084] The four Hairpin Probes listed in Table 2 above: Hairpin 1, Hairpin 2, Hairpin 3, and Hairpin 4 were dissolved in ultrapure water to 100 [tM, heated at 95 C for 5 min, and then slowly cooled to room temperature for later use.
[0085] The three reaction systems (10 pi) after the completion of the reaction were equally divided into 4 portions. The first portion of each reaction system was added to three wells marked as 1 (the ultrapure aqueous solutions of Hairpin 1 and Hairpin 2 were dissolved in well 1 in advance), and the second portion of each reaction system was added to three wells marked as 2 (the ultrapure aqueous solutions of Hairpin 3 and Hairpin 4 were dissolved in well 2 in advance).
The remaining two portions of each reaction system were added to three wells marked as 3 and three wells marked as 4 respectively (no Hairpin was placed in well 3 and well 4 as a negative control). Then, the self-assembly buffer (8 mM Na2HPO4, 2.5 mM NaH2PO4, 0.15 M
NaCl, 2 mM MgCl2, pH 7.4) was added in each well, and the final concentration of each hairpin probe was 2 [tM, and each well was 10 [IL. All the wells were incubated at 37 C for 20 min, and the nucleic acid self-assembly products was obtained.
100861 1 [IL of hemin stock solution (10 pM), 32 [IL of G-quadruplex inducing buffer (100 mM
2-(4-morpholine) ethanesulfonic acid (IVIES), 40 mM KCl, with a volume percentage of 0.05%
Triton X-100, pH 5.5), 23 [IL of ultrapure water were added to each well to incubate at 37 C for 20 min; and 8 pt of ABTS2- stock solution (20 mM) and 8 [IL of hydrogen peroxide (H202) stock solution (20 mM) were added to the mixture and incubated at room temperature for 5 min in the dark.
[0087] The experimental results show that the detection method established by the present disclosure has no cross-reaction to Shigella and Escherichia colt, and can simultaneously achieve a dual specific detection of Salmonella and Staphylococcus aureus.
100881 The examples described above are only illustrative of the embodiments of the present disclosure, and the description thereof is more specific and detailed, but is not to be construed as limiting the scope of the present disclosure. However, any technical solution obtained by using equivalent replacement or equivalent transformation should fall within the protection scope of the present disclosure.

16514131.1 Date Recue/Date Received 2021-02-24

Claims (7)

1. A method for detecting Salmonella and/or Staphylococcus aureus, comprising:
1) performing a nucleic acid amplification in vitro, wherein reaction system of the nucleic acid amplification in vitro comprises an upstream primer and a downstream primer, wherein:
for detecting Salmonella, (a) the upstream primer has a sequence linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via a linking arm, and (b) the downstream primer has the sequence set forth in SEQ ID NO: 3;
for detecting Staphylococcus aureus, (c) the upstream primer has a sequence linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via a linking arm, and (d) the downstream primer has the sequence set forth in SEQ ID NO: 6; and for detecting both Salmonella and Staphylococcus aureus, primers (a), (b), (c) and (d) are used; and 2) performing a color reaction based on nucleic acid self-assembly, wherein reaction system of the color reaction comprises two or four hairpins, wherein:
for detecting Salmonella, two hairpins having the sequences set forth in SEQ
ID NO: 9 and SEQ ID NO: 10 are used;
for detecting Staphylococcus aureus, two hairpins having the sequences set forth in SEQ ID NO: 11 and SEQ ID NO: 12 are used; and for detecting both Salmonella and Staphylococcus aureus, four hairpins having the sequences set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID
NO: 12 are used.
2. The method according to claim 1, wherein the linking arm is a compound having a long-chain structure which inhibits polymerase binding or new strand extension during nucleic acid amplification.
3. The method according to claim 2, wherein the linking arm is an oxyethyleneglycol bridge having a structure of
4. The method according to any one of claims 1 to 3, wherein the nucleic acid amplification in vitro is ultra-rapid PCR performed by steps of 90-98 C for 2-6s and 50-60 C for 2-8s, for 20-40 cycles in total.
5. The method according to any one of claims 1 to 4, wherein the color reaction based on nucleic acid self-assembly comprises:
1) adding hemin and buffer and incubating at 37 C for 20 min; and 2) adding 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS2-) and H202.
6. A kit for detecting Salmonella and/or Staphylococcus aureus comprising:
1) an upstream primer and a downstream primer, wherein:

for detecting Salmonella, (a) the upstream primer has a sequence linking the nucleotide sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 via a linking arm, and (b) the downstream primer has the sequence set forth in SEQ ID NO: 3;
for detecting Staphylococcus aureus, (c) the upstream primer has a sequence linking the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5 via a linking arm, and (d) the downstream primer has the sequence set forth in SEQ ID NO: 6; and for detecting both Salmonella and Staphylococcus aureus, primers (a), (b), (c) and (d) are included;
wherein the linking arm has a structure of 2) two or four hairpins, wherein:
for detecting Salmonella, two hairpins having the sequences set forth in SEQ
ID NO: 9 and SEQ ID NO: 10 are included;
for detecting Staphylococcus aureus, two hairpins having the sequences set forth in SEQ ID NO: 11 and 12 are included; and for detecting Salmonella and Staphylococcus aureus, four hairpins having the sequences set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID
NO: 12 are included.
7. The kit according to claim 6 further comprising terminal deoxynucleotidyl transferase (TdT), dATP, dGTP, hemin, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABT S2-) and H202.
CA3059288A 2018-02-08 2018-08-08 Novel colorimetric sensing method for dual pathogen Active CA3059288C (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN201810128946.4 2018-02-08
CN201810128946.4A CN108251514A (en) 2018-02-08 2018-02-08 A kind of colorimetric sensing new method of dual pathogenic bacteria
PCT/CN2018/099324 WO2019153675A1 (en) 2018-02-08 2018-08-08 Novel colorimetric sensing method for dual pathogen

Publications (2)

Publication Number Publication Date
CA3059288A1 CA3059288A1 (en) 2019-08-15
CA3059288C true CA3059288C (en) 2022-03-22

Family

ID=62744310

Family Applications (1)

Application Number Title Priority Date Filing Date
CA3059288A Active CA3059288C (en) 2018-02-08 2018-08-08 Novel colorimetric sensing method for dual pathogen

Country Status (3)

Country Link
CN (1) CN108251514A (en)
CA (1) CA3059288C (en)
WO (1) WO2019153675A1 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108251514A (en) * 2018-02-08 2018-07-06 中国农业大学 A kind of colorimetric sensing new method of dual pathogenic bacteria
CN109082459A (en) * 2018-07-18 2018-12-25 桂林理工大学 The method of Taq DNA ligase and the DNA electrochemical sensor detection single nucleotide polymorphism of quantum dot signal amplification
CN109207615B (en) * 2018-10-12 2021-06-29 广东省生态环境技术研究所 Method for label-free fluorescence detection of mecA gene of staphylococcus aureus and detection kit
CN111154844B (en) * 2020-04-07 2020-09-04 中国农业大学 Visual detection method based on overspeed PCR and functional nucleic acid
CN111154843B (en) * 2020-04-07 2020-07-28 中国农业大学 Quantitative detection method based on overspeed PCR and functional nucleic acid color development
CN114214392A (en) * 2021-11-17 2022-03-22 广东省科学院生态环境与土壤研究所 Nucleic acid tetrahedron-based quantitative detection method for coronavirus and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1274847A (en) * 2000-06-02 2000-11-29 上海长征医院 Method of making marker signal amplifying probe
CN102827836B (en) * 2012-06-11 2014-03-12 中国科学院成都生物研究所 Oligonucleotide probe, and method for detecting target molecule through using it
CN103993100B (en) * 2014-06-17 2017-02-15 东南大学 Method for improving accuracy of gene connecting and sequencing
CN105018474A (en) * 2014-08-22 2015-11-04 江苏省原子医学研究所 Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe
CN108251514A (en) * 2018-02-08 2018-07-06 中国农业大学 A kind of colorimetric sensing new method of dual pathogenic bacteria

Also Published As

Publication number Publication date
CA3059288A1 (en) 2019-08-15
WO2019153675A1 (en) 2019-08-15
CN108251514A (en) 2018-07-06

Similar Documents

Publication Publication Date Title
CA3059288C (en) Novel colorimetric sensing method for dual pathogen
Wang et al. Specific and rapid detection of foodborne Salmonella by loop-mediated isothermal amplification method
CN111020008B (en) Rapid isothermal detection method and kit for nucleic acid of vibrio cholerae O1 group
CN109207567B (en) Method for determining staphylococcus aureus based on aptamer and strand displacement amplification reaction
Wang et al. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes
Furukawa et al. Highly sensitive real-time PCR assay for quantification of toxic cyanobacteria based on microcystin synthetase A gene
CN109321669B (en) Method for fluorescence detection of staphylococcus aureus based on chimera sequence design and molecular beacon
CN106434917A (en) LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit
CA2692633A1 (en) Method for the simultaneous detection of multiple nucleic acid sequences in a sample
Wei et al. Rapid and sensitive detection of Vibrio parahaemolyticus in sea foods by electrochemiluminescence polymerase chain reaction method
US20090226895A1 (en) Method of detecting vibrio parahaemolyticus via real-time PCR-hybridization
WO2013128397A1 (en) Real-time pcr detection of streptococcus pyogenes
Zeng et al. A polymerase chain reaction based lateral flow test strip with propidium monoazide for detection of viable Vibrio parahaemolyticus in codfish
Hu et al. Rapid and visual detection of Vibrio parahaemolyticus in aquatic foods using blaCARB-17 gene-based loop-mediated isothermal amplification with lateral flow dipstick (LAMP-LFD)
CA3059246C (en) New method for visual quantitative detection of dual heavy metal ions
US20220098645A1 (en) Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method
CN111485028A (en) Fluorescent quantitative PCR method for detecting tilapia streptococcus agalactiae and corresponding kit
KR20170030746A (en) Primers used for LAMP reaction for the detection of Salmonella and its use
CN102719542A (en) Simultaneous amplification and testing reagent kit for VC (vibrio cholerae)
US6268143B1 (en) Automated high throughput E. coli o157:H7 PCR detection system and uses thereof
AU2020101818A4 (en) A novel LAMP method, primer set and kit for SNP detection
Liu et al. Visual assay of Escherichia coli O157: H7 based on an isothermal strand displacement and hybrid chain reaction amplification strategy
Li et al. Robust and highly specific fluorescence sensing of Salmonella typhimurium based on dual-functional phi29 DNA polymerase-mediated isothermal circular strand displacement polymerization
KR20170030190A (en) Primers used for LAMP reaction for the detection of Clostridium perfringens and its use
CN110387429B (en) Reagent and kit for detecting pathogenic bacteria of Escherichia coli O157H 7 serotype and application

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20191007