CN111154843B

CN111154843B - Quantitative detection method based on overspeed PCR and functional nucleic acid color development

Info

Publication number: CN111154843B
Application number: CN202010266832.3A
Authority: CN
Inventors: 许文涛; 黄昆仑; 田晶晶; 李舒婷; 杜再慧
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-04-07
Filing date: 2020-04-07
Publication date: 2020-07-28
Anticipated expiration: 2040-04-07
Also published as: CN111154843A

Abstract

The invention provides a quantitative detection method based on overspeed PCR and functional nucleic acid, which adopts an optimized overspeed PCR reaction system for detection, is quicker and more sensitive than the traditional method, has the advantages of strong specificity, high sensitivity, reliable detection result and the like, can simplify the analysis and detection steps, shortens the analysis time, more importantly, enables the detection of a DNA long target fragment with the length of 600bp-2000bp or longer to be possible, is convenient for carrying and field operation, and has very good application prospect in the field of microbial detection including the fields of food safety and rapid detection.

Description

Quantitative detection method based on overspeed PCR and functional nucleic acid color development

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a novel rapid colorimetric sensing method for a long target sequence of pathogenic bacteria.

Background

Polymerase Chain Reaction (PCR) is widely applied to the fields of food safety, environmental monitoring and clinical diagnosis as a molecular biology technology for amplifying and amplifying specific DNA target fragments. With the increasing demand for detecting timeliness, the overspeed PCR technology is developed, and the PCR amplification time of hours is reduced to minutes. However, due to the kinetic factors of PCR reaction, the ultra-fast PCR technique is only used for amplifying a shorter target sequence, and cannot amplify a target with a longer DNA length to be detected.

In addition, for the detection of amplification products, the traditional gel electrophoresis method consumes long time and is easy to form aerosol pollution, and chemicals used in electrophoresis are harmful to human bodies; in the real-time fluorescence detection, DNA double-stranded fluorescence intercalators such as SYTO9, SYBRGreenI, GelRed and the like are used, and the nucleic acid amplification condition is indirectly characterized by calculating the Ct value. The methods are high in cost, long in time consumption, not beneficial to convenient use, invisible in result and difficult to analyze.

In order to solve the problem of convenient application of rapid PCR detection, the subject group provides a Visual detection method of overspeed PCR (Visual single cell detection of dual-pathologens based on multiplex super PCR (MS-PCR) and asymmetry relating HCR (AT-HCR), "Sensors and directors B: Chemical" Volume 260, Pages 870-: designing a specific upstream primer, and adding a linker sequence (AGAGAGAGAGAGGGAAAGAGAGAG-oxythienyleneglycol-CTCTCTCTTTCCCTCTCTCTCTC) and a spacer sequence (TTTTTT) which are modified by oxythienyleneglycol chemistry and can generate self-complementary at the 5' end of the upstream primer. When the target sequence is amplified by the ultra-speed PCR, the extension of ExTaq DNA polymerase is blocked by using the chemical modification of oxylene glycol, so that a PCR amplicon carries a single-stranded DNA protruding tail end; the single-stranded DNA protruding end is used as an excitation sequence of the hybridization chain reaction, the self-assembly reaction is started, and a large number of DNA double-stranded structures with 3' end protruding sticky ends are formed; furthermore, a sticky end protruded from the 3' end which exists in a large amount is used as a catalytic site of terminal deoxynucleotidyl transferase to form single-stranded DNA rich in guanine G, under the induction of hemin, G-rich single-stranded DNA is formed by the catalysis of the terminal deoxynucleotidyl transferase to assemble into G-quadruplex, and the horseradish peroxidase activity is exerted to complete color development. Namely, 4 links of 'overspeed PCR amplification-hybridization chain reaction-terminal deoxynucleotidyl transferase-G-quadruplet color development' are adopted to finish the overspeed PCR and the color development.

The above techniques may still be improved.

Disclosure of Invention

Defining:

the invention relates to an 'ultra-speed PCR' which is characterized in that one cycle of PCR amplification is completed through two temperature control systems, and the amplification of the PCR is further completed, and is different from a PCR amplification method which completes one cycle of PCR amplification through three steps of annealing, renaturation and extension in the conventional PCR, and the ultra-speed PCR is shorter than the common PCR method in the conventional sense.

"G-concatemer" in the present invention refers to a higher conformation of a functional nucleic acid that is stabilized by hydrogen bonding to the Huster and is capable of forming a guanine-rich multi-layered conformation. The "G-concatemer" may be a G-diad, a G-triplet, a G-tetrad, or 5'-GGTTGGTGTGG-3'. The "G-concatemer" and the "G-diad", "G-triplet" and "G-tetrad" in the present invention refer to a multi-layered conformational functional nucleic acid which is stable by hydrogen bond and rich in guanine and is capable of undergoing a color development reaction by binding to hemin (hemin).

The G-diad structure can be Y- (G) n- α - (G) n-Z;

y represents 0 to 2 nucleotide residues, α represents 1 to 3 nucleotide residues, Z represents 0 to 3 nucleotide residues, n represents the number of guanines and n has a value of 2 or 3.

The G-triplet structure can be Y- (G) n- α - (G) n- β - (G) n-Z

Y represents 0 to 2 nucleotide residues, α and β represent 1 to 3 nucleotide residues, Z represents 0 to 3 nucleotide residues, n represents the number of guanines, and n has a value of 2 or 3.

The G-tetrad structure can be Y- (G) n- α - (G) n- β - (G) n-gamma- (G) n-Z

Y represents 0 to 2 nucleotide residues, α, β and gamma represent 1 to 3 nucleotide residues, Z represents 0 to 3 nucleotide residues, n represents the number of guanines and n has a value of 2 or 3.

The specific structures of G-diad, G-triplet and G-tetrad are illustrated by way of example only and are not intended to be limiting.

The term "nucleotide residue" as used herein refers to conventional nucleotide residues such as A, T, C, G, U, and also includes other nucleotide residues modified without affecting binding to a color developer and without affecting sequence specificity.

The specific primer sequence in the invention is a specific primer designed according to a target, can be completely complementary with a corresponding sequence of the target, and can also be basically complementary; "substantially complementary" means that the primers can differ from the corresponding sequence of the target by several bases, but still bind specifically to the target; "several base differences" include deletion, addition, substitution, etc. of several bases.

The "linker arm" in the present invention is a structure that inhibits the binding of polymerase and/or inhibits the extension of a new strand during an in vitro nucleic acid amplification reaction; specifically, the linking arm may be an oxydenthylene glycol, and the chemical structure of the oxydenthylene glycol is as follows:

。

the invention provides a quantitative detection method based on overspeed PCR and functional nucleic acid, aiming at overcoming the defects of long time consumption, high requirement on matched equipment, strict control on operation precision, high cost and the like of the traditional nucleic acid detection through PCR amplification.

On the other hand, the method for detecting the quantitative nucleic acid by the ultra-fast PCR of the present invention is further improved in order to improve the detection target range of the ultra-fast PCR, and to extend the length and detection precision of the target sequence.

1. One embodiment of the invention provides an overspeed PCR quantitative nucleic acid quantitative detection method, which is characterized in that a target sequence is amplified by using an overspeed PCR method and a color reaction is included;

the PCR reaction system comprises an upstream primer and a downstream primer;

the upstream primer comprises: nucleotide sequences of sequence A, linker arm and specific primer sequence B; the downstream primer comprises: the nucleotide sequence of the sequence A ', the connecting arm and the specific primer sequence B'; the connecting arm is positioned between the sequence A/A 'and a specific primer sequence B/B', and the specific primer sequence B or B 'is positioned at the 3' end of the upstream primer and the downstream primer and is complementary or basically complementary with the corresponding target; the linker arm comprises a structure that inhibits polymerase binding and/or a structure that inhibits new strand extension during an in vitro nucleic acid amplification reaction;

sequence A or sequence A' is one of the G-concatemers; the sequence A and the sequence A' may be the same or different;

the sequence A is partially complementary and/or reverse complementary to the nucleotide sequence of the specific primer sequence B, and the sequence A 'is partially complementary and/or reverse complementary to the nucleotide sequence of the specific primer sequence B'; when the detection target does not exist in the detection system, the upstream primer and the downstream primer can respectively form hairpin structures through the thermal cycle process of the ultra-fast PCR, and the chromogenic reaction can not occur; when a detection target exists in the detection system, the upstream primer and the downstream primer are annealed and melted by a thermal cycle process of the ultra-fast PCR to expose all or part of the sequence A or A', so that the upstream primer and the downstream primer are not contacted with enzymes except DNA polymerase any more and are directly reacted with a color developing agent for color development.

2. In the detection method of embodiment 1, the color reaction is induced by hemin (hemin) to catalyze 2, 2-diaza-bis (3-ethyl-benzothiazole-6-sulfonic acid) diamine salt (ABTS)^2-) With hydrogen peroxide (H)₂O₂) ABTS for producing a substance which gives a blue-green color to the reaction solution^-。

3. In the detection method of the

above embodiment

1 or 2, the target sequence length may be 80bp or more, 100bp or more, 200bp or more, 400bp or more, 600bp or more, 800bp or more, 1000bp or more, 2000bp or more, 3000bp or more, 4000bp or more, or 5000bp or more, or 50-500bp, 80-600bp, 600-2000bp, 600-3000bp or 600-5000bp or 50-5000 bp.

4. In the detection method according to any one of embodiments 1 to 3, the reaction process of the ultrarapid PCR includes: 95-98 ℃ for 0-30 s; 50-60 ℃ for 0-20 s; 25-40 cycles in total; specifically, the treatment time at 95-98 ℃ is 0-15s, 0-10s, 0-5s, 1-10s or 1-5s, and the treatment time at 50-60 ℃ is 0-15s, 0-10s, 0-5s, 1-10s or 1-5 s; 25-40 cycles in total; more specifically, it may be 95-98 deg.C for 0-5 s; 50-60 ℃ for 0-5 s; for a total of 25-40 cycles.

5. In the detection method according to any one of embodiments 1 to 4, the PCR reaction system may further include gold nanoparticles.

More specifically, the primer comprises 0.01-20 mu M of upstream primer, 0.01-20 mu M of downstream primer, 0.01-50U/mu L of polymerase and 0.01-10nM of gold nanoparticles;

more specifically, the primer comprises 0.5-10 mu M of upstream primer, 0.5-10 mu M of downstream primer, 0.2-10U/mu L of polymerase and 0.1-1 nM of gold nanoparticles;

more specifically, the primer comprises 1-5 mu M of upstream primer, 1-5 mu M of downstream primer, 1-5U/mu L of polymerase and 0.1-0.5nM gold nanoparticles;

more specifically, the primer contains 2.5. mu.M of the upstream primer, 2.5. mu.M of the downstream primer, 2U/. mu. L of polymerase, and 0.32 nM of gold nanoparticles.

6. In the detection method according to any one of embodiments 1 to 5, the ultrafast PCR reaction system further comprises a polymerase, which may be KAPA2G FAST polymerase used in vitro nucleic acid amplification techniques; the concentration of the DNA polymerase may be 2 times or more, 3 times or more, 5 times or more, 10 times or more, 15 times or more, 20 times or more, 30 times or more, 40 times or more, 50 times or more, 60 times or more, 70 times or more or 80 times or more the concentration of the ordinary PCR.

7. In the detection method of the

above embodiment

5 or 6, the spherical gold nanoparticles have a diameter of 5nm, 10nm, 15nm, 20nm, 30nm, 35nm or more, more specifically 15 nm; the concentration of spherical gold nanoparticles is 0.01-10nM, more specifically 0.01nM, 0.02nM, 0.05nM, 0.1nM, 0.2nM, 0.3nM, 0.5nM, 0.7nM, 1nM, 1.5nM, 3nM, 5nM, 8nM, 10nM, more specifically 0.32 nM.

8. In the detection method according to any one of embodiments 1 to 7, the linker arm is an oxydiethylene glycol having a chemical structure:

。

9. in the detection method according to any one of embodiments 1 to 8 above, the G-concatemer is a guanine-rich multi-layered conformational functional nucleic acid stabilized by a hydrogen bond; further, the G-concatemer may be a G-diad, a G-triplet, a G-tetrad, or 5'-GGTTGGTGTGG-3'; furthermore, one of the G-concatemer, the G-diad, the G-triplet or the G-tetrad is a multi-layer conformation functional nucleic acid which is stable by hydrogen bonds and rich in guanine and can be combined with hemin (hemin) to generate a color reaction;

further, the G-diad structure can be Y- (G) n- α - (G) n-Z, wherein Y represents 0-2 nucleotide residues, α represents 1-3 nucleotide residues, Z represents 0-3 nucleotide residues, n represents the number of guanine, and the value of n is 2 or 3;

further, the G-triplet structure can be Y- (G) n- α - (G) n- β - (G) n-Z

Y represents 0 to 2 nucleotide residues, α and β represent 1 to 3 nucleotide residues, Z represents 0 to 3 nucleotide residues, n represents the number of guanines, and n has a value of 2 or 3;

further, the G-quadruplex structure may be Y- (G) n- α - (G) n- β - (G) n-gamma- (G) n-Z, Y represents 0 to 2 nucleotide residues, α, β and gamma represent 1 to 3 nucleotide residues, Z represents 0 to 3 nucleotide residues, n represents the number of guanine, and n has a value of 2 or 3.

Also specifically, the G-triplet includes a functional nucleic acid sequence of G-triplet as defined in the prior art or common general knowledge; specifically, the G-triplet functional nucleic acid sequence comprises a G-triplet functional nucleic acid with horseradish peroxidase-like activity which can be formed after the sequence is self-assembled, and the G-triplet functional nucleic acid can catalyze ABTS under the induction of hemin (hemin)^2-And H₂O₂ABTS for producing a substance which gives a blue-green color to the reaction solution^-。

10. In the detection method according to any one of embodiments 1 to9 above, the present invention may also provide a method for detecting a long target sequence, the method further comprising at least one of the following 1) to 2):

1) the reaction process of the long target overspeed PCR comprises the following steps: 95-98 ℃ for 0-5 s; 50-60 ℃ for 0-5 s; 25-40 cycles in total;

specifically, the reaction process of the ultrarapid PCR comprises the following steps: 96 ℃ for 1 s; 30 cycles at 50 ℃ for 2 s;

2) the concentration of the upstream primer and the downstream primer in the reaction system of the ultra-fast PCR is more than 10 times of the concentration of the common PCR; more specifically, 15 times or more, 20 times or more, or 25 times or more; the reaction system of the ultrarapid PCR also comprises KAPA2G FAST DNA polymerase, wherein the concentration of the DNA polymerase is more than 2 times, more than 3 times, more than 5 times, more than 10 times, more than 15 times, more than 20 times, more than 30 times, more than 40 times, more than 50 times, more than 60 times, more than 70 times or more than 80 times of the concentration of the ordinary PCR, and is also more specifically 80 times; the reaction system of the ultra-fast PCR also comprises gold nanoparticles, and concretely, the diameter of the spherical gold nanoparticles is 5nm, 10nm, 15nm, 20nm, 30nm, 35nm or more, and more specifically 15 nm; the concentration of spherical gold nanoparticles is 0.01-10nM, more specifically 0.01nM, 0.02nM, 0.05nM, 0.1nM, 0.2nM, 0.3nM, 0.5nM, 0.7nM, 1nM, 1.5nM, 3nM, 5nM, 8nM, 10nM, more specifically 0.32 nM.

11. In the detection method according to any one of embodiments 1 to 10, any one of the following primer combinations may be used:

1) the connecting arm comprises a compound with a long chain structure;

2) the upstream primer comprises: and (3) mixing the amino acid sequence shown in SEQ ID NO: 5 and SEQ ID NO: 6 through connecting arms to obtain a primer;

3) the upstream primer comprises: and (3) mixing the amino acid sequence shown in SEQ ID NO: 5 and SEQ ID NO: 9 through a connecting arm;

4) the downstream primer comprises: and (3) mixing the amino acid sequence shown in SEQ ID NO: 7 and SEQ ID NO: 8 through a connecting arm;

5) the downstream primer comprises: and (3) mixing the amino acid sequence shown in SEQ ID NO: 7 and SEQ ID NO: 10 by a connecting arm;

6) the sequence A or A 'is all or part of nucleotide sequence forming G-triplet functional nucleic acid sequence and is positioned at 5' end of the described primer sequence;

7) the upstream primer comprises: and (3) mixing the amino acid sequence shown in SEQ ID NO: 1 (n in the sequence represents oxythienyleneglycol) to SEQ ID NO: 3 (n in the sequence represents oxylene glycol) and the nucleotide sequence shown by the sequence table is substituted and/or deleted and/or added by one or more nucleotides and has the nucleotide sequence shown by SEQ ID NO: 1 and SEQ ID NO: 3 nucleotide sequences with the same function are connected through a connecting arm to obtain a primer;

8) the downstream primer comprises a primer consisting of SEQ ID NO: 2 (n in the sequence represents oxythienyleneglycol) to SEQ ID NO: 4 (n in the sequence represents oxylene glycol) and the nucleotide sequence shown by the sequence table is substituted and/or deleted and/or added by one or more nucleotides and has the nucleotide sequence shown by SEQ ID NO: 2 and SEQ ID NO: 4 has the same function;

the functions include specific amplification or detection of a target to be detected.

More specifically, the upstream primer SEQ ID NO: 1 is:

GGGATGGGCGGGTT-oxyethyleneglycol-GGCATGTCTGCGCACTTC；

or the forward primer SEQ ID NO: 3 is as follows:

GGGATGGGCGGGTT-oxyethyleneglycol-GTGCTCGTTTACGACCTGA；

the downstream primer is SEQ ID NO: 2 is as follows:

GGGCGGGTTGGGTT-oxyethyleneglycol-TCCGCCCTGTCTACTTAT；

or the downstream primer SEQ ID NO: 4 is as follows:

GGGCGGGTTGGGTT- oxyethyleneglycol-CCCTTTGCGAATAACATCC。

12. another object of the present invention is to provide a rapid detection apparatus for a target sequence, which is characterized by incorporating components of a PCR reaction system included in the detection method according to any one of the above 1 to 11, and further comprising at least one of the following 1) to 4):

1) the overspeed PCR device consists of a control host, a stepping motor, a mechanical arm, a real-time temperature monitor, a reactor with a rapid heat conduction function and a temperature difference container;

2) the control host controls the motion of the mechanical arm to control the reaction temperature through a remote control stepping motor;

3) the stepping motor drives a reaction sample in the reactor to swing left and right among different temperature containers by carrying a mechanical arm; a real-time temperature monitor in the reactor can conduct heat quickly and sense the reaction temperature in real time;

4) the overspeed PCR device realizes 30 thermal cycle amplifications within 10 minutes.

13. Another objective of the present invention is to provide a colorimetric detection method for a long target sequence, wherein the method comprises a nucleic acid self-assembly color reaction using a PCR reaction system according to one of the above embodiments 1 to 11, and the method further comprises determining whether the analyte contains the target to be detected by a color change of the final reaction system;

specifically, when the color of the reaction system changes, the object to be detected is judged to contain the object to be detected; specifically, when the color of the reaction system is blue-green, the object to be detected is judged to contain the object to be detected;

14. it is another object of the present invention to provide a diagnostic kit and/or biosensor, characterized in that a PCR reaction system according to one of the above embodiments 1 to 11 is used, the diagnostic kit and/or biosensor comprising one or more of the following compositions 1) to 4):

1) gold nanoparticles;

2) an upstream primer and a downstream primer, wherein the upstream primer comprises: the nucleotide sequences of the G-triplet sequence A, the connecting arm and the specific primer sequence B; the downstream primer comprises: g-triplet sequence A ', connecting arm and specific primer sequence B'; the connecting arm is positioned between the G-triplet sequence A and a specific primer sequence B, and the specific primer sequence B or B 'is positioned at the 3' ends of the upstream primer and the downstream primer; the nucleotide sequences of the G-triplet sequence A and the specific primer sequences B and B' are partially complementary and/or reversely complementary; the linker arm comprises a structure that inhibits polymerase binding and/or a structure that inhibits extension of a new strand during in vitro nucleic acid amplification;

3) the ultra-fast PCR device is characterized by consisting of a control host, a stepping motor, a mechanical arm, a real-time temperature monitor, a reactor and a temperature difference container;

4) a nucleic acid self-assembly chromogenic reaction system;

more specifically, the primer comprises 0.01-20 mu M of upstream primer, 0.01-20 mu M of downstream primer, 0.01-50U/mu L of polymerase and 0.01-10nM of gold nanoparticles, and further comprises hemin (hemin), 2-diaza-bis (3-ethyl-benzothiazole-6-sulfonic acid) diamine salt (ABTS)^2-) And hydrogen peroxide (H)₂O₂) (ii) a Specifically, it contains 0.5-10 μM of upstream primer, 0.5-10 mu M of downstream primer, 0.2-10U/mu L of polymerase and 0.1-1 nM of gold nanoparticles, more specifically, 1-5 mu M of upstream primer, 1-5 mu M of downstream primer, 1-5U/mu L of polymerase and 0.1-0.5nM of gold nanoparticles, and more specifically, 2.5 mu M of upstream primer, 2.5 mu M of downstream primer, 2U/mu L of polymerase and 0.32 nM of gold nanoparticles.

Specifically, the polymerase includes KAPA2G FAST polymerase useful in vitro nucleic acid amplification techniques;

more specifically, the upstream primer SEQ ID NO: 1 is:

GGGATGGGCGGGTT-oxyethyleneglycol-GGCATGTCTGCGCACTTC

or the forward primer SEQ ID NO: 3 is as follows:

GGGATGGGCGGGTT-oxyethyleneglycol-GTGCTCGTTTACGACCTGA；

specifically, the downstream primer SEQ ID NO: 2 is as follows:

GGGCGGGTTGGGTT-oxyethyleneglycol-TCCGCCCTGTCTACTTAT

or the downstream primer SEQ ID NO: 4 is as follows:

GGGCGGGTTGGGTT- oxyethyleneglycol-CCCTTTGCGAATAACATCC。

it is a further object of the present invention to provide a use of the method according to any of the preceding claims, the diagnostic kit according to any of the preceding claims and/or the biosensor according to any of the preceding claims,

specifically, the application comprises at least one of the following applications 1) to 2):

1) detecting a long target fragment with the length of 600bp-2000 bp;

2) preparing a product with the detection gene fragment size of 600bp-2000 bp;

in particular, the long target fragment is from salmonella.

It is a final object of the present invention to establish a functional nucleic acid colorimetric sensor based on long target ultra-rapid PCR, using the detection method described in any of the previous embodiments.

(1) The method establishes a long target overspeed PCR reaction system, increases the target sequence to be detected of the overspeed PCR from 600bp to 2000bp and above, and widens the target detection range of the overspeed PCR;

(2) a nucleic acid color developing module is carried on the overspeed PCR system, so that a reaction signal is amplified, and the ultrasensitive detection of pathogenic bacteria is favorably realized; and realizing visual detection; meanwhile, the reaction system is optimized, so that the detection method is more accurate and faster.

According to a specific embodiment of the invention, an amplification primer of an overspeed polymerase chain reaction is designed according to a virulence gene of salmonella, and a novel overspeed PCR-based colorimetric sensing method for a long target sequence is integrated and established by combining a nucleic acid self-assembly color development module and is used for ultrasensitive detection of the salmonella.

For further understanding of the present invention, the principle of the optimized detection method is briefly described as follows:

in the visual detection method of the overspeed PCR proposed before the subject group, the 3' end protruding sticky end is formed by the combination of the overspeed PCR amplification and the hybridization chain reaction and the self-assembly reaction, and the single-stranded DNA rich in guanine G is formed by the catalysis of the terminal deoxynucleotidyl transferase, so that the color reaction is generated. In summary, the detection of pathogenic bacteria underwent 4 links of "ultrarapid PCR amplification-hybridization chain reaction-terminal deoxynucleotidyl transferase-G-quadruplet color development". In order to further improve the overspeed PCR visual detection method, the invention is further improved aiming at the following points, comprising the following steps:

first, primer

The upstream primer consists of a G-triplet sequence A, a connecting arm and a nucleotide sequence of a specific primer sequence B;

the downstream primer consists of a G-triplet sequence A ', a connecting arm and a nucleotide sequence of a specific primer sequence B';

the G-triplet sequence A and the G-triplet sequence A' may be identical or different;

the connecting arm is positioned between the G-triplet sequence A and the specific primer sequence B; the connecting arm is positioned between the G-triplet sequence A 'and the specific primer sequence B'; the specific primer sequence B or B 'is positioned at the 3' ends of the upstream primer and the downstream primer; the linker arm comprises a structure that inhibits polymerase binding and/or a structure that inhibits extension of a new strand during in vitro nucleic acid amplification;

the G-triplet sequence A is partially complementary and/or reversely complementary with the nucleotide sequence of the specific primer sequence B; the G-triplet sequence A 'is partially complementary and/or reversely complementary to the nucleotide sequence of the specific primer sequence B';

II, polymerase

KAPA2G FAST DNA polymerase with overspeed extension function is selected and a corresponding PCR amplification reaction system is optimized.

Thirdly, adding nano gold particles

The addition of the gold nanoparticles improves the detection accuracy for long targets.

In principle, in order to realize the aim of quickly detecting a long target nucleic acid sequence, a G-triplet functional nucleic acid joint is added to the 5 'end of a specific upstream primer to form a functional upstream primer, and a G-triplet functional nucleic acid joint is added to the 5' end of a specific downstream primer to form a functional downstream primer. When the target is not detected, the functional upstream primer and the functional downstream primer respectively form hairpin, and have lower chromogenic background; when the detection target exists, the connecting arm can block the extension of DNA polymerase, so that different G-triplet functional nucleic acid linkers are respectively exposed at the 5' ends of the two sides of the double-stranded DNA amplicon during the amplification by the ultra-speed PCR. Under the induction of hemin, the exposed G-triplet functional nucleic acid linker sequence is assembled to form G-triplet, the horseradish peroxidase activity is exerted, and the chromogenic reaction occurs to characterize the content of the target. Namely, the detection of the target in the invention only goes through 2 links of 'overspeed PCR amplification-G-triplet development'. Therefore, the visual detection of the long target sequence can be realized by optimizing a reaction system, selecting DNA polymerase with an overspeed extension function and adding gold nanoparticles, and the specificity and the accuracy of the detection method are ensured.

The invention has the following beneficial technical effects:

1) the detection method and the biosensor established by the invention are quicker and more sensitive than the traditional method, have the advantages of strong specificity, high sensitivity, reliable detection result and the like, can simplify the analysis and detection steps, shorten the analysis time, more importantly enable the detection of the DNA long target fragment with the length of 600bp-2000bp or longer to be possible, are convenient for carrying and field operation, and have very good application prospect in the field of microbial detection including the fields of food safety and quick detection.

2) The primer design is simpler, and the amplification efficiency is higher; and adding a G-triplet functional nucleic acid sequence with chromogenic potential at the 5' end of the specific primer. Compared with a G-tetrad sequence, the functional nucleic acid sequence of the G-triad reduces a group of guanine triad sequences (GGG) in composition, and can exert the same horseradish peroxidase activity as the G-tetrad under the induction of hemin. Meanwhile, the G-triplet is used as a component element of the primer joint and forms a functional nucleic acid hairpin with a primer consisting of a specific amplification sequence, a primer dimer is difficult to form between an upstream primer and a downstream primer, the loss of amplification efficiency caused by overlong primer joints is improved, and the high amplification efficiency and the subsequent color development function of PCR are considered.

3) The KAPA2G FAST DNA polymerase with the function of overspeed extension was selected to realize the possibility of detecting long targets using overspeed PCR. The extension speed reaches 1000bp/s, 1 cycle can be completed by amplifying long target sequences of 900bp and 1790bp for 3 seconds, and only 90 seconds are needed for completing 30 cycles. The reaction time is obviously shortened, and the overspeed PCR amplification of the long target sequence is realized. And meanwhile, gold nanoparticles are added, so that the detection precision of the long target sequence is improved.

4) The detection method and the biosensor established by the invention can realize the specific detection of the long gene fragment target, have good detection specificity, high sensitivity, reliable detection result, can be distinguished by naked eyes, have quick and convenient detection process, and have important significance in the aspects of daily monitoring or market screening and the like, particularly, the detection sensitivity of the detection of salmonella is respectively 1.5 × 10⁰Copy number/microliter; and the method has no cross reaction on Shigella, Vibrio parahaemolyticus, Escherichia coli, Staphylococcus aureus and Bacillus cereus, and has good specificity.

Drawings

FIG. 1 optimizes the effect of primer on background color development in the ultrarapid PCR. 1. Sample No. 2 is a color development image of the overspeed PCR of 900bp amplicon (amplification primers are Primer 1+ Primer 2), wherein sample No. 1 is negative amplification (RNase-freewater is added as an amplification template); 3. Sample No. 4 is a color development image of an ultrarapid PCR of 1790bp amplicon (Primer 3+ Primer 4 is an amplification Primer), wherein sample No. 3 is negative amplification (RNase-free water is added as an amplification template).

FIG. 2 optimization of primer pair overspeed PCR amplification efficiency effect.

FIG. 3 the use of gold nanoparticles to improve the accuracy of the ultrarapid PCR assay. FIG. 3A is a melting curve analysis of an amplicon (Primer 1+ Primer 2 for amplification primers) targeted at 900bp, with no added gold nanoparticles and added gold nanoparticles, respectively; FIG. 3B is a melting curve analysis for an amplicon (Primer 3+ Primer 4 for amplification primers) targeting 1790bp, with no added gold nanoparticles and added gold nanoparticles, respectively.

FIG. 4G-comparison of color development of concatemers. The final concentration of oligonucleotide in FIG. 4A was 2.5. mu.M; the final concentration of oligonucleotide in FIG. 4B was 500 nM.

FIG. 5 influence of primer concentration and DNA polymerase concentration on visualization of color development in ultraPCR. FIG. 5A is an optimization of primer concentration; FIG. 5B is an optimization of DNA polymerase concentration.

FIG. 6 is a schematic view showing the construction of an ultrafast PCR device. The system consists of a control host 1, a stepping motor 2, a mechanical arm 3, a real-time temperature detector 4, a rapid heat conduction reactor 6 with a hydrophobic coating 5, a heating temperature difference container 8, a refrigerating temperature difference container 9 and a real-time fluorescence monitoring optical fiber 7.

FIG. 7 is a comparison graph showing the verification of amplification effect of long target overspeed PCR reaction; wherein, lane 1 is D2000 Marker; lane 2 is the 80bp positive control of short target ultrarapid PCR (Salmonella addition ultrarapid PCR reaction system); lane 3 is the 80bp negative control of short target ultrarapid PCR (ultrarapid PCR reaction system without Salmonella addition); lane 4 is a 285bp positive control of short target ultrarapid PCR without gold nanoparticles (ultrarapid PCR reaction with salmonella); lane 5 is a 285bp short target ultrarapid PCR negative control (an ultrarapid PCR reaction system without salmonella) without gold nanoparticles; lane 6 is a 900bp long target ultrarapid PCR negative control with gold nanoparticles added (an ultrarapid PCR reaction system without salmonella addition); lane 7 is a positive control for 900bp long target ultrarapid PCR with gold nanoparticles added (salmonella-added ultrarapid PCR reaction system).

FIG. 8 is a graph showing the detection value and color development of Salmonella in different concentration ranges.

FIG. 9 is a graph showing the results of a specificity test.

FIG. 10 is a diagram showing the analysis of the secondary structure of a primer used in the present invention. FIGS. 10A and 10B are graphs showing the secondary structure analysis of primers (Primer 1, Primer 2) for a 900bp amplicon; FIGS. 10C and 10D are graphs showing the secondary structure analysis of primers (Primer 3, Primer 4) of the 1790bp amplicon.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

The molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods listed in molecular cloning, a laboratory manual (third edition) J. SammBruker, or according to the kit and product instructions.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Experimental Material

The information on the strains used in this example is shown in Table 1.

TABLE 1

The reagents used in this example include KAPA2G Fast DNA polymerase, 5 × KAPA2G Buffer (7.5mM Mg²⁺Plus) from KAPA biosystems, dNTP mix (2.5 mM) from Takara (Takara). Hemin (Hemin) and 2, 2-diaza-bis (3-ethyl-benzothiazole-6-sulfonic acid) diamine salt (ABTS 2-) were purchased from Allantin reagent (Sigma-Aldrich Che)micro Co). The experimental water was obtained from a Milli-Q pure water system. Other reagents were purchased from the national pharmaceutical group.

Example 1 influence of optimized primer design on the background of the color reaction of the ultrarapid PCR reaction.

(one) primer design

TABLE 2

Primer name	Sequence (from 5 'to 3')	Numbering
			Primer
1	GGGATGGGCGGGTT-oxyethyleneglycol-GGCATGTCTGCGCACTTC	SEQ ID NO:1
			Primer 2	GGGCGGGTTGGGTT-oxyethyleneglycol-TCCGCCCTGTCTACTTAT	SEQ ID NO:2
Primer 3	GGGATGGGCGGGTT-oxyethyleneglycol-GTGCTCGTTTACGACCTGA	SEQ ID NO:3
			Primer 4	GGGCGGGTTGGGTT-oxyethyleneglycol-CCCTTTGCGAATAACATCC	SEQ ID NO:4

Primer sequences were designed according to table 2. The nucleotide sequence on the left side of the connecting arm (oxylene glycol bridge) of the upstream Primer 1 is shown as SEQ ID NO: 5, and the nucleotide sequence on the right side of the connecting arm is shown as SEQ ID NO: 6, and the chemical structure of the connecting arm is as follows:

。

in table 2, the nucleotide sequence on the left side of the linker arm (oxylene glycol bridge) of the downstream Primer 2 is represented by SEQ ID NO: 7, the nucleotide sequence on the right side of the connecting arm is represented by SEQ ID NO: 8.

In table 2, the nucleotide sequence on the left side of the linker arm (oxydenethylene glycol bridge) of the upstream Primer 3 is represented by SEQ ID NO: 5, the nucleotide sequence on the right side of the connecting arm is represented by SEQ ID NO: 10, or a nucleotide sequence shown in the figure.

In table 2, the nucleotide sequence on the left side of the linker arm (oxylene glycol bridge) of the downstream Primer 4 is represented by SEQ ID NO: 7, the nucleotide sequence on the right side of the connecting arm is represented by SEQ ID NO: 10, or a nucleotide sequence shown in the figure.

The sequences listed in table 2 were all artificially synthesized.

(II) construction of an ultra-fast PCR reaction System

As shown in Table 3, an ultrarapid PCR reaction system was constructed.

TABLE 3

Reaction components	Concentration of
		Form panel	2 μL
KAPA2G FAST DNA polymerase	2 U/μL
		Primer
1/Primer 3	2.5 μM
		Primer
2/Primer 4	2.5 μM
		dNTP
	250 μM
		5×KAPA2G Buffer	1×KAPA2G Buffer
ddH₂O	Up to 10 μL

Salmonella was cultured and activated overnight in L B medium, genomic DNA in Salmonella bacterial suspension was extracted using a New Industry bacterial genomic DNA extraction kit, and 2. mu. L each of the extracted genomic DNA was mixed to prepare a template shown in Table 3.

(III) ultra-speed PCR reaction

According to the table 3, prepare 10 microliter reaction system on ice, and quickly place in the overspeed PCR device set up in step (two) for temperature control, the temperature control and the cycle number are shown in table 4:

(IV) color reaction

After completion of the reaction, 10. mu. L reaction system was added with 1. mu. L hemin (hemin) stock solution (10. mu.M), 73. mu. L G-triadIn vitro induction buffer (100 mM 2-morpholinoethanesulfonic acid, 2- (4-morpholinone) ethanesulfonic acid (MES)), 40 mM KCl, with a volume percentage of 0.05% Triton X-100, pH5.5), incubation at 37 deg.C for 20min, and addition of 8 μ L ABTS^2-Stock solution (20 mM) with 8. mu. L of hydrogen peroxide (H)₂O₂) The stock solution (20 mM) was incubated at room temperature for 5min in the absence of light, and a color developing picture shown in FIG. 1 was taken using a single lens reflex camera, after which 50. mu. L H was added₂SO₄(2M) the color reaction was terminated, and the OD value of the reaction solution at 450nm was measured using a spectrophotometer.

(V) color development results

As shown in FIG. 1, sample No. 1 is a color development image of the ultraPCR negative amplification (RNase-free water was added as an amplification template) of 900bp amplicon (Primer 1+ Primer 2 as an amplification Primer); after addition of sulfuric acid stop solution, OD₄₅₀=0.2722；

Sample No. 2 is a color development image of the overspeed PCR positive amplification (adding salmonella as an amplification template) of 900bp amplicon (amplification primers are Primer 1+ Primer 2); after addition of sulfuric acid stop solution, OD₄₅₀=0.8667；

Sample No. 3 is a color development image of the overspeed PCR negative amplification (RNase-freewater is added as an amplification template) of 1790bp amplicon (amplification primers are Primer 3+ Primer 4); after addition of sulfuric acid stop solution, OD₄₅₀=0.3289；

Sample No. 4 is a color development image of the overspeed PCR positive amplification (adding salmonella as an amplification template) of 1790bp amplicon (amplification primers are Primer 3+ Primer 4); after addition of sulfuric acid stop solution, OD₄₅₀=0.9196。

The results show that when the primers are used for negative PCR amplification in the absence of a target, part of G-rich sequences form functional hairpin, so that G-triplet conformation cannot be formed, and further the catalytic activity of horseradish peroxidase-like enzyme cannot be exerted, and the primers have low chromogenic background. Thus, the primer of the long target ultra-fast PCR has good chromogenic capability after amplification, but when the detection target does not exist as an amplification template, the optimized primer design ensures that the detection method has extremely low chromogenic background.

Example 2 Effect of optimized primer design on amplification efficiency of the ultrarapid PCR reaction

(one) genome extraction

The salmonella is cultured and activated in L B culture medium overnight, the genome DNA in salmonella bacterial liquid is extracted by adopting a bacterial genome DNA extraction kit of New Industry company, and the genome of the salmonella is quantitatively determined by using nanodrop, so that the genome concentration is 417.806 ng/u L.

(II) real-time quantitative PCR detection of amplification efficiency

After 10-fold serial dilution, 1 mu L of each solution was added to the real time PCR amplification system, and the reaction reagents and the reaction system were referred to the instruction of the product of Tiangen Biochemical technology (Beijing) Co., Ltd., FP205, and the reaction program was referred to the three-step reaction program of FP-205.

Primer selection in different reactions:

the primer sequences used in FIG. 2A are: AGAGAGAGAGAGGGAAAGAGAGAG-oxydenethyleneglycol bridge-CTCTCTCTTTCCCTCTCTCTCTCTTTTTTGTGAAATTATCGCCACGTTCGGGCAA; the sequence of the downstream primer is as follows: Biotin-TCATCGCACCGTCAAAGGAACC. The primer specifically amplifies a 285bp target fragment in a salmonella genome;

primers were used in fig. 2B: primer 1 and primer 2 amplify 900bp target;

primers were used in fig. 2C: primer 3 and primer 4 amplify 1790bp target.

(III) calculation of amplification efficiency

After the color reaction is stopped, drawing a Ct-L og (copy number) standard curve according to the Ct value of different amplification template concentrations, and calculating the amplification efficiency E of different primers during amplification according to the slope of the standard curve, wherein E =10^-1/slope– 1

The result shows that in FIG. 2A, the amplification efficiency of the 285bp target fragment is 67.70%; the amplification efficiency of the 900bp target fragment amplified in FIG. 2B was 78.24%; the amplification efficiency for amplifying 1790bp target fragment in FIG. 2C was 75.39%. Therefore, compared with a primer for amplifying a 285bp target fragment, the optimally designed primer has higher amplification efficiency in a reaction system.

Example 3 optimization of gold nanoparticles for detection accuracy of ultra-fast PCR

(one) reaction System establishment

The same long target ultra-rapid PCR reaction system (Table 3) and reaction conditions (Table 4) as in example 1 were prepared and reacted. Adding gold nanoparticles with the diameter of 15nM and the final concentration of 0.32 nM; the control sample was replaced with ultrapure water. Finally, the reaction system was made up to 10ul with ultrapure water.

Selecting upstream and downstream primers Primer 1 and Primer 2 for amplifying a 900bp target by using the primers; and an upstream Primer 3 and a downstream Primer 4 for amplifying 1790bp targets.

(II) dissolution curve analysis:

adding Eva green dye with the final concentration of 0.5 × into the reaction final product of the long-target ultra-speed PCR, and performing dissolution curve analysis on the reaction final product of the long-target ultra-speed PCR by using the dissolution curve analysis function (melt curve analysis) of real time PCR of Bio-Rad.

The result is shown in fig. 3, fig. 3A is the melting curve analysis of the 900bp long target overspeed PCR amplicon, which is not added with gold nanoparticles and added with gold nanoparticles respectively; FIG. 3B shows the melting curve analysis of 1790bp long target ultra-rapid PCR amplicon, again with no added gold nanoparticles and added gold nanoparticles. Compared with the single main peak of the amplicon after adding the gold nanoparticles, the long target overspeed PCR amplicon without adding the gold nanoparticles has a hybrid peak, both the 900bp target and the 1790bp target are the same, and the front end of the 1790bp target shows a prominent hybrid peak, namely the longer the target is, the higher the possibility of the hybrid peak in the overspeed reaction PCR is. The hetero-peak means an increase in non-specific products, and may affect the detection accuracy. Therefore, the gold nanoparticles can enhance the reaction specificity and sensitivity of the long-target overspeed PCR reaction and improve the detection precision.

Example 4 comparison of G-concatemer color development function in primer design

(I) G-concatemer sequence selection and color reaction system

Different G-concatemers were selected and their color development was compared. The selected G-concatemer sequence was as follows:

nucleic acid sequences used for samples 1 and 5: 5'-AGGGTTGGGCGGGATGGG-3'

Nucleic acid sequences used for samples 2 and 6: 5 '-AGGGTTGGG-3'

Nucleic acid sequences used for samples 3 and 7: 5'-GGGATGGGCGGGTT-3'

Nucleic acid sequences used for samples 4 and 8: 5'-GGGCGGGTTGGGTT-3'

mu.M of the above oligonucleotide stock solution at 10. mu. L was added to 1. mu. L hemin (hemin) stock solution (10. mu.M), 73. mu. L G-triad induction buffer (100 mM 2-morpholinoethanesulfonic acid, 2- (4-morpholinone) ethanesulfonic acid (MES)), 40 mM KCl, and 0.05% Triton X-100 by volume, pH5.5), incubated at 37 ℃ for 20min, and 8. mu. L of ABTS was added^2-Stock solution (20 mM) with 8. mu. L of hydrogen peroxide (H)₂O₂) Stock (20 mM) was incubated at room temperature for 5min in the absence of light, at a final concentration of 2.5. mu.M for the different oligonucleotides, after which 50. mu. L H was added₂SO₄(2M) the color reaction was terminated, and a developed image was taken using a single lens reflex camera (FIG. 4A), and the OD value of the reaction solution at 450nm was measured using a spectrophotometer.

The chromogenic step in FIG. 4B is identical to that of FIG. 4A, except that 10. mu. L of 0.5. mu.M stock oligonucleotide is used in the chromogenic system, resulting in a final concentration of 500 nM for the different oligonucleotides.

(II) comparison of color development results

Selecting guanine triplet (GGG) as core, designing different G-rich concatemer sequences, and performing color reaction to obtain OD₄₅₀The values are shown in Table 5:

TABLE 5

Thus, G-triplets are able to perform a similar color rendering task as G-quadruplets, whether at high concentrations of 2.5. mu.M or at low concentrations of 500 nM. Meanwhile, the G-diad is combined with hemin (hemin) to have a lower color development effect than that of the G-triplet or G-quartet due to the structural deletion.

Considering that the G-triplet functional nucleic acid sequence has a reduced guanine triplet sequence (GGG) compared with the G-quadruplex sequence, the G-triplet functional nucleic acid sequence is used as a component of a primer joint, and the possibility that primer dimers are difficult to form between an upstream primer and a downstream primer is reduced. Therefore, it is considered that the G-triplet functional nucleic acid sequence can improve the loss of amplification efficiency due to the formation of a dimer due to the overlong primer linker and can achieve both high amplification efficiency and a color-developing function of PCR.

Example 5 Effect of primer concentration and DNA polymerase concentration on visualization of color development in ultrarapid PCR

The overspeed PCR visual detection method is that the color is directly developed after the overspeed PCR amplification of the long target is finished, and a developing system contains high-concentration primers and protease. In order to achieve the optimal color development effect, the concentration of the primer and the concentration of the protease are optimized so that the color development precision is not influenced by the primer and the protease with high concentration.

(one) reaction System establishment

Preparation of the same Long target ultra-Rapid PCR reaction System (Table 3) and reaction conditions (Table 4) as in example 1, and addition of gold nanoparticles 15nM in diameter and 0.32 nM final concentration, the final reaction system was made up to 10 ul. with ultra-pure water and then 50. mu. L H₂SO₄(2M) the color reaction was terminated, a color developing picture was taken using a single lens reflex camera, and the OD value of the reaction solution at 450nm was measured using a spectrophotometer.

When the optimum Primer concentration was searched, the concentrations of immobilized KAPA2G FAST DNA polymerase were 2U/. mu. L, and when the optimum concentrations of KAPA2G FAST DNA polymerase were searched, the concentrations of immobilized Primer 1 and Primer 2 were 2.5. mu.M, respectively.

Primer concentrations were set to 0.25, 0.625, 1.25, 2.50 and 5.00. mu.M, respectively;

the concentrations of KAPA2G FAST DNA polymerase were 0.5, 1.0, 1.5, 2.0, 4.0U/. mu. L, respectively.

The results show that the color reaction system of the present invention can develop color well at a primer concentration of 0.25 to 5.00. mu.M and a KAPA2G FAST DNA polymerase concentration of 0.5 to 4.0U/. mu. L, and more preferably, the color development concentration is a primer concentration of 0.625 to 5.00. mu.M and a KAPA2G FAST DNA polymerase concentration of 1.5 to 4U/. mu. L.

Example 6 establishment of a novel method for functional nucleic acid colorimetric sensing based on Long-target ultra-fast PCR for detection of Salmonella

(I) test materials

The information of the strains used in this example is shown in Table 1, and the nucleotide sequences of the primers designed are shown in Table 2 and the sequence Listing.

(II) construction of ultra-speed PCR device

The main structure of the overspeed PCR device is shown in FIG. 6, and the specific structure, connection mode, operation principle and operation process thereof include:

the ultra-fast PCR device adopts L light circulator type capillaries (20 u L, 04929292001, Roche) as ultra-thin reactors, samples are respectively gathered to one end of each capillary in a rapid centrifugation mode, the capillaries with the samples are fixed on a mechanical arm after the centrifugation is finished, the mechanical arm is connected to a stepping motor (42 JSF 630-630 AS-1000, just motion Control), the stepping motor drives the reactors fixed on the mechanical arm to circularly switch between a temperature difference container with the temperature of 96 ℃ and 50 ℃, so as to realize the reaction temperature change and Control in the ultra-fast PCR process, the stepping motor is powered by a switching power supply (S-100-24, Elecall), a direct current servo motor driver (YZ-ACSD 60, Moving) and L overview (version 2014) are adopted to realize the frequency or the time Control of the circular switching of the stepping motor, the temperature measurement is realized by a real-time temperature monitor (BD-ACSD 60, Moving) in the reactor, the thermocouple signal amplification and the linear processing process is realized by a thermocouple, the temperature processing module is converted into an Arduco signal by an analog chip (SBW-0, UN-1. and then the analog processing module is executed by a digital signal processing module (UN-1. UN-1. A.

(III) Long target ultra-fast PCR reaction

1) A long target overspeed PCR reaction system was prepared, as shown in table 3:

the salmonella is cultured and activated in L B culture medium overnight, genome DNA in salmonella bacterial liquid is extracted by a bacterial genome DNA extraction kit of New Industry company, 2 mu L of the extracted genome DNA is respectively taken and mixed to be used as a template in Table 3, gold nanoparticles with the diameter of 15nM and the final concentration of 0.32 nM are added, ultrapure water is used for replacing a contrast, and finally, 10ul of ultrapure water is used for a reaction system.

The primer sequences used for each sample were:

the 80bp short target was identified using the primer sequence (lanes 2, 3):

an upstream primer: gtaaagct ggctttccctttcc, respectively; a downstream primer: tgatgcggatgccgcgcgcgcgaa

The 285bp short target was identified using the primer sequence (lanes 4, 5):

an upstream primer: gtgaaattatcgccacgttcgggcaa, respectively; 285-downstream primer: tcatcgcaccgtcaaaggaacc, respectively;

the 900bp short target was identified using the primer sequence (lanes 6, 7): primer 1 and Primer 2.

2) Long target overspeed PCR reaction process:

according to the following table 3, a 10. mu.l reaction system was prepared on ice and quickly placed in the overspeed PCR apparatus set up in step (ii) for temperature control, the temperature control and the number of cycles are shown in the following table (see Table 4):

3) and (3) verifying the amplification effect of the long-target overspeed PCR reaction:

after the long-target overspeed PCR reaction process is completed, verifying the amplification effect of the long-target overspeed PCR reaction system by using 2% ethidium bromide pre-stained agarose gel electrophoresis, wherein the electrophoresis conditions are as follows: 130V for 25 min, photographing system: molecular Imager Gel Doc XR (Bio-Rad).

Wherein, lane 1 is D2000 Marker; lane 2 is the 80bp positive control of short target ultrarapid PCR (Salmonella addition ultrarapid PCR reaction system); lane 3 is the 80bp negative control of short target ultrarapid PCR (ultrarapid PCR reaction system without Salmonella addition); lane 4 is a 285bp positive control of short target ultrarapid PCR without gold nanoparticles (ultrarapid PCR reaction with salmonella); lane 5 is a 285bp short target ultrarapid PCR negative control (an ultrarapid PCR reaction system without salmonella) without gold nanoparticles; lane 6 is a 900bp long target ultrarapid PCR negative control with gold nanoparticles added (an ultrarapid PCR reaction system without salmonella addition); lane 7 is a positive control for 900bp long target ultrarapid PCR with gold nanoparticles added (salmonella-added ultrarapid PCR reaction system).

The comparison graph of amplification effect validation for the long target overspeed PCR reaction is shown in fig. 7, and the results in fig. 7 show: the long target overspeed PCR reaction system with participation of gold nanoparticles realizes effective amplification of a salmonella 900bp long target gene sequence, and has higher amplification efficiency and specificity.

(IV) establishment of nucleic acid self-assembly chromogenic module and visual detection of salmonella long target sequence

1) Sensitivity test

Drawing a standard curve of salmonella:

activating the Salmonella in L B culture medium overnight, diluting the gradient, counting by plate, and respectively measuring the concentration to be 1.5 × 10⁰Copy number/microliter, 1.5 × 10¹Copy number/microliter, 1.5 × 10²Copy number/microliter, 1.5 × 10³Copy number/microliter, 1.5 × 10⁴Copy number/microliter, 1.5 × 10⁵Copy number/microliter, 1.5 × 10⁶Extracting genome of Salmonella bacteria solution with copy number/microliter by using a bacterial genome DNA extraction kit of New Industry company, taking 2u L from the genome extracted from the Salmonella bacteria solution with the same concentration as a template, and performing the steps (III)Adding 1 mu L hemin (hemin) stock solution (10 mu M), 73 mu L G-triplet induction buffer solution (100 mM 2-morpholinoethanesulfonic acid, 2- (4-morpholinoline) ethanesulfonic acid (MES)), 40 mM KCl and 0.05% Triton X-100 in volume percentage, pH5.5) into a 10 mu L reaction system after the reaction is finished, incubating for 20min at 37 ℃, and adding 8 mu L ABTS^2-Stock solution (20 mM) with 8. mu. L hydrogen peroxide (H)₂O₂) Stock (20 mM) was incubated at room temperature for 5min in the dark.

Detecting OD value of the reaction solution at 450nm by using a spectrophotometer after the reaction is finished, subtracting OD value of a negative control (without salmonella as an amplification template) at 450nm to obtain △ OD450 value (as shown in figure 8), and finding that when the concentration of the bacteria liquid of the salmonella is more than or equal to 1.5 × 10⁰The semi-quantitative result observed by naked eyes when the copy number is in microliter is obviously different from the value obtained by monitoring by a spectrophotometer and compared with a blank control, so that the detection limit of the salmonella is determined to be 1.5 × 10⁰Copy number/microliter, which shows that the new detection method established by the invention has high sensitivity.

2) Experiment of accuracy

Labeling recovery detection experiment:

the concentration is 1.5 × 10¹The salmonella bacterial liquid with copy number/microliter is detected by the traditional flat plate detection method and the new method established by the invention, the detection result is shown in table 6, the new detection method established by the invention (the detection process is the same as the sensitivity experiment process, and only the extracted concentration of the salmonella bacterial liquid is 1.5 × 10¹Copy number/microliter of genome DNA of salmonella bacterial liquid, extracting, taking 2 mu L as a template after mixing), the detected average colony number is close to the average colony number detected by the traditional plate detection method, which shows that the new detection method established by the invention has high accuracy.

TABLE 6

3) Experiment of specificity

Culturing and activating salmonella, Shigella, Vibrio parahaemolyticus, Escherichia coli, Staphylococcus aureus, and Bacillus cereus in L B culture medium overnight to obtain 1.5 × 10⁰Salmonella bacteria solution with copy number/microliter, 1.5 × 10²Shigella bacterial solution with copy number/microliter, 1.5 × 10²Copy number/microliter Vibrio parahaemolyticus bacterial liquid 1.5 × 10²Copy number/microliter Escherichia coli solution, 1.5 × 10²Staphylococcus aureus bacterial liquid with copy number/microliter and 1.5 × 10²And (3) respectively extracting genome DNA in different bacterial liquids by using copy number/microliter bacillus cereus liquid and a bacterial genome DNA extraction kit of New Industry company, respectively taking 2 mu L as a template, mixing the template to obtain a reaction system, and carrying out long-target ultra-speed PCR reaction according to the long-target ultra-speed PCR reaction (except that the template is correspondingly replaced, the other parts are consistent) in the step (three).

Adding 1 μ L hemin (hemin) stock solution (10 μ M), 73 μ L G-triplet inducing buffer (100 mM 2-morpholinoethanesulfonic acid, 2- (4-morpholinone) ethanesulfonic acid (MES)), 40 mM KCl, 0.05% Triton X-100 by volume, pH5.5) to each 10 μ L reaction system, incubating at 37 deg.C for 20min, and adding 8 μ L ABTS^2-Stock solution (20 mM) with 8. mu. L hydrogen peroxide (H)₂O₂) Stock (20 mM) was incubated at room temperature for 5min in the dark.

The experimental result is shown in fig. 9, the detection method established by the invention has no cross reaction to shigella, vibrio parahaemolyticus, escherichia coli, staphylococcus aureus and bacillus cereus, and can realize the specific detection of salmonella.

The above-mentioned embodiments only express the embodiments of the present invention, and the description is more specific and detailed, but not understood as the limitation of the patent scope of the present invention, but all the technical solutions obtained by using the equivalent substitution or the equivalent transformation should fall within the protection scope of the present invention.

Sequence listing

<110> university of agriculture in China

<120> quantitative detection method based on overspeed PCR and functional nucleic acid chromogenic reaction

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gggatgggcg ggttnggcat gtctgcgcac ttc 33

<210>2

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gggcgggttg ggttntccgc cctgtctact tat 33

<210>3

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gggatgggcg ggttngtgct cgtttacgac ctga 34

<210>4

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gggcgggttg ggttnccctt tgcgaataac atcc 34

<210>5

<211>14

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gggatgggcg ggtt 14

<210>6

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggcatgtctg cgcacttc 18

<210>7

<211>14

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gggcgggttg ggtt 14

<210>8

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tccgccctgt ctacttat 18

<210>9

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gtgctcgttt acgacctga 19

<210>10

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccctttgcga ataacatcc 19

Claims

1. A method for quantitatively detecting salmonella of non-diagnosis purpose based on overspeed PCR is characterized in that a target sequence is amplified by using the overspeed PCR method, and a color reaction is included;

the PCR reaction system comprises an upstream primer, a downstream primer and DNA polymerase;

the upstream primer is as follows: GGGATGGGCGGGTT-oxydenethylene glycol-GGCATGTCTGCGCACTTC;

the downstream primer is as follows: GGGCGGGTTGGGTT-oxydenethylene glycol-TCCGCCCTGTCTACTTAT;

or the upstream primer is: GGGATGGGCGGGTT-oxydenethylene glycol-GTGCTCGTTTACGACCTGA;

the downstream primer is as follows: GGGCGGGTTGGGTT-oxydenethylene glycol-CCCTTTGCGAATAACATCC;

the color reaction is to catalyze 2, 2-diaza-di (3-ethyl-benzothiazole-6-sulfonic acid) diamine salt ABTS under the induction of hemin^2-With hydrogen peroxide H₂O₂ABTS for producing a substance which gives a blue-green color to the reaction solution^-；

The chemical structure of the oxythienyleneglycol is as follows:

，

the DNA polymerase is KAPA2G FAST DNA polymerase.

2. The detection method according to claim 1, wherein the PCR reaction system further comprises gold nanoparticles; the final concentration of the gold nanoparticles is 0.1-0.5 nM.

3. The detection method according to claim 1 or 2, wherein the concentration of the forward primer is 1 to 5. mu.M, the concentration of the reverse primer is 1 to 5. mu.M, and the concentration of KAPA2G FAST DNA polymerase is 1 to 5U/μ L.

4. The detection method according to claim 3, wherein the reaction process of the ultrarapid PCR reaction comprises: 95-98 ℃ for 0-10 s; 50-60 ℃ for 0-10s, and 25-40 cycles.

5. The detection method according to claim 4, wherein the reaction process of the ultrarapid PCR reaction comprises: 95-98 ℃ for 1-5 s; 50-60 ℃ for 1-5s, and 25-40 cycles.

6. The detection method according to claim 3, comprising 2.5 μ M of the upstream primer, 2.5 μ M of the downstream primer, 2U/μ L of the polymerase, and 0.32 nM of the gold nanoparticles.

7. The detection method according to claim 5, comprising 2.5 μ M of the upstream primer, 2.5 μ M of the downstream primer, 2U/μ L of the polymerase, and 0.32 nM of the gold nanoparticles.

8. A rapid detection device for a target sequence, comprising the reagent used in the detection method according to any one of claims 1 to 7, and further comprising:

1) the rapid detection device consists of a control host, a stepping motor, a mechanical arm, a real-time temperature monitor, a reactor with a rapid heat conduction function and a temperature difference container;

4) the rapid detection device can complete 30 thermal cycle amplifications within 10 minutes;

wherein the built-in reagent comprises an upstream primer, a downstream primer and DNA polymerase in the PCR reaction system of the claims 1-7, hemin and ABTS in the color reaction^2-And H₂O₂。