CA2512399A1 - F11 receptor(f11r) antagonists as therapeutic agents - Google Patents

Abstract

The present invention provides a cell adhesion molecule (CAM), designated F11 receptor (F11R), which is a member of the immunoglobulin super family localized on the surface of human platelets, and determined to effect platelet aggregation, secretion, platelet spreading and cellular adhesion. Cloned F11R
cDNA and full length F11R cDNA and amino acid sequences are provided. F11R-antagonists and methods for the prevention and treatment of thrombosis, heart attacks, stroke and other clinical disorders involving thrombus formation are also provided.

Description

F11 RECEPTOR (F11R) ANTAGONISTS AS THERAPEUTIC AGENTS
FIELD OF THE INVENTION
The present invention relates to protein and peptide chemistry, as well as crystallography and organic chemistry. The present invention is directed to a cell adhesion molecule (CAM) and fragments thereof, and more particularly to a CAM
designated as the F11 receptor (Fl 1R), or a polypeptide fragment thereof. The present invention also relates to F11R-antagonists and methods for t he prevention and treatment of thrombosis, heart attacks, stroke and other clinical disorders involving thrombus formation.
BACKGROUND OF THE INVENTION
The vasculature is recognized as a dynamic metabolic organ that exists under normal physiological conditions in an intact, undisturbed state (Karsan, et al. In: Hematology:
Basic Prifaciples afzd Practice, 3rd Ed. Hoffman, et al. (eds) 2000; pp. 1770 -82). Endothelial cells (EC), which line the exposed (luminal) surface of blood vessels, are normally not thrombogenic. That is, healthy EC do not attract nor bind circulating platelets (fines, et al.
Blood 1998, 91: 3527-61; May, et al. Thrornb Haemost 1999, 82: 962-70). It is well known that the physiological function of the endothelium is to facilitate blood flow by providing a highly thromboresistant surface to flowing blood that inhibits platelet adhesion and clotting (fines, et al.). However, under inflammatory conditions, the nonthrombotic surface of EC
can be transformed to a prothrombotic surface foll owing exposure to cytokines (May, et al.;

Diquelou et al. Tlaromb Haernost 1995, 74: 778-83), resulting in procoagulant activity and a predisposition to thrombosis (May, et al.; Dardik, et al. Bs' JHaemarol. 2000, 109:512 -8;
Andre, et al. Blood 2000, 96:3322-8). Indeed, the adhesion, accumulation and recruitment of non-stimulated platelets on cytokine- stimulated EC have been reported, with studies implicating the Platelet Endothelial Cell Adhesion Molecule-1 (PECAM-1;
Rosenblum, et al.
Stroke 1995, 27:709-11); beta 1 integrin (Bombeli et al. JExp. Med 1998, 187:329-39), von Willebrand factor (Dardik, et al.; Andre, et al.), and tissue factor (Verheul, et al. Blood 2000, 96:4216-21) in these processes. Thus, under inflammatory conditions, cytokines induce alterations in EC which result in the adhesion of non-stimulated platelets.
Recently, a novel adhesion protein of the Ig superfamily has been described with properties indicating a potential triggering role in the pathogenesis of in flammatory thrombosis.
This protein was identified first on the surface of human platelets and called the F11 receptor (F11R; Kornecki, et al. JBiol Chern 1990, 265: 10042-8; Naik, et al. Biochem J 1995, 311: 155 -62), and then on the surface of marine endothelial and epithelial cells and called JAM (Martin-Padura, et al.
J. Cell Biol. 1998, 142:117-27.).
The human platelet Fll receptor (F11R) is a surface glycoprotein duplex (32 and 35 kD at core protein: 29 kDa) member of the immunoglobulin superfamily.
The F11R
was first discovered as the target of a potent stimulatory monoclonal antibody, M.Ab.Fll, that induces platelet secretion followed by aggregation (Kornecki, et al.; Naik, et al.; Kornecki, et al. JLab Clin. Med. 1988, 111:618-26; Wang et al. Biochenz. J. 1995, 311: 401-6; Kornecki, et al. In: Leucocyte Typing V. Schlossman, et al. (eds.) Oxford University Press 1195: 1241 -3; Sobocka, et al. Blood 1997, 90: 10, Supplement 1, Part 2, November 15, 2996a.; Sobocka, Ph.D. Thesis, 1998: SUNY Downstate, Brooklyn, NY, Prese nted June 10, 1998;
published Sept. 15, 1998; Sobocka, et al. Bloozl 2000, 95:2600-9; Babinska, et al.
Tlaromb HaenZOSt 2002, 87: 712-21). Signal transduction mechanisms for platelet secretion and aggregation induced by M.Ab.Fl l following its initial binding to F11 include:
crosslinking of the F11 to the FcyRII (Naik, et al.), activation and translocation of specific PKC
isozymes (Wang, et al.), phosphorylation of the Fl 1R through activation of PKC (Naik, et al.; Wang, et al.), phosphorylation of the F11R following induction of platelet aggregation by the physiological agonists thrombin and collagen and by M.Ab.Fl 1 itself (Sobocka, et al. 1997;
Sobocka;
Sobocka, et al. 2000; ' Babinska, et al.), and phosphorylation of myosin light chain and pleckstrin, leading to shape change and granular secretion respectively (Kornecki, et al.
1990). Following secretion, this signal transduction pathway culminates in the activation of latent fibrinogen receptors and platelet aggregation (Kornecki, et al. 1990).
Partial amino acid sequences representing 30% of the length of purified Fl 1R have been reported in 1995 (Naik, et al.). Cloning of the full-length cDNA for the platelet Fl 1R has revealed that it is a cell adhesion molecule (CAM), a member of the immunoglobin superfamily (Sobocka, et al.
1997; Sobocka; Sobocka, et al. 2000). As a CAM, the Fl 1R participates in mechanisms underlying adhesion of platelets, endothelial cells, and epithelial cells (Martin-Padura, et al.;
Sobocka, et al. 2000).
The conclusion that in addition to its role as a receptor that triggers signal transduction leading to secretion, the F11R also serves as a CAM
involved in platelet adhesion was supported by the high degree of sequence similarity found between the human platelet F11R and an adhesion protein called Junctional Adhesion Molecule (JAM), a protein found in marine endothelial cells (Martin-Padura, et al.). Comparison of the marine JAM
sequence to the previously-reported sequences of human-platelet Fl 1R (Naik, et al.) revealed over 70% homology of JAM to the N -terminus (23 amino acids) of F11R and to two digested products of F11 R. In addition, both the human platelet F 11 R core protein and the marine JAM protein were found to contain a single transmembrane domain and two pairs of cysteine residues in their extracellular domains that allow formation of intermolecular disulfide bridges forming characteristic Ig-like folds. It is now well established that the protein referred to as JAM (Martin-Padura, et al; Ozaki, et al. J. IfnTnunol 1999, 163: 553 -7;
Williams, et al. Mol.
Imfnunol. 1999, 36: 1175 -88; Liu, et al. J. Cell Science 2000, 113: 2363-74;
Gupta, et al.
IUBMB Life 2000, 50: 51-6; Naik, et al. J. Cell Science 2001, 114: 539-47), is the marine ortholog of the human F11R (Kornecki, et al. 1990; Naik, et al 1995; Kornecki, et al. 1988;
Wang, et al.; Kornecki, et al 1995; Sobocka, et al. 1997; Sobocka; Sobocka, et al. 2000;
Babinska, et al.). JAM was localized at intercellular junctions of mouse endothelial and epithelial cells (Martin-Padura, et al.). Similarly, the platelet antibody M.Ab.Fl1 was found to recognize F11R molecules present at intercellular junctions of cultured human umbilical vein endothelial cells (Sobocka, et al., manuscript in preparation; Sobocka, et al. XTIIIIISTH
Congress, July, 2001, Paris, France, Abs# P1902). A recent study conducted by the inventors (Babinska, et al.) has determined that two domains of F11R are critical for the induction of platelet aggregation by M.Ab.Fl l and the adhesion of platelets to M.Ab.Fll.
Heretofore, the role of Fl 1R in physiological and pathophysiological processes involving the adhesion of platelets to endothelial cells has remained unknown. The inventors have now determined that the N-terminus of Fl 1R and the first Ig fold of F11R contain protein sequences which are critical for the adhesion of platelets to endothelial cells, and that recombinant soluble F11R

and Fl 1R-peptides block approximately 60% of the adhesion of platelets to cytokine-treated EC, demonstrating the involvement of the F11R in platelet -endothelial cell interactions, which under pathological conditions result in thrombosis.
SUMMARY OF THE INVENTION
The present invention provides the full length cDNA sequence of the Fl 1 receptor (F11R) (SEQ ID NO: 6) and the encoded F11R amino acid sequence (SEQ ID NO: 7). The present invention also provides F11R-antagonists including peptide antagonists.
The present invention is directed to methods and compositions for treating F11R-mediated disorders such as thrombosis, heart attacks, stroke and all other clinical disorders involving thrombus formation. The present invention provides specific compositions containing at least one F11R -antagonist peptide which inhibits, suppresses or causes the cessation of at least one F11R-mediated biological activity in a mammal, and preferably humans.
Nucleic acid molecules coding for any of the above Fl 1R -antagonist peptides of the present invention, expression vectors which include any of such nucleic acid molecules, as well as related host cells containing such nucleotide sequences or vectors, are also contemplated by the present invention.
Still another embodiment of the present invention is directed to antibodies raised against the Fl 1R-antagonist peptides of the present invention.
Preferably, the antibodies of the present invention are raised against those Fl 1R-antagonist peptides whose sequences coincide with the corresponding sequences of a mammalian F11R or Junctional Adhesion Molecule (JAM) protein. The antibodies of the present invention can antagonize or neutralize the activity of F11R. Both polyclonal antibodies and monoclonal antibodies are contemplated by the present invention. Examples of such antibodies include M.Ab.Fll.
These and other embodiments of the invention will be readily apparent to those of ordiilary skill in view of the disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the 3-D structure of the external domain of the mature human platelet F 11 R. The two Ig-like folds of the human recombinant F 11 R protein (F 11 R) are shown as a backbone structure based on the template of the mouse JAM which shares about 70% homology to that of human F11R.
Figure 2 shows that potentiation of ADP-induced platelet aggregation by M.Ab.Fll is blocked by F11R peptides (SEQ ID NO: 1 and SEQ ID NO: 4). Figure demonstrates strong potentiation of aggregation using subthreshold levels of M.Ab.Fl l (0.3 ~,g/ml) and ADP (0.5 wM). No aggregation with ADP or M.Ab.Fll alone. Figure 2,B
demonstrates that a subthreshold concentration of M.Ab.Fl1 (0.3~,g/ml) does not induce platelet aggregation. However, ADP (O.SwM) plus M.Ab.Fl1 causes a strong aggregation.
Figure 2C demonstrates inhibition of the potentiation of aggregation by F11R-peptide (SEQ
ID NO: 1). SEQ ID NO: 1 (SO~,M) preincubated with platelets for about 30 sec prior to the addition of M.Ab.Fll (0.3~,g/ml) followed by the addition of ADP (O.SwM) inhibited aggregation. Control: aggregation in the absence of SEQ ID NO: 1. Figure 2D
demonstrates inhibition of the potentiation of aggregation by F11R -peptide (SEQ ID NO: 4).
SEQ ID NO:

4 preincubated with platelets for about 42 sec. prior to the addition of M.Ab.Fl l (0.3~g/ml) followed by addition of ADP (O.S~M) inhibited aggregation. Control:
aggregation in the absence of SEQ ID NO: 4. Figure 2E shows no inhibit ion in the presence of peptide 2, 3 or 5 (SEQ ID NOS: 2, 3, or 5, respectively).
Figure 3 shows inhibition of M.Ab.Fl l-induced platelet aggregation by F11R
peptides (Fig. 3A); Inhibition of M.Ab.Fl l (2.45 ~.g/ml)-induced platelet aggregation by 50 ~,M F11R peptide (SEQ ID NO: 1) and by 50 ~,M F11R peptide (SEQ ID NO: 4) Figure 3B
Control: Fig. 3C shows lack of inhibition of M.Ab.Fll (2.45 ~,g/ml)-induced platelet aggregation by F11R (SEQ ID NO: 2) (500 ~,M).
Figures 4A-4D show that potentiation of collagen-inducted platelet aggregation by M.Ab.Fl l is inhibited by F11R peptides (SEQ ID NOS: 1 and 4).
Figure 5 shows inhibition of adhesion by F11R peptides (SEQ ID NOS: 1 and 4).
Figure 6 provides the F11R cDNA sequence (full length) (SEQ ID NO: 6).
Figure 7 provides the F11R amino acid sequence (SEQ ID NO: 7).
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to F11R- antagonists. By "F11R-antagonist"
is meant a molecule that inhibits, suppresses or causes the cessation of at least one F 11R-mediated biological activity by, e.g., interfering with, blocking or otherwise preventing the interaction or binding of Fl.lR to its target, e.g. F11R on another cell.

In accordance with the present invention, novel F11R-antagonist peptides derived from or corresponding to the F11R have been isolated and synthesized.
These peptides possess F11R antagonistic properties including the ability to selectively bind to F11R
and inhibit F11R-mediated biological activity which, for example, is associated with adhesion of platelets to endothelial cells in mammals. The peptides of the present invention preferably correspond to specific portions of the native human Fl 1 receptor and include variations thereof, and therefore are non-immunogenic when administered to humans.
The Fl 1R-antagonist peptides of the present invention substantially correspond to the amino acids of the N-terminus or first Ig domain of human Fl 1R.
A preferred F11R-antagonist peptide of the present invention is a sequence of the N-ternlinal peptide of the F11R structure: SVTVHSSEPEVRIPENNPVKLSC (SEQ ID
NO: 1).
Another preferred F11R-antagonist peptide of the present invention is a sequence of the first Ig fold of the F11R structure:
KSVTREDTGTYTC (SEQ ID NO: 4).
Homologs, analogs and fragments of these peptides are also contemplated by the present invention which maintain F11R- antagonist activity in a mammal, particularly humans.
Another aspect of the present invention provides methods of interfering with, blocking or otherwise preventing the interaction or binding of platelets to endothelial cells with F11R by employing the F11R-antagonists contemplated by the present invention.
The present invention also provides compositions for the treatment of F11R -mediated disorders such as thrombosis, heart attacks, stroke and all other clinical disorders involving thrombus formation, in animals, including humans and includes methods of tr eating such disorders. The compositions include at least one of the F11R-antagonists, preferably at least one F11R peptide antagonist according to the present invention, admixed with a pharmaceutically acceptable carrier.
In accordance with the present invention, the protein F11R serves a significant role in the adhesion of platelets to inflamed endothelial cells. The present invention has identified that the activity of F11R is critical for initiating the formation of platelet plaques in blood vessels and for the formation of thrombi. Thus, any agents, chemicals or drugs that inhibit the action of F11R (named here col lectively: F11R-antagonists) will serve as powerful inhibitors of thrombus development in the circulation. Accordingly, the present invention provides F11R-antagonists as drugs useful for the prevention and treatment of thrombosis, heart attacks, strokes, immunothrombocytopenia, posttransfusion purpura, acute and chronic immunothrombocytopenia, acquired disorders of platelet function, myeloproliferative disorders, uremia, liver disease, cardiopulmonary bypass, various types of thrombosis inflammatory thrombosis, peripheral vein thrombosis, coronary artery thrombosis and other arterial thrombosis, atherosclerosis, disorders of angiogenesis, cancer growth and metastasis, and all other human disorders that involve thrombus formation.
One aspect of the inventi on is directed to methods of identifying a compound which prevents the adhesion of platelets to endothelial cells and inhibits platelet aggregation, also referred to as "F 11 R- antagonists."
The term "compound" is taken to include both organic compounds such as peptides, as well as inorganic compounds such as ion chelators. Antibodies, e.g., polyclonal or monoclonal antibodies directed against F11R, the Fab, Fab', F(ab')2 fragments of such antibodies, as well as single-chain anti-F11R antibodies can also be considered as compounds useful in the present methods.
Other preferred compounds include chemical compounds that can be derived from the knowledge of the sequence of the F11R, from each of the above sequences (i.e. SEQ
ID NOS: 1-7) and from the combination of the sequences together. These include linear sequences, cyclic sequences, annealing of the peptides together (preferably SEQ ID NOS: 1 and 4), and any other possible derivations using standard peptide chemistry techniques. In one embodiment the present invention contemplates any compound whose structure is based on the interaction of peptides 1 and 4 (SEQ ID NOS. l and 4), which form the binding site of the mature human platelet F11R.
As used herein a "mimetic" or "peptidomimetic" of a compound 's functional site refers to a compound in which chemical structures of protein or peptide sequences necessary for functional activity of a compound's functional site have been replaced with other chemical structures that mimic the conformation of the functional site.
An example of a peptidomimetic contemplated by the present invention includes a compound (e.g.
a small organic molecule) including portions with residues which interact sterically with the binding site of the F11R molecule. A "residue" refers to an amino acid incorporated in the peptide by an amide bond, for example. Approaches to designing peptide mimetics are known in the art.
For example, see Farmer, P.S. in Drug Design (E.J. Ariens, ed). Academic Press, New York, 1980, vol. 10, pp. 119-143; Ball J.B. and Alewood, P.F. (1990) J. Mol.
Recognition 3:55, Morgan B.A. and Ganor, J.A. (1985) Ann. Rev. Med. Chem. 24:243 and Freidinger R.M.
(1989) Trends Pharmacol. Sci: 10:270, incorporated herein by reference. In one embodiment, the present invention contemplates all peptidomimetics which can be designed based on the knowledge of the three-dimensional structure of the F11R molecule of the invention including but not limited to all mimetic compounds which can be conventionally synthesized by an ordinarily skilled chemist to bind to, antagonize, act as an agonist, inhibit, promote, block, or otherwise functionally interact with the binding site of the F11R as illustrated in Figure l, for example.
Most preferred compounds of the present methods ar a peptides which are made to resemble the monoclonal antibody F11 ("M.Ab.Fl l") binding site on platelets.
"F11R" refers to a receptor protein on the surface of human platelets as a target for a stimulatory M.Ab.Fl 1. "F11R" is also referred to as human ortholog of the marine protein called functional adhesion molecule (JAM). "F11R" is depicted in Figure 1 as a backbone structure in its entirety including the extracellular, soluble domain, consisting of two Ig-folds, a transmembrance domain and a short cytoplasmic portion, on both human platelets and endothelial cells.
"F11R antagonists" and "F11R antagonist peptides" further refers to any compound that can bind to the pocket formed by the N-terminal 23 amino acid region and 13 amino acid region in the first Ig fold. By such binding, the action of F11R is inhibited, i.e.
alignment of platelets and endothelial cells in F11R-mediated trans -homophilic interaction through the steric pocket, as depicted in Figures 1- 2, is blocked so that platelet aggregation or thrombosis, heart attacks, strokes, and all other human disorders that involve thrombus formation, can be prevented or treated. By "F11R antagonist peptide" is also meant a peptide that inhibits, suppresses or causes the cessation of at least one F11R
mediated biological activity by e.g. interfering with or otherwise preventing the interaction or binding of platelets to endothelial cells and thereby inhibit platelet aggregation.

In accordance with the present invention, two peptide sequences of the F11R
have been determined the sequences correspond to (the N -terminus SVTVHSSEPEVRIPENNPVKL,SC (SEQ ID NO: 1), and the first Ig fold sequence KSVTREDTGTYTC (SEQ ID NO: 4). The peptide sequences of the present invention inhibit the adhesion of platelets to endothelial cells and inhibit platelet aggregation.
As used herein, "peptide" refers to a linear series of amino acid residues linked to one another by peptide bonds between the alpha -amino and carboxy groups of adjacent amino acid residues. The term "synthetic peptide" is intended to refer to a chemically derived chain of amino acid residues linked together by peptide bonds. The term "synthetic peptide"
is also intended to refer to recombinantly produced peptides in accordance with the present invention. According to the present invention, preferred F11R antagonists include peptides (referred to herein as "F11R antagonist peptides") and antibodies.
Additionally, analogs, homologs and fragments of the novel peptides provided herein are included within the scope of the term " Fl 1R antagonist peptide".
By "homologs" is meant the corresponding peptides from F11R proteins of other mammalian species substantially homologous at the overall protein (i.e., mature protein) level to human Fl 1R, so long as such homologous peptides retain the F11R
antagonist activity.
By "analogs" is meant peptides which differ by one or more amino acid alterations, which alterations, e.g., substitutions, additions or deletions of amino acid residues, do not abolish the F11R antagonist properties of the relevant peptides. Thus, an analog may comprise a peptide having a substantially identical amino acid sequence to a peptide provided herein and in which one or more amino acid residues have been conservatively or non-conservatively substituted. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another. Likewise, the present invention contemplates the substitution of one polar (hydrophilic) residue such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine. Additionally, the substitution of a basic residue such as lysine, arginine or histidine for another or the substitution of one acidic resi due such as aspartic acid or glutamic acid for another is also contemplated. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residues such as cyteine, glutamine, glutamic acid, lysine and/or a polar residue for a non -polar residue.
The phrase "conservative substitution" also includes the use of chemically derivatized residues in place of a non-derivatized residues as long as the peptide retains the requisite Fl 1R antagonist, inhibition properties as conventionally measured.
Analogs also include the presence of additional amino acids or the deletion of one or more amino acids which do not affect Fl 1R-mediated biological activity. For example, analogs of the subject peptides can contain an N- or C-terminal cysteine, by which, if desired, the peptide may be covalently attached to a carrier protein, e.g., albumin. Such attachment, it is believed, will minimize clearing of the peptide from the blood and also prevent proteolysis of the peptides.
In addition, for purposes of the present invention, peptides containing D-amino acids in place of L-amino acids are also included in the term "conservative substitution."
The prese nce of such D-isomers can help minimize proteolytic activity and clearing of the peptide.

The term "fragment" refers to any subject peptide having an amino acid sequence shorter than that of any peptide depicted in SEQ ID NOS: 1-5 and 7 and which fragment retains the F11R-mediated antagonist activity of the subject peptides.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of synthetic organic chemistry, protein chemistry, molecular biology, microbiology, and recombinant DNA technology, which are well within the skill of the art.
These techniques are applied in connection with peptide synthesis, recombinant production of peptides and peptide mutagenesis, for example. Such techniques are explained fully in the literature. See e.g., Scopes, R.K., Protein Puf°ification Principles and Practices, 2d ed.
(Springer-Verlag. 1987), Methods in Enzynzology (M. Deutscher, ed., Academic Press, Inc.
1990), Sambrook, et al., Molecular' Cloning: A laboratory Manual, 2d ed., (Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989), Handboo7z ofExperinaental Ifnm.unology , Vols. I-IV (D.M. Weir and C.C. Blackwell, eds., 1986, Blackwell Scientific Publications), House, Modern Synthetic Reactions, 2d ed., (BenjaminlCummings, Menlo Pa rk, Cal., 1972).
The peptides of the present invention, homologs, analogs and fragments thereof may be synthesized by a number of known techniques. For example, the peptides may be prepared using the solid-phase synthetic technique initially described by Mernfield, in J.
Am. Chem. Soc. 85:2149-2154 (1963). Other peptide synthesis techniques rnay be found in M. Bodanszky, et al. Peptide Synthesis, John Wiley & Sons, 2d Ed., (1976) and other references readily available to those skilled in the art. A summary of polypeptide synthesis techniques can be found in J. Stuart and J.D. Young, Solid Phase Peptide Synthesis, Pierce Chemical Company, Rockford, Ill., (1984). Peptides may also be synthesized by solution methods as described in The Proteins, Vol. II. 3d Ed., Neurath, H. et al., Eds., p. 105-237, Academic Press, New York, N.Y. (1976). Appropriate protective groups for use in different peptide syntheses are described in the above- mentioned texts as well as in J.F.W. McOmie, Protective Groups in Organic Ch ernist~y, Plenum Press, New York, N.Y. (1973).
The peptides of the present invention can also be prepared by chemical or enzymatic cleavage from larger portions of the F11R molecule or from the entire Fl 1R molecule.
Additionally, the peptides of the present invention may also be prepared by recombinant DNA techniques (see e.g. Cur°rent Protocols ifa Molecular Cloning Ausubel et al., 1995, John Wiley & Sons, New York); Sambrook et al., 1989, Molecular Cloning: A
Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, New York;
Coligan et al. Curs°ent Protocols in Immunology, John Wiley ~ Sons Inc., New York, New York (1994)). The skilled artisan understands that any of a wide variety of expression systems can be used to provide the recombinant p eptides of the present invention. The precise host cell used is not critical to the invention. The Fl 1R antagonist peptides can be produced in a prokaryotic host (e.g. E. coli), or in a eukaryotic host (e.g., S. cerevisiae or mammalian cells, e.g. COS1, CHO, NIH3T3, and JEG3 cells, or in the cells of an arthropod, e.g. S. f°ugiperda). Such cells are available from e.g. the American Type Culture Collection, Mantissas, VA. The method of transfection and the choice of expression vehicle will depend on the host system selected. Transformation and transfection methods are described, e.g. in Sambrook et al. supra; expression vehicles can be chosen from those provided e.g. in Cloning Tpectors: A Labof°atory Manual P.H. Powels et al (1985), Supp.
1987.
For most of the amino acids used to build proteins, more than one coding nucleotide triplet (codon) can code for a particular amino acid residue. This property of the genetic code is known as redundancy. Therefore, a number of different nucleotide sequences can code for a,particular subject F11R antagonist peptide. The present invention also contemplates a deoxyribonucleic acid (DNA) molecule or segment that defines a gene coding for, i.e., capable of expressing, a subject peptide or a subject chimeric peptide from which a peptide of the present invention may be enzymatically or chemically cleaved.
DNA molecules that encode peptides of the present invention can be synthesized by chemical techniques, for example, the phosphotriester method of Matteuccie, et al., J. Am. Che~ra. Soc. 103:3185(1981). Using a chemical DNA synthesis technique, desired modifications in the peptide sequence can be made by making substitutions for bases which code for the native amino acid sequence. Ribonucleic acid equivalents of the above described DNA molecules may also be used.
A nucleic acid molecule comprising a vector capable of replication and expression of a DNA molecule defining coding sequence for a subject polypeptide or subject chimeric polypeptide is also contemplated.
The peptides of the present invention are chemically synthesized by conventional techniques such as the Merrifield solid phase technique. In general, the method comprises the sequential addition of one or more amino acid residues to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid residue is protected by a suitable, selectively removable protecting group. A different, selectively removable protecting group is utilized for amino acids containing a reactive side group such as lysine.
A preferred method of solid phase synthesis entails attaching the protected or derivatized amino acid to an inert solid support through its unprotected carboxyl or amino group. The protecting group of the amino or carboxyl group is then selectively removed and the next amino acid in the sequence having the complementary (amino or carboxyl) group suitably protected is admixed and reacted under conditions suitable for forming the amide linkage with the residue already attached to the solid support. The protecting group of the amino carboxyl group is then removed from this newly added amino acid residue, and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining terminal and side group protecting groups including the solid support are removed sequentially or concurrently to yield the final peptide. The lyophilized oligopeptides are resuspended in double distilled H 20 at 2 mg/ml as stock solutions and subsequently diluted in M199 -HPS for experiments.
Consistent with the observed properties of the peptides of the invention, the present peptides can be used to inhibit, suppress, or cause the cessation of at least one F11R-mediated biological activity. F11R functions in the biochemical events associated with platelets aggregation and adhesion of platelets to endothelial cells. Accordingly, the present invention contemplates methods to block, interrupt or otherwise prevent the association of platelets to endothelial cells and thereby effectively treat or prevent F11R- cell associated disorders such as thrombosis, for example.
F11R-mediated disorders such as, for example, thrombosis, heart attacks and strokes are F11R-dependent therefore treatable w ith the F11R antagonists, preferably F11R
antagonist peptides of the present invention. Other F11R related diseases are also contemplated by the present invention.
In another embodiment of the present invention, one or more F11R
antagonists, e.g., F11R antagonist peptides or antibodies, are included in pharmaceutical compositions.

Preferably, compositions containing the F11R antagonist peptides of the present invention are administered intravenously to inhibit, suppress, or cause the cessation of at least one F11R-mediated biological activity. When administered intravenously, the peptide compositions may be combined with other ingredients, such as carriers and/or adjuvants. The peptides may also be covalently attached to a protein carrier, such as albu min, so as to minimize clearing of the peptides. There are no limitations on the nature of the other ingredients, except that such ingredients must be pharmaceutically acceptable, efficacious for their intended administration and cannot degrade the activity of the active ingredients of the compositions. Examples of other anti-inflammatory ingredients contemplated by the present invention include, but are not limited to anti-Fl 1R antibodies, NSAIDS, steroids, or cyclosporin-A. When employed together with F11R antagonists, these agents may be employed in lesser dosages than when used alone.
The pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the ultimate solution form must be sterile and fluid. Typical carriers include a solvent or dispersion medium containing, for example, water buffered aqueous solutions (i.e., biocompatible buffers), ethanol, polyols such as glycerol, propylene glycol, polyethylene glycol, suitable mixtures thereof, surfactants or vegetable oils.
Sterilization can be accomplished by any art-recognized technique, including but not limited to, filtration or addition of antibacterial or antifungal agents, for example, paraben, chlorobutano, phenol, sorbic acid or thimerosal. Further, isotonic agents such as sugars or sodium chloride may be incorporated in the subj ect compositions.

Production of sterile injectable solutions containi ng the subject peptides is accomplished by incorporated these compounds in the required amount in the appropriate solvent with various ingredients enumerated above, as required, followed by sterilization, preferably filter sterilization. To obtain a steri 1e powder, the above solutions ar a vacuum -dried or freeze-dried as necessary.
When the peptides of the invention are administered orally, the pharmaceutical compositions thereof containing an effective dose of the peptide can also contain an inert diluent, as assimilable edible carrier and the like, be in hard or soft shell gelatin capsules, be compressed into tablets, or may be in an elixir, suspension, syrup or the like.
The subject peptides are thus compounded for convenient and effective administration in pharmaceutically effective amounts with a suitable pharmaceutically acceptable carrier in a therapeutically effective dose.
The peptides should preferably be administered in an amount of at least about 50 mg per dose, more preferably in an amount up to about 500 mg to about 1 gram per dose.
Since the peptide compositions of this invention will eventually be cleared from the bloodstream, re-administration of the compositions is indicated and preferred.
The peptides can be administered in a manner compatible with the dosage formulation and in such amount as well be therapeutically effective. Systemic dosages depend on the age, weight and conditions of the patient and on the administration route. For example, a suitable dose for the administration to adult humans ranges from about lmg/kg of body weight about 10 mg per kilogram of body weight.
As used herein, a pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents the like. The use of such media and agents are well-known in the art. The pharmaceutically acceptable carriers used in conjunction with the peptides of the present invention vary according to the mode of administration. For example, the compositions may be formulated in any suitable carrier for oral liquid formulation such as suspensions, elixirs and solutions.
Compositions for liquid oral dosage include any of the usual pharmaceutical media such as, for example, water, oils, alcohols, flavoring agents, preservatives, coloring agents and the like. In the case of oral solid preparations (capsules and tablets) carriers such as starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents and the like may be used. In addition, carriers such as liposomes and microemulsions may be used.
In a further aspect of the present invention, the pharmaceutical compositions of the present invention are employed for the treatment of F11R mediated pathological disorders.
Thus, the present invention provides methods of treating an Fl 1R mediated disorder in a subject by administering a therapeutically effective amount of a pharmaceutical composition of the present invention.
The term "therapeutically effective amount" means the dose required to treat an Fl 1R-mediated disorder.
By "an F11R-mediated disorder" is meant a pathological disorder, the onset, progression or the persistence of the symptoms of which requires the participation of F11R
molecules. Particularly, F11R-mediated disorders contemplated by the present invention include thrombosis, heart attacks and strokes.
The term "treatment" or "treat" refers to effective inhibition, suppression or cessation of the F11R activity so as to prevent or delay the onset, retard the progression or ameliorate the symptoms of the disorder.

The term "subject" refers to any mammalian subject. Preferably, the subject is a human.
The present invention thus provides methods of interfering with, blocking or otherwise preventing the interaction or binding of platelets with endothelial cells by employing the F11R antagonists contemplated by the present invention.
The F11R antagonist peptides of the present invention (or homologs, analogs or fragments) can be used to raise single-chain antibodies (SAb) or humanized monoclonal antibodies useful in the invention. The peptides can be coupled to a carrier protein such as KLH as described in Ausubel et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York. The KLH- antagonist peptide is mixed with Freund's adjuvant and injected into guinea pigs, rats, donkeys and the like or preferably into rabbits. Antibodies may be purified by peptide antigen affinity chromatography.
A single-chain antibody (SAb) is created by fusing together the variable domains of the heavy and light chains using a short peptide linker, thereby reconstituting an antigen binding site on a single molecule. Such single-chain antibody variable fragments (Fvs) can be fused to all or a portion of the constant domains of the heavy chain of an imrnunoglobulin molecule, if necessary. The use of sAb avoids the technical difficulties in the introduction of more than one gene construct into host cells. Single chain antibodies and methods for their production are known in the art. See, e.g., Bedzyk et al.
(1990) J. Biol.
Chern., 265:18615; Chaudhary et al. (1990) Proc. Natl. Acad. Sci., 87:9491;
U.S. Patent No.
4,946,778 to Ladner et al.; and U.S. Patent No. 5,359,046 to Capon et al.
Monoclonal antibodies can be prepared using F11R antagonist peptides and standard hybridoma technology (see e.g. Kohler et al., (1975) Nature 256:495;
Hammerling et al., (1981) In Moraocloraal Antibodies and T Cell Hybf~idomas, Elsevier, New York). For example, monoclonal antibodies to Fl 1R antagonist peptides (homologs, analogs or fragments thereof) can be raised in Balb/C or other similar strains of mice by immunization with purified or partially purified preparations of Fl 1R antagonist peptides.
The spleens of the mice can be removed, and their lymphocytes fused to a mouse myeloma cell line. After screening of hybrids by known techniques, a stable hybrid will be isolated that produces antibodies against Fl 1R antagonist peptides. The monoclonal antibody can be examined for its ability to inhibit the biological activity of F11R, e.g. platelet aggregation. Once produced, monoclonal antibodies are tested for specific F11R recognition by Western blot or immunoprecipitation analysis (by methods described in Ausubel et al., supra).
Antibodies which antagonize F11R/platelet aggregation are considered to be useful antagonists in the invention.
The monoclonal antibodies of the present invention can be humanized to reduce the immunogenicity for use in humans. One approach is to make mouse-human chimeric antibodies having the original variable region of the murine mAb, joined to constant regions of a human immunoglobulin. Chimeric antibodies and methods for their production are known in the art. See, e.g., Cabilly et al., European Patent Application 125023 (pub lished Nov. 14, 1984); Taniguchi et al., European patent Application 171496 (published Feb. 19, 1985); Mornson et al., European Patent Application 173494 (published Mar. 5, 1986);
Neuberger et al., PCT Application WO 86/01533, (published Mar. 13, 1986); Kudo et al., European Patent Application 184187 (published Jun. 11, 1986); Robinson et al., International Patent Publication #PCT/US86/02269 (published 7 May 1987); Liu et al., Proc.
Natl. Acad.
Sci. USA 84:3439-3443 (1987); Sun et al., Pf~oc. Natl. Acad. Sci. USA 84:214-218 (1987);

Better et al., SciefZCe 240:1041-1043 (1988). These references are incorporated herein by reference. Generally, DNA segments encoding the H and L chain antigen-binding regions of the marine mAb can be cloned from the mAb-producin g hybridoma cells, which can then be joined to DNA segments encoding C H and CL regions of a human immunoglobulin, respectively, to produce marine-human chimeric immunoglobulin-encoding genes.
The invention is further illustrated by the following specific examples which are not intended in any way to limit the scope of the invention.

F,X A MPT ,F
FXAMPT~F 1 Hurnara platelets. Whole blood was collected into the anticoagulant ACD (pH
4.6), as detailed (Kornecki et al. (1990) J. Biol. Claem., 265:10042-10048, incorporated herein by reference). Platelets were washed and isolated by differential centrifugation, and resuspended in a Tyrode-albumin (0.35%) solution buffered with 11.9 mM sodium bicarbonate (pH 7.35) in the presence of apyrase, heparin, and PGEI -(Id.).
Final platelet suspensions did not contain any inhibitors. Platelet aggregation was measured iii a Chronolog Whole Blood Lumi-Aggregometer (Chronolog Corp. Havertown, PA). Potentiation of platelet aggregation was measured by adding a mixture of two platelet agonists, each at a subthreshold concentr anon that did not induce any platelet aggregation. The lowest concentration of each agonist which caused platelet aggregation was determined in these experiments for each donor on the day of blood collection.
Immunoblottirag. Polyacrylamide gel electrophoresis, immunoblotting of transferred proteins onto nitrocellulose strips, and detection using ECL
chemluminescence were performed as detailed (Id.).
Antibodies. Monoclonal antibody M.Ab.Fl1 (IgG1 isotype) was affinity -purified as described (Id.). Histidine antibody was obtained from InVitrogen (Carlsbad, CA).
Corastr~uction of tlae plasmid pcDNA3.1/FIIR. A 726-base -pair fragment (nucleotide-6 till +720) was amplified by PCR using a human Fl 1 receptor cDNA
as a template (Sobocka et al. (1997) Blood, 90(10): Supp. 1, Part 2, 2996a, incorporated herein by reference) utilizing the forward primer [GCG GGATCCATCGCGATGGGGACAAAGGCG

(SEQ ID NO: 8)], and the reverse primer [CCGACCTCGAGCGGCATTCCGCTCCACAGCTTCCAT (SEQ ID NO: 9)] (bases in bold represent BamHI and Xhol sites), respectively. This PCR fragment encodes amino acids ser-1 to asn-208 of F11R, and excludes the C-terminal transmembrane and cytoplasmic domains. The 726-base-pair PCR-product was subcloned into plasmid pcDNA3.1/Myc-His (+) C (Invitrogen, Carlsbad, CA) using BamHI and Xhol to yield pcDNA3.1/F11R.
Transcription of the Fl 1R in this plasmid is under the control of CMV
immediate-early promoter. The construct pcDNA3.1/F11R was verified by sequencing and fine restriction mapping prior to its use in expression studies in COS -7 cells.
Recombinant DNA methods. E. coli transformation, plasmid DNA isolation, restriction analysis, extraction of DNA from agarose gells and ligation of insert into pcDNA3.1/myc-His(+)C vector were carried out as described (Sambrook et al.
Moleczclaf°
Cloning: A Labof°atofy Manuel 2nd Ed. Cold Spying Harbor- Labor~atoiy, Cold Spring Harbor, NY 1989, incorporated herein by reference). Plasmids were isolated from E.
coli DHSa (Life Technologies, Grand Island, NY) using Qiaprep columns (Qiagen, Valencia, CA).
DNA
restriction fragments were separated by agarose gel eletrophoresis and isolated with the QIAquick Gel extraction kit (Qiagen). PCR was performed using the Perkin Elmer Gene Amp 2400PCR System. DNA sequencing was performed by PCR-cycle sequencing using ABI PRISM Dye Terminator Cycle Sequencing I~it from Perkin Elmer (Foster City, CA) and the ABI Prism 377 DNA Squencer. Computer analysis of sequence data was performed with the Biology WorkBench, release 3.2.
Tf~afasfection of COS-7 cells. COS-7 cells were grown in DMEM/10%FBS
(Cellgro Mediatech, Inc.) and 1% antimycotic (Life Technologies), at 37°C/5% C02, Cells (about 50% confluency), plated in a 75 mm flask, were used for transfection one day later.
The plasmid pcDNA3.1/Fl 1R (10 qg) was transfected into cells using 30 ~1 of FuGENE -6 (Roche Diagnostics). Cells were maintained at 37°C/5% COZ in 7 ml complete medium.
Cells were also treated with FuGENE-6 alone as controls. Total RNA was isolated (RNeasy Miiu Kit, Qiagen) and used for subsequent RT -PCR. RNA (2 ~.g) was used for reverse transcription (Omniscript Reverse Transcriptase, Oxnniscript RT Kit, Qiagen).
Half of the reaction mixture was used to amplify Fl 1R in a 35-cycle PCR using the specific F11R
primers as detailed previously (Sobocka, supra ). PCR cycling was as follows:
94°C for 5 min followed by 35 cycles of 94°C for 45 sec, 55°C for 45 sec, 72°C for 2 min and 94°C for 2 min. A 726-by fragment was obtained only from pcDNA3.1/F11R transfected cells.
Conditioned media, collected 72 h posttransfection, were pooled and passed twice over a M.Ab.Fl1-immunoaffinity column. After washing of the affinity column, the bound sFllR
was eluted by use of 50 mM diethylamine (pH 11.5), fractions were collected into 1 M Tris-HCI buffer (pH 8.0) and immediately dialysed against 10 mM Tris-HCI buffer (pH
7.4). The sFllR solution was concentrated Sx by Centricon YM-10 (Bedford, MA), and stored frozen at -20°C.
Synthesis ofFIlR peptides. Five FllRpeptides (95% pure) were synthesized (New England Peptides, Inc., Fitchburg, MA). The sequence of amino acids in these peptides and their location within the F11R molecule are shown in Table. Their mass was determined by MALDI-TOF DE mass spectrometry.

reptiae name Yt;Y'1'll)U SE(~Ut~;NCE
F11R-peptide 1 *SVTVHSSEPEVRIPENNPVKLSC
1___________________________________________23 (SEQ ID NO: 1) F11R-peptide 2 SYEDRVTFLPTGITFKSVTRED
55--____________________________________76 (SEQ ID NO: 2) F11R-peptide 3 WKFDQGDTTRLVEYNNKITASY
35--___________-___________________________56 (SEQ ID NO: 3) F11R-peptide 4 KSVTREDTGTYTC
70--_____________________g2 (SEQ ID NO: 4) F11R-peptide 5 EQDGSPPSEYTWFKD
128-________________________142 (SEQ ID NO: 5) The amino acid numbers refer to the sequence of the mature platelet cell surface F11 receptor and of the recombinant protein, sFllR, which does not include the leader peptide sequence.
*In accordance with the present invention, ser-1 is the first amino acid that follows the 27 amino acid leader peptide sequence of the nascent protein (Sobocka et al. (2000) Blood 95:2600-2609).
Platelet adlaesiofz to aTZ irnmobiliaed matrix. An adhesion assay, based on the determination of cell-derived protein using Bicinchoninic Acid (BCA) protein assay (Tuszynski et al. (1990) A~aal. Biochena 184:189-191, incorporated herein by reference), was used for platelet adhesion to immobilized M.Ab.Fll. Wells of a 96-well plate (Nunc -IxnmunoTM Plate, MaxiSoipTM Surface, flat bottomed) were incubated overnight at 4°C with 150 ml of a 1 mg/ml solution of M.Ab.Fl 1. Wells were aspirated, washed, treated with TBS/1%BSA for 1 h at 37°C, and washed with TBS/0.1 mM MnCl2/0.1 mM
CaCl2. Isolated platelet suspensions (100 ~,1) (3 x 10$/m1) were added and plates were incubated at 37°C for 90 min. Total platelet-associated protein was determined by dissolving the attached platelets directly with 100 ~.1 BCA. Platelets were incubated at 37°C for 2 h, and absorbance (595 rim) determined (Dynatech Laboratories, Chantilly, VA).

3D-Structure of humans sFlIR . The crystal structure of the external domain of mouse recombinant JAM (I~ostrewa et al. (2001) The Embo .I. 20:4391-4398, incorporated herein by reference) was used as a template to generate a 3D model of the human recombinant sFl 1R based on the sequence (Sobocka et al. (2000) Blood 95:2600-2609, incorporated herein by reference) of the mature human platelet Fl 1R (GenBank accession #AF207907).

Prepay°ation afzd use of Reconzbifaant sFIlR. A schematic model of the external domain of the F11R protein constructed on the basis of its sequence (Sobocka 2000) is illustrated in Fig. 1. A secreted, recombinant F11R protein (sFllR) was prepared in COS-7 cells which contained only the extracellular portion (amino acids ser -1 to asn-208) of the mature Fl 1R molecule. The transcription of the recombinant sFllR in COS -7 cells was determined by RT-PCR. A 726-base-pair fragment was detected only in pcI~NA3.l/F11R
transfected cells. (Babinska et al. (2002) Thronzb. Haemost 87:712-721, incorporated herein by reference). To determine the expression of sFllR in COS-7 cells, the conditioned media obtained from transfected cells were examined by immunoblotting using both a polyclonal anti-F11R antibody and the monoclonal M.Ab.Fl 1. The sFl 1R polypeptide was detected in the F11R COS-7 conditioned media obtained from these two separate F11R
secreting clones, COS-7 cells which were treated with only Fugene 6 (mock- transfected), or COS-7 cells transfected with a plasmid lacking F11R I~NA, did not secrete sFllR. The sFl 1R protein was engineered to contain a Histidine tag sequence, and indeed, it was recognized by an anti -His antibody. The use of a control protein (Positope, 53 kD, obtained from InVitrogen) that contains the His tag, confirmed this identification. Finally, sFllR was purified from COS-7 cell media using M.Ab.Fl1 immunoaffinity chromatography. The purred sFllR was recognized by both the platelet stimulatory monoclonal antibody, M.Ab.Fll, and by a polyclonal F11R antibody, directed against the N -terminal amino acids ser-1 to cys-23. The results detailed above demonstrate that transfected COS-7 cells not only synthesize by also secrete sFllR.

Inhibitory effects of specifz c FIIR peptides. Synthetic peptides according to published sequences of F11R were prepared. (Naik et al. (1995) Biochern. J.
311:155-162, incorporated herein by reference) (see also Table 1) and used for the identification of domains involved in M.Ab.Fl1-induced platelet aggregation. As shown in Fig. 3A, peptide 1 (SEQ ID
NO: 1) (SO~.M) completely inhibited M.Ab.Fl 1-induced platelet aggregation, and aggregation did not ensue when examined even after a 12 h period. In contrast, the addition of 50-500 mM of peptides 2 (SEQ ID NO: 2), 3 (SEQ ID NO: 3), or 5 (SEQ ID NO: 5) (shown in panel C), derived from the F11R sequence (see Table 1), had no inhibitory effects.
On the other hand, in addition to peptide 1, peptide 4 (SEQ ID NO: 3) (SO~,M), was able to completely block M.Ab.Fl 1-induced platelet aggregation (Fig. 3, panel B).

EXAMPT,F 4 Poterrtiation of agonist-induced platelet aggregation by FIIR. The presence of low, non-aggregating (sub-threshold) concentrations of the physiological agonist ADP, collagen or thrombin can cause platelet aggregation when added together with non-aggregating concentrations of M.Ab.Fl1 (Sobocka et al. (1997); Sobocka et al.
(1998) PhD
Thesis, SLTNY Downstate, Brooklyn, NY 6/10/98, published 9/15/98; Sobocka et al. 2001, supra, incorporated herein by reference). Such potentiating effects of M.Ab.Fl l on agonist -induced aggregation are depicted in Fig. 2. When subthreshold concentrations of ADP
(O.SmM) or M.Ab.Fl l (0.3 mg/ml), respectively, were added separately to platelet suspensions, there was no aggregation (panel B). However, when subthreshold concentrations of ADP were added together with subthreshold concentrations of M.Ab.Fll, a pronounced aggregation response was observed, reflecting the potentiating effect (see "M.Ab.Fl 1 plus ADP" tracings in each panel). Similar potentiating effects were observed with thrombin (data not shown). As shown in Panels B and C of Fig. 2, the addition of SO~,M
of Fl 1R peptide 1 (SEQ ID NO: 1) or peptide 4 (SEQ ID NO: 4) completely inhibited the potentiation by M.Ab.Fl l of ADP- induced platelet aggregation. In contrast to these two peptides, peptide 3 (SEQ ID NO: 3) (as shown in Panel D), did not inhibit the potentiation of ADP-induced platelet aggregation by subthreshold concentrations of M.Ab.Fl 1.
The lack of inhibition by F11R peptides 2 (SEQ ID NO: 2) and 5 (SEQ ID NO: 5) was the same as shown in Fig. 2D for peptide 3 (SEQ ID NO: 3).

FIIR peptides inhibit the potentiation of collagen-iizdz~ced platelet aggregation. The effect of F11R peptides on M.Ab.Fl 1 -induced potentiation of platelet aggregation induced by nonaggregating concentrations of collagen (O.S~,g/ml) also was examined. These results are shown in Fig. 4. Subthreshold concentrations of collagen and of M.Ab.Fl 1 used here w ere determined separately for each blood donor. Panel A
of Fig. 4 demonstrates that the selected concentrations of each of the agonists were not able to induce platelet aggregation when added alone. However, the addition of collagen just after adding M.Ab.Fl1 readily triggered a full-blown platelet aggregation. The potentiation by M.Ab.Fl 1 of collagen-induced platelet aggregation could be completely blocked by Fl 1R -peptide 1 (SEQ ID NO: 1), as shown in Panel B, as well as by peptide 4 (SEQ ID NO: 4), as shown in.
Panel C, but not with peptide 5 (SEQ ID NO: 5) (also shown in Panel C) nor with peptide 3 (SEQ ID NO: 3) (shown in panel D). The addition of sFllR (l~.g/ml) to platelet suspensions completely blocked the potentiation by M.Ab.Fl 1 of both ADP- and collagen-induced platelet aggregation, and the results were the same as shown for peptides 1 (SEQ ID NO:
1) and 4 (SEQ ID NO: 4) in Figs. 2 and 4.

F.T~AMPT,F F
Two specific FlIR peptides inhibit platelet adlaesiofa to M.Ab.Fll. The five peptides with sequenc es shown in Table 1 were tested also for their effects on the adhesion of platelets to immobilized M.Ab.Fl1 (150 ng/well). The left bar of Fig. 5 demonstrates the control adhesion measured without added peptide. Peptide 1 (SEQ ID NO: 1), added at 50 ~M caused about 60% inhibition of the adhesion of platelets to immobilized M.Ab.Fll, and with SOO~,M of peptide 1 (SEQ ID NO: 1), about 70% inhibition was observed.
Peptide 4 (SEQ ID NO: 4), at SO~M, produced very little (10%) inhibition compared to peptide 1 (SEQ
ID NO: 1) at similar concentrations. However, 500 ~,M of peptide 4 (SEQ ID NO:
4) produced approximately 70% inhibition in the adhesion of platelets to M.Ab.Fl l, similar to that observed with peptide 1 (SEQ ID NO: 1) at the same concentration. On the other hand the addition of 500 wM (or higher) of peptides 2, 3 or 5 did not cause significant inhibition of platelet adhesion to M.Ab.Fll.

Tht~ee-dimensional str"uctuf~e of the recontbinant human platelet FIlR. A 3 -dimensional structural model of the human platelet F11R, highlighting the two domains that are occupied by sequences of the platelet inhibitory peptides 1 and 4, are depicted in Fig. 1.
From this modeling it appears that the N -terminal portion of the molecule (containing the sequence of peptide 1 (SEQ ID NO: 1)), forms a loop around the 1St Ig-fold (containing the sequence of peptide 4 (SEQ ID NO: 4)) to form an "active pocket" containing the sequences of both peptides 1 and 4, arranged in an anti-parallel orientation. The data demonstrates that these two domains contain critical sites of the molecule that are responsible, at least in part, for triggering platelet aggregation, potentiation and adhesion by and to this immunologic agonist. This "active pocket" thus constitutes the stereospecific binding site for M.Ab.Fl 1 (Kornecki et al. 1990, Supf-a), and for homophilic interactions of F11R
molecules (Kornecki et al. (2001) FIIR: A Novel Receptor of the Irnmttnoglobulin Supetfanaily Involved in the Adhesion atad Aggf-egation ofHumatt Platelets, XV111th 15~' Congress, July, Paris, France 2001; Abs #54942, incorporated herein by reference).

Claims (13)

1. An isolated platelet membrane glycoprotein encoded by a sequence set forth in SEQ
ID NO: 7.

2. A composition comprising the glycoprotein of claim 1 and a suitable carrier.

3. An isolated F11R-antagonist compound.

4. An isolated F11R-antagonist compound comprising a sequence consisting of the amino acid sequence as set forth in SEQ ID NO: 1.

5. An isolated F11R-antagonist compound comprising a sequence consisting of the amino acid sequence as set forth in SEQ ID NO: 4.

6. A pharmaceutical composition comprising the isolated F11R- antagonist according to any one of claims 3-5.

7. A method for treating or preventing thrombus formation, in a patient in need thereof comprising administering a effective amount of the pharmaceutical composition of claim 6.

8. An isolated F11R antagonist comprising SVTVHSSEPEVRIPENNPVKLSC
(SEQ ID NO: 1).

9. An isolated F11R antagonist comprising KSVTREDTGTYTC (SEQ ID NO: 4).

10. An antibody directed against the antagonist compound of any one of claims 4-5, 8 or 9.

11. A method of treating an F11R mediated disorder in a subject, comprising administering to the subject a therapeutically effective amount of the compound of any of Claims 4-5, 8 or 9 and a pharmaceutically acceptable carrier.

12. The method of Claim 11, wherein said F11R mediated disorder is thrombosis, heart attack and stroke.

13. A method of treating a F11R mediated disorder comprising blocking the adhesion of platelets to endothelial cells by the administration of an F11R antagonist.