JP2002540083A - Human tumor necrosis factor receptor-like 2 - Google Patents

Abstract

  (57) [Summary] The present invention relates to novel members of the tumor necrosis factor family of receptors. The present invention provides an isolated nucleic acid molecule encoding the human TR2 receptor and two splice variants thereof. TR2 polypeptides are also provided, as well as vectors, host cells and recombinant methods for producing them. The present invention further relates to screening methods for identifying agonists and antagonists of TR2 receptor activity. Diagnostic methods are also provided for detecting disease states associated with aberrant expression of the TR2 receptor. Further provided are therapeutic methods for treating disease states associated with abnormal proliferation and differentiation of cells that express the TR2 receptor.

Description

DETAILED DESCRIPTION OF THE INVENTION

BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to novel members of the tumor necrosis factor (TNF) receptor family. More particularly, provided is an isolated nucleic acid molecule encoding a human TNF receptor-related protein, which has significant homology to mouse CD40, as the TR2 receptor of FIGS. 1A-1B herein. Quoted in Two different TR2 splicing variants (TR2-SV1 and TR2
-Called SV2) is also provided. Human type 2 TNF receptor (TNF
A TR2 polypeptide that is homologous to -RII) is also provided. Vectors, host cells and recombinant methods for producing a TR2 receptor polypeptide are also provided. The present invention also relates to diagnostic methods for detecting and inhibiting both TR2 receptor polypeptide functional activity, as well as TR2 receptor gene expression.

Related Art Human tumor necrosis factor α (TNF-α) and β (TNF-β or lymphotoxin) are related members of a broad class of polypeptide mediators. Polypeptide mediators include interferons, interleukins, and growth factors (collectively referred to as cytokines) (Beutler, B. and Ce).
rami, A .; , Annu. Rev .. Immunol. , 7: 625-655 (
1989)).

[0003] Tumor necrosis factors (TNF-α and TNF-β) were originally discovered as a result of their antitumor activity, but now play an important role in hosts of biological processes and pathology. It is recognized as a pleiotropic cytokine. To date, T
NF-related cytokine family, TNF-α, TNF-β (Lymphotoxin-
α), LT-β, TRAIL, and Fas receptor, CD30, CD27
There are ten known members of the ligands for the, CD40, OX40, and 4-1BB receptors. These proteins have a conserved C-terminal sequence and a variable N-terminal sequence that are often used as membrane anchors, except for TNF-β. TN
Both F-α and TNF-β function as homotrimers when bound to the TNF receptor.

[0004] TNF is derived from many cell types (monocytes, fibroblasts, T cells, natural killers (N
K) including cells) and mainly by activated macrophages. TNF-α is used for rapid tumor necrosis, immune stimulation, self-diseases, transplant rejection, generation of antiviral responses, septic shock, cerebral malaria, cytotoxicity, harm of ionizing radiation generated during chemotherapy Protection (eg, enzyme denaturation, lipid peroxidation, and DNA damage) (Nata et al., J. Immunol.
136 (7): 2483 (1987)), and have been reported to have roles in growth regulation, vascular endothelial effects, and metabolic effects. TNF-α also induces the secretion of various factors (including PAI-1, IL-1, GM-CSF, IL-6) by endothelial cells to promote cell proliferation. In addition, TNF-α is E-selectin,
It upregulates various cell adhesion molecules such as ICAM-1 and VCAM-1. TNF-α and Fas ligand have also been shown to induce programmed cell death.

[0005] TNF-β induces antiviral status and tumor necrosis, activates polymorphonuclear leukocytes, induces class I major histocompatibility complex antigens on endothelial cells, induces adhesion molecules on endothelium And many activities including growth hormone stimulation (Ruddle
, N .; And Homer, R.A. Prog. Allergy, 40: 162-1
82 (1988)).

[0006] Both TNF-α and TNF-β are involved in growth regulation and interact with hematopoietic cells at several stages of differentiation, inhibit the proliferation of various types of progenitor cells, and Induce proliferation of bone marrow monocytic cells. Porter, A .; Tibtech
9: 158-162 (1991).

[0007] Recent studies using "knock-out" mice have shown that mice deficient in TNF-β production exhibit abnormal development of peripheral lymphoid organs and morphological changes in spleen structure ( Aggarwal et al., Eur Cytokine Ne
tw, 7 (2): 93-124 (1996)). With respect to lymphoid organs, popliteal, groin, para-aortic, mesenteric, axillary, and cervical lymph nodes did not develop in TNF-β − / − mice. Furthermore, TNF-β-/-
Peripheral blood from mice had a three-fold reduction in white blood cells as compared to normal mice. However, peripheral blood from TNF-β − / − mice contained four times more B cells than their normal counterparts. Furthermore, TNF-β has a higher EB compared to TNF-α.
It has been shown to induce proliferation of V-infected B cells. These results indicate that TNF-
β indicates that it is involved in lymphocyte development.

The first step in inducing various cellular responses mediated by TNF-αTNF-β or TNF-β is the binding to specific cell surfaces or soluble receptors. Two different TNF receptors have been identified, approximately 55 kDa (TNF-RI) and 75 kDa (TNF-RII) (Hohman et al., J. Bio.
l. Chem. , 264: 14927-14934 (1989)), and human and mouse cDNAs corresponding to both receptor types have been isolated and characterized (Loetscher et al., Cell, 61: 351 (1990)). Both TNF-Rs share the typical structure of cell surface receptors, including extracellular, transmembrane, and intracellular regions.

[0009] These molecules are not only in a cell-bound form, but also in a soluble form consisting of the truncated extracellular domain of the intact receptor (Nopha et al., EM
BO Journal, 9 (10): 3269-76 (1990)), and otherwise in intact receptors lacking the transmembrane domain. The extracellular domains of TNF-RI and TNF-RII share 28% identity and are characterized by four repetitive cysteine-rich motifs with significant intersubunit sequence homology. Most cell types and tissues have both T
Although it appears to express NF receptors, and both receptors are active in signaling, they can mediate different cellular responses. Furthermore, T
NF-RII mediates only human T cell proliferation by TNF, as shown in PCT WO 94/09137.

[0010] TNF-RI dependent responses include C-FOS, IL-6 and manganese superoxide dismutase mRNA accumulation, prostaglandin E2 synthesis, IL-
2 receptor and MHC class I and II cell surface antigen expression, growth inhibition,
As well as cytotoxicity. TNF-RI also triggers second messenger systems such as phospholipase A ₂ , protein kinase C, phosphatidylcholine-specific phospholipase C, and sphingomyelinase (Pfef
ferk et al., Cell, 73: 457-467 (1993)).

Several interferons and other factors have been shown to regulate TNF receptor expression. For example, retinoic acid has been shown to induce TNF receptor production in some cell types, while down-regulating production in other cells. Furthermore, TNF-α has been shown to result in localization of both types of receptors. TNF-α induces TNF-RI internalization and TNF-RII secretion (reviewed in Aggarwal et al., Supra). Thus, the production and localization of both TNF-Rs is regulated by various factors.

The yeast two-hybrid system has been used to identify ligands that associate with both types of TNF-R (Aggarwal et al., Supra and Vandenab).
eele et al., Trends in Cell Biol. 5: 392-399 (
1995)). Several proteins have been identified, which interact with the cytoplasmic domain of mouse TNF-R. These two proteins appear to be involved in baculovirus inhibitors of apoptosis, suggesting a direct role for TNF-R in regulating programmed cell death.

(Summary of the Invention) The present invention relates to SEQ ID NO: 26, FIGS. 1A to 1B (SEQ ID NO: 2), FIGS. 4A to 4C (
SEQ ID NO: 5) and the amino acid sequence set forth in FIGS. An isolated nucleic acid molecule comprising or consisting of a polynucleotide encoding a TR2 receptor and a splice variant thereof having the amino acid sequence of the present invention. The present invention also relates to recombinant vectors comprising the isolated nucleic acid molecules of the invention and host cells comprising the recombinant vectors, as well as methods for making such vectors and host cells and TR2 polypeptides or peptides by recombinant techniques. And methods for their use for the production of

[0014] The invention further provides an isolated TR2 polypeptide having an amino acid sequence encoded by a polynucleotide described herein.

[0015] The present invention also provides a screening method for identifying a compound capable of enhancing or inhibiting a cellular response induced by a TR2 receptor, the method comprising:
Contacting a cell expressing the R2 receptor with a candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response;
The standard is assayed when contact is made in the absence of the candidate compound, whereby an increased cellular response above the standard indicates that the compound is an agonist and decreased above the standard A cellular response indicates that the compound is an antagonist.

In another aspect, there is provided a screening assay for agonists and antagonists, comprising the step of determining whether a candidate compound has an effect on binding of a cellular ligand to the TR2 receptor. In particular, this method
Contacting the TR2 receptor with a ligand polypeptide and a candidate compound;
And ligand binding to the TR2 receptor, due to the presence of the candidate compound,
Deciding whether to increase or decrease.

[0017] The present invention further provides diagnostic methods that are useful during diagnosis or prognosis of disease states resulting from abnormal cell proliferation due to changes in TR2 receptor expression.

[0018] A further aspect of the present invention relates to a method for treating an individual in need of increased levels of TR2 receptor activity in the body, the method comprising an isolated TR2 polypeptide of the present invention or an agonist thereof. A composition comprising a therapeutically effective amount,
Administering to such an individual.

[0019] Yet a further aspect of the invention relates to a method for treating an individual in need of reduced levels of TR2 receptor activity in the body, the method comprising a therapeutically effective amount of a TR2 receptor antagonist. Is administered to such an individual.

The present invention further provides a soluble form of the polypeptide of the present invention. A soluble peptide is defined by an amino acid sequence, wherein the sequence comprises or consists of a polypeptide sequence that lacks a transmembrane domain. TR
Such soluble forms of the two receptors are useful as membrane-bound antagonists of the receptor.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention relates to TR2 polypeptides (FIGS. 1A-1B (SEQ ID NO: 2)) and splice variants thereof, TR2-SV1 (FIGS. 4A-4C (SEQ ID NO: 5). )) As well as isolated nucleic acid molecules comprising or consisting of the polynucleotides encoding TR2-SV2 (FIGS. 7A-7C (SEQ ID NO: 8)), wherein the amino acid sequence of the cDNA comprises Was determined by sequencing.
The TR2 protein shown in FIGS. 1A-1B shares sequence homology with the mouse CD40 receptor (FIG. 2 (SEQ ID NO: 3)). Amer on February 13, 1995
ican Type Culture Collection, 10801 U
diversity Blvd, Manassas, VA 20110-220
9, a deposit has been made with the USA and has been assigned ATCC accession number 97059.
The nucleotide sequence shown in FIGS. 1A-1B (SEQ ID NO: 1) has the deposited plasmid (clone ID HLHAB49 assigned ATCC Accession No. 97059).
CDN) which is thought to contain the same amino acid coding sequence as the cDNA contained in
A was obtained by sequencing.

[0022] The TR2 receptor of the present invention includes several allelic variants that include alterations in at least four nucleotides and two amino acids. The nucleotide sequence variants identified were either guanine or adenine at nucleotide 314, and nucleotide 386, as shown in FIGS. 1A-1B (SEQ ID NO: 1).
, 624, and 627. The changes identified at nucleotides 624 and 627 are silent, but the change at nucleotide 386 results in a codon at nucleotides 385 to 387 encoding either serine or phenylalanine, and the change at nucleotide 314 is
This results in a codon at nucleotides 313-315 encoding either lysine or arginine.

The nucleotide sequences shown in FIGS. 4A-4C (SEQ ID NO: 4) and FIGS. 7A-7B (SEQ ID NO: 7) have also been identified on February 13, 1995 as American Type.
e Culture Collection and deposited with the AT
CC accession numbers 97058 (TR2-SV1) and 97057 (TR2-SV2)
) Was obtained by sequencing the given cDNA. Deposited cD
NA was expressed in pBluescript SK (-) plasmid (Stratagen).
e, La Jolla, CA).

As used herein, the phrase “splice variant” refers to a cDNA molecule produced from an RNA molecule originally transcribed from the same genomic DNA sequence that has undergone alternative RNA splicing. . Alternative RNA splicing involves the initial R
It occurs when the NA transcript undergoes splicing (generally removing introns), which results in the production of more than one mRNA molecule, each of which can encode a different amino acid sequence. The term "splice variant" also refers to the protein encoded by the cDNA molecule described above.

As used herein, “TR2 protein”, “TR2 receptor”
, “TR2 receptor protein” and “TR2 polypeptide” refer to SEQ ID NO: 26, FIGS. 1A-1B (SEQ ID NO: 2), FIGS. 4A-4C (SEQ ID NO: 5), or FIGS. 7A-7C (SEQ ID NO: 5). 8) and all proteins resulting from alternative splicing of a genomic DNA sequence encoding a protein having a region of amino acid sequence identity and receptor activity corresponding to the protein shown in the TR2 allelic variant. SEQ ID NO: 26 and the T shown in FIGS. 1A-1B.
The R2 protein, the TR2-SV1 protein shown in FIGS. 4A-4C, and the TR2-SV2 protein shown in FIGS. 7A-7C are examples of such receptor proteins.

Nucleic Acid Molecules Unless otherwise indicated, all nucleotide sequences determined herein by sequencing DNA molecules are converted to an automated DNA sequencer (eg, Ap
Plied Biosystems, Inc. The entire amino acid sequence of the polypeptide encoded by the DNA molecule determined using Model 373) and determined herein was deduced by translation of the DNA sequence determined as described above. . Thus, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation typically will be at least about 90% identical to the actual nucleotide sequence of the sequenced DNA molecule, more typically at least about 95% to at least about 99.9. % Is the same. The actual sequence may be more accurately determined by other approaches, including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in the determined nucleotide sequence, as compared to the actual sequence, causes a frameshift in translation of the nucleotide sequence, and as a result, The deduced amino acid sequence encoded is completely different from the amino acid sequence actually encoded by the sequenced DNA molecule beginning at the point of such insertion or deletion.

Using the information provided herein, such as SEQ ID NO: 26, the nucleotide sequence in FIGS. 1A-1B, 4A-4C, or 7A-7C, the TR
The nucleic acid molecules of the invention encoding two polypeptides can be obtained using standard cloning and screening procedures, such as those used for cloning cDNA using mRNA as starting material. obtain. As an illustration of the present invention, the nucleic acid molecules set forth in FIGS. 1A-1B (SEQ ID NO: 1) were found in a cDNA library derived from activated human T lymphocytes. The nucleic acid molecules set forth in FIGS. 4A-4C (SEQ ID NO: 4) and FIGS. 7A-7C (SEQ ID NO: 7) were used in cDNA libraries derived from human fetal heart and stimulated human monocytes, respectively. Was found.

As described in Example 6, TR2 mRNA is expressed in many tissues (lung,
(Including spleen, and thymus) and is ubiquitous in human cells
Can be expressed. TR2 RNA is also available on B lymphocytes (CD19⁺), CD4⁺(T _H1 Clones and T_H2Clone) and CD8⁺Of both T lymphocytes, monocytes, and
And endothelial cells.

[0029] As also noted in Example 6, production of TR2 mRNA was determined by TN
It was inducible in MG63 cells by Fα. In addition, TR2 mRNA accumulation was observed in HL60, U937, and THP cells upon PMA or DMSO treatment. PMA and DMSO are agents known to induce differentiation of these three cell types.

The determined nucleotide sequence of the TR2 cDNA of FIGS. 1A-1B (SEQ ID NO: 1) contains an open reading frame encoding a protein of about 283 amino acid residues, a putative leader sequence of about 36 amino acid residues and About 30,417
Has an estimated molecular weight of kDa. About amino acid residue 37 to residue 283 (SEQ ID NO: 2)
The amino acid sequence of the putative mature TR2 receptor (amino acid residues 1-247) is shown in FIGS. 1A-1B. In this context, “about” means several (5, 4, 3, 2,
Or 1) including or less than the recited values, which are greater or less than the amino acid alone. As noted in Example 6, the position of the leader sequence cleavage site was T
It was confirmed for the R2-Fc fusion protein and was found between amino acids 36 and 37 (amino acid residues -1 to 1 of SEQ ID NO: 2) shown in FIGS. 1A-1B. The TR2 protein shown in FIGS. 1A-1B (SEQ ID NO: 2) is about 29% identical and about 47% similar to the mouse CD40 protein shown in SEQ ID NO: 3 (see FIG. 2). thing).

Similarly, the determined cDNA nucleotide sequence of TR2 splice variant TR2-SV1 (FIGS. 4A-4C (SEQ ID NO: 4)) contains an open reading frame encoding a protein of about 185 amino acid residues. Has a predicted leader sequence of about 36 amino acid residues and a predicted molecular weight of about 19.5 kDa. The amino acid sequence of the putative mature TR2-SV1 receptor from about amino acid residue 37 to about residue 185 (amino acid residues 1-149 of SEQ ID NO: 5) is shown in FIGS. 4A-4C (SEQ ID NO: 5). In this context, “about” includes the specifically recited values that are greater or less than a few (5, 4, 3, 2, or 1) amino acids. 4A-
The TR2-SV1 protein shown in FIG. 4C (SEQ ID NO: 5) is about 25% identical and about 48% similar to the human type 2 TNF receptor protein shown in SEQ ID NO: 6 (see FIG. 5). See).

The determined cDNA nucleotide sequence of the splice variant TR2-SV2 of TR2 (FIGS. 7A-7C (SEQ ID NO: 7)) contains an open reading frame encoding a protein of about 136 amino acid residues and contains a putative leader. It contains no sequence and has a predicted molecular weight of 14 kDa. The amino acid sequence of the putative mature TR2-SV2 receptor from about 1 to about 136 amino acid residues is shown in FIGS. 7A-7C (SEQ ID NO: 8). In this context, “about” includes the specifically recited values that are greater or less than a few (5, 4, 3, 2, or 1) amino acids.
The TR2-SV2 protein shown in FIGS. 7A-7C (SEQ ID NO: 8) is about 27% identical and about 45% similar to the human type 2 TNF receptor protein shown in SEQ ID NO: 9 ( See FIG. 8).

The TR2 shown in FIGS. 1A-1B, 4A-4C, and 7A-7C,
Comparison of both the nucleotide and amino acid sequences of the TR2-SV1 and TR2-SV2 receptor proteins shows some regions that are nearly identical.
The amino acid sequence of the TR2 receptor protein shown in FIGS. 1A-1B (SEQ ID NO: 2) is about 60% identical to the amino acid sequence of the TR2-SV1 receptor protein shown in FIGS. 4A-4C (SEQ ID NO: 5). And about 73% similar, but in the first about 100 amino acids of their respective sequences, the two proteins differ at one position (FIG. 10).

Similarly, the amino acid sequence of the TR2 receptor protein shown in FIGS. 1A-1B (SEQ ID NO: 2) is different from the amino acid sequence of the TR2-SV2 receptor protein shown in FIGS. 7A-7C (SEQ ID NO: 8). About 60% identical and about 71% similar, but the two proteins are nearly identical over a 60 amino acid stretch of the central portion of the TR2-SV2 protein (Figure 11).

In contrast, the TR2-SV1 and TR2-SV2 proteins are only about 20% identical at the amino acid level to each other and are about 38% similar. Unlike the comparison of either of these proteins to the TR2 protein shown in FIGS. 1A-1B (SEQ ID NO: 2), these proteins
-Shares their homology across the entire 136 amino acid sequence of the SV2 protein (Figure 12).

A comparison of these sequences with respect to their nucleotide sequence of the cDNA encoding the disclosed TR2 protein indicates that the TR2 cDNAs share approximately the same large region at the nucleic acid level (FIGS. 13A-B). 13D, 14A-14D, and 15A-15F). The cDNA sequences encoding the TR2 and TR2-SV1 proteins, for example, share large regions that are nearly identical in their nucleotide sequences encoding both the N-terminus of the respective proteins and both their 5 'and 3' non-coding regions. (FIGS. 13A to 13D). In addition, TR
The nucleotide sequences of the cDNAs encoding the 2-SV1 and TR2-SV2 proteins share significant homology, but this identity is limited to the 3 'region well beyond their respective coding sequences. (FIGS. 15A to 15F)
.

When such regions of similarity between two different cDNA sequences are maintained over a stretch of extended sequence, one of skill in the art will appreciate that each molecule was originally transcribed from the same genomic DNA sequence. Is shown. One of skill in the art further recognizes that, since more than one codon may encode the same amino acid, the identity at the amino acid level between the two proteins may result in the DNA sequences encoding these proteins sharing similar regions of the same identity. Understand that it does not necessarily mean. The above data indicate that the TR2 receptor of the present invention is transcribed from a single genomic DNA sequence and represents multiple splice variants of one initial RNA transcript.

A related protein generated from the alternatively spliced RNA is
It is called a splice variant and is known in the art. For example, transcripts of the src gene undergo alternative RNA splicing to produce cell type-specific products.
In most cells, the Src protein consists of 533 amino acids, whereas in neurons, an additional short exon is included in the mRNA, yielding a protein of 539 amino acids. Alberts, B .; MOLECULAR BI
OLOGY OF THE CELL (3rd edition, Garland Publis
ing, Inc. 1994), 455. Similarly, sex-specific mRN
A transcript has been identified in Drosophila, where alternative mRNA splicing results in a protein named Dsx, which is about 550 amino acids long in males and about 430 amino acids long in females. These two splice variant proteins share a common core sequence of about 400 amino acids. See ibid 457.

In the examples of the present invention, the TR2 receptor protein shown in FIGS. 1A-1B (SEQ ID NO: 2) is considered to be a full-length polypeptide encoded by RNA, from which the TR2 receptor protein is translated. . RNA encoding the TR2-SV1 splice variant shown in FIGS. 4A to 4C (SEQ ID NO: 5)
Include an insertion in the region encoding amino acid residue 102 of the amino acid sequence shown in FIGS. 1A-1B, and include a deletion in the region encoding amino acid residue 184 of the amino acid sequence shown in FIGS. 1A-1B. It is considered. The RNA encoding the TR2-SV2 splice variant shown in FIGS.
Starting from the nucleotide sequence encoding amino acid residue 102 of the amino acid sequence shown in FIG. 1B, and including insertions in the regions encoding amino acid residues 184 and 234 of the amino acid sequence shown in FIG. 1A-1B. Have been.

As indicated, the present invention also provides mature forms of the TR2 receptors of the present invention. According to the signal hypothesis, proteins secreted by mammalian cells have a signal sequence or secretory leader sequence that is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum is initiated. Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, cleavage of a secreted protein is not quite uniform, which results in more than one mature species for that protein. Furthermore, it has long been known that the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein. That is, it is unique to the amino acid sequence of the polypeptide. Accordingly, the present invention relates to ATCC Deposit No. 97
Amino acid sequences encoded by the cDNAs contained in the deposits identified as 059 and 97058 and amino acids as set forth in SEQ ID NO: 26, FIGS. 1A-1B (SEQ ID NO: 2) and FIGS. 4A-4C (SEQ ID NO: 5) A nucleotide sequence encoding a mature TR2 polypeptide having the sequence is provided. CDN contained within the deposit identified as ATCC Deposit Nos. 97059 and 97058
A mature TR2 polypeptide having the amino acid sequence encoded by A, allows the mammalian cell to have a fully open reading frame encoded by the human DNA sequence of the cDNA contained in the deposited plasmid (eg, COS as described below). The mature form of the TR2 receptor produced by expression in cells is contemplated.

The present invention also relates to the TR2-SV2 receptor protein of FIGS. 7A-7C (SEQ ID NO: 8) (having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 97057, and excluding the secretory leader sequence). A nucleic acid sequence encoding

[0042] Methods are available for predicting whether a protein has a secretory leader and a cleavage site for the leader sequence. For example, the method of McGeoch (Virus Res. 3: 271-286 (1985)) and von He
inje's method (Nucleic Acids Res. 14: 4683-46).
90 (1986)) may be used. The accuracy of known mammalian secretory protein breakpoint estimates for each of these methods ranges from 75-80%. von
Heinje, supra. However, the two methods do not always create the same putative breakpoint for a given protein.

In this case, FIGS. 1A-1B (SEQ ID NO: 2) and FIGS. 4A-4C (SEQ ID NO: 5)
) And the deduced amino acid sequence of the complete TR2 polypeptide shown in FIGS. 7A-7C (SEQ ID NO: 8) was obtained from a computer program (“PSORT”) (K. Naka).
i and M.I. Kanehisa, Genomics 14: 897-911 (1
992), which is a skilled system for estimating the cellular location of proteins based on amino acid sequences). McGeoch and von
Heinje's method is incorporated as part of this computational estimation of localization. POR
Analysis by the T program showed that in SEQ ID NO: 2 and SEQ ID NO: 5 the amino acid-
The cleavage site between 1 and amino acid 1 was deduced. Thereafter, the complete amino acid sequence
A simple form of the on-Hein (-1, -3) rule was applied and further analyzed by visual inspection. von Heinje, supra. Therefore, the leader sequence for the TR2 protein and TR-2SV1 protein shown in SEQ ID NO: 2 is
Although predicted to be composed of amino acid residues -36 to -1 in both SEQ ID NO: 2 and SEQ ID NO: 5, the predicted mature TR2 protein has amino acid residues 1 to 36 of the TR2 protein shown in SEQ ID NO: 2. 247 and the amino acid residues 1-149 of TR-2-SV1 shown in SEQ ID NO: 5.

As described in Example 6, the cleavage site of the leader sequence of the TR2-Fc fusion protein was confirmed using amino acid analysis of the expressed fusion protein.
This fusion protein has been found to begin at amino acid 37, which corresponds to amino acid 1 in SEQ ID NO: 2 and SEQ ID NO: 5, and the cleavage site in the leader sequence matches amino acids 36 and 37 of this protein. (Corresponding to amino acid residues -1 to 1 in SEQ ID NO: 2 and SEQ ID NO: 5).

However, as the skilled artisan will appreciate, due to the possibility of sequencing errors as well as the variability of the cleavage site for the leader in different known proteins, ATC
The TR2 receptor polypeptide encoded by the C Accession No. 97059 cDNA contains approximately 283 amino acids, but can be anywhere in the range of 250 to 316 amino acids; and the leader sequence of the protein is approximately 36 amino acids, but can be anywhere in the range of about 30 to about 2 amino acids. Similarly, the TCC encoded by the cDNA at ATCC deposit no.
The R2-SV1 receptor polypeptide contains approximately 185 amino acids,
It can be anywhere in the range of 163-107 amino acids; and the leader sequence for this protein is approximately 36 amino acids, but approximately 30 to approximately 42.
May be anywhere in the range of amino acids. In addition, ATCC deposit number 9705
The TR2-SV2 receptor polypeptide encoded by the 7 cDNAs contains approximately 136 amino acids, but can be anywhere in the range of 120 to 152 amino acids. In this context, "approximately" includes the values specifically recited and those values that are larger or smaller by some (5, 4, 3, 2, or 1) amino acids.

The leader sequence for the TR2 protein shown in SEQ ID NO: 26 is predicted to be composed of amino acid residues −38 to −1 in SEQ ID NO: 26, but the predicted mature TR2 protein has the sequence In number 26, amino acid residues 1 to
245.

As indicated, the nucleic acid molecules of the invention can be cDNA and genomic DNA, either in the form of RNA (eg, mRNA) or in the form of DNA (eg, obtained by cloning or produced synthetically). May be included). This D
NA can be double-stranded or single-stranded. Single-stranded DNA or single-stranded RNA can be the coding strand (also known as the sense strand) or the non-coding strand (also known as the antisense strand).

An “isolated” nucleic acid molecule is a nucleic acid molecule that has been removed from its natural environment (D
NA, or RNA). For example, a recombinant DNA molecule contained in a vector is considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules that are maintained in a heterologous host cell, or (partially or substantially) purified DNA molecules in solution. An isolated RNA molecule comprises an RNA transcript of the in vivo or in vitro DNA molecule of the invention. An isolated nucleic acid molecule according to the present invention further includes such molecules produced synthetically.

However, nucleic acids contained in clones that are members of a library (eg, a genomic library or a cDNA library) and have not been isolated from other clones of the library (eg, library clones and Chromosomes isolated or removed from cells or cell lysates (eg, in the form of a homogeneous solution containing other members), such as "chromosome spreads (spr
ead) ") is not" isolated "for the purposes of the present invention. As further discussed herein, an isolated nucleic acid molecule according to the present invention may be produced naturally, recombinantly or synthetically.

[0050] The isolated nucleic acid molecule of the present invention includes a DNA molecule comprising or consisting of an open reading frame (ORF) shown in SEQ ID NO: 26 or FIGS. 1A-1B (SEQ ID NO: 1). Comprises or consists of the coding sequence for the mature TR2 receptor set forth in SEQ ID NO: 26 (last 245 amino acids) or in FIGS. 1A-1B (SEQ ID NO: 2) (last 247 amino acids); Due to the degeneracy of the genetic code, but which still differs from the above sequence but still encodes the TR2 receptor protein shown in SEQ ID NO: 26 or in FIGS. 1A-1B (SEQ ID NO: 2). DNA molecules that contain or consist of the sequences that make up them. It will be appreciated that the genetic code is well known in the art. Thus, it is conventional for those skilled in the art to generate such degenerate variants.

Similarly, the isolated nucleic acid molecules of the present invention include those in FIGS. 4A-4C (SEQ ID NO: 4).
4A-4C (SEQ ID NO: 5) (last 149 amino acids) for the mature TR2-SV1 receptor shown in FIG. A DNA molecule comprising or consisting of the coding sequence of SEQ ID NO: 2; and comprising, due to the degeneracy of the genetic code, a sequence substantially different from that described above, but still encoding the TR2-SV1 receptor. Or a DNA molecule composed of them.

Further, the isolated nucleic acid molecules of the present invention include those shown in FIGS. 7A-7C (SEQ ID NO: 7).
Although substantially different from the above sequences due to the degeneracy of the genetic code and the DNA molecule comprising or consisting of the open reading frame (ORF) shown in DNA molecules that contain or consist of a coding sequence.

[0053] In another aspect, the invention relates to ATCC Deposit No. 97 February 13, 1995.
TR2, TR2- having the amino acid sequence encoded by the cDNA contained in the plasmids deposited as 059, 97058 and 97057, respectively.
Provided are isolated nucleic acid molecules encoding SV1 and TR2-SV2 polypeptides. In a further embodiment, these nucleic acid molecules encode a mature or full-length polypeptide lacking the N-terminal methionine. The invention further relates to SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1), FIGS. 4A-4C (SEQ ID NO: 4).
), And having the nucleotide sequence shown in FIGS. 7A-7C (SEQ ID NO: 7).
An isolated nucleic acid molecule; a nucleotide sequence of a cDNA contained in the deposited cDNA described above; or a nucleic acid molecule having a sequence complementary to one of the above sequences. Such isolated molecules, especially DNA molecules, can be used, for example, as probes for genetic mapping by in situ hybridization using chromosomes.
And it is useful as a probe for detecting the expression of the TN2 receptor gene of the present invention in human tissues by, for example, Northern blot analysis.

A further embodiment of the present invention is directed to (a) SEQ ID NO: 26, FIGS. 1A-1B (amino acid residues -36 to 247 of SEQ ID NO: 2), FIGS. 149) or FIGS. 7A-7C (amino acid residues 1-136 of SEQ ID NO: 8).
A) a nucleotide sequence encoding a TR2 polypeptide having the complete amino acid sequence shown in SEQ ID NO: 26, FIG.
5-247), 4A-4C (amino acid residues 35-149 of SEQ ID NO: 5) or 7A-7C (amino acid residues 2-136 of SEQ ID NO: 8), Nucleotides lacking the N-terminal methionine; (c) about positions 1 to about 245 of SEQ ID NO: 26, about positions 37 to 283 of FIGS. 1A-1B.
Position (amino acid residues 1-247 of SEQ ID NO: 2), or approximately 37 in FIGS. 4A-4C.
Amino acid sequence from position to about position 185 (amino acid residues 1 to 14 of SEQ ID NO: 5)
9) or a nucleotide sequence encoding the mature TR2 receptor (full-length polypeptide with any associated leader sequences removed) having the amino acid sequence at about position 1 to about position 136 of FIGS. 7A-7C (SEQ ID NO: 8); (D) cDs contained in ATCC deposit numbers 97059, 97058, and 97057, respectively.
TR2, T having the complete amino acid sequence, including the leader encoded by NA
A nucleotide sequence encoding an R2-SV1 or TR2-SV2 polypeptide; (e) a mature TR2 or TR2- having the amino acid sequence encoded by the cDNA contained in ATCC Deposit Nos. 97059 and 97058, respectively.
A nucleotide sequence encoding the SV1 receptor; (f) TR2 or TR2
A nucleotide sequence encoding the SV1 receptor extracellular domain; (g) TR
(H) nucleotide sequence encoding the TR2 receptor intracellular domain; (i) TR2 receptor extracellular and intracellular domains having all or part of the deleted transmembrane domain And (j) (a), (b), (b)
c) at least 80% identical to a nucleotide sequence complementary to any of the nucleotide sequences of c), (d), (e), (f), (g), (h) or (i), and more preferably at least 85% , 90%, 92%, 95%, 96%, 97%, 98
Or an isolated nucleic acid molecule comprising or consisting of a polynucleotide having a nucleotide sequence that is 100% or 99% identical. In this context, "approximately" includes the values specifically recited and those values that are larger or smaller by some (5, 4, 3, 2, or 1) amino acids.

For example, a polynucleotide having a nucleotide sequence that is at least 95% “identical” to a reference nucleotide sequence encoding a TR2 receptor polypeptide may cause the polynucleotide sequence to be 5 per 100 nucleotides of the reference nucleotide sequence encoding the TR2 receptor, respectively. Up to one mismatch (mismatc)
h) is intended to be identical to the reference sequence except that it may include h). In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to the reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or replaced with another nucleotide, or As many as 5% of all nucleotides in the reference sequence can be inserted into the reference sequence. These inconsistencies in the reference sequence correspond to 5 in the reference nucleotide sequence.
It can occur anywhere between these terminal portions, dispersed either individually at the 'or 3' terminal positions or nucleotides in the reference sequence or in one or more adjacent groups within the reference sequence. This reference (query) sequence is described in SEQ ID NO: 25, FIG. 1A-1B (SEQ ID NO: 1), FIG.
4C (SEQ ID NO: 4), or the entire TR2 receptor encoding the nucleotide sequence set forth in FIGS. 7A-7C (SEQ ID NO: 7), or any TR2 receptor polynucleotide fragment (e.g., Polynucleotides encoding N-terminally deleted and / or C-terminally deleted amino acid sequences of TR2 receptor), variants, derivatives or analogs.

As a practical matter, any particular nucleic acid molecule may be, for example, SEQ ID NO: 25, FIG.
1B (SEQ ID NO: 1), the coding nucleotide sequence shown in FIGS. 4A-4C (SEQ ID NO: 4), or FIGS.
At least 80%, 85%, 90%, 92%, based on the nucleotide sequence of NA,
Whether they are 95%, 96%, 97%, 98%, or 99% identical can be determined by known computer programs (eg, Bestfit program (Wisc).
onsin Sequence Analysis Package, Vers
ion 8 for Unix (registered trademark), Genetics Comput
er Group, University Research Park, 57
5 Science Drive, Madison, WI 53371). Bestfit is Smith and Water
Find the best segment of homology between two sequences using the local homology algorithm of man (Advances in Applied Mathem)
atics 2: 482-489 (1981)). If using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present invention, it is understood that identity Are calculated over the entire length of the reference nucleotide sequence, and the parameters are set such that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.

In certain embodiments, the identity (also referred to as an overall sequence alignment) between a reference (query) sequence (a sequence of the invention) and a subject sequence is determined by the algorithm of Brutlag et al. (Comp. App. Biosci. .6: 237-245 (1990))
Determined using the FASTDB computer program based on To calculate% identity, the preferred parameters used in the FASTDB alignment of DNA sequences are: Matrix = Unitary, k-tuple = 4, Mi
smart Penalty = 1, Joining Penalty = 30,
Randomization Group Length = 0, Cutoff
Score = 1, Gap Penalty = 5, Gap Size Penal
ty = 0.05, Window Size = 500 or the length of the nucleotide sequence of interest (whichever is shorter). According to this embodiment, if the subject sequence is 5
If the FASTDB program calculates the percent identity, if it is shorter than the query sequence due to the 'or 3' deletion (not because of an internal deletion),
Manual corrections are made to the results, taking into account the fact that 5 'and 3' truncations of the subject sequence are not considered. 5 'end or 3 compared to the query sequence
'For subject sequences with truncated ends, percent identity is calculated as the number of bases in the query sequence that are 5' and 3 'to the subject sequence that are not matched / aligned as a percentage of the total bases in the query sequence. Is corrected. The determination of whether nucleotides are matched / aligned is determined by the result of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the above FASTDB program using the specified parameters to arrive at the final percent identity score. This corrected score is
It is used for the purpose of the present embodiment. Only bases outside of the 5 'and 3' bases of the subject sequence that are not matched / aligned with the query sequence are calculated for the purpose of manually adjusting the percent identity score, as indicated by the FASTDB alignment. For example, a 90 base subject sequence is aligned with a 100 base query sequence to determine percent identity. The deletion occurs at the 5 'end of the subject sequence, so the FASTDB alignment does not show a match / alignment of the first 10 bases at the 5' end.
Ten unpaired bases represent 10% of the sequence (number of bases at unmatched 5 'and 3' ends / total number of bases in query sequence), so that 10%
It is subtracted from the percent identity score calculated by the ASTDB program. If the remaining 90 residues match perfectly, the final percent identity is 9
0%. In another example, a 90 residue subject sequence is compared to a 100 base query sequence. In this case, the deletion is an internal deletion, so that there is no base at the 5 'or 3' end of the subject sequence that is not matched / aligned with the query sequence. In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only the bases at the 5 'and 3' ends of the subject sequence that do not match / align with the query sequence are manually corrected. Other manual corrections are not made for the purposes of this embodiment.

The present application is disclosed herein, irrespective of whether they encode a polypeptide having functional activity of a TR2 receptor (eg, as disclosed herein for the N2 receptor disclosed herein). A nucleic acid sequence encoding a polypeptide having a truncated and / or C-terminally deleted amino acid sequence (eg, amino acids 50-283 of SEQ ID NO: 2)
At least 80%, 85%, 90%, 92%
, 95%, 96%, 97%, 98%, or 99% identical nucleic acid molecules. This means that even if a particular nucleic acid molecule does not encode a polypeptide having TR2 receptor activity, one of skill in the art will still appreciate how to use the nucleic acid molecule, for example, as a hybridization probe or polymerase chain reaction (PCR) primer. That's because I understand. Uses of the nucleic acid molecules of the invention that do not encode a polypeptide having TR2 receptor activity include, inter alia: (1) the TR2 receptor gene in a cDNA library or an allele or splice variant thereof. Isolation of (2) TR
In situ hybridization to metaphase chromosomal spreads (eg, "FISH") to provide the exact chromosomal location of the two receptor gene (V
erma et al., Human Chromosomes: A Manual of.
Basic Technologies, Pergamon Press, New
York (1988)); and (3) TR2 in specific tissues
Northern blot analysis to detect receptor mRNA expression.

However, the nucleic acid sequence shown in SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1), FIGS. 4A-4C (SEQ ID NO: 4) or FIGS. At least 80%, 85%, 90%, 92%, 9
Preferred are nucleic acid molecules having a sequence that is 5%, 96%, 97%, 98%, or 99% identical, and that actually encodes a polypeptide having TR2 receptor activity.

Preferably, the polynucleotide fragment of the present invention encodes a polypeptide that demonstrates TR2 functional activity. By a “polypeptide having TR2 receptor activity”, for example, as measured in certain immunoassays and biological assays, the TR2 receptors of the invention (eg, full (full length) TR2 receptor polypeptides, mature TR2 receptor polypeptides) , Secreted TR2 receptor polypeptides, and soluble TR2 receptor polypeptides (eg, TR2
Polypeptides which exhibit an activity similar to, but not necessarily identical to, the activity of (with a sequence contained in the extracellular domain of the receptor) are contemplated. For example, TR2 receptor activity can be measured using a TR2 receptor ligand (eg, AIM II (WO No. W).
O97 / 34911), the lymphotoxin-α, and the ability of the TR2 receptor polypeptide to bind to the herpes virus protein HSV1gD) can be routinely measured. TR2 receptor activity was determined as described in Example 6 below.
Can be measured by determining the ability of the polypeptide Fc fusion protein to inhibit lymphocyte proliferation, as described in. TR2 receptor activity also
It can be measured by determining the ability of the polypeptide, for example, the ability of a free or expressed cognate ligand on the cell surface to confer proliferative activity on intact cells that express the receptor.

Other methods are known to those skilled in the art and are within the scope of the present invention.

Of course, due to the degeneracy of the genetic code, those skilled in the art will appreciate the nucleic acid sequence of the deposited cDNA or SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1), FIGS. 4A-4C (SEQ ID NO: 4) or At least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 9% in the nucleic acid sequence shown in FIGS. 7A-7C (SEQ ID NO: 7).
It is immediately recognized that a number of nucleic acid molecules having sequences that are 9% identical encode polypeptides having "TR2 receptor activity". Indeed, since all of the degenerate variants of these nucleotide sequences encode the same polypeptide, this will be apparent to those skilled in the art, even without performing the above-described comparative assays. It will be further recognized in the art that for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having TR2 protein activity. This is because one of skill in the art will recognize that either amino acid substitutions that are unlikely or unlikely to significantly affect the function of the protein (eg, one aliphatic amino acid with a second aliphatic amino acid) Replacement).

For example, guidance on how to produce phenotypically silent amino acid substitutions can be found in Bowie, J. et al. U. Et al., "Deciphering the
Message in Protein Sequences: Toleran
ce to Amino Acid Substitutions "Science
ce 247: 1306-1310 (1990), where we provide:
Shows that the protein is surprisingly tolerant of amino acid substitutions.

The present invention further relates to a polynucleotide comprising or consisting of a fragment of the isolated nucleic acid molecule described herein. Nucleotide sequence of the deposited cDNA or SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1)
4A-4C (SEQ ID NO: 4) or 7A-7C (SEQ ID NO: 7) by a fragment of the isolated nucleic acid molecule having the nucleotide sequence shown, Even more preferably, fragments of at least about 30 nt in length, and even more preferably, of at least about 40 nt in length are contemplated, which are useful as diagnostic probes and primers as discussed herein. In this context, “approximately” includes the specifically recited values and values that are larger or smaller by several (5, 4, 3, 2, or 1) nucleotides.

Of course, 50, 75, 100, 125, 150, 175, 200, 225,
250, 275, 300, 325, 350, 375, 400, 425, 450,
475, 500, 525, 550, 575, 600, 625, 650, 675,
Larger fragments of 700, 725, 750, 775, 800, 825 or 848 nt in length are also useful according to the invention, and the nucleotide sequence of the deposited cDNA or SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1), FIG. 4A-4
Fragments corresponding to most (if not all) of the nucleotide sequences set forth in C (SEQ ID NO: 4) or FIGS. 7A-7C (SEQ ID NO: 7) are also useful. For example, by depositing at least a 20 nt fragment, c
The nucleotide sequence of the DNA or SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1),
Fragments containing 20 or more contiguous bases from the nucleotide sequence shown in FIGS. 4A-4C (SEQ ID NO: 4) or 7A-7C (SEQ ID NO: 7) are contemplated.

The preferred nucleic acid fragment of the present invention is presumed to constitute the mature TR2-SV1 receptor (about 37 to about 185 amino acid residues in FIGS. 4A to 4C (amino acid residues 1 to 149 in SEQ ID NO: 5). And complete T
A nucleic acid molecule encoding a polypeptide comprising or consisting of the R2-SV2 receptor (presumed to comprise from about 1 to about 136 amino acid residues in FIGS. 7A-7C (SEQ ID NO: 8)) No. In this context, "approximately" includes the values specifically recited and those values that are larger or smaller by some (5, 4, 3, 2, or 1) amino acids.

As in the above leader sequence, the amino acid residues constituting the extracellular domain, transmembrane domain and intracellular domain are estimated by computer analysis. Thus, as the skilled artisan will appreciate, depending on the criteria used to define each domain, the amino acid residues making up these domains may vary slightly (e.g., from about 1 to about Up to 15 amino acid residues). In this context, "
"Approximately" means in particular the listed values and some (5, 4, 3, 2, or 1)
Only the amino acids of greater or lesser values are included.

[0068] Preferred nucleic acid fragments of the present invention also include nucleic acid molecules that encode: the extracellular domain of the TR2 receptor protein of FIGS. 1A-1B (SEQ ID NO: 2) (in FIGS. 1A-1B, approximately 37- A polypeptide comprising or consisting of approximately 200 amino acid residues (estimated to comprise amino acid residues 1-164 in SEQ ID NO: 2); the TR2 receptor transmembrane domain (in FIGS. 1A-1B, the amino acids A polypeptide comprising or consisting of residues 201-225 (amino acid residues 165-189 in SEQ ID NO: 2); the TR2 receptor intracellular domain (approximately 226 to approximately 283 amino acid residues in FIGS. 1A-1B). Group (amino acid residue 19 in SEQ ID NO: 2)
0-247)) or having all or part of the deleted transmembrane domain;
A polypeptide comprising or consisting of the extracellular and intracellular domains of the TR2 receptor protein of FIGS. 1A-1B (SEQ ID NO: 2). In this context, “approximately” means especially the listed values and some (5, 4, 3)
Include values that are larger or smaller by amino acids of 2, 2, or 1).

A preferred nucleic acid fragment of the present invention also includes an amino acid sequence represented by SEQ ID NO: 26 (an accompanying leader sequence (respectively, an amino acid residue of SEQ ID NO: 26-
Nucleic acid molecules encoding amino acid residues of the extracellular domain of the TR2 protein having both an amino acid sequence having amino acid residues 38 to 162 and amino acid residues 1 to 162) of SEQ ID NO: 26 and an amino acid sequence having no amino acid residues thereof. .

[0070] Preferred nucleic acid fragments of the present invention also include nucleic acid molecules that encode an epitope-bearing portion of a TR2 receptor protein. In particular, such nucleic acid fragments of the present invention include nucleic acid molecules that encode:
Comprises or consists of 1, 2, 3, 4, 5 or more amino acid sequences selected from about 39 to about 70 amino acid residues in B (amino acid residues 3-34 in SEQ ID NO: 2) Polypeptide; approximately 106- in FIG.
A polypeptide comprising or consisting of about 120 amino acid residues (amino acid residues 70 to 80 in SEQ ID NO: 2); about 142 to about 189 amino acid residues in FIGS. Groups 106 to 15
3) a polypeptide comprising or consisting of; approximately 276 to approximately 283 amino acid residues in FIGS. 1A-1B (amino acid residue 240 of SEQ ID NO: 2);
247), comprising a polypeptide comprising or consisting of;
About 39 to about 70 amino acid residues (amino acid residues 3 to
34) comprising about 99 to about 136 amino acid residues in FIGS. 4A-4C (from amino acid residue 63 to SEQ ID NO: 5).
100); about 171 to about 185 amino acid residues in FIGS. 4A-4C (amino acid residues 135-149 of SEQ ID NO: 5);
Approximately 68 amino acid residues (SEQ ID NO: 8); approximately 93 to approximately 136 amino acid residues in FIGS. 7A-7C (SEQ ID NO: 8). In this context, "approximately"
In particular, include the values recited and values that are larger or smaller by several (5, 4, 3, 2, or 1) amino acids. The present inventors have determined that the polypeptide fragment is the antigenic region of the TR2 receptor. Methods for determining other such epitope-bearing portions of the TR2 protein are described in detail below. The polypeptides encoded by these polynucleotides are also included in the present invention.

Representative examples of TR2 receptor polynucleotide fragments include, for example, about 1-64, 65-100, 101-150, 151-2 of SEQ ID NO: 1.
00, 201-250, 225-265, 251-300, 301-350, 3
51-372, 373-450, 451-500, 501-550, 551-6
00, 601-650, 651-700, 701-750, 751-800, 8
01-850, 851-900, 901-950, 951-1000, 1001
-1050, 1051-1100, 1070-1113, 1101-1150,
1151-1200, 1201-1250, 1251-1300, 1301-1
350, 1351-1400, 1401-1450, 1451-1500, 15
A sequence derived from nucleotides 01-1550, 1551-1600, or 1601-1670, comprising or consisting of the complement of any of the cDNAs or fragments thereof contained in the deposit identified as ATCC Deposit No. 97059. Fragments. In this context, “approximately” includes the particularly recited range (either larger or smaller by some (5, 4, 3, 2, or 1) nucleotides) at either or both termini. The polypeptides encoded by these polynucleotides are also included in the present invention.

Further representative examples of the TR2 receptor polynucleotide fragment of the present invention include, for example, about 373 to 433, 373 to 450,
51-500, 501-550, 551-600, 601-650, 651-7
Nucleotides 00, 701-750, 751-800, 801-850, 851-900, or 901-927, approximately 247-300,3 of SEQ ID NO: 7
01-350, 351-372, 373-450, 451-500, 501-5
50, 551-600, or 601-654 nucleotides, or ATCC
CD contained in the deposit identified as deposit number 97058 or 97057
Fragments that include or consist of sequences derived from NA or the complement of any of these polynucleotides are included. In this context, “approximately” includes the particularly recited range (either larger or smaller by some (5, 4, 3, 2, or 1) nucleotides) at either or both termini. The polypeptides encoded by these polynucleotides are also included in the present invention.

[0073] One or more of the cysteine repeat regions of the TR2 receptor disclosed in FIGS. 1A-1B comprises a TR2 receptor and its ligand (eg, AIM II (WO W).
O97 / 34911), lymphotoxin-α, and herpesvirus protein HSV1 glycoprotein D (gD)). Accordingly, certain embodiments of the present invention are directed to poly-polypeptides comprising or consisting of the amino acid sequences of cysteine repeat regions A, B, C or D disclosed in FIG. 16 and described in Example 6. It relates to a polynucleotide encoding a peptide. A further embodiment of the invention comprises or comprises any combination of 1, 2, 3, or all four of the cysteine repeat regions AD disclosed in FIG. 16 and described in Example 6. A polynucleotide encoding a TR2 receptor polypeptide. A further preferred embodiment of the present invention is the cysteine repeat region A, B disclosed in FIG. 16 and described in Example 6.
, C, or D TR2 receptor amino acid sequence. A further embodiment of the invention comprises or comprises any combination of 1, 2, 3, or all four of the cysteine repeat regions AD disclosed in FIG. 16 and described in Example 6. Composed, T
R2 receptor polypeptide.

In certain embodiments, the polynucleotides of the present invention comprise at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 9
It comprises or consists of polynucleotide sequences that are 8% or 99% identical. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these nucleic acid and / or polynucleotide sequences are also encompassed by the present invention.

In another embodiment, the present invention relates to a method for producing one, two, or all three of the above-described cysteine-rich motifs, the above-described polynucleotides of the present invention, or their complements under stringent hybridization conditions. Provided isolated nucleic acid molecules comprising, or consisting of, polynucleotides that hybridize to E. coli. The meaning of the phrase “stringent conditions” as used herein is described below.

[0076] Preferably, the polynucleotide fragment of the invention encodes a polypeptide that exhibits one or more functional activities of the TR2 receptor. By a polypeptide that exhibits a “functional activity” of a TR2 receptor is meant a polypeptide that can exhibit one or more known functional activities associated with a full-length (complete) TR2 receptor protein. Such functional activities include, but are not limited to: biological activity (eg, inhibition of B cell proliferation), antigenicity, immunogenicity (antibodies that bind to a TR2 receptor polypeptide). Ability to bind to (or compete with the TR2 receptor polypeptide for binding), the ability to form multimers with the TR2 receptor polypeptides of the invention, and TR2 receptor polypeptides (eg, AIM II (International Publication Number WO
97/34911), the ability to bind to the receptor or ligand for lymphotoxin-α, and herpesvirus protein HSV1 glycoprotein D (gD).

[0077] The functional activity of a TR2 receptor polypeptide, and fragments, variants, derivatives, and analogs thereof, can be assayed by various methods.

For example, in one embodiment, various immunoassays known in the art are used to assay the ability to bind to the TR2 receptor antibody or compete with the full length TR2 receptor polypeptide for binding to the TR2 receptor antibody. Can be done. Such assays include radioimmunoassay, ELISA
(Enzyme-linked immunosorbent assay), “sandwich” immunoassay, immunoradiometric assay, gel diffusion sedimentation reaction, immunodiffusion assay, in situ immunoassay (eg using colloidal gold, enzyme or radioisotope labeling), Western blot, sedimentation Reactions, agglutination assays (eg, gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A
Assays and competitive and non-competitive assay systems using techniques such as immunoelectrophoresis assays and the like. In one embodiment,
Antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in immunoassays and are within the scope of the invention.

In another embodiment, if a TR2 receptor ligand is identified (eg, AIM II (WO 97/34911), lymphotoxin-α,
When the ability of the herpesvirus protein HSV1 gD), or a polypeptide fragment, variant, or derivative of the invention to multimerize is assessed, binding can be assessed, for example, by reducing and non-reducing gel chromatography, protein affinity chromatography, As well as by means well known in the art, such as affinity blotting. Generally, Phiz
icky, E.I. Et al., Microbiol. Rev .. 59: 94-123 (199
See 5). In another embodiment, the physiological correlation (signaling) of binding of the TR2 receptor to its substrate can be assayed.

In addition, the assays described herein (see, eg, Examples 6 and 8) and other assays known in the art are TR2 receptor polypeptides and fragments, variants, derivatives thereof. , And analog is TR2
It can be routinely applied to determine the ability to elicit a receptor-related biological activity (eg, inhibition of B cell proliferation, in vitro or in vivo). Other methods are known to those skilled in the art and are within the scope of the present invention.

In another aspect, the present invention provides a nucleic acid molecule of the present invention as described above (eg, the complement of the above-described polynucleotide fragment or ATCC accession numbers 97059, 97058, and 97057) under stringent hybridization conditions. The present invention provides an isolated nucleic acid molecule comprising or consisting of a polynucleotide that hybridizes to a portion of one polynucleotide of the included cDNA). "Stringent hybridization conditions"
Does it contain 50% formamide, 5 × SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% dextran sulfate, and 20 μg / ml denatured sheared salmon sperm DNA Alternatively, it is intended to incubate overnight at 42 ° C. in a solution consisting of them, followed by washing the filters at about 65 ° C. in 0.1 × SSC.

A polynucleotide that hybridizes to a “portion” of a polynucleotide is at least about 15 nucleotides (nt), and more preferably at least about 20 nucleotides (nt).
A polynucleotide (either DNA or RNA) that hybridizes to a reference polynucleotide of nt, even more preferably at least about 30 nt, and even more preferably about 30-70 nt is contemplated. In this context, "about" includes the specifically recited values, and values that are greater or less than a few (5, 4, 3, 2, or 1) nucleotides. These are useful as diagnostic probes and primers, discussed above and in more detail below.

A portion of a polynucleotide that is “at least 20 nt in length” is, for example, a reference polynucleotide (eg, a deposited cDNA or SEQ ID NO: 25, FIG. 1A).
From the nucleotide sequence of 1B (SEQ ID NO: 1), FIGS. 4A-4C (SEQ ID NO: 4), or the nucleotide sequence as shown in FIGS. 7A-7C (SEQ ID NO: 7).
Zero or more consecutive nucleotides are intended.

It will be appreciated that the poly A sequence (eg, SEQ ID NO: 25, shown in FIGS. 1A-1B (SEQ ID NO: 1), FIGS. 4A-4C (SEQ ID NO: 4), or FIGS. 7A-7C (SEQ ID NO: 7)) 3 (terminal) poly (A) range of TR2 receptor cDNA sequence
)), Or polynucleotides that hybridize only to the complementary stretch of T (or U) residues are included in the polynucleotides of the invention used to hybridize to portions of the nucleic acids of the invention. Absent. Such polynucleotides will hybridize to any nucleic acid molecule comprising a poly (A) stretch or its complement, such as, in particular, any double-stranded cDNA clone generated from an oligo dT primed cDNA library. This is because they soy.

As indicated, nucleic acid molecules of the invention that encode a TR2 polypeptide are nucleic acid molecules that themselves encode the amino acid sequence of a mature polypeptide; and mature polypeptide and additional sequences (eg, about 36 Coding sequences for amino acid leader or secretory sequences (eg, sequences encoding a pre- or pro- or pre-pro-protein sequence); additional non-coding sequences (eg, introns and non-coding 5 ′ and 3 ′ sequences) 'Sequences, including, but not limited to, transcribed, untranslated sequences that play a role in transcription, mRNA processing (eg, ribosome binding and mRNA stability), including splicing and polyadenylation signals. With the coding sequence for the mature polypeptide (top (Which may or may not have additional coding sequences); may include, but are not limited to, additional coding sequences that code for additional amino acids (eg, coding sequences that provide additional functionality). Thus, the sequence encoding the polypeptide can be fused to a marker sequence (eg, a sequence encoding a peptide that facilitates purification of the fusion polypeptide) In certain preferred embodiments of this aspect of the invention. The marker amino acid sequence is, inter alia, a hexahistidine peptide (eg, a tag provided in a pQE vector (QIAGEN, Inc.)), many of which are commercially available, Gentz et al., Proc.
Natl. Acad. Sci. USA 86: 821-824 (1989), for example, hexahistidine provides for convenient purification of the fusion protein. The “HA” tag is another peptide useful for purification, corresponding to an epitope from the influenza hemagglutinin protein, which is described in Wilso
n et al., Cell 37: 767 (1984). As discussed below, other such fusion proteins include a TR2 receptor fused to Fc at its N- or C-terminus.

The present invention further relates to variants of the nucleic acid molecules of the invention, which variants encode a part, analog or derivative of the TR2 receptor. A variant may be naturally occurring (eg, a natural allelic variant). "Allelic variant" intends one of several alternative forms of a gene that occupies a given locus on the chromosome of an organism. G
enes II, Lewin, B .; Hen, John Wiley & Sons, Ne
w York (1985).

Non-naturally occurring variants can be obtained by mutagenesis techniques known in the art (oligonucleotide-mediated mutagenesis, alanine scanning, PCR mutagenesis, site-directed mutagenesis (eg, Carter et al., Nucl. Acids Res. 13). : 4331
(1986); and Zoller et al., Nucl. Acids Res. 10:
6487 (1982)), cassette mutagenesis (eg, Wells
Et al., Gene 34: 315 (1985)), Limited Selection Mutagenesis (
See, for example, Wells et al., Philos. Trans. R. Soc. London
SerA 317: 415 (1986)).

Such variants include those produced by nucleotide substitutions, deletions, or additions that can include one or more nucleotides. Variants can be altered in the coding region, non-coding region, or both. Changes in the coding region may result in conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the TR2 receptor or portions thereof. Also particularly preferred in this regard are conservative substitutions.

Vectors and Host Cells The present invention also provides vectors comprising the isolated DNA molecules of the present invention, host cells genetically engineered with the recombinant vectors, and TR2 polypeptides or fragments thereof by recombinant techniques. For the production of

[0090] The polynucleotide may be ligated into a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, the vector can be packaged in vitro using a suitable packaging cell line and then transduced into host cells.

The DNA insert is inserted into appropriate promoters, such as the phage λPL promoter, the E. coli lac, trp, and tac promoters, the SV40 early and late promoters, and the retroviral LTR promoter, to name a few. Should be operably linked. Other suitable promoters are known to those skilled in the art. The expression constructs further include sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcript expressed by the construct preferably contains start and stop codons (UAA) appropriately positioned at the end of the polypeptide to be translated.
, UGA, or UAG).

[0092] As indicated, the expression vectors preferably include at least one selectable marker. Such markers include dihydrofolate reductase, or neomycin resistance for eukaryotic cell culture, and E. coli. For culturing in E. coli and other bacteria, include the tetracycline resistance gene, and the ampicillin resistance gene. Representative examples of suitable heterologous hosts include bacterial cells, such as E. coli cells, Streptomyces cells, and Salmon.
fungal cells (eg, yeast cells); insect cells (eg, Drosophila S2 cells and Spodoptera)
Sf9 cells); animal cells (eg, CHO cells, COS cells, and Bowes)
But not limited to, melanoma cells); and plant cells. Suitable culture media and conditions for the above host cells are known in the art.

Among the preferred vectors for use in bacteria, pQE70, pQE60
And pQE-9 (available from QIAGEN); pBS vector, Page
script vector, Bluescript vector, pNH8A, pNH1
6a, PNH18A, pNH46A (available from Stratagene); and ptrc99a, pKK223-3, pKK233-3, pDR540, p
RIT5 (available from Pharmacia). Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG (available from Stratagene); and pSVK3, pB
PV, pMSG and pSVL (available from Pharmacia). Other suitable vectors will be readily apparent to one skilled in the art.

The introduction of the construct into the host cells can be performed by calcium phosphate transfection, DE
Produced by AE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are compatible with many standard laboratory manuals (eg,
Davis et al., Basic Methods In Molecular Bi.
ology (1986)).

The polypeptide may be expressed in a modified form (eg, a fusion protein) and may include not only secretion signals but also additional heterologous functional regions. For example, regions of additional amino acids (especially charged amino acids) may be
Alternatively, it may be added to the N-terminus of the polypeptide to improve stability and durability during subsequent handling and storage. Peptide moieties can also be added to the polypeptide to facilitate purification. Such regions can be removed prior to final preparation of the polypeptide. Above all, it causes secretion or excretion,
The addition of peptide moieties to polypeptides to improve stability and facilitate purification is well known and routine in the art. Preferred fusion proteins contain heterologous regions from immunoglobulins useful for solubilizing the protein. For example, EP-A-0 464 533 (Canadian correspondence application 2045869).
Discloses a fusion protein comprising various portions of the constant region of an immunoglobulin molecule together with another human protein, or a portion thereof. In many cases, the Fc part in the fusion protein is sufficiently advantageous for use in therapy and diagnosis, thus resulting, for example, in improved pharmacokinetic properties (EP-A 0232 262).
. On the other hand, for some uses, it is desirable that the Fc portion can be deleted after the fusion protein has been expressed, detected, and purified in the advantageous manner described. This is when the Fc portion turns out to be an obstacle for use in therapy and diagnosis (eg, when the fusion protein is used as an antigen for immunization). In drug discovery, for example, human proteins such as hIL-5 have been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of the human hIL-5 receptor. D. Bennett
Et al., The Journal of Molecular Recogniti.
on Vol. 8: 52-58 (1995); Johanson et al.
The Journal of Biological Chemistry
Vol. 270 No. 16: 9449-9471 (1995).

The TR2 receptor is prepared by ammonium sulfate precipitation or ethanol precipitation, acid extraction,
Recombinant cell culture by well-known methods, including but not limited to anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography And can be purified. Most preferably, high performance liquid chromatography ("HPLC") is used for purification. Polypeptides of the invention include: natural purified products; products of chemical synthesis procedures; and prokaryotic or eukaryotic hosts (eg, bacterial cells, yeast cells, higher plant cells, insect cells, and mammalian cells). ) Produced by recombinant techniques. Depending on the host used in the recombinant production procedure, the polypeptide of the invention may be glycosylated or non-glycosylated. In addition, the polypeptides of the invention may also contain an altered starting methionine residue, in some cases as a result of a host-mediated process.

In addition to encompassing host cells containing the vector constructs discussed herein, the present invention also relates to primary host cells of vertebrate origin (particularly mammalian origin), secondary host cells. Cells and immortalized host cells. These cells may contain genetic material (eg, heterologous poly) that is operably linked to delete or replace endogenous genetic material (eg, a TR2 receptor coding sequence) and / or to a TR2 receptor polynucleotide of the invention. Nucleotide sequence) and activates, alters, and / or amplifies an endogenous TR2 receptor polynucleotide. For example, using techniques known in the art, heterologous control region sequences (
Endogenous TR2 receptor polynucleotide sequences can be operably linked via, for example, a promoter and / or enhancer) and homologous recombination (eg, US Pat. No. 5,641,670, issued Jun. 24, 1997; 1996 9
International Publication WO 96/29411 published on August 26; International Publication WO 94/12650 published on August 4, 1994; Koller et al., Proc. Natl. Acad.
Sci. USA 86: 8932-8935 (1989); and Zijlst.
Ra et al., Nature 342: 435-438 (1989), each of which disclosures are incorporated by reference in their entirety).

TR2 Polypeptides and Fragments The present invention further provides amino acid sequences encoded by the deposited cDNA, or SEQ ID NO: 26, FIGS. 1A-1B (SEQ ID NO: 2), FIGS.
Or an isolated TR2 polypeptide having the amino acid sequence shown in FIGS. 7A-7C (SEQ ID NO: 8), or a peptide or polypeptide comprising a portion of the above polypeptide, or a peptide comprising a portion of the above polypeptide or A polypeptide is provided.

[0099] The polypeptides of the present invention may be membrane-bound or in a soluble, circulating form. A soluble peptide is defined by an amino acid sequence, which comprises or consists of a polypeptide sequence that lacks a transmembrane domain. One example of such a soluble form of the TR2 receptor is a TR2-SV having a secretory leader sequence (but lacking both the intracellular and transmembrane domains).
One splice variant. Thus, the TR2-SV1 receptor protein is
Cells expressing this protein appear to be secreted in secreted form.

The polypeptide of the invention may exist as a transmembrane receptor having a transmembrane region and an intracellular and extracellular region, or the polypeptide of the invention may exist in a soluble form, wherein The transmembrane domain has been deleted. One example of such a form of the TR2 receptor is shown in FIGS. 1A-1B (SEQ ID NO: 2).
Are two receptors, which, in addition to the leader sequence, contain a transmembrane domain, an intracellular domain, and an extracellular domain. Thus, this form of the TR2 receptor appears to be localized on the plasma membrane of cells expressing this protein.

The polypeptides of the present invention also include: a polypeptide encoded by the deposited cDNA (including the leader); a polypeptide encoded by the deposited cDNA (without the leader) (ie, the mature protein). SEQ ID NO: 26, polypeptide (including leader) of FIGS. 1A-1B (SEQ ID NO: 2) or FIGS. 4A-4C (SEQ ID NO: 5), SEQ ID NO: 26, FIGS.
Or the polypeptide of Figures 4A-4C (SEQ ID NO: 5) (including the leader but not the N-terminal methionine); SEQ ID NO: 26, Figures IA-IB (SEQ ID NO: 2) or Figures 4A-4C (SEQ ID NO: 5) 7A-7 (without leader)
A polypeptide of C (SEQ ID NO: 8); the extracellular, transmembrane, and intracellular domains of the TR2 receptor set forth in SEQ ID NO: 26 or in FIGS. 1A-1B (SEQ ID NO: 2); A polypeptide that is at least 80% identical, more preferably at least 85%, 90%, 92%, or 95% identical, and even more preferably at least 96%, 97%, 98%, or 99% identical. And also at least 30 amino acids, and more preferably at least 5 amino acids
Portions of such polypeptides having zero amino acids are also included.

[0102] At least, for example, 95% relative to a reference amino acid sequence of a TR2 polypeptide.
By the polypeptide having an "identical" amino acid sequence, the amino acids of the polypeptide are modified except that the polypeptide sequence can include up to 5 amino acid changes per 100 amino acids of the TR2 receptor reference amino acid sequence. It is intended that the sequence is identical to this reference sequence. In other words,
To obtain a polynucleotide having an amino acid sequence that is at least 95% identical to the reference amino acid sequence, up to 5% of the amino acid residues of the reference sequence can be deleted or replaced with another nucleotide, or 5% of total amino acid residues
Up to as many amino acids as can be inserted into this reference sequence. These changes in the reference sequence may occur at amino- or carboxy-terminal positions of the reference amino acid sequence, or anywhere between these terminal positions, individually within the residues within the reference sequence, or within the reference sequence. It can occur dispersedly in any of one or more consecutive groups.

As a practical matter, any particular polypeptide may be, for example, SEQ ID NO: 26, FIG.
A-1B (SEQ ID NO: 2), FIGS. 4A-4C (SEQ ID NO: 5), or FIGS. 7A-7C (
At least 80%, 85%, relative to the amino acid sequence set forth in SEQ ID NO: 8) or the amino acid sequence encoded by one of the deposited cDNAs.
The 90%, 92%, 95%, 96%, 97%, 98% or 99% identity is determined by the Bestfit program (Wisconsin Sequence A).
analysis Package, Version 8 for Unix (registered trademark), Genetics Computer Group, Univers.
ity Research Park, 575 Science Drive, M
adison, WI 53711), and can be determined routinely using known computer programs. If, for example, Bestfit or any other sequence alignment program is used to determine whether a particular sequence is 95% identical to a reference sequence according to the invention, the parameter will, of course, be the percent identity. Is calculated over the entire length of the reference amino acid sequence and set such that a homology gap of up to 5% of the total number of amino acid residues in the reference sequence is tolerated.

In certain embodiments, the identity (also called an overall sequence alignment) between a reference (query) sequence (sequence of the invention) and a subject sequence is determined by Brutlag et al.
omp. App. Biosci. 6: 237-245 (1990)). F
Preferred parameters used in the ASTDB amino acid sequence alignment are:
rix = PAM 0, k-tuple = 2, Mismatch Penalty
= 1, Joining Penalty = 20, Randomization
Group Length = 0, Cutoff Score = 1, Window
Size = array length, Gap Penalty = 5, Gap Size Pen
alty = 0.05, Window Size = 500, or the length of the amino acid sequence of interest (whichever is shorter). According to this embodiment, the subject sequence is
Due to N- or C-terminal deletions (not due to internal deletions), if shorter than the query sequence, a manual correction is made to the result. This is FASTDB
This is because the program does not consider N-terminal and C-terminal truncations of the subject sequence when calculating the overall percent identity. For subject sequences truncated at the N-terminus and C-terminus, for the query sequence, the percent identity is the N-terminus of the subject sequence that does not match / align with the corresponding subject residue as a percentage of the total bases of the query sequence. And by calculating the number of residues in the query sequence that are C-terminal. The determination of whether residues are matched / aligned is determined by FAST
Determined by the result of DB array alignment. This percentage is then subtracted from the percent identity and calculated by the FASTDB program described above using the specified parameters to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only the N- and C-terminal residues of the subject sequence that are not matched / aligned with the query sequence are considered for the purpose of manually adjusting the percent identity score. That is, only query residue positions located outside the farthest N- and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence, and thus the FASTDB alignment does not show a match / alignment of the first 10 residues at the N-terminus. 10 unpaired residues represent 10% of the sequence (number of unmatched N- and C-terminal residues / total number of residues in query sequence)
10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues match exactly, the final percent identity is 90%. In another example, a 90 residue subject sequence is compared to a 100 residue query sequence. In this case, the deletion is an internal deletion, so there are no N- or C-terminal residues of the subject sequence that do not match / align with the query sequence. In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only the residue positions outside the N- and C-termini of the subject sequence that do not match / align with the query sequence, as indicated in the FASTDB alignment, are manually corrected. No other manual corrections are made for the purposes of this embodiment.

It is understood that some amino acid sequences of the TR2 receptor can be altered without significantly affecting the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there are important regions in the protein that determine activity. Accordingly, the present invention further provides substantially TR
Variants of the TR2 receptor exhibiting two-receptor activity, or variants of the TR2 receptor that include a region of the TR2 protein (eg, the protein portion discussed below). Such variants include deletions, insertions, inversions, repeats, and type substitutions. Guidance on which amino acid changes appear to be phenotypically silent can be found in Bowie, J. et al.
U. "Deciphering the Message in Prote
in Sequences: Tolerance to Amino Acid
Substitutions ", Science 247: 1306-131.
0 (1990).

Accordingly, fragments, derivatives or analogs of SEQ ID NO: 26, FIGS. 1A-1B (SEQ ID NO: 2), FIGS. 4A-4C (SEQ ID NO: 5), or FIGS. 7A-7C (SEQ ID NO: 8), or deposited The fragment, derivative or analog encoded by the cDNA may be: (i) one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues). And such substituted amino acid residues may or may not be those encoded by the genetic code, or (ii) one or more amino acid residues Or (iii) the mature polypeptide is a compound that increases the half-life of another polypeptide (eg, a polyethylene Glycol)), or (iv) additional amino acids for purification of the mature polypeptide (eg, an IgG Fc fusion region peptide, or a leader or secretory sequence, or a mature polypeptide or proprotein sequence). Sequence used for). Such fragments, derivatives and analogs are deemed to be within the skill of the art in light of the teachings herein. Polynucleotides encoding these fragments, derivatives, or analogs are also encompassed by the present invention.

[0107] Of particular interest are the substitution of charged amino acids with another charged amino acid and a neutral or negatively charged amino acid. The latter results in polypeptides with reduced positive charge, improving the properties of the TR2 protein. Prevention of agglomeration is highly desirable. Aggregation of proteins not only results in loss of activity, but can also be problematic in preparing pharmaceutical formulations (because they can be immunogenic) (P
inckard et al., Clin. Exp. Immunol. 2: 331-340 (
1967); Robbins et al., Diabetes 36: 838-845 (1
987); Cleland et al., Crit. Rev .. Therapeutic D
rug Carrier Systems 10: 307-377 (1993)
).

Amino acid substitutions may also alter the selectivity of binding to cell surface receptors. Ostade et al., Nature 361: 266-268 (1993).
Describe certain variants that result in the selective binding of TNF-α to only one of the two known types of TNF receptors. Thus, the TR2 receptors of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or man-made manipulations.

As indicated, the change is preferably a change in an insignificant property, such as a conservative amino acid substitution that does not significantly affect the folding or activity of the protein (see Table I).

[0110]

[Table 1] Amino acids in the TR2 protein of the present invention that are essential for function can be determined by methods known in the art (eg, site-directed mutagenesis or alanine scanning mutagenesis (C
unningham and Wells, Science 244: 1081-1.
085 (1989))). The latter procedure introduces one alanine mutation at each residue in the molecule. The resulting mutant molecules are then tested for biological activity, such as in vitro receptor binding and in vitro proliferative activity. Sites important for ligand-receptor binding can also be determined by structural analysis (eg, crystallization, nuclear magnetic resonance or photoaffinity labeling) (Sm
ith et al. Mol. Biol. 224: 899-904 (1992) and de Vos et al., Science 255: 306-312 (1992)).

[0111] The polypeptides of the present invention are preferably provided in an isolated form. By "isolated polypeptide" is intended a polypeptide that has been removed from its native environment. Thus, a polypeptide produced by and contained in a recombinant host cell is considered "isolated" for the purposes of the present invention. Also, contemplated as an "isolated polypeptide" are polypeptides that have been partially or substantially purified from a recombinant host. For example, recombinantly produced versions of the TR2 receptor are described in Smith and Johnson, G.
ene 67: 31-40 (1988).

The polypeptides of the present invention can be used as sources for producing antibodies that bind to the polypeptides of the present invention and on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those skilled in the art. It has uses, including but not limited to use as molecular weight markers.

[0113] The TR2 polypeptides of the present invention may also inhibit mixed lymphocyte reactions (MLRs). As discussed in Example 6 below, TR2 polypeptides are ternary (th
(tree-way) Inhibits MLR. Additional methods for performing three-way MLR are described in Harrop et al., Jour. Immunol. 161: 1786-179
4 (1998), which is incorporated herein by reference.

The present application also provides herein for n ¹ -m ¹ , n ² -m ² , n ³ -m ³ , n ⁴ -m ⁴ ,
And / or n ⁵ -m ⁵ at least 80% enumerated TR2 receptor polypeptide sequence as, 85%, 90%, 92%, 95%, 96%, 97%, 98%
Or a protein comprising a polypeptide that is 99% identical. In a preferred embodiment, the present application relates to a polypeptide having at least 80%, 85%, 90%, 92%, 92% 95%, 96%, 97%, 98% or 99
% Identical to a protein comprising the polypeptide. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

[0115] In certain preferred embodiments, the TR2 receptor protein of the present invention comprises:
Contains or consists of the above fusion proteins. Here, the TR2 receptor polypeptide is herein described as ^{n 1 -m 1, n 2 -m} 2, n 3 -m 3, n 4 -m 4, and / or n ⁵ -m ⁵ Polypeptide. In a preferred embodiment, the present application provides at least 80%, 85%, 90%, 90%, 80%, 90%, 92%, 95%,
A nucleic acid molecule that is 96%, 97%, 98% or 99% identical. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

As mentioned above, even though the deletion of one or more amino acids from the N-terminus of a protein results in an alteration in the loss of one or more biological functions of the protein, other functional activities still remain. Can be retained. Thus, the ability of a truncated TR2 mutein to induce and / or bind an antibody that recognizes the complete or mature form of the polypeptide generally has fewer residues than most of the complete or mature polypeptide. When removed from the N-terminus, it is retained. Whether a particular polypeptide lacking the N-terminal residue of an intact polypeptide will retain such immunological activity
It can be readily determined by the conventional methods described herein and other conventional methods known in the art. It is likely that TR2 muteins with a number of deleted N-terminal amino acid residues may retain some biological or immunological activity. In fact, peptides composed of as few as 6 TR2 amino acid residues can often elicit an immune response.

Thus, the present invention further provides a poly-polypeptide that deletes one or more residues from the amino terminus to the glycine residue at position 278 of the TR2 amino acid sequence shown in FIGS. 1A-1B (ie, SEQ ID NO: 2). Provided are peptides, and polynucleotides encoding such polypeptides. In particular, the present invention provides a polypeptide comprising or consisting of the amino acid sequence of residues n ^{1 to} 283 of FIGS. 1A-1B (SEQ ID NO: 2), wherein n ¹ is It is an integer in the range of 2-278.
Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

More particularly, the present invention provides a polynucleotide encoding a polypeptide comprising or consisting of the following amino acids of the TR2 sequence shown in FIGS. 1A-1B:

[0119]

(Equation 1) The invention also provides a polynucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to a polynucleotide sequence encoding the above-described polypeptide. Or a nucleic acid molecule comprising or consisting of such a polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

Also, as described above, deletion of one or more amino acids from the C-terminus of a protein
Although altering the loss of one or more biological functions of the protein, other biological activities may still be retained. Thus, the ability of a shortened TR2 mutein to induce and / or bind an antibody that recognizes the intact or mature form of the polypeptide is generally less than most of the intact or mature polypeptide. Retained when a residue is removed from the C-terminus. Whether a particular polypeptide lacking the C-terminal residue of the intact polypeptide retains such immunological activity will depend on conventional methods described herein and other methods known in the art. Can be easily determined by the conventional method. T with many of the C-terminal amino acid residues deleted
It is likely that the R2 mutein may retain some biological or immunological activity. In fact, peptides composed of as few as 6 TR2 amino acid residues can often elicit an immune response.

Thus, the present invention further provides for the deletion of one or more residues from the acarboxy terminus to the aspartic acid residue at position 6 of the amino acid sequence of the TR2 polypeptide shown in FIGS. 1A-1B (SEQ ID NO: 2). Polypeptides that are lost and polynucleotides that encode such polypeptides are provided. In particular, the invention concerns an. 1A-1B (i.e., SEQ ID NO: 2) or containing residues 1-m ¹ of the amino acid sequence of, or providing now becomes polypeptide. Here, m ¹ is an integer in the range of 6 to 282.
Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to a polynucleotide encoding a polypeptide comprising or consisting of the amino acid sequence of the following residues of the sequence of the TR2 sequence shown in FIGS. 1A-1B: provide:

[0123]

(Equation 2) The invention also provides a polynucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to a polynucleotide sequence encoding the above-described polypeptide. Or a nucleic acid molecule comprising or consisting of such a polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

[0124] The invention also provides polypeptides that have one or more amino acids deleted from both the amino and carboxy termini of a TR2 polypeptide. This can be generally described as having residues n ^{1 to} m ¹ of FIGS. 1A-1B (ie, SEQ ID NO: 2), where n ¹ and m ¹ are integers as described above. Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

Also, as described above, deletion of one or more amino acids from the N-terminus of the protein
Even though this results in an alteration in the loss of one or more biological activities of the protein, other biological activities may still be retained. Thus, truncated TR2-SV1 muteins induce antibodies that recognize the complete or mature form of this polypeptide and / or
Or the ability to bind is generally retained when less than most of the residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lacking the N-terminal residue of the intact polypeptide retains such immunological activity will depend on conventional methods described herein and other methods known in the art. Can be easily determined by the conventional method. It appears that TR2-SV1 muteins with multiple N-terminal amino acid residue deletions may retain some biological or immunological activity. In fact, peptides composed of as few as 6 TR2-SV1 amino acid residues can often elicit an immune response.

Accordingly, the present invention further provides a method for increasing one or more residues from the amino terminus of the TR2-SV1 amino acid sequence to the threonine residue at position 180 as shown in FIGS. Provided are polypeptides that delete one or more residues, and polynucleotides that encode such polypeptides. In particular, the invention comprises residues n ² -185 of the amino acid sequence of FIGS.
Or providing a polypeptide consisting, where, n ² is an integer ranging from 2 to 180, 180, fully TR2 which are believed to be at least necessary TR2-SV1 polypeptide of immunogenic activity -Position of the first residue from the N-terminus of the SV1 polypeptide. Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to a polynucleotide comprising the amino acid sequence of the following residues of the TR2-SV1 sequence shown in FIGS. I will provide a:

[0128]

(Equation 3) . The invention also relates to polynucleotide sequences that are at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the polynucleotide sequences encoding the above-described polypeptides. A nucleic acid molecule comprising or consisting of such a polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

Also, as described above, deletion of one or more amino acids from the C-terminus of a protein
Although altering the loss of one or more biological activities of the protein, other functional activities may still be retained. Thus, the shortened TR2-SV1 mutein induces antibodies that recognize the intact or mature form of this polypeptide and / or
Or the ability to bind is generally retained when less than most residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking the C-terminal residue of the intact polypeptide retains such immunological activity will depend on conventional methods described herein and other methods known in the art. Can be easily determined by the conventional method. It appears that TR2-SV1 muteins with multiple C-terminal amino acid residue deletions may retain some biological or immunological activity. In fact, peptides composed of as few as 6 TR2-SV1 amino acid residues can often elicit an immune response.

Accordingly, the present invention further provides the TR2-S shown in FIGS.
Provided are polypeptides that delete one or more residues from the carboxy terminus to the aspartic acid residue at position 6 of the amino acid sequence of a V1 polypeptide, and polynucleotides encoding such polypeptides. Specifically, the present invention relates to FIGS.
(I.e., SEQ ID NO: 5) or comprising the amino acid sequence of residues 1 to m ^2, or to provide a polypeptide consisting of such amino acid sequences, wherein, m ² is 6-18
It is an integer in the range of 4. Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to a polypeptide encoding the polypeptide comprising or consisting of the amino acid sequence of the following residues of the sequence of TR2-SV1 shown in FIGS. 4A-4C: Provide nucleotides:

[0132]

(Equation 4) . The invention also relates to polynucleotide sequences that are at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the polynucleotide sequences encoding the above-described polypeptides. A nucleic acid molecule comprising or consisting of such a polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

The present invention also provides polypeptides having one or more amino acid deletions from both the amino and carboxy termini of a TR2-SV1 polypeptide, wherein
In general, FIG. 4A-4C (i.e., SEQ ID NO: 5) have a residue n ² ~m ² of, where n ² and m ² may be described as an integer as described above. Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

As mentioned above, even though the deletion of one or more amino acids from the N-terminus of a protein alters the loss of one or more biological activities of the protein, other biological activities Can still be retained. Accordingly, the ability of a truncated TR2-SV2 mutein to induce and / or bind an antibody that recognizes the full or mature form of the polypeptide generally will be less than the majority of the full or mature polypeptide. Retained when the group is removed from the N-terminus. Whether a particular polypeptide lacking the N-terminal residue of the intact polypeptide retains such immunological activity will depend on conventional methods described herein and other methods known in the art. Can be easily determined by the conventional method. TR2-SV2 muteins with multiple N-terminal amino acid residue deletions appear to be able to retain some biological or immunological activity. In fact, peptides composed of as few as 6 TR2-SV2 amino acid residues can often elicit an immune response.

Accordingly, the present invention further provides one or more residues from the amino terminus of the amino acid sequence of TR2-SV2 shown in FIGS. 7A-7C (ie, SEQ ID NO: 8) to the serine residue at position 131. Polypeptides that are deleted and polynucleotides that encode such polypeptides are provided. In particular, the present invention, FIG. 7A-7C (i.e., SEQ ID NO: 8) or comprises residues n ³ -136 of the amino acid sequence of, or provides now becomes polypeptide, wherein, n ³ is 2 It is an integer in the range of ~ 131. Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to a polynucleotide encoding a polypeptide comprising or consisting of an amino acid sequence of the following residues of the TR2-SV2 sequence shown in FIGS. 7A-7C: I will provide a:

[0137]

(Equation 5) . The invention also relates to polynucleotide sequences that are at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the polynucleotide sequences encoding the above-described polypeptides. A nucleic acid molecule comprising or consisting of such a polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

Also, as described above, deletion of one or more amino acids from the C-terminus of a protein
Although altering the loss of one or more biological functions of the protein, other biological activities may still be retained. Thus, truncated TR2-SV2 muteins induce antibodies that recognize the complete or mature form of this polypeptide and / or
Or the ability to bind is generally retained when less than most residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking the C-terminal residue of the intact polypeptide retains such immunological activity will depend on conventional methods described herein and other methods known in the art. Can be easily determined by the conventional method. It appears that TR2-SV2 muteins with deletions of multiple C-terminal amino acid residues may retain some biological or immunological activity. In fact, peptides composed of as few as 6 TR2-SV2 amino acid residues can often elicit an immune response.

Thus, the present invention further provides one or more residues from the carboxy terminus to the glycine residue at position 6 of the amino acid sequence of the TR2-SV2 polypeptide shown in FIGS. And polynucleotides encoding such polypeptides are provided. In particular, the present invention relates to FIG.
～7C (i.e., SEQ ID NO: 8) providing a polypeptide comprising the amino acid sequence of residues 1 to m ³ of wherein, m ³ is an integer in the range of 6-135. Polynucleotides encoded by these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to a polypeptide comprising the amino acid sequence of the following residues of the sequence of the TR2-SV2 sequence shown in FIGS. Providing nucleotides: M-1 to S-135;
M-1 to P-134; M-1 to R-133; M-1 to T-132; M-1 to S-
131; M-1 to V-130; M-1 to N-129; M-1 to R-128;
M-1 to P-126; M-1 to G-125; M-1 to M-12
4; M-1 to P-123; M-1 to L-122; M-1 to S-121;
P-120; M-1 to G-119; M-1 to R-118; M-1 to P-117;
M-1 to C-116; M-1 to N-115; M-1 to Q-114; M-1 to C-
113; M-1 to L-112; M-1 to T-111; M-1 to D-110;
M-1 to S-108; M-1 to E-107; M-1 to T-10
6; M-1 to G-105; M-1 to G-104; M-1 to K-103;
Q-102; M-1 to V-101; M-1 to R-100; M-1 to Q-99; M
M-1 to P-97; M-1 to S-96; M-1 to S-95, M
M-1 to A-93; M-1 to Y-92; M-1 to A-91; M
-1 to R-90; M-1 to C-89; M-1 to A-88; M-1 to A-87; M
M-1 to H-85; M-1 to D-84; M-1 to G-83; M
M-1 to Q-81; M-1 to V-80; M-1 to I-79; M
M-1 to F-77; M-1 to H-76; M-1 to G-75; M
M-1 to S-73; M-1 to C-72; M-1 to G-71; M
M-1 to V-69; M-1 to A-68; M-1 to N-67; M
M-1 to T-65; M-1 to R-64; M-1 to S-63; M
M-1 to N-61; M-1 to R-60; M-1 to S-59; M
-1 to A-58; M-1 to R-57; M-1 to L-56; M-1 to G-55; M
M-1 to A-53; M-1 to P-52; M-1 to T-51; M
M-1 to S-49; M-1 to S-48; M-1 to P-47; M
M-1 to L-45; M-1 to P-44; M-1 to P-43; M
M-1 to H-41; M-1 to L-40; M-1 to G-39; M
M-1 to C-37; M-1 to W-36; M-1 to G-35; M
M-1 to A-33; M-1 to L-32; M-1 to V-31; M
-1 to A-30; M-1 to D-29; M-1 to V-28; M-1 to P-27; M
-1 to W-26; M-1 to P-25; M-1 to S-24; M-1 to S-23; M
-1 to G-22; M-1 to P-21; M-1 to R-20; M-1 to G-19; M
-1 to A-18; M-1 to L-17; M-1 to S-16; M-1 to F-15; M
-1 to G-14; M-1 to Q-13; M-1 to S-12; M-1 to L-11; M
M-1 to V-9; M-1 to L-8; M-1 to H-7; and M
-1 to G-6. The present invention also provides at least 80%, 85%, 90%, 92%, 95%, 96%,
A nucleic acid molecule comprising or consisting of a polynucleotide sequence that is 97%, 98% or 99% identical. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

The present invention also provides polypeptides in which one or more amino acids have been deleted from both the amino and the carboxyl terminus of a TR2-SV2 polypeptide, which generally includes the polypeptides of FIGS. It can be described as having residues n ³ ~m ³ of 8), where, n ³ and m ³ are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

In addition, the present invention further provides that one or more residues from the amino terminus of the putative extracellular domain of the TR2 amino acid sequence up to the glycine residue at position 159 shown in SEQ ID NO: 2 (FIGS. 1A-1B). Provided are deleted polypeptides and polynucleotides encoding such polypeptides. In particular, the present invention provides or polypeptide consisting of an amino acid sequence comprising the amino acid sequence of residues n ⁴ to 164 of SEQ ID NO: 2, wherein, n ⁴ is in the range of 1 to 159 Is an integer. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

More specifically, the invention relates to SEQ ID NO: 2, wherein the amino acid residues in FIGS. 1A-1B are numbered consecutively from 1-28 to N-terminal to C-terminal. 1A-1 except that amino acid residues in SEQ ID NO: 2 are numbered consecutively from -36 to 247, reflecting the position of the putative signal peptide.
B) comprising the following amino acid sequence of the TR2 amino acid sequence shown in SEQ ID NO: B or encoding a polypeptide consisting of these amino acid sequences: P-1 To H-164; A-2 to H
-164; L-3 to H-164; P-4 to H-164; S-5 to H-164; C
-6 to H-164; K-7 to H-164; E-8 to H-164; D-9 to H-1.
E-10 to H-164; Y-11 to H-164; P-12 to H-164;
V-13 to H-164; G-14 to H-164; S-15 to H-164; E-1
6 to H-164; C-17 to H-164; C-18 to H-164; P-19 to H
-164; K-20 to H-164; C-21 to H-164; S-22 to H-16
4; P-23 to H-164; G-24 to H-164; Y-25 to H-164; R
-26 to H-164; V-27 to H-164; K-28 to H-164; E-29
~ H-164; A-30 ~ H-164; C-31 ~ H-164; G-32 ~ H-
164; E-33 to H-164; L-34 to H-164; T-35 to H-164
G-36 to H-164; T-37 to H-164; V-38 to H-164;
39 to H-164; E-40 to H-164; P-41 to H-164;
H-164; P-43 to H-164; P-44 to H-164; G-45 to H-1
64; T-46 to H-164; Y-47 to H-164; I-48 to H-164;
A-49 to H-164; H-50 to H-164; L-51 to H-164; N-5
2-H-164; G-53 to H-164; L-54 to H-164; S-55 to H
-164; K-56 to H-164; C-57 to H-164; L-58 to H-16
4; Q-59 to H-164; C-60 to H-164; Q-61 to H-164; M
-62 to H-164; C-63 to H-164; D-64 to H-164; P-65
A-66 to H-164; M-67 to H-164; G-68 to H-.
164; L-69 to H-164; R-70 to H-164; A-71 to H-164
S-72 to H-164; R-73 to H-164; N-74 to H-164;
75 to H-164; S-76 to H-164; R-77 to H-164;
H-164; E-79 to H-164; N-80 to H-164; A-81 to H-1.
64; V-82 to H-164; C-83 to H-164; G-84 to H-164;
C-85 to H-164; S-86 to H-164; P-87 to H-164; G-8
8-H-164; H-89-H-164; F-90-H-164; C-91-H
-164; I-92 to H-164; V-93 to H-164; Q-94 to H-16
4; D-95 to H-164; G-96 to H-164; D-97 to H-164; H
-98 to H-164; C-99 to H-164; A-100 to H-164; A-1
01 to H-164; C-102 to H-164; R-103 to H-164; A-1
04-H-164; Y-105-H-164; A-106-H-164; T-1
07 to H-164; S-108 to H-164; S-109 to H-164; P-1
G-111 to H-164; Q-112 to H-164; R-1
13-H-164; V-114 to H-164; Q-115 to H-164; K-1
G-117-H-164; G-118-H-164; T-1
19 to H-164; E-120 to H-164; S-121 to H-164; Q-1
22-H-164; D-123-H-164; T-124-H-164; L-1
25-H-164; C-126-H-164; Q-127-H-164; N-1
28 to H-164; C-129 to H-164; P-130 to H-164; P-1
31 to H-164; G-132 to H-164; T-133 to H-164; F-1
34-H-164; S-135-H-164; P-136-H-164; N-1
37-H-164; G-138-H-164; T-139-H-164; L-1
E-141 to H-164; E-142 to H-164; C-1
43-H-164; Q-144 to H-164; H-145 to H-164; Q-1
46 to H-164; T-147 to H-164; K-148 to H-164; C-1
49 to H-164; S-150 to H-164; W-151 to H-164; L-1
52 to H-164; V-153 to H-164; T-154 to H-164; K-1
55-H-164; A-156 to H-164; G-157 to H-164; A-1
58-H-164; and G-159-H-164. The present invention also relates to a polynucleotide sequence encoding at least 80%, 85%
, 90%, 92%, 95%, 96%, 97%, 98% or 99% of nucleic acid molecules comprising or consisting of a polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

The present invention further provides one or more carboxy termini from the putative extracellular domain of the amino acid sequence of TR2 shown in SEQ ID NO: 2 (FIGS. 1A-1B) up to the cysteine residue at position 6 in SEQ ID NO: 2. Provided are polypeptides having deleted residues, and polynucleotides encoding such polypeptides. In particular, the present invention is SEQ ID NO: 2 provides or polypeptide consisting of an amino acid sequence comprising the amino acid sequence of residues 1 to m ⁴ (FIG. 1A-1B), wherein, m ⁴ is 6-164
Is an integer in the range Polynucleotides encoding these polypeptides are also encompassed by the present invention.

More specifically, the present invention provides SEQ ID NO: 2 (where the amino acid residues in FIGS. 1A-1B are numbered consecutively from 1-28 to N-terminal to N-terminal, The amino acid residue in No. 2 is -36 reflecting the position of the putative signal peptide.
Identical to the sequence shown in FIGS. 1A-1B, except that they are numbered consecutively from 〜 to 247). Provided are polynucleotides encoding a polypeptide consisting of these amino acid sequences: P-1 to H-164; P-1 to S-163;
1 to S-162; P-1 to S-161; P-1 to T-160; P-1 to G-15
9; P-1 to A-158; P-1 to G-157; P-1 to A-156;
K-155; P-1 to T-154; P-1 to V-153; P-1 to L-152;
P-1 to W-151; P-1 to S-150; P-1 to C-149; P-1 to K-
148; P-1 to T-147; P-1 to Q-146; P-1 to H-145;
P-1 to C-143; P-1 to E-142; P-1 to E-14
1; P-1 to L-140; P-1 to T-139; P-1 to G-138;
N-137; P-1 to P-136; P-1 to S-135; P-1 to F-134;
P-1 to T-133; P-1 to G-132; P-1 to P-131; P-1 to P-
130; P-1 to C-129; P-1 to N-128; P-1 to Q-127;
P-1 to L-125; P-1 to T-124; P-1 to D-12
3; P-1 to Q-122; P-1 to S-121; P-1 to E-120;
T-119; P-1 to G-118; P-1 to G-117; P-1 to K-116;
P-1 to Q-115; P-1 to V-114; P-1 to R-113; P-1 to Q-
112; P-1 to G-111; P-1 to Q-115; P-1 to P-110;
1 to S-109; P-1 to S-108; P-1 to T-107; P-1 to A-10
6; P-1 to Y-105; P-1 to A-104; P-1 to R-103;
C-102; P-1 to A-101; P-1 to A-100; P-1 to C-99; P
P-1 to D-97; P-1 to G-96; P-1 to D-95; P
P-1 to V-93; P-1 to I-92; P-1 to C-91; P
P-1 to H-89; P-1 to G-88; P-1 to P-87; P
P-1 to C-85; P-1 to G-84; P-1 to C-83; P
P-1 to A-81; P-1 to N-80; P-1 to E-79; P
P-1 to R-77; P-1 to S-76; P-1 to C-75; P
P-1 to R-73; P-1 to S-72; P-1 to A-71; P
P-1 to L-69; P-1 to G-68; P-1 to M-67; P
P-1 to P-65; P-1 to D-64; P-1 to C-63; P
-1 to M-62; P-1 to Q-61; P-1 to C-60; P-1 to Q-59; P
P-1 to C-57; P-1 to K-56; P-1 to S-55; P
P-1 to G-53; P-1 to N-52; P-1 to L-51; P
P-1 to A-49; P-1 to I-48; P-1 to Y-47; P
P-1 to G-45; P-1 to P-44; P-1 to P-43; P
-1 to C-42; P-1 to P-41; P-1 to E-40; P-1 to C-39; P
P-1 to T-37; P-1 to G-36; P-1 to T-35; P
P-1 to E-33; P-1 to G-32; P-1 to C-31; P
P-1 to E-29; P-1 to K-28; P-1 to V-27; P
-1 to R-26; P-1 to Y-25; P-1 to G-24; P-1 to P-23; P
-1 to S-22; P-1 to C-21; P-1 to K-20; P-1 to P-19;
P-1 to C-17; P-1 to C-17; P-1 to E-16; P-1 to S-15;
P-1 to V-13; P-1 to P-12; P-1 to Y-11; P
-1 to E-10; P-1 to D-9; P-1 to E-8; P-1 to K-7;
-1 to C-6. The present invention also provides at least 80%, 85%, 90%, 92%, 95%, 96%,
A nucleic acid molecule comprising or consisting of a polynucleotide sequence that is 97%, 98% or 99% identical. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

The present invention also provides one or more amino acids from both the amino and carboxyl termini of a soluble TR2 polypeptide, which may be generally described as having residues n ^{4 to} m ⁴ of SEQ ID NO: 2 (FIGS. 1A-1B). Provides a polypeptide wherein n ⁴ has been deleted.
And m ⁴ are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

Further, the present invention further provides one or more from the amino terminus of the putative extracellular domain of the TR2-SV1 amino acid sequence shown in SEQ ID NO: 5 (FIGS. 4A-4C) up to the threonine residue at position 144. Provided are polypeptides having deleted residues, as well as polynucleotides encoding such polypeptides. In particular, the present invention provides a polypeptide comprising or consisting of the amino acid sequence of residues n ^{5 to} 149 of SEQ ID NO: 5, wherein n ⁵ is in the range of 1 to 144 Is an integer. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to SEQ ID NO: 5, in which the amino acid residues in FIGS. 4A-4, except that the amino acid residues in SEQ ID NO: 5 are numbered consecutively from -36 to 149 reflecting the position of the putative signal peptide.
C) comprising the amino acid sequence of the following residues of the TR2-SV1 amino acid sequence shown in SEQ ID NO: 2 or encoding a polypeptide consisting of these amino acid sequences: -1 to A-149; A
-2 to A-149; L-3 to A-149; P-4 to A-149; S-5 to A-1
49; C-6 to A-149; K-7 to A-149; E-8 to A-149; D-9
E-10 to A-149; Y-11 to A-149; P-12 to A-.
149; V-13 to A-149; G-14 to A-149; S-15 to A-149.
E-16 to A-149; C-17 to A-149; C-18 to A-149;
19 to A-149; K-20 to A-149; C-21 to A-149; S-22.
A-149; P-23 to A-149; G-24 to A-149; Y-25 to A-1
49; R-26 to A-149; V-27 to A-149; K-28 to A-149;
E-29 to A-149; A-30 to A-149; C-31 to A-149; G-3
2-A-149; E-33 to A-149; L-34 to A-149; T-35 to A
-149; G-36 to A-149; T-37 to A-149; V-38 to A-14
9; C-39 to A-149; E-40 to A-149; P-41 to A-149; C
-42 to A-149; P-43 to A-149; P-44 to A-149; G-45
T-46 to A-149; Y-47 to A-149; I-48 to A-.
149; A-49 to A-149; H-50 to A-149; L-51 to A-149.
N-52 to A-149; G-53 to A-149; L-54 to A-149;
55-A-149; K-56-A-149; C-57-A-149; L-58-
A-149; Q-59 to A-149; C-60 to A-149; Q-61 to A-1
49; M-62 to A-149; C-63 to A-149; D-64 to A-149;
P-65 to A-149; D-66 to A-149; I-67 to A-149; G-6
8-A-149; S-69-A-149; P-70-A-149; C-71-A
-149; D-72 to A-149; L-73 to A-149; R-74 to A-14
9; G-75 to A-149; R-76 to A-149; G-77 to A-149; H
-78 to A-149; L-79 to A-149; E-80 to A-149; A-81
A-149; G-82 to A-149; A-83 to A-149; H-84 to A-.
149; L-85 to A-149; S-86 to A-149; P-87 to A-149.
G-88 to A-149; R-89 to A-149; Q-90 to A-149;
91 to A-149; G-92 to A-149; E-93 to A-149; P-94 to
A-149; D-95 to A-149; P-96 to A-149; E-97 to A-1
49; V-98 to A-149; A-99 to A-149: F-100 to A-149.
E-101 to A-149; S-102 to A-149; L-103 to A-149;
S-104 to A-149; A-105 to A-149; E-106 to A-149;
P-107 to A-149; V-108 to A-149; H-109 to A-149;
A-110 to A-149; A-111 to A-149: N-112 to A-149;
G-113 to A-149; S-114 to A-149: V-115 to A-149;
P-116 to A-149; L-117 to A-149; E-118 to A-149;
P-119 to A-149; H-120 to A-149; A-121 to A-149;
R-122 to A-149; L-123 to A-149; S-124 to A-149;
M-125 to A-149; A-126 to A-149; S-127 to A-149;
A-128 to A-149; P-129 to A-149; C-130 to A-149;
G-131 to A-149; Q-132 to A-149; A-133 to A-149;
G-134 to A-149; L-135 to A-149; H-136 to A-149;
L-137 to A-149; R-138 to A-149: D-139 to A-149;
: R-140 to A-149; A-141 to A-149; D-142 to A-149
G-143 to A-149; and T-144 to A-149; The present invention also provides at least 80% of the polynucleotide sequence encoding the above polypeptide.
, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% of the nucleic acid molecules comprising or consisting of the same polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

The present invention further relates to the carboxy terminus of the putative extracellular domain of the amino acid sequence of TR2-SV1 shown in SEQ ID NO: 5 (FIGS. 4A-4C) up to the cysteine residue at position 6 in SEQ ID NO: 5. Provided are polypeptides in which these residues have been deleted, and polynucleotides encoding such polypeptides. In particular, the present invention is SEQ ID NO: 5 provides or polypeptide consisting of the amino acid sequence comprising the amino acid sequence of 1-m ⁵ residues (Fig. 4A-4C), where, m ⁵ is 6 ~ 1
It is an integer in the range of 49. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

More specifically, the present invention relates to SEQ ID NO: 5, wherein the amino acid residues in FIGS. 4A-4C are numbered consecutively from N-terminal to C-terminal from 1-185. 4A-4, except that the amino acid residues in SEQ ID NO: 5 are numbered consecutively from -36 to 149 reflecting the position of the putative signal peptide.
C) which comprises an amino acid sequence of the following residues of the sequence of the TR2-SV1 sequence shown in SEQ ID NO: 1) or encodes a polypeptide consisting of these amino acid sequences: P-1 to A-149; P-
1 to R-148; P-1 to G-147; P-1 to G-146; P-1 to P-14
5; P-1 to T-144; P-1 to G-143; P-1 to D-142;
A-141; P-1 to R-140; P-1 to D-139; P-1 to R-138;
P-1 to L-137; P-1 to H-136; P-1 to L-135; P-1 to G-
134; P-1 to A-133; P-1 to Q-132; P-1 to G-131;
P-1 to P-129; P-1 to A-128; P-1 to S-12
7; P-1 to A-126; P-1 to M-125; P-1 to S-124;
L-123; P-1 to R-122; P-1 to A-121; P-1 to H-120;
P-1 to P-119; P-1 to E-118; P-1 to L-117; P-1 to P-
116; P-1 to V-115; P-1 to S-114; P-1 to G-113;
1 to N-112; P-1 to A-111; P-1 to A-110; P-1 to H-10
9; P-1 to V-108; P-1 to P-107; P-1 to E-106;
A-105; P-1 to S-104; P-1 to L-103; P-1 to S-102;
P-1 to E-101; P-1 to F-100; P-1 to A-99; P-1 to V-9
8; P-1 to E-97; P-1 to P-96; P-1 to D-95; P-1 to P-9
4; P-1 to E-93; P-1 to G-92; P-1 to K-91; P-1 to Q-9
0; P-1 to R-89; P-1 to G-88; P-1 to P-87; P-1 to S-8
6; P-1 to L-85; P-1 to H-84; P-1 to A-83; P-1 to G-8.
P-1 to A-81; P-1 to E-80; P-1 to L-79; P-1 to H-7
8; P-1 to G-77; P-1 to R-76; P-1 to G-75; P-1 to R-7
4; P-1 to L-73; P-1 to D-72; B-1 to C-71; P-1 to P-7
0; P-1 to S-69; P-1 to G-68; P-1 to I-67; P-1 to D-6
6; P-1 to P-65; P-1 to D-64; P-1 to C-63; P-1 to M-6
2; P-1 to Q-61; P-1 to C-60; P-1 to Q-59; P-1 to L-5
8; P-1 to C-57; P-1 to K-56; P-1 to S-55; P-1 to L-5
4; P-1 to G-53; P-1 to N-52; P-1 to L-51; P-1 to H-5
0; P-1 to A-49; P-1 to I-48; P-1 to Y-47; P-1 to T-4
6; P-1 to G-45; P-1 to P-44; P-1 to P-43; P-1 to C-4
2; P-1 to P-41; P-1 to E-40; P-1 to C-39; P-1 to V-3
8; P-1 to T-37; P-1 to G-36; P-1 to T-35; P-1 to L-3
4; P-1 to E-33; P-1 to G-32; P-1 to C-31; P-1 to A-3
0; P-1 to E-29; P-1 to K-28; P-1 to V-27; P-1 to R-2.
6; P-1 to Y-25; P-1 to G-24; P-1 to P-23; P-1 to S-2.
2; P-1 to C-21; P-1 to K-20; P-1 to P-19; P-1 to C-1
8; P-1 to C-17; P-1 to E-16; P-1 to S-15; P-1 to G-1
4; P-1 to V-13; P-1 to P-12; P-1 to Y-11; P-1 to E-1
0; P-1 to D-9; P-1 to E-8; P-1 to K-7; and P-1 to C-6.
. The present invention also relates to polynucleotide sequences encoding the above polypeptides of at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%.
% Or 99% identical polynucleotide sequence. The invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. The polypeptides encoded by these polynucleotide sequences are also encompassed by the present invention.

The present invention also provides a polypeptide having one or more amino acids deleted from both the amino and carboxyl termini of a soluble TR2-SV1 polypeptide, which generally comprises SEQ ID NO: 5 (FIGS. 4A-4C). Having the residues n ^{5 to} m ⁵ of
Here, n ⁵ and n ⁵ are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

In addition, one or more amino acid residues (eg, arginine and lysine residues) of a polypeptide of the invention may be deleted or substituted with another residue, eg,
Unwanted processing by proteases such as furin or kexin can be eliminated.

The present invention further provides a protein comprising a polypeptide sequence encoded by a polynucleotide of the present invention.

Among the particularly preferred fragments of the present invention are those that are characterized by the structural or functional properties of the TR2 receptors of the present invention. Such fragments include the complete (ie, full-length) TR2 receptor (SEQ ID NO: 2).
A) helix and α-helix forming region (“α region”), β-sheet and β sheet forming region (“β region”), turn and turn forming region (“turn region”), coil and coil forming region (“coil region”), hydrophilic region, hydrophobic region, α amphiphilic region, β Amphiphilic region, surface forming region and high antigenic index region (
That is, including 4 or more consecutive amino acids having an antigenic index of 1.5 or more)
. Certain preferred regions are those shown in FIG. 3 and include, but are not limited to, regions of the above type identified by analysis of the amino acid sequence shown in FIGS. 1A-1B (SEQ ID NO: 2). Particularly preferred regions include the following when estimated using the default parameters of these computer programs: Garnier-Robson estimated α, β, turn and coil regions; Chou-Fasman estimated α region, β Region, turn region and coil region; Kyte-Doolittle putative hydrophilic region and hydrophobic region; Eis
enberg α amphipathic region and β amphipathic region; Emini surface forming region;
And Jameson-Wolf high antigenic index region. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

In a further embodiment, a polynucleotide of the invention encodes a functional property of a TR2 receptor. Preferred embodiments of the present invention in this regard include fragments comprising or consisting of one, two, three, four or more of one or more of the following functional domains: the α-helix and α of the TR2 receptor.
Helix-forming region (“α region”), β-sheet and β-sheet forming region (“β region”), turn and turn-forming region (“turn region”), coil and coil-forming region (“coil region”), hydrophilic Region, hydrophobic region, alpha amphipathic region, beta amphipathic region, flexible region, surface forming region and high antigenic index region.

The data presenting the structural or functional properties of the TR2 receptor shown in FIGS. 3, 6 and 9 and Tables II, III and IX were analyzed using various identified modules and algorithms of the DNA ^* STAR set with default parameters. Was generated using. In a preferred embodiment, columns VIII, IX, X of Table II
Using the data presented in columns III and XIV, regions of the TR2 receptor that show a high degree of potential for antigenicity can be determined. By selecting values representing regions of the polypeptide that are likely to expose regions of high antigenicity to the surface of the polypeptide in an environment where antigen recognition can occur in the process of initiating the immune response, column VIII, column VIII Determined from the data shown in column IX, column XIII and / or column IV.

[0157] Certain preferred regions for these are shown in FIGS. 3, 6 and 9, which regions are shown in FIGS. 3, 6 and 9, respectively, as shown in Tables II, III and IV.
Can be presented or identified by using a tabular presentation of the data presented in. The data in FIGS. 3, 6 and 9 were presented in tabular form using the DNA ^* STAR computer algorithm used to generate FIGS. 3, 6 and 9 (set to the original default parameters). (Tables II and II, respectively)
See I and IV).

The above preferred regions shown in FIGS. 3, 6 and 9 and Tables II, III and IV include those of the above type identified by analysis of the amino acid sequence shown in FIGS. It is not limited to these. As shown in FIGS. 3, 6 and 9 and Tables II, III and IV, such preferred regions include: the Garnier-Robson α, β, turn and coil regions (Table II, Columns I, III, V and VII in Tables III and IV), Chou-Fasman α, β and turn regions (columns II, III and IV in Tables II, III and IV). Columns IV and VI), the hydrophilic region of Kyte-Doolittle (column VIII in Tables II, III and IV) and the hydrophobic region of Hopp-Woods (Table I).
I, columns IX in Tables III and IV), the α and β amphipathic regions of Eisenberg (columns X and XI in Tables II, III and IV), Karplus-Schulz Flexible area (Table II, Table II
I and Table IV, column XII), Jameson-Wolf high antigenic index region (column XIII in Table II, Table III and Table IV), and Em
ini surface-forming region (column XIV in Tables II, III and IV).

[0159]

[Table 2]

[0160]

[Table 3]

[0161]

[Table 4] Among highly preferred fragments in this regard are those that include or include regions of the TR2 receptor that combine certain structural features (eg, some of the features listed above). It is a fragment consisting of regions. Polynucleotides encoding these polypeptides are also encompassed by the present invention.

As those skilled in the art will appreciate, the TR2 polypeptides and epitope-bearing fragments thereof of the present invention can be combined with heterologous polypeptide sequences. For example, the polypeptides of the present invention may comprise immunoglobulin (IgA, IgE, IgG, IgM) constant domains or portions thereof (CH1, CH2, CH3, and any combination thereof, including both the entire domain and portions thereof). ) Can result in a chimeric polypeptide. These fusion proteins facilitate purification and exhibit an increased half-life.

The present invention further relates to an isolated polypeptide comprising or consisting of a fragment of TR2, TR2-SV1, and TR2-SV2. In particular, the invention relates to amino acids -36 to 24, -26 to 34, -16 to 44 of SEQ ID NO: 2.
, -6 to 54, 1 to 60, 11 to 70, 21 to 80, 31 to 90, 41 to 100
, 51-110, 61-120, 71-130, 81-140, 91-150,
101-160, 111-170, 121-180, 131-190, 141-
200, 151-210, 161-220, 171-230, 181-240,
Isolated polypeptides comprising or consisting of the amino acid sequence of a member selected from the group consisting of: and 191-247, as well as isolated polynucleotides encoding these polypeptides. The invention further relates to amino acids -36 to 24, -26 to 34, -16 to 44, -6 to 5 of SEQ ID NO: 5.
4, 1-60, 11-70, 21-80, 31-90, 41-100, 51-1
Comprising or consisting of an amino acid sequence of a member selected from the group consisting of 10, 61-120, 71-130, 81-140, and 91-149,
Provided are isolated polypeptides, as well as isolated polynucleotides that encode these polypeptides. The present invention also provides amino acids 1-6 of SEQ ID NO: 8.
0, 11-70, 21-80, 31-90, 41-100, 51-110, 61
Isolated polypeptides comprising or consisting of the amino acid sequence of a member selected from the group consisting of -120, 71-130 and 81-136, and isolated polypeptides encoding these polypeptides. A polynucleotide is provided.

The present invention also relates to an isolated polypeptide comprising or consisting of TR2, TR2-SV1, and TR2-SV2 domains. In particular, the present invention provides polypeptides comprising or consisting of the β2 sheet regions of TR2, TR2-SV1, and TR2-SV2, as shown in Tables II, III and IV. These polypeptides comprise about -19 to about 5 amino acid residues, about -18 to about -6 amino acid residues, about -2 to about 4 amino acid residues, about 25 amino acid residues of SEQ ID NO: 2.
From about 31 amino acid residues, from about 46 to about 51 amino acid residues, from about 57 to about 71 amino acid residues, from about 99 to about 104 amino acid residues, from about 151 to about 156 amino acid residues, from about 175 About 191 amino acid residues, about 174 to about 190 amino acid residues, about 197 to about 206 amino acid residues, about 197 to about 208 amino acid residues, about 215 to about 220 amino acid residues, about 228 About 238 amino acid residues, and about 229 to about 241 amino acid residues; about -19 to about 5 amino acid residues of SEQ ID NO: 5, about -18 to about 6 amino acid residues, about -2 to about 3, about 26 to about 31, about 34 to about 40, about 46 to about 50, about 57 to about 64, about 69 to about 74 amino acid residues, about 1
22 to about 128 amino acid residues, and about 132 to about 140 amino acid residues; and about 6 to about 13 amino acid residues, about 26 to about 33 amino acid residues, about 50 to about 58 of SEQ ID NO: 8. And a polypeptide comprising or consisting of an amino acid sequence of a member selected from the group consisting of from about 86 to about 93 amino acid residues. The present invention further provides isolated polynucleotides comprising or consisting of the nucleic acid molecules encoding the β-sheet region, as shown in Tables II, III and IV, and TR2, TR2-SV1, and TR2-SV
At least 80% identical to the nucleic acid molecule encoding the β-sheet region of the two proteins,
And more preferably at least 85%, 90%, 92%, 95%, 96%, 9
An isolated polypeptide comprising or consisting of an amino acid sequence that is 7%, 98% or 99% identical.

The TR2 receptor proteins of the invention can be monomeric or multimeric (ie, dimers, trimers, tetramers, and higher multimers). Accordingly, the present invention relates to monomers and multimers of the TR2 receptor proteins of the present invention, their preparation, and compositions (preferably pharmaceutical compositions) containing them. In certain embodiments, a polypeptide of the invention is a monomer, dimer, trimer, or tetramer. In a further embodiment, the multimer of the invention is at least a dimer, at least a trimer, or at least a tetramer.

The multimers encompassed by the present invention may be homomeric or heteromeric.
As used herein, the term homomer refers to a multimer that includes only the TR2 receptor protein of the present invention (as described herein, fragments, variants, and fusion proteins of the TR2 receptor). including). These homomers can include TR2 receptor proteins having the same or different polypeptide sequences. In certain embodiments, a homomer of the invention is a multimer that includes only a TR2 receptor protein having the same polypeptide sequence. In another specific embodiment, the homomers of the invention have T polypeptides having different polypeptide sequences.
It is a multimer containing the R2 receptor protein. In certain embodiments, the multimers of the invention are homodimers (eg, including TR2 receptor proteins having the same or different polypeptide sequences) or homotrimers (eg,
(Including TR2 receptor proteins having the same or different polypeptide sequences). In a further embodiment, a homomultimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.

As used herein, the term heteromer includes, in addition to the TR2 receptor proteins of the invention, heterologous proteins (ie, only polypeptide sequences that do not correspond to the polypeptide sequence encoded by the TR2 receptor gene). (A protein containing). In certain embodiments, a multimer of the invention is a heterodimer, heterotrimer, or heterotetramer. In a further embodiment, the heteromultimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.

The multimers of the present invention may be the result of hydrophobic, hydrophilic, ionic, and / or covalent bonds, and / or may be indirectly linked, for example, by liposome formation. Thus, in one embodiment, multimers of the invention, such as, for example, homodimers or homotrimers, are formed when the proteins of the invention come into contact with each other in solution. In another embodiment, a heteromultimer of the invention, eg, a heterotrimer or heterotetramer, is an antibody against a polypeptide of the invention (in a fusion protein of the invention) wherein the protein of the invention is in solution. (Including antibodies to heterologous polypeptide sequences). In other embodiments, the multimers of the invention are formed by covalent binding to and / or between the TR2 receptor proteins of the invention. Such a covalent bond can be a polypeptide sequence of a TR2 receptor protein (eg, a polypeptide sequence listed in SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8 or SEQ ID NO: 26, or ATCC Accession No. 97059, 97058, or 9705).
7 (polypeptide encoded by the cDNA contained in cDNA). In one example, a covalent bond is a bridge between cysteine residues located within the polypeptide sequence of a protein that interacts in a native (ie, naturally occurring) polypeptide. In another example, the covalent bond is the result of a chemical or recombinant operation. Alternatively, such a covalent bond is included in a heterologous polypeptide sequence in the TR2 receptor fusion protein.
It may include one or more amino acid residues. In one example, a covalent bond is between heterologous sequences contained in a fusion protein of the invention (eg, US Pat. No. 5,478,92).
No. 5). In certain instances, a covalent bond is between heterologous sequences contained in a TR2 receptor-Fc fusion protein of the invention (as described herein). In another specific example, the covalent attachment of a fusion protein of the invention is a heterologous polypeptide from another TNF family ligand / receptor member that can form a covalently attached multimer, such as, for example, osteoprotegerin. Between sequences (eg, International Publication No. WO 98/49305).
(See, this is incorporated by reference herein in its entirety). In another embodiment, two or more TR2 polypeptides of the present invention are linked through a synthetic linker (eg, a peptide, carbohydrate or soluble polymer linker). Examples include, but are not limited to, the peptide linkers described in US Pat. No. 5,073,627, which is incorporated herein by reference. Proteins comprising multiple TR2 polypeptides separated by a peptide linker can be produced using conventional recombinant DNA techniques.

Another method for preparing a multimeric TR2 polypeptide of the present invention involves the use of a TR2 polypeptide fused to a leucine zipper polypeptide sequence. Leucine zipper domains are polypeptides that promote multimerization of the protein in which they are found. Leucine zippers were originally identified in several DNA binding proteins (Landschulz et al., Science 240: 175).
9, (1988)). And since then it has been found in a variety of different proteins. Among the known leucine zippers are naturally occurring peptides and their derivatives that dimerize or trimerize. An example of a suitable leucine zipper domain for producing a soluble multimeric TR2 protein is described in PCT application WO 94/1.
Leucine zipper domain as described at 0308, incorporated herein by reference. A recombinant fusion protein comprising a soluble TR2 polypeptide fused to a peptide that dimerizes or trimers in solution is expressed in a suitable host cell, and the resulting soluble multimeric TR2 is expressed in the art. It is recovered from the culture supernatant using known techniques.

[0170] Certain members of the TNF family of proteins are believed to exist in trimeric form (Beutler and Huffel, Science 264).
: 667, 1994; Banner et al., Cell 73: 431, 1993).
Thus, trimeric TR2 may offer the advantage of enhanced biological activity. Preferred leucine zipper moieties are those that preferentially form trimers. One example is Hoppe et al. (FEBS Letters 344: 191, (1994)).
And pulmonary surfactant protein D (lung surf) as described in U.S. patent application Ser.
actin protein D) (SPD) -derived leucine zipper. Other peptides derived from naturally occurring trimeric proteins can be used in the preparation of trimeric TR2.

In another example, a protein of the invention is a Flag®-T of the invention.
It is bound by an interaction between the Flag® polypeptide sequences contained in the R2 protein or Flag®-TR2 fusion protein. In a further embodiment, a binding protein of the invention comprises a heterologous polypeptide sequence comprised in a Flag®-TR2 protein or a Flag®-TR2 fusion protein of the invention and an anti-Flag® antibody. Are coupled by the interaction between them.

[0172] Multimers of the invention can be produced using chemical techniques known in the art. For example, proteins desired to be included in the multimers of the present invention can be obtained using linker molecules and linker molecule length optimization techniques known in the art (eg, US Pat.
8,925, which is incorporated herein by reference in its entirety.
) Can be chemically crosslinked. Further, the multimer of the present invention is
It can be generated using techniques known in the art to form one or more intermolecular bridges between cysteine residues located within the polypeptide sequence of the protein desired to be included in the multimer ( See, for example, U.S. Patent No. 5,478,925, which is incorporated by reference herein in its entirety. In addition, the proteins of the present invention can be routinely modified by the addition of cysteine or biotin to the C-terminus or N-terminus of the protein's polypeptide sequence, and any technique known in the art can be used to modify one or more of these proteins. It can be applied to generate multimers containing the variant protein (see, eg, US Pat. No. 5,478,925, which is incorporated herein by reference in its entirety). In addition, techniques known in the art can be applied to generate liposomes containing the protein component desired to be included in the multimers of the present invention (see, for example, US Pat. No. 5,478,925 (which is hereby incorporated by reference)). Is incorporated herein by reference in its entirety).

[0173] Alternatively, the multimers of the present invention can be produced using genetic engineering techniques known in the art. In one embodiment, the proteins comprised in the multimers of the invention are recombinantly produced (e.g., using the fusion protein techniques described herein or other techniques known in the art) (e.g., U.S. Pat. No. 5,478,925 (
Which is incorporated herein by reference in its entirety).
. In certain embodiments, a polynucleotide encoding a homodimer of the invention comprises a polynucleotide sequence encoding a polypeptide of the invention linked to a sequence encoding a linker polypeptide, and then further comprising the native Produced by ligation to a synthetic polynucleotide encoding a translation product of the polypeptide in the opposite direction from the C-terminus to the N-terminus (lacking the leader sequence) (see, eg, US Pat. No. 5,478,925, which is incorporated herein by reference). , Incorporated herein by reference in its entirety)). In another embodiment, the recombinant techniques described herein or other techniques known in the art comprise a transmembrane domain,
And applied to produce recombinant polypeptides of the invention that can be incorporated into liposomes by membrane reconstitution techniques (see, eg, US Pat. No. 5,478,925).
No., which is incorporated herein by reference in its entirety).

The present invention relates to an epitope of a polypeptide having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8 or SEQ ID NO: 26, or ATCC Accession No. 9705
An epitope of the polypeptide sequence encoded by the polynucleotide sequence contained in the deposited cDNA identified as 9,97058 or 97057, or a stringent hybridization condition as defined herein, or more. Under low stringency hybridization conditions, the polynucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 or SEQ ID NO: 25, or ATCC accession number 97059, 97058 or 97
The polypeptide comprises or consists of an epitope of the polypeptide sequence encoded by the polynucleotide that hybridizes to the complement of the polynucleotide sequence contained in the deposited cDNA identified as 057.
The present invention further provides polynucleotide sequences encoding epitopes of the polypeptide sequences of the invention (eg, such as those disclosed in SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, or SEQ ID NO: 26), epitopes of the invention. And a polynucleotide that hybridizes to the complementary strand under stringent or lower stringency hybridization conditions as defined herein. Includes nucleotide sequence.

As used herein, the term “epitope” refers to a portion of a polypeptide that has antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. In a preferred embodiment, the invention includes a polypeptide comprising an epitope, as well as a polynucleotide encoding the polypeptide. As used herein, an “immunogenic epitope” is an antibody response in an animal, as measured by any method known in the art (eg, by the methods of making antibodies described below). (Eg, Geysen et al., Proc. Natl. Acad. Sci.
. ScL USA 81: 3998-4002 (1983)). As used herein, the term “antigenic epitope” refers to an antibody as determined by any method known in the art (eg, by the immunoassays described herein). It is defined as the part of the protein that can bind the antigen immunospecifically. Immunospecific binding eliminates non-specific binding, but need not necessarily eliminate cross-reactivity with other antigens. An antigenic epitope need not be immunogenic.

For the selection of peptides or polypeptides that carry an antigenic epitope (ie, include a region of a protein molecule to which an antibody can bind), a relatively short synthetic peptide that mimics a portion of the protein sequence may be partially It is well known in the art that antisera that react with mimetic proteins can be routinely induced. For example, Su
tcliffe, J.M. G. FIG. , Shinnick, T .; M. Green, N .; And Learner, R .; A. (1983) Antibodies that
react with predetermined sites on pr
oteins. Science 219: 660-666. Peptides that can elicit protein-reactive sera are often represented in the primary sequence of a protein, can be characterized by a series of simple chemical rules, and can be characterized by the immunodominant region (ie, immunogenicity) of the intact protein. Epitope), nor at the amino or carboxyl terminus.

Accordingly, the antigenic epitope-bearing peptides and polypeptides of the present invention are useful for raising antibodies (including monoclonal antibodies) that specifically bind to the polypeptides of the present invention. See, eg, Wilson et al., Cell 37: 767-7.
78 (1984) (777).

The antigenic epitopes of the present invention preferably have at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 15, at least 15, It comprises a sequence of 20, at least 25, and most preferably between about 15 and about 30 amino acids.
In this context, “about” refers to values specifically indicated, and some (5, 4, 3,
2, 2 or 1) include values greater or less than an amino acid. Preferred polypeptides comprising an immunogenic or antigenic epitope are at least 10
, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70
, 75, 80, 85, 90, 95, or 100 amino acid residues in length. Antigenic epitopes are useful, for example, for raising antibodies (including monoclonal antibodies) that specifically bind the epitope. Antigenic epitopes can be used as target molecules in immunoassays (eg, Wilson et al., Cell).
37: 767-778 (1984); Sutcliffe et al., Science.
219: 660-666 (1983)).

Non-limiting examples of antigenic polypeptides or peptides that can be used to generate TR2 receptor-specific antibodies include the following: about 39 to 39 of FIG.
A polypeptide comprising or consisting of about 70 amino acid residues (amino acid residues 3-34 of SEQ ID NO: 2); about 106 to about 120 amino acid residues of FIGS. 1A-1B (amino acid residues of SEQ ID NO: 2) A polypeptide comprising or consisting of groups 70-84); comprising or consisting of about 142 to about 189 amino acid residues (amino acid residues 106 to 153 of SEQ ID NO: 2) of FIGS. 1A-1B. A polypeptide;
1. About 276 to about 283 amino acid residues in FIG.
247) or about 39 of FIGS. 4A-4C.
A polypeptide comprising or consisting of about 70 amino acid residues (amino acid residues 3-34 of SEQ ID NO: 5); about 99 to about 136 amino acid residues of FIGS. 4A-4C (amino acids of SEQ ID NO: 5) Residues 63-100) or consists of
4A-4C amino acid residues (SEQ ID NO: 5)
A polypeptide comprising or consisting of about 56 to about 68 amino acid residues of FIGS. 7A-7C (SEQ ID NO: 8); and 7A to 7C (SEQ ID NO: 8).
A polypeptide comprising or consisting of about 136 amino acid residues. In this context, “about” refers to values specifically indicated, and some (5, 4, 3, 2,
1) Includes values larger or smaller than amino acids. As shown, we have determined that the above polypeptide fragment is an antigenic region of the TR2 receptor protein.

The epitope-bearing peptides and polypeptides of the present invention may be prepared by any conventional means (
Houghten, R .; A. (1985) General method fo
r the rapid solid-phase synthesis of
large numbers of peptides: specifici
ty of antigen-antibly interaction a
t the level of individual amino acid
s, Proc. Natl. Acad. Sci. USA 82: 5131-513
5). This “simultaneous multiple peptide synthesis (Simultane
ous Multiple Peptide Synthesis (SMPS)
The process is disclosed in U.S. Pat. No. 4,631,32 to Houghten et al. (1986).
No. 11 is further described.

Similarly, immunogenic epitopes can be used, for example, to elicit antibodies according to methods well known in the art (eg, Sutcliffe et al., Supra; Wil).
Son et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA
82: 910-914; and Bittle et al. Gen. Virol. 6
6: 2347-2354 (1985)). Preferred immunogenic epitopes include secreted proteins. A polypeptide comprising one or more immunogenic epitopes can be displayed to elicit an antibody response with a carrier protein (eg, albumin) to an animal system (eg, rabbit or mouse), or If the peptide is long enough (at least about 25 amino acids), the polypeptide can be presented without a carrier. However, immunogenic epitopes containing as few as 8 to 10 amino acids have been shown (eg, in western blotting) to be at least sufficient to elicit antibodies capable of binding linear epitopes on denatured polypeptides. ing.

The epitope-bearing polypeptides of the present invention can be used to elicit antibodies according to methods well known in the art. This method includes, but is not limited to, in vivo immunization, in vitro immunization, and phage display.
See, e.g., Sutcliffe et al., Supra; Wilson et al., Supra and Bittl.
e. Gen. Virol. , 66: 2347-2354 (1985). If in vivo immunization is used, animals can be immunized with the free peptide; however, anti-peptide antibody titers can be used to bind the peptide to a macromolecular carrier, such as keyhole limpet hemocyanin (KLH) or tetanus toxin. Can be boosted by For example, a peptide containing a cysteine residue can be attached to a carrier using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides have more common linking agents (eg, , Glutaraldehyde). animal(
For example, rabbits, rats, and mice) and / or an intraperitoneal injection of an emulsion containing, for example, about 100 μg of the peptide or carrier protein and Freund's adjuvant or any other adjuvant known to stimulate an immune response.
Alternatively, it is immunized with either free peptide or carrier-bound peptide by intradermal injection. Several booster injections are required, for example, at intervals of about two weeks to provide useful titers of anti-peptide antibodies that can be detected, for example, by an ELISA assay using free peptide adsorbed on the surface of the individual. Can be done. The titer of the anti-peptide antibody in the serum from the immunized animal is determined by the choice of the anti-peptide antibody (eg, by adsorption of the peptide to the surface of an individual and elution of the selected antibody according to methods well known in the art). Can be increased.

As will be appreciated by those of skill in the art, and as discussed above, polypeptides of the invention that include an immunogenic or antigenic epitope can be fused to other polypeptide sequences. For example, a polypeptide of the invention may comprise an immunoglobulin (Ig
A, IgE, IgG, IgM) or their constants (CH1, C
H2, CH3, or any combination thereof and portions thereof), resulting in a chimeric polypeptide. Such a fusion protein may facilitate purification and increase in vivo half-life. This is shown for a chimeric protein consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of a mammalian immunoglobulin. See, for example, EP 394,827; Traunecker et al., Nature,
331: 84-86 (1988). An IgG fusion protein having a disulfide bond dimer structure due to the disulfide bond of the IgG moiety also
It was found to be more effective at binding and neutralizing other molecules than the monomeric polypeptides or fragments thereof alone. For example, Foundou
Lakis et al. Biochem. , 270: 3958-3964 (1995).
)checking. Nucleic acids encoding the above-described epitopes may also include an epitope tag (
For example, it may be recombined with a gene of interest as a hemagglutinin ("HA") tag or a flag tag to aid in the detection and purification of the expressed polypeptide. For example, the system described by Janknecht et al. Allows easy purification of non-denatured fusion proteins expressed in human cell lines (Janknec).
ht et al., 1991, Proc. Natl. Acad. Sci. USA 88:
8972-897). In this system, the gene of interest is subcloned into a vaccinia recombinant plasmid, such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues.
This tag serves as a substrate binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto Ni2 ⁺ nitriloacetic acid-agarose columns and histidine-tagged proteins can be selectively eluted using imidazole-containing buffers .

Additional fusion proteins of the invention can be produced through the techniques of gene shuffling, motif shuffling, exon shuffling, and / or codon shuffling (collectively referred to as "DNA shuffling"). D
NA shuffling can be used to modulate the activity of the polypeptides of the invention, and using this method, polypeptides with altered activity, as well as agonists and antagonists of these polypeptides, can be produced. In general, U.S. Patent Nos. 5,605,793; 5,811,238;
Nos. 0,721; 5,834,252; and 5,837,458;
And Patten et al., Curr. Opinion Biotechnol.
8: 724-33 (1997); Harayama, Trends Biote.
chnol. 16 (2): 76-82 (1998); Hansson et al. M
ol. Biol. 287: 265-76 (1999); and Lorenzo.
And Blasco, BioTechniques 24 (2): 308-13.
(1998), each of which is hereby incorporated herein by reference in its entirety. In one embodiment, modification of the polynucleotides corresponding to SEQ ID NO: 1 and the polypeptides encoded by these polynucleotides can be achieved by DNA shuffling. D
NA shuffling involves assembling two or more DNA segments to produce a change in a polynucleotide sequence by homologous recombination or site-specific recombination. In another embodiment, the polynucleotide of the invention or the encoded polypeptide thereof is error-prone prior to recombination.
ne) may be modified by subjecting them to random mutagenesis by PCR, random nucleotide insertion or other methods. In another embodiment, one or more components, motifs, sections, portions, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention are one or more components, motifs of one or more heterologous molecules. , Sections, parts, domains, fragments, etc.

The proteins of the present invention can be chemically synthesized using techniques known in the art (eg, Creighton, 1983, Proteins: Structure).
s and Molecular Principles, W.S. H. Freem
an & Co. , N .; Y. And Hunkapiller et al., Nature,
310: 105-111 (1984)). For example, TR2 of the present invention
Peptides corresponding to fragments of the receptor polypeptide can be synthesized by use of a peptide synthesizer. In addition, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the TR2 receptor polypeptide sequence. Non-classical amino acids include, but are not limited to, the D isomer of a normal amino acid, 2,4-diaminobutyric acid, a-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ -Abu, ε-Ahx,
6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
Citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoroamino acid, designer amino acid (eg, β-methyl amino acid), Ca-methyl amino acid, Na-methyl amino acids, and common amino acid analogs. Further, the amino acid can be D (dextrorotary) or L (levorotary).

[0186] Non-naturally occurring variants can be produced using mutagenesis techniques known in the art. This technique includes oligonucleotide-mediated mutagenesis, alanine scanning, PCR mutagenesis, site-directed mutagenesis (eg, Carter et al., Nu
cl. Acids Res. 13: 4331 (1986); and Zoller
Et al., Nucl. Acids Res. 10: 6487 (1982)), cassette mutagenesis (eg, Wells et al., Gene 34: 315 (19).
85)), restriction selection mutagenesis (eg, Wells et al., Philo).
s. Trans. R. Soc. London SerA 317: 415 (19
86)), but is not limited thereto.

The invention is further directed to differentially modifying during or after translation (eg, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, TR2 receptor polypeptide (such as by linking to an antibody molecule, or other cellular ligand). Any of a number of chemical modifications can be made by known techniques. As the technique, cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH _4; acetylation, formylation, oxidation, reduction; tunicamycin (tun
icamycin) in the presence of, but not limited to.

Additional post-translational modifications included by the present invention include, for example, the following: N-linked or O-linked carbohydrate chains (N- or C-terminal processing), chemical moieties to the amino acid backbone. , N- or O-linked carbohydrate chains, and addition or deletion of N-terminal methionine residues as a result of prokaryotic host cell expression. The polypeptide can also be modified with a detectable label (eg, an enzymatic, fluorescent, isotopic or affinity label) to allow detection and isolation of the protein.

The present invention also provides TR2, T that may provide additional advantages, such as increased solubility, stability and circulation time, or reduced immunogenicity of the polypeptide.
Chemically modified derivatives of the R2-SV1 and TR2-SV2 receptor polypeptides are provided (see U.S. Pat. No. 4,179,337). The chemical moiety for derivatization can be selected from water-soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymer, carboxymethyl cellulose, dextran, polyvinyl alcohol, and the like. The polypeptide can be modified at random positions in the molecule or at predetermined positions in the molecule, and can include one, two, three or more attached chemical moieties.

The polymer can be of any molecular weight and can be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa for ease of handling and manufacture (the term "about" means that in the preparation of polyethylene glycol, some molecules may have higher molecular weights than indicated). Heavy and some are lighter than the indicated molecular weight). The desired therapeutic profile (eg, the desired duration of sustained release, in some cases effects on biological activity, ease of handling, degree of antigenicity or lack of antigenicity, and Other sizes may be used, depending on other known effects of polyethylene glycol). For example, polyethylene glycol is about 200, 500, 1000, 1500, 2000,
2500, 3000, 3500, 4000, 4500, 5000, 5500, 6
000, 6500, 7000, 7500, 8000, 8500, 9000, 95
00, 10,000, 10,500, 11,000, 11,500, 12,000
0, 12,500, 13,000, 13,500, 14,000, 14,500
, 15,000, 15,500, 16,000, 16,500, 17,000,
175,000, 18,000, 18,500, 19,000, 20,000, 2
5,000, 30,000, 35,000, 40,000, 50,000, 55
000, 60,000, 65,000, 70,000, 75,000, 80,
It may have an average molecular weight of 000, 90,000, 95,000, or 100,000 kDa.

As mentioned above, polyethylene glycol can have a branched structure. Branched polyethylene glycols are described, for example, in US Pat. No. 5,643,575; Morp.
urgo et al., Appl. Biochem. Biotechnol. 56: 59-
72 (1996); Vorovjev et al., Nucleosides Nucle.
otides 18: 2745-2750 (1999); and Calicet.
i et al., Bioconjug. Chem. 10: 638-646 (1999), the disclosure of each of which is incorporated herein by reference.

A polyethylene glycol molecule (or other chemical moiety) should be attached to a protein in view of its effect on the functional or antigenic domains of the protein. There are a number of conjugation methods available to those of skill in the art (see, for example, EP 0 401 384 (P in G-CSF, incorporated herein by reference).
EG), Malik et al., Exp. Hematol. 20: 1028-
1035 (1992) (pegylation of GM-CSF using tresyl chloride)
report)) also see)). For example, polyethylene glycol can be covalently linked via an amino acid residue by a reactive group (eg, a free amino or carboxyl group). Reactive groups are groups to which activated polyethylene glycol molecules can be attached. Amino acid residues having a free amino group may include lysine residues and N-terminal amino acid residues; amino acid residues having a free carboxyl group include aspartic acid residues, glutamic acid residues and C-terminal amino acid residues Residues may be mentioned. Sulfhydryl residues can also be used as a reactive group for attaching polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.

As suggested above, polyethylene glycol can be attached to proteins via linkage to any number of amino acid residues. For example, polyethylene glycol can be attached to a protein via a covalent bond to a lysine, histidine, aspartic acid, glutamic acid, or cysteine residue. One or more reaction chemistry may be performed on a particular amino acid residue of the protein (eg, lysine, histidine, aspartic acid, glutamic acid, or cysteine), or on more than one type of amino acid residue of the protein (eg, lysine, Histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) can be used to attach polyethylene glycol.

In particular, one may desire a protein that is chemically modified at the N-terminus. Using polyethylene glycol as an example of the present composition, various polyethylene glycol molecules (
Molecular weight, branching, etc.), the ratio of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mixture, the type of PEGylation reaction to be performed,
And the method of obtaining the selected N-terminally pegylated protein. A method of obtaining an N-terminal pegylated preparation (ie, if necessary, separating this moiety from other mono-PEGylated moieties) is obtained by purifying the N-terminal pegylated material from a population of pegylated protein molecules. Selective proteins that have been chemically modified with N-terminal modifications can be achieved by reductive alkylation, which is a primary amino group (lysine vs. N) available for derivatization in certain proteins. Utilizing different reactivities of different types (ends). Using a carbonyl group-containing polymer under appropriate reaction conditions,
Substantial selective derivatization of the protein at the N-terminus is achieved.

As mentioned above, pegylation of the proteins of the invention can be achieved by any number of means. For example, polyethylene glycol can be linked to a protein either directly or by an intervening linker. A linkerless system for attaching polyethylene glycol to proteins is described by Delgado et al., Cr.
it. Rev .. Thera. Drug Carrier Sys. 9: 249-
304 (1992); Francis et al., Intern. J. of Hemat
ol. 68: 1-18 (1998); U.S. Pat. No. 4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/3246.
No. 6 (the disclosure of each of which is incorporated herein by reference).

One system for attaching polyethylene glycol directly to amino acid residues of a protein without an intervening linker uses tresylated MPEG, which converts tresyl chloride (ClSO ₂ CH ₂ CF ₃ ). The monomethoxy used (m
onmethoxy) produced by modification of polyethylene glycol (MPEG). Upon reaction of the protein with the tresylated MPEG, the polyethylene glycol is attached directly to the amine groups of the protein. Accordingly, the present invention relates to a protein of the present invention and 2,2,2-trifluoroethane.
ane) including protein-polyethylene glycol conjugates produced by reaction with a poethylene glycol molecule having a sulfonyl group.

[0197] Polyethylene glycol can also be attached to proteins using a number of different intervening linkers. For example, US Pat. No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses a urethane linker for attaching polyethylene glycol to a protein. Protein-polyethylene glycol conjugates, where polyethylene glycol is linked to the protein by a linker, can also be produced by reaction of the protein with a compound such as: MPEG-succinimidyl succinate, 1,1'- MPEG activated with carbonyldiimidazole, MPEG-2,4,5-trichlorophenylcarbonate, MPEG
-P-nitrophenol carbonate, and various MPEG-succinate derivatives. A number of additional polyethylene glycol derivatives and reaction chemistry for attaching polyethylene glycol to proteins are described in WO 98/32466, the entire disclosure of which is incorporated herein by reference. PEGylated protein products produced using the reaction chemistry described herein are included within the scope of the present invention.

The number of polyethylene glycol moieties attached to each protein of the invention (ie, the degree of substitution) can also vary. For example, a PEGylated protein of the invention
On average 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20
Or more than one polyethylene glycol molecule. Similarly, the average degree of substitution is, for example, 1-3, 2-4, 3 per protein molecule.
-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 1
1-13, 12-14, 13-15, 14-16, 15-17, 16-18, 1
Within the range of 7 to 19, or 18 to 20 polyethylene glycol moieties.
Methods for determining the degree of substitution are described, for example, in Delgado et al., Crit. R
ev. Thera. Drug Carrier Sys. 9: 249-304 (
1992).

(Antibodies) The present invention further relates to antibodies and T cell antigen receptors (TCRs) that specifically bind to a polypeptide of the present invention. The antibody of the present invention comprises an IgG (IgG1,
G2, including IgG3 and IgG4), IgA (including IgA1 and IgA2), IgD, IgE or IgM and IgY. As used herein, the term "antibody" (Ab) is meant to include single antibodies, including whole antibodies and antigen-binding fragments thereof. Most preferably, the antibody is a human antigen-binding antibody fragment of the invention, including Fab, Fab 'and F (
ab ′) 2, Fd, single-chain Fvs (scFv), single-chain antibody, disulfide-bonded Fv
s (sdFv) and fragments comprising either the _VL or _VH domain, including but not limited to. The antibodies can be of any animal origin, including birds and mammals. Preferably, the antibody is human, mouse, rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, a "human" antibody includes an antibody having the amino acid sequence of a human immunoglobulin, and is a human immunoglobulin library or a transgenic animal against one or more human immunoglobulins and Includes antibodies isolated from animals that do not express endogenous immunoglobulin (as described below and, for example, in US Pat. No. 5,939,598 to Kucherlapati et al.).

[0200] Antigen-binding antibody fragments, including single-chain antibodies, can include the variable region alone or in combination with all or part of the following: hinge region, CH1, CH2, and CH3 domains. The present invention includes a variable region and a hinge region, CH1, CH2.
And any combination of CH3 domains. The invention further includes monoclonal, polyclonal, chimeric, humanized, and human monoclonal and polyclonal antibodies that specifically bind to a polypeptide of the invention. The present invention further includes antibodies that are anti-idiotypic to the antibodies of the present invention.

The antibodies of the present invention can be mono-antigen-specific, bi-antigen-specific, tri-antigen-specific, or can be more multi-specific. Multispecific antibodies can be specific for different epitopes of a polypeptide of the invention, or can be specific for both a polypeptide of the invention and a heterologous composition (eg, a heterologous polypeptide or a solid support material). Can be targeted. For example, WO 93/17715; WO 9
WO 91/00360; WO 92/05793; Tutt
A. et al. Immunol. 147: 60-69 (1991); U.S. Pat.
No. 5,573,920, No. 4,474,893, No. 5,601,819,
Nos. 4,714,681 and 4,925,648; Kostelny, S
. A. J. et al. Immunol. 148: 1547-1553 (1992).

The antibodies of the invention may be described or specified in terms of an epitope or portion of a polypeptide of the invention that is recognized or specifically bound by the antibody. The epitope or polypeptide portion may be identified by the size of contiguous amino acid residues, as described herein, for example, by N- and C-terminal positions, or may be listed in tables and figures . Antibodies that specifically bind to any epitope or polypeptide of the present invention may also be excluded. Accordingly, the present invention includes antibodies that specifically bind to a polypeptide of the present invention,
The exclusion of this antibody is allowed.

The antibodies of the present invention may also be described or specified for their cross-reactivity.
obtain. Any other analog, ortholog, of the polypeptide of the present invention
log) or homologs. In the present invention, the present invention
Less than 95%, less than 90%, less than 85%, less than 80%, 75
Less than 70%, less than 65%, less than 60%, less than 55%, and less than 50%
Using methods known in the art and those described herein.
Antibodies that do not bind a polypeptide having the formula: The present invention
Under stringent hybridization conditions (described herein).
The polynucleotide hybridizing to the polynucleotide of the present invention
And antibodies that bind only to the polypeptide encoded by The present invention
Can also be described or specified for their binding affinity. Preferred binding
The affinity is 5 × 10^-6M, 10^-6M, 5 × 10^-7M, 10^-7M, 5 × 10 ^-8 M, 10^-8M, 5 × 10^-9M, 10^-9M, 5 × 10^-TenM, 10^-TenM, 5 × 1
0^-11M, 10^-11M, 5 × 10^-12M, 10^-12M, 5 × 10^-13M, 10^-13M,
5 × 10^-14M, 10^-14M, 5 × 10^-15M, and 10^-15Dissociation constant less than M (
That is, an affinity having Kd) can be mentioned.

The invention also relates to any method known in the art for determining competitive binding (
For example, an antibody is provided that competitively inhibits the binding of the antibody to an epitope of the present invention, as determined by an immunoassay described herein. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.

An antibody of the present invention can act as an agonist or antagonist of a polypeptide of the present invention. For example, the invention includes antibodies that disrupt either the partial or total interaction of the receptor / ligand with a polypeptide of the invention. The invention features both receptor-specific antibodies and ligand-specific antibodies. The invention also features receptor-specific antibodies that do not prevent ligand binding but do prevent receptor activation. Receptor activation (ie, signal transduction) can be determined by techniques described herein, or otherwise known in the art. For example, receptor activation is determined by phosphorylation of the receptor (eg, tyrosine or serine / threonine) or immunoprecipitation (eg, as described above), followed by detection of its substrate by Western blot analysis. Can be done. In certain embodiments, the antibody confers a ligand or receptor activity that is at least 90%, at least 80%, at least 70%, at least 60%, or at least 50% inhibited of the activity in the absence of the antibody.

The present invention also recognizes receptor-specific antibodies that interfere with both ligand binding and receptor activation, and recognizes receptor-ligand complexes, and preferably recognizes unbound receptors or unbound ligands. Characterized by antibodies that do not specifically recognize. Similarly, the present invention includes neutralizing antibodies that bind to a ligand and prevent binding of the ligand to the receptor, as well as binding to the ligand, thereby preventing receptor activation, but preventing the ligand from binding to the receptor. Not including antibodies. Also included in the invention are antibodies that activate the receptor. These antibodies can act like receptor agonists, ie, enhance or activate either the entire or a subset of the biological activity of ligand-mediated receptor activation. The antibodies may be specified as agonists, antagonists or inverse agonists for biological activities, including the specific biological activities of the peptides of the invention disclosed herein. The above antibody agonists can be made using methods known in the art. See, for example, PCT Publication WO 96/40281; U.S. Pat.
811,097; Deng et al., Blood 92 (6): 1981-1988.
(1998); Chen et al., Cancer Res. 58 (16): 3668-
3678 (1998); Harrop et al. Immunol. 161 (4):
1786-1794 (1998); Zhu et al., Cancer Res: 58 (1
5): 3209-3214 (1998); Yoon et al. Immunol. 1
60 (7): 3170-3179 (1998); Prat et al. Cell. S
ci. 111 (Pt2): 237-247 (1998); Pitard et al.
Immunol. Methods 205 (2): 177-190 (1997)
Liautard et al., Cytokine 9 (4): 233-241 (199);
7); Carlson et al. Biol. Chem. 272 (17): 1129
5-11301 (1997); Taryman et al., Neuron 14 (4):
755-762 (1995); Muller et al., Structure 6 (9).
: 1153-1167 (1998); Bartunek et al., Cytokine.
8 (1): 14-20 (1996), all of which are hereby incorporated by reference in their entirety.

The antibodies of the present invention include those known in the art for purifying, detecting and targeting polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods, including, but not limited to, methods known in the art. Has unlimited uses. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of a polypeptide of the invention in biological samples. See, for example, Harlow et al., ANTIBODIES: A LABORATORY MA
NUAL, (Cold Spring Harbor Laboratory)
Press, Second Edition, 1988), which is incorporated herein by reference in its entirety.

The antibodies of the present invention can be used either alone or in combination with other compositions. The antibody may further be recombinantly fused at the N-terminus or C-terminus to a heterologous polypeptide, or chemically conjugated (including covalent and non-covalent) to the polypeptide or other composition. . For example, the antibodies of the invention can be recombinantly fused or conjugated to molecules and effector molecules (eg, heterologous polypeptides, drugs, or toxins) useful as labels in detection assays. For example, PCT Publication WO92 / 08495; WO91 / 14438; WO89 / 1
U.S. Pat. No. 5,314,995; and EP 0 396 3
See No. 87.

The antibodies of the present invention may be modified (ie, covalently attached).
Attachment) includes derivatives (by covalent attachment of any type of molecule to the antibody) that do not prevent the antibody from producing an anti-idiotypic response. For example, but not limited to, antibody derivatives include, for example, glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic Antibodies that have been modified by cleavage, ligation to cellular ligands or other proteins, and the like. Numerous optional chemical modifications can be performed by known techniques, including but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. Further, the derivative may contain one or more non-classical amino acids.

[0210] The antibodies of the present invention can be produced by any suitable method known in the art.
Polyclonal antibodies to an antigen of interest can be produced by various procedures well known in the art. For example, a polypeptide of the invention can be administered to a variety of host animals, including but not limited to rabbits, mice, rats, and the like, to induce the production of serum containing polyclonal antibodies specific for the antigen. Various adjuvants can be used to increase the immunological response, depending on the host species, and mineral gels such as Freund (complete and incomplete), aluminum hydroxide (m
inner gel), a surfactant such as lysolecithin, pluronic (
including, but not limited to, polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum. Not done. Such adjuvants are also well-known in the art.

[0211] Monoclonal antibodies can be prepared using a wide variety of techniques known in the art, including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using the following hybridoma techniques known in the art and include, for example, Harr
low et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press
Hammerling et al., Monoclonal An.
tibodies and T-Cell Hybridomas 563-6
81 (Elsevier, NY 1981), the above references being incorporated by reference in their entirety. The term "monoclonal antibody" is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and is not the method by which monoclonal antibodies are produced. Monoclonal antibodies can be prepared using a wide variety of techniques known in the art, including hybridoma, recombinant, and phage display technologies.

Hybridoma technology includes methods known in the art, as well as Harlow
Et al, ANTIBODIES: A LABORATORY MANUAL (Col
d Spring Harbor Laboratory Press, 2nd edition, 1988); and Hammerling et al., MONOCLONAL ANT.
IBODIES AND T-CELL HYBRIDOMAS 563-68
1 (Elsevier, NY, 1981), which are incorporated by reference in their entirety.

[0213] Fab and F (ab ') 2 fragments are produced by proteolytic cleavage, using enzymes such as papain (for producing Fab fragments) or pepsin (for producing F (ab') 2 fragments). obtain.

Alternatively, the antibodies of the invention can be made by the application of recombinant DNA and phage display techniques using methods known in the art, or by synthetic chemistry.
For example, the antibodies of the present invention can be prepared using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles that carry the polynucleotide sequences that encode them. Phage with the desired binding properties are selected directly by using an antigen (typically an antigen bound or captured on a solid surface or a bead) to produce a repertoire or combinatorial antibody library (
(For example, human or mouse). The phage used in these methods are typically fd and M13 having the antibody domain of a Fab, Fv or disulfide stabilized Fv recombinantly fused to either the phage gene III protein or the phage gene VIII protein. This is a filamentous phage containing Examples of phage display methods that can be used to make the antibodies of the invention include those disclosed below: Brinkman U
. J. et al. Immunol. Methods 182: 41-50 (1995)
Ames, R .; S. J. et al. Immunol. Methods 184: 17
7-186 (1995); Kettleborough, C .; A. Et al., Eur.
J. Immunol. 24: 952-958 (1994); Persic, L .;
Et al., Gene 187 9-18 (1997); Burton, D .; R. A
dvances in Immunology 57: 191-280 (199)
4); PCT / GB91 / 01134; WO 90/02809; WO 91 /
10737; WO 92/01047; WO 92/18619; WO 93 /
WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426, 5,223,409, and 5,403,4.
No. 84, No. 5,580,717, No. 5,427,908, No. 5,75
No. 0,753, No. 5,821,047, No. 5,571,698, No. 5
No. 5,427,908, No. 5,516,637, No. 5,780,225,
Nos. 5,658,727 and 5,733,743 (these references are incorporated by reference in their entirety).

As described in the above references, after phage selection, antibodies encoding regions from the phage can be used to generate whole antibodies, including human antibodies, or any other desired antigen-binding fragment. Can be isolated and used, and can be expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast and bacteria. For example, techniques for making Fab, Fab 'and F (ab') 2 fragments recombinantly can also be employed utilizing methods known in the art, such as those disclosed below: WO 92/22324; Mullinax, R .; L
. Et al., BioTechniques 12: 864-869 (1992); and Sawai, H. et al. AJRI 34: 26-34 (1995); and Be.
tter, M .; Et al., Science 240: 1041-1043 (1998).
(These references are incorporated by reference in their entirety).

Examples of techniques that can be used to make single-chain Fvs and antibodies include US Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203: 46-88 (199
1); Shu, L .; Et al., PNAS 90: 7995-7999 (1993); and Skerra, A. et al. Et al., Science 240: 1038-1040 (1
988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, the use of chimeric, humanized, or human antibodies may be preferred. Methods for making chimeric antibodies are known in the art. For example, Morrison, Science
229: 1202 (1985); Oi et al., BioTechniques 4:
214 (1986); Gillies, S .; D. J. et al. Immunol. Me
methods 125: 191-202 (1989); and US Pat. No. 5,80.
See 7,715. Antibodies can be humanized using a variety of techniques, including: CDR-grafting (EP 0 239 400; WO 91 /
09967; U.S. Patent Nos. 5,530,101 and 5,585,089), veneering or resurfacing.
rfacing (EP 0 592 106; EP 0 519)
No. 596; Padlan E. et al. A. , Molecular Immunolog
y 28 (4/5): 489-498 (1991); Studnicka G
. M. Et al., Protein Engineering 7: 805-814 (1
994); Roguska M. A. Et al., PNAS 91: 969-973) (
1994), and chain shuffling.
(US Pat. No. 5,565,332). Human antibodies can be produced by various methods known in the art, including the phage display method described above. US Patent No. 4
Nos. 4,444,887, 4,716,111, 5,545,806 and 5,814,318; and WO 98/46645, WO 98.
/ 50433, WO 98/24893, WO 98/16654, WO 96
See also / 34096, WO 96/33735, and WO 91/10741, which references are incorporated by reference in their entirety.

Further, the present invention includes antibodies recombinantly fused or chemically conjugated (including both covalent and non-covalent bonds) to a polypeptide of the present invention. This antibody is
It may be specific for an antigen other than the polypeptide of the invention. For example, an antibody targets a polypeptide of the invention to a particular cell type, either in vitro or in vivo, by fusing or binding the polypeptide of the invention to an antibody specific for a particular cell surface receptor. Can be used for Antibodies fused or conjugated to a polypeptide of the invention can also be used in in vitro immunoassays and purification methods using methods known in the art. For example, Harbor et al.
Supra, and WO 93/21232; EP 0 439 095; Na
ramura, M .; Et al., Immunol. Lett. 39: 91-99 (199
4); U.S. Patent No. 5,474,981; O. Et al., PNA
S 89: 1428-1432 (1992); P. J. et al. Im
munol. 146: 2446-2452 (1991) (these references are:
The entirety of which is incorporated by reference).

The present invention further includes compositions comprising a polypeptide of the present invention fused or conjugated to an antibody domain other than the variable region. For example, a polypeptide of the invention can be fused to or linked to the Fc region of an antibody or a portion thereof. The antibody portion fused to the polypeptide of the present invention may comprise the hinge region, CH1 domain, CH2 domain, and CH3 domain or the complete domain or any combination of the portions. The polypeptides of the invention can be fused or conjugated to the antibody portions described above for use in immunoassays to increase the half-life of the polypeptide in vivo, using methods known in the art. The polypeptide can also be fused or conjugated to an antibody moiety described above to form a multimer. For example, an Fc portion fused to a polypeptide of the invention may form a dimer through disulfide bonds between the Fc portions. Higher multimeric forms can be made by fusing the polypeptide to portions of IgA and IgM. Methods for fusing or linking a polypeptide of the invention to an antibody moiety are known in the art. For example, US Pat. No. 5,336,603
No. 5,622,929, No. 5,359,046, No. 5,349,
No. 053, No. 5,447,851, No. 5,112,946; EP 0
No. 307 434, EP 0 367 166; WO 96/04388, W
O91 / 06570; Ashkenazi, A .; Et al., (1991) PNAS
88: 10535-1039; Zheng, X .; X. Et al., (1995) J. Am. I
mmunol. 154: 5590-5600; and Vil, H .; (19
92) PNAS 89: 113337-11341 (the above references are incorporated by reference in their entirety).

[0219] The present invention further relates to antibodies that act as agonists or antagonists of the polypeptides of the present invention. Antibodies that act as agonists or antagonists of the polypeptides of the present invention include, for example, antibodies that disrupt receptor / ligand interactions, either partially or wholly, with the polypeptides of the present invention. Can be For example, the invention includes antibodies that disrupt the ability of the proteins of the invention to multimerize. In another example, the invention allows a protein of the invention to multimerize, but wherein the protein of the invention comprises one or more TR2s.
Receptors or ligands (for example, AIM-II (International Application Publication No.
/ 34911), lymphotoxin-α, and herpesvirus protein HS
V1 gD). In yet another example, the invention relates to the multimerization of the proteins of the invention and to TR2 receptors or ligands (eg, AIM-II (International Application Publication No. WO 97/34911).
), Lymphotoxin-α, and herpesvirus protein HSV1 gD)
And antibodies that block the biological activity associated with the TR2 receptor / ligand complex.

[0220] Antibodies that act as agonists or antagonists of the polypeptides of the present invention also include both receptor-specific and ligand-specific antibodies. Also included are receptor-specific antibodies that do not prevent ligand binding but prevent activation of the receptor. Receptor activation (ie, signal transduction) can be determined by techniques described herein, or otherwise known in the art. Also included are receptor-specific antibodies that prevent both ligand binding and receptor activation. Also, include neutralizing antibodies that bind to the ligand and prevent binding of the ligand to the receptor, as well as antibodies that bind to the ligand and thereby prevent receptor activation, but do not prevent the ligand from binding to the receptor. . Also included are antibodies that activate the receptor. These antibodies can act like agonists for either all or some of the biological activities affected by ligand-mediated receptor activation. The antibody can be specified as an agonist or antagonist for a biological activity, including the specific activities disclosed herein. The above antibody agonists can be made using methods known in the art. See, for example, WO 96/40281; US Pat. No. 5,811.
No., 097; Deng, B .; Et al., Blood 92: 1981-1988 (19
98); Chen, Z .; Et al., Cancer Res. 58: 3668-3678
(1998); Harrop, J .; A. J. et al. Immunol. 161: 17
86-1794 (1998); Zhu, Z .; Et al., Cancer Res: 58:
3209-3214 (1998); Y. J. et al. Immunol
. 160: 3170-3179 (1998); Prat, M .; J. et al. Cell
. Sci. 111 (Pt2): 237-247 (1998); Pitard, V
. J. et al. Immunol. Methods 205: 177-190 (199
7); Lioutard, J .; Et al., Cytokine 9 (4): 233-24.
1 (1997); Carlson, N .; G. FIG. J. et al. Biol. Chem. 27
2: 11295-11301 (1997); Taryman, R .; E. FIG. Ne
uron 14: 755-762 (1995); Muller, Y .; A. S
structure 6: 1153-1167 (1998); Bartunek,
P. See Cytokine 8: 14-20 (1996), which is incorporated by reference in its entirety.

Methods for producing and screening for particular antibodies using hybridoma technology are conventional and well known in the art, and are discussed in detail in Example 17. Briefly, mice can be immunized with a polypeptide of the invention or cells expressing such a peptide. Once an immune response is detected (eg,
Antigens specific for the antigen are detected in the serum of the mouse), and the spleen of the mouse is collected and splenocytes are isolated. The splenocytes are then fused by well known techniques to any suitable melanoma cells (eg, cells from cell line SP20 available from the ATCC). Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed for cells secreting antibodies capable of binding the polypeptide of the invention by methods known in the art. Ascites fluid, which generally contains high levels of antibody, can be produced by immunizing mice with a positive hybridoma clone.

Thus, the present invention provides a method of producing an antibody produced by a method comprising culturing a monoclonal antibody and a hybridoma cell secreting the antibody of the present invention, preferably Hybridomas are defined as hybridoma clones that secrete antibodies capable of binding to a polypeptide of the invention by fusing splenocytes isolated from the immunized mouse with an antigen of the invention using myeloma cells. Produced by screening hybridomas resulting from the fusion.

[0223] Antibody fragments that recognize a particular epitope can be produced by known techniques. For example, Fab and F (ab) '2 fragments of the present invention comprise (Fa
It can be produced by proteolytic cleavage of immunoglobulin molecules using an enzyme such as papain (to produce the b-fragment) or pepsin (to produce the F (ab ') 2 fragment). The F (ab ') 2 fragment contains the variable region, the light chain constant region and the CH1 domain of the heavy chain.

For example, the antibodies of the present invention can also be produced using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles that carry the polynucleotide sequences that encode them. In particular, such phage can be utilized to display an antigen binding domain expressed from a repertoire or combinatorial antibody library (eg, human or mouse). Phage expressing an antigen binding domain that binds to the antigen of interest can be selected or identified using the antigen (eg, using a labeled antibody or an antigen bound or captured on a solid surface or bead). The phage used in these methods is typically a phage having the antibody domain of a Fab, Fv or disulfide stabilized Fv recombinantly fused to either the phage gene III protein or the phage gene VIII protein. Filamentous phage containing fd and M13 binding domains expressed from. Examples of phage display methods that can be used to make the antibodies of the invention include the methods disclosed below: Brinkman et al. Immunol. Method
s 182: 41-50 (1995); Ames et al. Immunol. Me
methods 184: 177-186 (1995); Kettleborough
h et al., Eur. J. Immunol. 24: 952-958 (1994); Pe.
rsic et al., Gene 187 9-18 (1997); Burton et al., Ad.
vents in Immunology 57: 191-280 (1994)
); PCT Application No. PCT / GB91 / 01134; PCT Publication WO 90/0
2809; WO 91/10737; WO 92/01047; WO 92/1
8619; WO 93/11236; WO 95/15982; WO 95/2
0401; and U.S. Patent Nos. 5,698,426; 5,223,409.
No. 5,403,484; No. 5,580,717; No. 5,427,
No. 908; 5,750,753; 5,821,047; 5,5
Nos. 71,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and No. 5,969,108 (each of the above references is incorporated herein by reference in its entirety).

As described in the above references, after phage selection, the region encoding the antibody from the phage can be used to generate whole antibodies, including human antibodies, or any other desired antigen-binding fragment. It can be isolated and used, and expressed in any desired host, including (eg, as described in detail below), mammalian cells, insect cells, plant cells, yeast and bacteria. For example, techniques for making Fab, Fab 'and F (ab') 2 fragments recombinantly can also be used using methods known in the art. Such methods are disclosed, for example, in PCT Publication WO 92/22324; Mullinax et al., BioT.
techniques 12 (6): 864-869 (1992); and Saw.
ai et al., AJRI 34: 26-34 (1995); and Better et al., S.
science 240: 1041-1043 (1998) (these references are incorporated by reference in their entirety).

Examples of techniques that can be used to make single-chain Fvs and antibodies include US Pat. Nos. 4,946,778 and 5,258,498; Huston.
Et al., Methods in Enzymology 203: 46-88 (19
91); Shu et al., PNAS 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, the use of chimeric, humanized or human antibodies may be preferred. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species (eg, an antibody having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region). Methods for making chimeric antibodies are known in the art. For example, Morris
on, Science 229: 1202 (1985); Oi et al., BioTec.
hniques 4: 214 (1986); Gillies et al., (1989) J.
. Immunol. Methods 125: 191-202; U.S. Pat.
Nos. 807,715; 4,816,567; and 4,816,397.
(These are hereby incorporated by reference in their entirety). A humanized antibody is an antibody molecule from a non-human species antibody that binds to a desired antigen having one or more complementarity determining regions (CDRs) from a non-human species and framework regions from a human immunoglobulin molecule. . Often, framework residues within the human framework regions are replaced with corresponding residues from a CDR donor antibody to alter (preferably improve) antigen binding. These framework substitutions are identified by methods well known in the art, for example, modeling the interaction of CDR and framework residues to identify framework residues important for antigen binding, and at specific positions. By sequence comparison to identify abnormal framework residues. (See, for example, Queen et al., US Patent No. 5,585,089; Riechmann. Et al.,
Nature 332: 323 (1988). These are incorporated herein by reference in their entirety). Antibodies can be humanized using various techniques known in the art, including: for example, CDR-grafting (European Patent No.
No. 9,400; PCT Publication WO 91/09967; US Pat. No. 5,225,5.
39; 5,530,101 and 5,585,089), veneering or resurfacing.
ng) (European Patents 592,106; 519,596; Padlan,
Molecular Immunology 28 (4/5): 489-498
(1991); Studnicka et al., Protein Engineerin.
g 7 (6): 805-814 (1994); Roguska et al., PNAS 9
1: 969-973 (1994)), and chain shuffling (chai).
n shuffling) (U.S. Patent No. 5,565,332).

[0227] Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be produced by various methods known in the art, including the phage display method described above using an antibody library derived from human immunoglobulin sequences. U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT
Published WO 98/46645, WO 98/50433, WO 98/2489
3, WO 98/16654, WO 96/34096, WO 96/3373
5, and WO 91/10741; each of which is incorporated herein by reference in its entirety.

[0228] Human antibodies can also be produced using transgenic mice, which are unable to express functional endogenous immunoglobulin, but are capable of expressing human immunoglobulin genes. For example, a complex of a human heavy chain immunoglobulin gene and a human light chain immunoglobulin gene can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region (diversity)
region) can be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes. The mouse heavy and light immunoglobulin genes can be rendered non-functional separately or simultaneously with the introduction of a human immunoglobulin locus by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring that express human antibodies. The transgenic mice are immunized in the normal fashion with a selected antigen (eg, all or a portion of a polypeptide of the invention). Monoclonal antibodies directed against the antigen can be obtained from the immunized transgenic mice using conventional hybridoma technology. The human immunoglobulin transgene retained in the transgenic mouse is B
Rearranges during cell differentiation and subsequently undergoes class switching and somatic mutation. Thus, the use of such techniques allows for the production of therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar (
1995, Int. Rev .. Immunol. 13: 65-93). For a detailed discussion of this technology for producing human and human monoclonal antibodies, as well as protocols for producing such antibodies, see, for example, PCT Publication WO 98/24893; WO 96/34096; WO 96/337.
35; U.S. Patent Nos. 5,413,923; 5,625,126;
Nos. 633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,
No. 598, which are incorporated herein by reference in their entirety. Further, Abgenix, Inc. (Freemont, CA) and Ge
Companies such as npharm (San Jose, CA) may be engaged in providing human antibodies to the selected antigen using techniques similar to those described above.

Human antibodies that fully recognize the selected epitope were identified as “guided (gui
ded) selection ". In this approach,
Selected non-human monoclonal antibodies (eg, mouse antibodies) are used to guide the selection of human antibodies that fully recognize the same epitope. (Jespers
Et al., Bio / technology 12: 899-903 (1988)).

As discussed above, antibodies against the TR2 receptor protein of the present invention
It can in turn be utilized to produce anti-idiotypic antibodies that "mimic" the TR2 receptor using techniques well known to those skilled in the art. (See, e.g., Greenspan and Bona, FASEB J. 7 (5): 437-444; (1989) and Nissinoff, J. Immunol. 147 (8): 2429-2438).
(1991). For example, an antibody that binds and competitively inhibits TR2 receptor multimerization and / or binding to a ligand may be an anti-idio that "mimics" the TR2 receptor multimerization and / or binding domain. Can be used to produce a type,
And consequently binds and neutralizes the TR2 receptor and / or its ligand. Neutralization of such anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize TR2 receptor ligands. For example, such an anti-idiotypic antibody is TR
Can be used to bind to the TR2 receptor or to bind to the TR2 receptor or ligand, thereby blocking the inhibition of TR2 receptor-mediated apoptosis.

A. Polynucleotides Encoding Antibodies The present invention further provides polynucleotides comprising nucleotide sequences encoding the antibodies of the present invention and fragments thereof. The present invention also provides antibodies (preferably, specifically as defined herein) that bind under stringent or lower stringency hybridization conditions (eg, as defined herein). , Preferably an antibody that binds to a polypeptide having the amino acid sequence of SEQ ID NO: 2; SEQ ID NO: 5 or SEQ ID NO: 26).

A polynucleotide can be obtained by any method known in the art, and the nucleotide sequence of the polynucleotide is determined. For example, if the nucleotide sequence of an antibody is known, the polynucleotide encoding the antibody can be constructed from chemically synthesized oligonucleotides (eg, Kutmeie).
et al., BioTechniques 17: 242 (1994), which, in brief, involves the following steps: Synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody. Annealing and ligation of these oligonucleotides, followed by amplification of the ligated oligonucleotides by PCR.

[0233] Alternatively, a polynucleotide encoding an antibody can be produced from nucleic acid from a suitable source. If no clone is available containing the nucleic acid encoding the particular antibody, but the sequence of the antibody molecule is known, the nucleic acid encoding the immunoglobulin can be obtained from a suitable source (eg, an antibody cDNA library, or an antibody cDNA library). From any tissue or cell that expresses (eg, a hybridoma cell selected for expression of an antibody of the invention), or a nucleic acid (preferably poly A + RNA) isolated therefrom. For example, to identify a cDNA clone from a cDNA library that encodes the antibody, by PCR amplification using synthetic primers that can hybridize to the 3 'and 5' ends of the sequence, or specific to a particular gene sequence Can be obtained by cloning using a unique oligonucleotide probe The amplified nucleic acid generated by PCR can then be cloned into a replicable cloning vector using any method known in the art.

Once the nucleotide sequence and the corresponding amino acid sequence of the antibody have been determined,
The nucleotide sequence of an antibody can be determined by methods known in the art for manipulating nucleotide sequences (eg, recombinant DNA technology, site-directed mutagenesis, PCR, etc. (eg,
Sambrook et al., 1990, Molecular Cloning, AL.
laboratory Manual, 2nd edition, Cold Spring Har
bor Laboratory, Cold Spring Harbor, NY
And Ausubel et al., Eds. 1998, Current Protocols.
in Molecular Biology, John Wiley & Sons
, NY. These are both incorporated herein by reference in their entirety. )) Can be used to generate antibodies with different amino acid sequences to make, for example, amino acid substitutions, deletions, and / or insertions.

In certain embodiments, the amino acid sequences of the heavy and / or light chain variable domains are identified by methods well known in the art for identification of complementarity determining region (CDR) sequences (eg, sequence To determine the region of hypervariability, other heavy chains,
And by comparing the variable region of the light chain with the known amino acid sequence). Using conventional recombinant DNA techniques, one or more CDRs can be inserted into a framework region as described above (eg, into a human framework region to humanize a non-human antibody). . The framework region can be naturally occurring or a consensus framework region, and can preferably be a human framework region (eg, for the listed human framework regions, see Chothia et al., J. Mol. Biol.278: 457-479 (1
998)). Preferably, the polynucleotide generated by the combination of the framework regions and the CDRs encodes an antibody that specifically binds a polypeptide of the invention. Preferably, as discussed above, one or more amino acid substitutions can be made within the framework regions, and preferably, the amino acid substitutions improve the binding of the antibody to its antigen. Further, such methods can produce antibody molecules that lack one or more intrachain disulfide bonds,
It can be used to make amino acid substitutions or deletions of cysteine residues in one or more of the variable regions involved in intrachain disulfide bonds. Other changes to polynucleotides are encompassed by the present invention and in the art.

Furthermore, by splicing genes from mouse antibody molecules of appropriate antigen specificity with genes from human antibody molecules of appropriate biological activity,
Techniques developed to produce "chimeric antibodies" (Morrison et al., 1984)
Proc. Natl. Acad. Sci. 81: 851-855; Neube
rger et al., 1984, Nature 312: 604-608; Takeda.
Et al., 1985, Nature 314: 452-454) may be used. As noted above, a chimeric antibody is a molecule in which different portions are derived from different animal species, such molecules having variable regions derived from the constant regions of mouse mAbs and human immunoglobulins (eg, humanized antibodies). .

Alternatively, techniques described for the production of single chain antibodies (US Pat. No. 4,694,941)
No. 778; Bird, 1988, Science 242: 423-42; Hu
Stone et al., 1988, Proc. Natl. Acad. Sci. USA 85
: 5879-5883; and Ward et al., 1989, Nature 334:
544-54) can be adapted for the production of single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. E. FIG. Techniques for the assembly of functional Fv fragments in E. coli can also be used (Skerr
a, et al., 1988, Science 242: 1038-1041).

B. Methods for Producing Antibodies The antibodies of the present invention can be produced by any method known in the art for synthesizing antibodies, particularly by chemical synthesis, or preferably, by recombinant expression techniques. Can be produced.

An antibody of the invention, or a fragment, derivative or analog thereof (eg,
Recombinant expression of the antibody (heavy or light chain) of the present invention requires the construction of an expression vector containing a polynucleotide encoding the antibody. Once a polynucleotide encoding the antibody molecule or antibody heavy or light chain, or portions thereof, (preferably containing the heavy or light chain variable domains) of the invention is obtained, the production of the antibody molecule is Can be produced by recombinant DNA technology using techniques well known in the art. Accordingly, methods for preparing a protein by expression of a polynucleotide containing a nucleotide sequence encoding an antibody are described herein. Methods well known to those skilled in the art can be used for the construction of expression vectors containing antibody-encoding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant D
NA techniques, synthetic techniques, and in vivo genetic recombination. Accordingly, the present invention provides a replicable vector comprising a nucleotide sequence encoding an antibody molecule of the present invention, or a heavy or light chain thereof, or a variable domain of a heavy or light chain, operably linked to a promoter. I will provide a. Such a vector is
And may comprise a nucleotide sequence encoding the constant region of an antibody molecule (see, eg, PCT Publication WO 86/05807; PCT Publication WO 89/01036; and US Pat. No. 5,122,464), and the variable domain of the antibody. Is
It can be cloned into such a vector for expression of the entire heavy or light chain.

The expression vector is transferred into a host cell by conventional techniques, and the transfected cells are then cultured by conventional techniques to produce an antibody of the present invention. Accordingly, the invention includes a host cell comprising a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, operably linked to a heterologous promoter. In a preferred embodiment for expression of a double-chain antibody, the vector encoding both the heavy and light chains is co-expressed in a host cell for expression of the entire immunoglobulin molecule, as detailed below. Can be done.

[0241] A variety of host expression vector systems can be utilized to express the antibody molecules of the present invention. Such host expression systems represent vehicles in which the coding sequence of interest can be produced and subsequently purified, but also can be used in situ when transformed or transfected with sequences encoding the appropriate nucleotides. 1 represents a cell capable of expressing the antibody molecule of the invention. These include, but are not limited to: bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody-encoding sequences (eg, E. coli, A microorganism such as B. subtilis; a yeast (eg, Sacc) transformed with a recombinant yeast expression vector containing a sequence encoding the antibody.
haromyces, Pichia); an insect cell line infected with a recombinant virus expression vector (eg, baculovirus) containing a sequence encoding the antibody; a recombinant virus expression vector (eg, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) A plant cell line infected with E. coli or a plant cell line transformed with a recombinant plasmid expression vector (eg, Ti plasmid) containing a sequence encoding an antibody; or a promoter derived from the genome of a mammalian cell (
For example, a mammalian cell line (eg, COS, CHO, BHK) carrying a recombinant expression construct containing a promoter derived from a mammalian virus (eg, adenovirus late promoter; vaccinia virus 7.5K promoter). , 293, 3T3 cells). Preferably, Esch
Bacterial cells such as E. coli, and more preferably, eukaryotic cells, particularly for the expression of whole recombinant antibody molecules, are used for expression of recombinant antibody molecules. For example, mammalian cells, such as Chinese hamster ovary cells (CHO), combined with vectors, such as the major immediate-early gene promoter element from human cytomegalovirus, are effective expression systems for antibodies. (Foecking et al., 1986, Gene 45: 101; Cocke.
tt et al., 1990, Bio / Technology 8: 2).

[0242] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the expression of the antibody molecule. For example, if large quantities of such a protein are to be produced, a vector that directs high-level expression of a fusion protein product that is easily purified may be desirable for the production of a pharmaceutical composition of the antibody molecule. Such vectors include, but are not limited to, the following: the sequence encoding the antibody is in frame with the region encoding lacZ in the vector.
e) can be separately ligated, so that a fusion protein is produced. coli
Expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1).
791); pIN vector (Inouye & Inouye, 1985, Nucl
eic Acids Res. 13: 3101-3109; Van Heke
& Schuster, 1989, J.A. Biol. Chem. 24: 5503-5
509). The pGEX vector can also be used as a fusion protein with glutathione S-transferase (GST) to express foreign polypeptides. Generally, such fusion proteins are soluble and can be readily purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads, followed by elution in the presence of free glutathione.
The pGEX vector was designed to include a thrombin or factor Xa protease cleavage site so that the cloned target gene product was GS
It can be released from the T part.

In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector for expressing heterologous genes. This virus grows in Spodoptera frugiperda cells. Sequences encoding the antibody can be cloned individually into non-essential regions of the virus, such as the polyhedrin gene, and placed under the control of an AcNPV promoter, such as the polyhedrin promoter.

In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the sequence encoding the antibody of interest may be ligated to an adenovirus transcription / translation control complex, such as the late promoter and a three-part leader sequence. Then
This chimeric gene can be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertions in non-essential regions of the viral genome (eg, the E1 or E3 regions) result in a recombinant virus that is viable and capable of expressing the antibody molecule in the infected host (eg, Logan & Shenk)
1984, Proc. Natl. Acad. Sci. USA 81: 355-
359). Specific initiation signals may also be required for efficient translation of the inserted antibody-encoding sequence. These signals include the ATG start codon and adjacent sequences. In addition, this initiation codon may be used to ensure that the translation of the entire insert is in reading frame (r) of the desired coding sequence.
The phase must be the same as the leading frame. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (Bittner et al., 1987, Metho
ds in Enzymol. 153: 51-544).

In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (eg, glycosylation) and processing (eg, cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the heterologous protein expressed. To this end, eukaryotic host cells that have the cellular machinery for the correct processing of first transcription, glycosylation, and phosphorylation of the gene product can be used. Such mammalian host cells include CHO, VERY, BHK, Hela, COS, MDC
K, 293, 3T3, WI38, and especially, for example, BT483, Hs578
Including, but not limited to, breast cancer cell lines such as T, HTB2, BT20 and T47D, and normal breast cell lines such as, for example, CRL7030 and Hs578Bst.

For long-term, high-yield production of recombinant proteins, stable expression is preferred.
For example, cell lines that stably express the antibody molecule can be engineered. Rather than using an expression vector containing a viral origin of replication, the host cell can be selected from DNA controlled by appropriate expression control elements (eg, promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.) and selectable. It can be transformed with a marker. Following the introduction of the exogenous DNA, the engineered cells can be grown for 1-2 days in a concentrated medium and then switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection and forms foci, which allow the cells to stably integrate the plasmid into their chromosomes and grow and then be cloned and propagated into cell lines. To be able to This method can be advantageously used to engineer cell lines that express the antibody molecule. Such engineered cell lines may be particularly useful in screening and evaluating compounds that interact directly or indirectly with the antibody molecule.

A number of selection systems can be used, including herpes simplex virus thymidine kinase (Wigler et al., Cell 11: 223 (1977)), which can be used in tk-, hgprt-, or aprt- cells, respectively. Hypoxanthine-guanine phosphoribosyltransferase (Szybalska and S
zybalski, Proc. Natl. Acad. Sci. USA 48: 2
02 (1992)), and adenine phosphoribosyltransferase (Lo
wy et al., Cell 22: 817 (1980)) gene. Also, antimetabolite resistance can be used as a basis for selection for the following genes: dhfr (Wigle, which confers resistance to methotrexate)
r et al., Natl. Acad. Sci. USA 77: 357 (1980)); O
'Hare et al., Proc. Natl. Acad. Sci. USA 78: 152
7 (1981); gpt conferring resistance to mycophenolic acid (Mulligan
And Berg, Proc. Natl. Acad. Sci. USA 78:20
72 (1981)); neo (C which confers resistance to aminoglycoside G-418
Wu and Wu, linear Pharmacy 12: 488-505;
Biotherapy 3: 87-95 (1991); Tolstoshev,
Ann. Rev .. Pharmacol. Toxicol. 32: 573-596
(1993); Mulligan, Science 260: 926-932 (
1993); and Morgan and Anderson, Ann. Rev ..
Biochem. 62: 191-217 (1993); May 1993, TIB.
TECH 11 (5): 155-215); as well as hygro (Santere et al., Gene 30: 147 (198), which confers resistance to hygromycin.
4)). Methods of recombinant DNA technology generally known in the art that can be used include:
Ausubel et al. (Eds.), Current Protocols in Mol.
ecological Biology, John Wiley & Sons, NY (19
93); Kriegler, Gene Transfer and Express
session, A Laboratory Manual, Stockton P
ress, NY (1990); and Dracopoli et al. (eds.), Curr.
ent Protocols in Human Genetics, John
Chapters 12 and 13 of Wiley & Sons, NY (1994);
re-Garapin et al. Mol. Biol. 150: 1 (1981), which are incorporated herein by reference in their entirety.

The expression level of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of
vectors based on gene amplification
for the expression of cloned genes i
n. mammalian cells in DNA cloning, vol. 3, Academic Press, New York, 1987). If the marker can be amplified in a vector system expressing the antibody, increasing the level of inhibitor present in the host cell culture will increase the number of copies of the marker gene. Because the amplified region is associated with the antibody gene, production of the antibody is also increased (Crouse et al., Mol. Cell. Biol. 3:
257 (1983)).

The host cells are co-transfected with two expression vectors of the invention (a first vector encoding a polypeptide from the heavy chain and a second vector encoding a polypeptide from the light chain). Can be done. The two vectors may contain the same selectable marker that allows for equal expression of the heavy and light chain polypeptides. Alternatively, a single vector encoding both heavy and light chain polypeptides can be used. In such situations, the light chain should be placed in front of the heavy chain to avoid excess toxic free heavy chains (Proudfoot,
Nature 322: 52 (1986); Kohler, Proc. Natl
. Acad. Sci. USA 77: 2197 (1980)). The heavy and light chain coding sequences can include cDNA or genomic DNA.

Once an antibody molecule of the present invention has been recombinantly expressed, the antibody molecule can be purified by any method known in the art for the purification of immunoglobulin molecules (eg,
By chromatography (eg, ion exchange chromatography, affinity (especially by affinity to specific antigens after Protein A) and sizing column chromatography), centrifugation, differential solubility, or It can be purified (by any other standard technique for protein purification).

C. Antibody Conjugates The present invention relates to combining polypeptides of the present invention (or a portion thereof, preferably at least 10, 20, or 50 amino acids of a polypeptide) to produce a fusion protein. Includes antibodies that are alternatively fused or chemically attached (including both covalent and non-covalent attachments). The fusion need not be direct, but can occur through a linker sequence. The antibody may comprise a polypeptide of the invention (or a portion thereof, preferably at least 10,2,
(0 or 50 amino acids). For example, by fusing or binding a polypeptide of the present invention to an antibody specific for a particular cell surface receptor, the antibody will direct the polypeptide of the present invention to a particular cell type, either in vitro or in vivo. Can be used to target. Antibodies fused or conjugated to a polypeptide of the invention can also be used in in vitro immunoassays and purification methods using methods known in the art. For example,
Harbor et al., Supra and PCT Publication WO 93/21232; EP 439.
, 095; Naramura et al., Immunol. Lett. 39: 91-99
(1994); U.S. Patent No. 5,474,981; Gillies et al., PNAS.
89: 1428-1432 (1992); Fell et al. Immunol.
146: 2446-2452 (1991), which are incorporated by reference in their entirety.

The present invention further includes compositions comprising a polypeptide of the present invention fused or linked to a domain of an antibody other than the variable region. For example, a polypeptide of the invention can be fused or conjugated to the Fc region of an antibody, or a portion thereof. The antibody portion fused to a polypeptide of the invention may comprise the constant region, hinge region, CH1, CH2, and CH3 domains, or any combination of all or part of those domains. The polypeptide may also be fused or conjugated to the antibody portion described above to form a multimer. For example, an Fc portion fused to a polypeptide of the invention can form a dimer via a disulfide bond between the Fc portions. Higher multimeric forms can be made by fusing the polypeptide to portions of IgA and IgM. Methods for fusing or linking a polypeptide of the invention to an antibody moiety are known in the art. For example, U.S. Patent Nos. 5,336,603; 5,622,929; 5,359,04.
No. 6, No. 5,349,053; No. 5,447, 851; No. 5,112
, 946; EP 307, 434; EP 367, 166; PCT Publication WO
96/04388; WO 91/06570; Ashkenazi et al., Proc.
. Natl. Acad. Sci. USA 88: 10535-10538 (19
91); Zheng et al. Immunol. 154: 5590-5600 (1
995); and Vil et al., Proc. Natl. Acad. Sci. USA
89: 11337-11341 (1992) (the above references are incorporated by reference in their entirety).

As discussed above, the polypeptides of the present invention can be fused or conjugated to the antibody portions described above to increase the in vivo half-life of the polypeptide or to use methods known in the art. Used in the immunoassay used. Further, the polypeptides of the present invention can be fused or conjugated to the antibody portions described above to facilitate purification. One reported example is that the first two of the human CD4 polypeptides were
A chimeric protein comprising one domain and various domains of a heavy or light chain constant region of a mammalian immunoglobulin is described. (EP 394,827;
Traunecker et al., Nature 331: 84-86 (1988)).
The polypeptides of the present invention fused or conjugated to an antibody having a disulfide-linked dimeric structure (due to IgG) also bind to and bind to other molecules more than the monomeric secreted protein or protein fragment alone. It may be more efficient in sum. (Funtoulakis et al., J. Biochem. 270: 3.
958-3964 (1995)). In many cases, the Fc of the fusion protein
The moieties are advantageous in therapy and diagnosis, and thus may result, for example, in improved pharmacokinetic properties. (EP A 232,262). Alternatively, deletion of the Fc portion after the fusion protein has been expressed, detected, and purified is preferred. For example, if the fusion protein is used as an antigen for immunization, the F
The c portion can interfere with therapy and diagnosis. In drug discovery, for example, human proteins (eg, hIL-5) have been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. (Bennett et al., J. Molecular Recognition 8
: 52-58 (1995); Johanson et al. Biol. Chem. 2
70: 9449-9471 (1995). In addition, the antibodies or fragments thereof of the present invention can be fused to a marker sequence, such as a peptide that facilitates purification. In a preferred embodiment, the marker amino acid sequence is, inter alia, a pQE vector (QIAGEN, Inc.).
, 9259 Eton Avenue, Chatsworth, CA, 9131.
Hex-histidine peptides such as the tags provided in 1), many of which are commercially available. See, for example, Gentz et al., Proc. Natl. Ac
ad. Sci. USA 86: 821-824 (1989), hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include the “HA” tag corresponding to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (19).
84)) and the "flag" tag.

The present invention further includes antibodies or fragments thereof that are conjugated to a diagnostic or therapeutic agent. The antibodies can be used diagnostically to monitor tumor development or progression, for example, as part of a clinical trial procedure (eg, to determine the efficacy of a given treatment regimen). Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various proton emission tomography methods, and non-radioactive paramagnetic metals. Ions. See, for example, US Pat. No. 4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; the example, luciferase, luciferin, and aequorin can be mentioned; and examples of suitable radioactive material include ^{12 5 I, 131 I, 111} in or ⁹⁹ Tc.

Further, the antibody or fragment thereof can be conjugated to a therapeutic moiety (eg, a cytotoxin (eg, a cytostatic or cytocidal agent)), a therapeutic agent, or a radiometal ion. Cytotoxic or cytotoxic agents include any agents that are harmful to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetin, mitomycin, etoposide, teniposide, vincristine, vinblastine,
Colchicine, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoid, procaine, tetracaine, lidocaine, propranolol,
And puromycin, and analogs or homologs thereof. Therapeutic agents include antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (eg, chlormethamine, thioepa chlorambucil, melphalan, Carmustine (BSNU
) And lomustine (CCNU), cyclophosphamide (cyclothosp)
hamide), busulfan, dibromomannitol, streptozotocin,
Mitomycin C and cis-dichlorodiamineplatinum (II) (DDP)
Cisplatin), anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and Mitotic inhibitors, such as, but not limited to, vincristine and vinblastine.

The conjugates of the present invention can be used to modify a given biological response, and the therapeutic or drug moiety is not to be construed as being limited to conventional chemotherapeutic agents. For example,
The drug moiety can be a protein or polypeptide having the desired biological activity. Such proteins include, for example, toxins (eg, abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin); proteins (eg, tumor necrosis factor, a-interferon, β-interferon, nerve growth factor, platelet-derived growth factor) Tissue plasminogen activators, thrombotic or anti-angiogenic agents (eg, angiostatin or endostatin); or biological response modifiers (eg, lymphokines, interleukin-1 (“IL-1”), interleukins) -2 ("IL-2"), interleukin-6 ("IL-6"),
Granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.

Antibodies can also be attached to a solid support, which is particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Techniques for coupling such therapeutic moieties to antibodies are well known, for example, Arno.
n et al., Monoclonal Antibodies For Immuno.
targeting Of Drugs In Cancer Therapy
", Monoclonal Antibodies And Cancer T
herppy, Reisfeld et al. 243-56 (Alan R
. Liss, Inc. 1985); Hellstrom et al., "Antibody.
es For Drug Delivery ", Controlled Dru
g Delivery (second edition), Robinson et al. 623-
53 (Marcel Dekker, Inc. 1987); Thorpe, "A
antibody Carriers Of Cytotoxic Agents
In Cancer Therapy: A Review ", Monoclo
nal Antibodies '84: Biological And Cl
initial Applications, Pinchera et al., eds.
475-506 (1985); "Analysis, Results, And.
Future Prospective Of The Therapeuti
c Use Of Radiolabeled Antibody In Ca
nc Therapy ”, Monoclonal Antibodies
For Cancer Detection And Therapy, Bal
dwin et al. (eds.), pp. 303-16 (Academic Press 19)
85), and Thorpe et al., "The Preparation And And.
Cytotoxic Properties of Antibody-Tox
in Conjugates ", Immunol. Rev .. 62: 119-58
(1982).

Alternatively, the antibody can be conjugated to a second antibody, as described by Segal in US Pat. No. 4,676,980, which is hereby incorporated by reference in its entirety, Form an antibody heteroconjugate.

Antibodies, alone or with a cytotoxic agent and / or cytokine, with or without a therapeutic moiety attached thereto, can be used as therapeutics.

D. Assays for Antibody Binding The antibodies of the invention can be assayed for immunospecific binding by any method known in the art. Examples of immunoassays that can be used include (only to name a few) Western blots, radioimmunoassays, ELISAs (enzyme-linked immunosorbent assays), "sandwich" immunoassays,
Competitive and non-competitive assays using techniques such as immunoprecipitation assays, sedimentation reactions, gel diffusion sedimentation reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays Systems, including, but not limited to. Such an assay is conventional and
And are well known in the art (eg, Ausubel et al., Eds., 1994, Current Protocol, incorporated herein by reference in its entirety).
ols in Molecular Biology, Volume 1, John Wi
ley & Sons, Inc. , New York). Exemplary immunoassays are briefly described below (although these are not intended to be limiting).

Immunoprecipitation protocols generally involve RIPA buffer (1% NP-40 or Trito) supplemented with protein phosphatases and / or protease inhibitors (eg, EDTA, PMSF, aprotinin, sodium vanadate).
nX-100, 1% sodium deoxycholate, 0.1% SDS, 0.1%
0.01 M sodium phosphate at 15 M NaCl, pH 7.2, 1% Tr
lysing a population of cells in a lysis buffer, such as asylol, adding the antibody of interest to the cell lysate, incubating at 4 ° C. for a period of time (eg, 1-4 hours), protein A and Adding protein G sepharose beads to the cell lysate, incubating at 4 ° C. for at least about 1 hour, washing the beads in lysis buffer, and resuspending the beads in SDS / sample buffer The step of performing The ability of the antibody of interest to immunoprecipitate a particular antigen can be assayed, for example, by Western blot analysis. One skilled in the art is familiar with parameters that can be modified to increase the binding of the antibody to the antigen and reduce the background (eg, pre-clearing the cell lysate using Sepharose beads). ing. For further discussion on immunoprecipitation protocols, see, for example, Ausubel et al., Ed., 1994, Curren.
t Protocols in Molecular Biology, Volume 1, John Wiley & Sons, Inc. , New York, 10.
See 16.1

[0263] Western blot analysis generally involves the steps of preparing a protein sample, a polyacrylamide gel of the protein sample (eg, 8 depending on the molecular weight of the antigen).
% -20% SDS-PAGE), transferring the protein sample from its polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking solution (eg, 3% BSA or skim milk). Blocking the membrane in PBS with PBS, washing the membrane with a wash buffer (eg,
Washing in PBS-Tween 20), blocking the membrane with the primary antibody (antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking buffer A secondary antibody (recognizing the primary antibody) bound to an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (eg, ³² P or ¹²⁵ I) diluted in
For example, blocking the membrane with an anti-human antibody), washing the membrane in a wash buffer, and detecting the presence of the antigen. Those skilled in the art
One is familiar with parameters that can be modified to increase the signal detected and reduce background noise. For further discussion of Western blot protocols, see, for example, Ausubel et al., Eds., 1994, Current Protocols in Molecula.
r Biology, Volume 1, John Wiley & Sons, Inc.
, New York, 10.8.1.

ELISA comprises preparing an antigen, coating the wells of a 96-well microtiter plate with the antigen, binding to a detectable compound such as an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase). Adding the antibody of interest to the wells and incubating for a certain period of time, and detecting the presence of the antigen. In an ELISA, the antibody of interest need not be conjugated to a detectable compound; instead, a second antibody (recognizing the antibody of interest) conjugated to the detectable compound can be added to the well. Further, instead of coating the well with the antigen, the antibody can be coated on the well. In this case, a second antibody bound to the detectable compound can be added subsequent to the addition of the antigen of interest to the coated wells. One skilled in the art is familiar with parameters that can be modified to increase the signal detected, and other variations of ELISAs known in the art. ELIS
For further discussion of A, see, for example, Ausubel et al., Ed., 1994,
Current Protocols in Molecular Biolo
gy, Volume 1, John Wiley & Sons, Inc. , New Yo
See rk, 11.2.1.

The binding affinity of the antibody to the antigen and the off-rate of the antibody-antigen interaction (of
f-rate) can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay, which involves incubation of a labeled antigen (eg, ³ H or ¹²⁵ I) with an antibody of interest in the presence of increasing amounts of unlabeled antigen. And detection of the antibody bound to the labeled antigen.
The affinity of the antibody of interest for a particular antigen, and the binding off-rate, can be determined from data by Scatchard plot analysis. Competition with the second antibody can also be determined using a radioimmunoassay. In this case, the antigen is incubated with the antibody of interest conjugated to a labeled compound (eg, ³ H or ¹²⁵ I) in the presence of increasing amounts of an unlabeled second antibody.

E. Therapeutic Uses The present invention further relates to antibody-based therapies, which treat the antibodies of the present invention to treat one or more of the disclosed diseases, disorders or conditions. Administering to an animal, preferably a mammal, and most preferably a human patient. Therapeutic compounds of the invention include antibodies of the invention (including fragments, analogs and derivatives thereof, as described herein) and nucleic acids encoding the antibodies of the invention (described herein). Including, but not limited to, fragments, analogs and derivatives thereof, and anti-idiotype antibodies). The antibodies of the present invention can be used to treat, inhibit or prevent a disease, disorder or condition associated with abnormal expression and / or activity of a polypeptide of the present invention, such a disease, disorder or condition. Include, but are not limited to, autoimmune diseases, disorders or conditions associated with such diseases or disorders, including but not limited to: autoimmune hemolytic anemia, autoimmune neonatal thrombocytopenia Disease, idiopathic thrombocytopenic purpura, autoimmune cytopenia, hemolytic anemia, antiphospholipid syndrome, dermatitis, allergic encephalomyelitis, myocarditis, relapsing polychondritis, ulcerative colitis, densis Deposit disease, rheumatic heart disease, glomerulonephritis (
For example, IgA nephritis), pemphigus vulgaris, discoid lupus, multiple sclerosis, neuritis, uveitis, multiple endocrine diseases, purpura (eg, Henoho-Schönlein purpura), Reiter's disease Stiff man syndrome, autoimmune pneumonia, Gan-Barré syndrome, insulin-dependent diabetes mellitus, and autoimmune inflammatory eyes, autoimmune thyroiditis, hypothyroidism (ie, Hashimoto's thyroiditis), systemic lupus erythematosus, goodpasture Syndrome, pemphigus, receptor autoimmunity (eg, (a) Graves' disease, (b) myasthenia gravis, and (c) insulin resistance), autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, chronic joint Rheumatism, scleroderma with anti-collagen antibody, mixed connective tissue disease, polymyositis /
Dermatomyositis, pernicious anemia, idiopathic Addison's disease, infertility, glomerulonephritis (eg, primary glomerulonephritis and IgA nephropathy), bullous pemphigoid, Sjogren's syndrome, diabetes mellitus, and adrenergic drug resistance (asthma Or adrenergic drug resistance with cystic fibrosis), chronic active hepatitis (chronic acti)
ve hepatitis), primary biliary cirrhosis, other endocrine gland failure, vitiligo,
Vasculitis, post-MI, cardiotomy syndrome, urticaria, atopic dermatitis, asthma, inflammatory myopathy, graft versus host disease (GVHD) and other inflammatory disorders, granulomatous disorders, and atrophy Sexual disorders.

In certain embodiments, the antibodies of the invention are used to treat, inhibit, determine prognosis, diagnose or prevent rheumatoid arthritis.

In another specific embodiment, the antibodies of the invention are used to treat, inhibit, prognosticate, diagnose or prevent systemic lupus erythematosus.

In addition, the antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with immunodeficiencies, including those associated with severe combined immunodeficiency ( SCID) -X binding, SCID-autosome, adenosine deaminase deficiency (ADA deficiency), X-binding agammaglobulinemia (XLA)
, Bruton's disease, congenital agammaglobulinemia, X-linked infant agammaglobulinemia, acquired agammaglobulinemia, adult-onset agammaglobulinemia,
Late-onset agammaglobulinemia, hypogammaglobulinemia, hypergammaglobulinemia, infant transient hypergammaglobulinemia, unspecified hypergammaglobulinemia, agammaglobulinemia, unclassified immunodeficiency (CVID) (acquired), Viscott-Aldrich syndrome (WAS), X-linked immunodeficiency with excess IgM, non-X-linked immunodeficiency with excess IgM, selective IgA deficiency, IgG subclass deficiency (with IgA deficiency) Antibody deficiency with or without Igs, immunodeficiency with thymoma, Ig heavy chain deficiency, kappa chain deficiency, B-cell lymphoproliferative disorder (BLPD), selective IgM immunodeficiency, recessive Agammaglobulinemia (Swiss type), reticulodysplasia, neonatal neutropenia, severe congenital leukopenia, immunodeficiency Lymph dysplasia - growth deficiency or dysplasia, ataxia - telangiectasia, short limb dwarfism, X- binding lymphoproliferative syndrome (XLP), Ig
Nesoroff syndrome with s-mixed immune deficiency, purine nucleoside phosphorylase deficiency (PNP), MHC class II deficiency (insufficient lymphocyte syndrome), and severe combined immunodeficiency, but are not limited to these.

The antibodies of the present invention are used for preventing graft rejection and inflammation, and for treating arthritis.

Treatment and / or prevention of diseases and disorders associated with abnormal expression and / or activity of a polypeptide of the invention include, but are not limited to, alleviation of the symptoms associated with these diseases and disorders. Not done. Antibodies of the present invention are known in the art or can be provided in pharmaceutically acceptable compositions as described herein.

One summary of how the antibodies of the present invention can be used therapeutically is to treat locally or systemically in the body, or (eg, by complement (CDC) or by effector cells (ADCC)). Due to the direct cytotoxicity of the antibody (as mediated)
And binding the polynucleotide or polypeptide of the invention. Some of these approaches are described in more detail below. Given the teachings provided herein, one of skill in the art would recognize, without undue experimentation, how to use the antibodies of the present invention for diagnostic, monitoring, or therapeutic purposes. Understand.

The antibodies of the present invention can be used, for example, to increase the number or activity of effector cells that interact with the antibody, other monoclonal or chimeric antibodies, or lymphokines or hematopoietic growth factors (eg, IL-2, IL-3 and IL
-7, etc.).

The antibodies of the invention can be administered alone or in combination with other types of treatment, such as radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents.
Generally, administration of a species-derived or species-reactive product that is the same species as the patient (in the case of antibodies) is preferred. Thus, in a preferred embodiment, a human antibody,
Fragment derivatives, analogs, or nucleic acids are administered to a human patient for treatment or prevention.

For both immunoassays for the polynucleotides or polypeptides of the invention (including fragments thereof) and the treatment of disorders related thereto, high affinity and / or high affinity for the polypeptides or polynucleotides of the invention are provided. It is preferred to use potent, in vivo inhibitory and / or neutralizing antibodies, fragments thereof, or regions thereof. Such antibodies, fragments, or regions preferably have affinity for the polynucleotides or polypeptides of the present invention, including fragments thereof. The preferred binding affinity is 5
× 10 ⁻⁶ M, 10 ⁻⁶ M, 5 × 10 ⁻⁷ M, 10 ⁻⁷ M, 5 × 10 ⁻⁸ M, 10 ⁻⁸ M, 5
× 10 ⁻⁹ M, 10 ⁻⁹ M, 5 × 10 ⁻¹⁰ M, 10 ⁻¹⁰ M, 5 × 10 ⁻¹¹ M, 10 ⁻¹¹ M
5 × 10 ⁻¹² M, 10 ⁻¹² M, 5 × 10 ⁻¹³ M, 10 ⁻¹³ M, 5 × 10 ⁻¹⁴ M, 1
Binding affinities having a dissociation constant or Kd of less than 0 ^-14 M, 5 × 10 ^-15 M, and 10 ^-15 M are mentioned.

Transgenic Non-Human Animals The proteins of the invention can also be expressed in transgenic animals.
Mouse, rat, rabbit, hamster, guinea pig, pig, mini pig (micro
Any species of animal, including, but not limited to, o-pig), goats, sheep, cattle and non-human primates (eg, baboons, monkeys and chimpanzees) can be used to produce transgenic animals. . In certain embodiments,
Techniques described herein or otherwise known in the art are used for expression of a polypeptide of the invention in humans as part of a gene therapy protocol.

Any technique known in the art for introducing a transgene (ie, a nucleic acid of the invention) into an animal can be used to create a founder line of a transgenic animal.
ine). Such a technique is known as pronuclear microinjection (P
aterson et al., Appl. Microbiol. Biotechnol. 4
0: 691-698 (1994); Carver et al., Biotechnology.
y (NY) 11: 1263-1270 (1993); Wright et al., Biot.
technology (NY) 9: 830-834 (1991); and Hopp.
e et al., U.S. Patent No. 4,873,191 (1989)); Retrovirus-mediated gene transfer into the germline (Van der Putten et al., Proc. Nat).
l. Acad. Sci. USA 82: 6148-6152 (1985)), blastocysts or embryos; gene targeting in embryonic stem cells (Thompson et al., Cel).
l 56: 313-321 (1989)); Electroporation of cells or embryos (Lo, Mol Cell. Biol. 3: 1803-1814 (1983).
)); Introduction of the polynucleotide of the present invention using a gene gun (for example, Ulmer
Et al., Science 259: 1745 (1993)); introduction of the nucleic acid construct into pluripotent stem cells and retransfer of the stem cells into blastocysts; and sperm-mediated gene transfer (Lavitrano et al.). , C
ell 57: 717-723 (1989)); and the like. For a review of such techniques, Gordon, "Transgenic Animals", Int., Incorporated herein by reference in its entirety.
l. Rev .. Cytol. 115: 171-229 (1989).
U.S. Patent No. 5,464,764 (Capecchi et al., Positive-N).
EGATIVE Selection Methods and Vector
s); U.S. Patent No. 5,631,153 (Capecchi et al., Cell ann.).
d Non-Human Organisms Containing Pre
determined Genomic Modifications and
Positive-Negative Selection Methods
and Vectors for Making Same); US Patent No. 4
No., 736,866 (Leder et al., Transgenic Non-Huma.
n Animals); and U.S. Patent No. 4,873,191 (Wagner).
Et al., Genetic Transformation of Zygotes)
See also, each of which is incorporated herein by reference in its entirety. The content of each document listed in this paragraph is incorporated herein by reference in its entirety.

[0278] Any technique known in the art can be used to generate transgenic clones comprising the polynucleotides of the invention (eg, cultured, quiescently induced embryonic, fetal or adult cells). Nuclear transfer into the nucleus of enucleated oocytes from cells (Campell et al., Nature 380: 64-66 (1996); Will)
Mut et al., Nature 385: 810-813 (1997), each of which is hereby incorporated by reference in its entirety).

The present invention relates to transgenic animals having a transgene in all of their cells, as well as animals having a transgene in some (but not all) cells (ie, mosaic animals or chimeric animals). provide. The transgene is
It can be integrated as one transgene or as multiple copies, such as a concatamer (eg, head-to-head or head-to-tail tandem). This transgene is also described, for example, in the teachings of Lasko et al. (Lasko et al., Proc. Natl.
Acad. Sci. USA 89: 6322-2236 (1992)) and can be selectively introduced into specific cell types and activated. The regulatory sequences required for such cell type-specific activation will depend on the particular cell type of interest, and they will be apparent to those skilled in the art. If it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred. Briefly, when such a technique is used, a vector containing several nucleotide sequences homologous to the endogenous gene is transformed into a nucleotide sequence of the endogenous gene through homologous recombination with a chromosomal sequence. And designed to disrupt the function of the nucleotide sequence. The transgene can also be selectively introduced into a particular cell type, and is thus, for example, Gu et al. (Gu et al., Science).
265: 103-106 (1994)), and endogenous genes are inactivated only in the introduced cell type. The regulatory sequences required for such cell type-specific inactivation will depend on the particular cell type of interest, and they will be apparent to those skilled in the art. The content of each document listed in this paragraph is incorporated herein by reference.

[0280] Once the transgenic animal is created, the expression of the recombinant gene can be assayed using standard techniques. Initial screening can be accomplished by Southern blot analysis or PCR techniques, and analysis of animal tissue can confirm that transgene integration has occurred. Transgene mRNA expression levels in tissues of transgenic animals can also be determined by Northern blot analysis, in situ hybridization analysis and reverse transcriptase P analysis of tissue samples obtained from the animals.
It can be assessed using techniques including, but not limited to, CR (rt-PCR). Samples of the transgenic gene-expressing tissue can also be assessed immunocytochemically or immunohistochemically using antibodies specific for the transgene product.

Once founders have been generated, they can be crossed, inbred, outbred or crossed to produce colonies of a particular animal. Examples of such mating strategies include, but are not limited to: outcrossing of founders with more than one integration site to establish another lineage; additive expression of each transgene By effect, inbreeding of separate strains to produce complex transgenics expressing higher levels of the transgene; certain routines for both enhancing expression and eliminating the need to screen animals by DNA analysis. Crosses of heterozygous transgenic animals that produce animals homozygous for the integration site; crosses of separate homozygous lines to generate compound heterozygous or homozygous lines; and the desired experimental model Crosses to place the transgene on a suitable different background.

The transgenic and “knock-out” animals of the present invention are animal model systems that are useful in generating the biological function of a TR2 receptor polypeptide, studies of conditions and / or disorders associated with aberrant TR2 receptor expression. And screening for compounds that are effective in ameliorating such conditions and / or disorders.

In a further embodiment of the present invention, cells that have been genetically engineered to express a protein of the present invention, or that have been genetically engineered to not express a protein of the present invention (eg, knockouts), can be used in vivo. Administer to patients. Such cells can be obtained from patients (ie, animals including humans) or MHC compatible donors, and include fibroblasts, bone marrow cells, blood cells (eg, lymphocytes), adipocytes, muscle cells, endothelial cells, and the like. But not limited to them. This cell,
For example, transduction (using viral vectors and preferably vectors that incorporate the transgene into the cell genome) or transfection procedures (including the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. , But not limited to, for introducing a coding sequence of a polypeptide of the invention into a cell or destroying the coding sequence and / or the endogenous regulatory sequence bound to the polypeptide of the invention. To do so, it is engineered in vitro using recombinant DNA technology. The coding sequence for a polypeptide of the present invention may be placed under the control of a strong constitutive or inducible promoter or promoter / enhancer to achieve expression and preferably secretion of the polypeptide of the present invention. Engineered cells that express and preferably secrete a polypeptide of the present invention can be introduced systemically into a patient, for example, in the circulation or intraperitoneally. Alternatively, the cells can be incorporated into a matrix and transplanted into the body (eg, genetically engineered fibroblasts can be transplanted as part of a skin graft; genetically engineered endothelial cells can be transplanted into lymph or vascular grafts). (Eg, Anderson et al., US Pat. No. 5,399,349)
And Mulligan and Wilson, US Patent No. 5,460,95.
See No. 9. Each of these is hereby incorporated by reference in its entirety).

Where the cells to be administered are non-autologous or non-MHC compatible cells, they may be administered using well-known techniques which prevent the development of a host immune response against the transduced cells. For example, the cells can be introduced in an encapsulated form, and while the components can be exchanged with the immediate extracellular environment, the introduced cells cannot be recognized by the host immune system.

(Detection of Disease State) The TNF family ligand is a TNF family receptor (TR2 of the present invention).
(Including receptors) to induce various cellular responses. TNF-β (
Potential ligands for the TNF receptor protein are involved in a number of biological processes (lymphocyte development, tumor necrosis, induction of antiviral status, activation of polymorphonuclear leukocytes,
It is known to be involved in the induction of class I major histocompatibility complex to endothelial cells, the induction of adhesion molecules to the endothelium and the stimulation of growth hormone (Ruddle and Homer, Prog. Allergy, 40: 162). -182 (1988
)). TNF-α (also a ligand for the TNF receptor protein) is used for rapid tumor necrosis, immune stimulation, autoimmune diseases, transplant rejection, development of antiviral responses, septic shock, cerebral malaria, cytotoxicity, chemotherapy (Nata et al, J. Immunol. 136 (7): 2483 (198).
7); Porter, Tibtech 9: 158-162 (1991)), reported to have a role in growth regulation, vascular endothelial and metabolic effects. TNF-α also shows that endothelial cells have various factors (PAI-1, IL-
1, including GM-CSF and IL-6) and promote cell proliferation. In addition, TNF-α up-regulates various cell adhesion molecules such as E-selectin, ICAM-1 and VCAM-1. TNF-α and Fas
Ligands have also been shown to induce programmed cell death.

Cells that express the TR2 polypeptide and are thought to have a strong cellular response to the TR2 receptor ligand include B lymphocytes (CD19 ⁺ ), CD
Includes both 4 ^- T and CD8 ⁺ T lymphocytes, monocytes, endothelial cells and other cell types shown in Tables V and VI. A "cellular response to a TNF family ligand" contemplates any genotypic, phenotypic, and / or morphological change to a cell, cell line, tissue, tissue culture or patient induced by a TNF family ligand. I do. As indicated, such cellular responses include not only normal physiological responses to TNF family ligands, but also diseases associated with increased cell proliferation or inhibition of increased cell proliferation (eg, by inhibiting apoptosis). Are also mentioned. Apoptosis-programmed cell death is a physiological mechanism involved in the loss of peripheral T lymphocytes of the immune system, and its disregulation can lead to many different pathogenic processes (Ameisen, J. C., AIDS 8: 1197-1
213 (1994); Krammer, P .; H. Et al., Curr. Opin. Im
munol. 6: 279-289 (1994)).

When a particular tissue in a mammal with a particular disease state associated with abnormal cell survival is compared to a corresponding “standard” mammal (ie, a homologous mammal without the disease state), Significantly altered levels of the TR2 receptor protein,
And express mRNA encoding the TR2 receptor protein. In addition, because some forms of the protein are secreted, increased levels of the TR2 receptor protein will result in a mammal having the disease state when compared to serum from a homologous mammal not having the disease state. It is believed that it can be detected in certain body fluids of origin, such as serum, plasma, urine, and cerebrospinal fluid. Therefore,
The present invention provides diagnostic methods that are useful during the diagnosis of a disease state. This diagnosis is
Measuring the expression level of the gene encoding the TR2 receptor protein in a mammalian cell or body fluid, and comparing the standard TR2 receptor gene expression level to the measured gene expression level, whereby the gene compared to the standard Increasing or decreasing expression levels indicates a particular disease state associated with abnormal cell survival.

If the diagnosis of a disease state involving the TR2 receptor of the present invention has already been made according to conventional methods, the present invention is useful as a prognostic indicator, thereby significantly aberrant TR2 receptor gene expression. Indicating patients will suffer worse clinical results than patients expressing lower levels of this gene.

"Assaying the expression level of a gene encoding a TR2 receptor protein" refers to the level of TR2, TR2-SV1 and / or TR2-SV2 receptor protein or TR2, TR2- in a first biological sample. SV1
And / or the level of mRNA encoding the TR2-SV2 receptor protein directly (eg, by determining or estimating absolute protein or mRNA levels) or relatively (eg, in a second biological sample). Qualitatively or quantitatively (by comparing against TR2, TR2-SV1 and / or TR2-SV2 receptor protein or mRNA levels in a target sample).

Preferably, TR2 receptor protein levels or mRNA levels in the first biological sample are measured or estimated and compared to standard TR2 receptor protein or mRNA levels. This standard is taken from a second biological sample obtained from an individual without a disease state. As will be appreciated in the art, once the standard TR2 receptor protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.

By “biological sample” is intended any biological sample, cell line, tissue culture, or other source containing a TR2 receptor protein or mRNA obtained from an individual. Biological samples include mammalian body fluids (eg, serum, plasma, urine, synovial fluid, and cerebrospinal fluid) containing secreted mature TR2 receptor protein, as well as thymus, prostate, heart, placenta, muscle, liver, spleen , Lungs, kidneys and other tissues. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. If the biological sample is intended to contain mRNA, a tissue biopsy is the preferred source.

Disorders associated with increased cell survival or inhibition of apoptosis include cancer (
For example, follicular lymphoma, cancer with a p53 mutation, and hormone-dependent tumors (colorectal, heart, pancreatic, melanoma, retinoblastoma, glioblastoma, lung, intestinal, testicular, gastric, These include neuroblastoma, myxoid, myoma, lymphoma, endothelial, osteoblastoma, giant cell tumor, osteosarcoma, chondrosarcoma, glandular type, breast cancer, prostate cancer, kaposi sarcoma and ovarian cancer. Autoimmune diseases (eg, systemic lupus erythematosus and immune-associated glomerulonephritis rheumatoid arthritis) and viral infections (eg, herpes virus, poxvirus and adenovirus), information versus host graft disease, acute Graft rejection and chronic graft rejection are included. Diseases associated with decreased cell survival or increased apoptosis include A
IDS; neurodegenerative disorders (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration); myelodysplastic syndrome (eg, aplastic anemia), ischemic injury (eg, Myocardial infarction, ischemic injury caused by stroke and reperfusion injury), toxin-induced liver disease (eg, liver disease caused by alcohol), septic shock, cachexia and anorexia.

In a preferred embodiment, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides of the invention are used to treat or prevent autoimmune diseases and / or cancer (eg, as described herein). The cancers disclosed in, for example, lymphocytic leukemia (eg, MLL and chronic lymphocytic leukemia (CL
L)), and follicular lymphomas). In another embodiment, the TR2, TR2-SV1 and / or TR2-
An SV2 polynucleotide or polypeptide is a cancerous cell or tissue (eg,
Used to activate, differentiate or proliferate B cell lineage-related cancers (eg, CLL and MLL), lymphocytic leukemia, or lymphoma, thereby transforming the cells into cancer treatments (eg, chemotherapy or radiation therapy) Make them more vulnerable.

[0294] Assays available for detecting levels of soluble receptor are well known to those of skill in the art, and for example, radioimmunoassays, binding competition assays, Western blot analysis, preferably ELISA assays may be used.

[0295] TR2 receptor protein-specific antibodies comprise an intact TR2 receptor protein or an antigenic polypeptide portion thereof, which combine a carrier protein, such as albumin, with an animal system (eg, rabbit or mouse). Or can be raised for long enough (at least about 25 amino acids, if present without a carrier).

As used herein, the term “antibody” (Ab) or “monoclonal antibody” (mAb) refers to intact molecules as well as antibody moieties that can specifically bind to TR2 receptor proteins (eg, Fab and F (ab ') ₂ fragment). Fab and F (ab ') ₂ fragments lack the Fc fragment of the intact antibody, are cleared more rapidly from the circulation,
And may have less nonspecific tissue binding of intact antibodies (Wahl
J. et al. Nucl. Med. 24: 316-325 (1983)). Therefore, these portions are preferred.

[0297] The antibodies of the present invention can be prepared by any of a variety of methods. For example, TR2,
Cells expressing the TR2-SV1 and / or TR2-SV2 receptor proteins or antigenic fragments thereof can be administered to animals to induce the production of serum containing polyclonal antibodies. In a preferred method, TR2, TR2
A preparation of -SV1 and / or TR2-SV2 receptor protein is prepared and purified such that the preparation is substantially free of natural contaminants.
Such a preparation is then introduced into an animal to produce a higher specific activity polyclonal antiserum.

In a most preferred method, the antibodies of the present invention are monoclonal antibodies (or TR2 receptor protein binding fragments thereof). Such monoclonal antibodies are available from hybridoma technology (Kohler et al., Nature 256: 4).
95 (1975); Kohler et al., Eur. J. Immunol. 6: 511
(1976); Kohler et al., Eur. J. Immunol. 6: 292 (1
976); Hammerling et al .: Monoclonal Antibodi.
es and T-Cell Hybridomas, Elsevier, N .;
Y. , (1981) pp. 563-681). In general,
Such a procedure can be performed using the TR2 receptor protein antigen or, more preferably, the TR2 receptor protein antigen.
Immunization of animals (preferably mice) with cells expressing the 2 receptor protein. Suitable cells can be recognized by an antigen capable of binding the anti-TR2 receptor protein antibody. Such cells can be cultured in any suitable tissue culture medium; however, supplemented with 10% fetal bovine serum (immobilized at about 56 ° C.) and about 10 g / l of non-essential amino acids, about 10 g / l. Preferably, it is cultured in Earle's modified Eagle's medium supplemented with 1,000 U / ml penicillin and about 100 μg / ml streptomycin. The splenocytes of such mice are extracted and fused with an appropriate myeloma cell line. Any suitable myeloma cell line can be used in accordance with the present invention; however, American type culture
Collection (Rockville, Maryland) it is preferable to employ the parent myeloma cell line (SP ₂ O), available from. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then are compared to Wands et al.
cloning by limiting dilution as described by troenterology 80: 225-232 (1981)). The hybridoma cells resulting from such a selection are then assayed to identify clones that secrete antibodies capable of binding the TR2 receptor protein antigen.

(Agonists and Antagonists of TR2 Receptor Function) In one aspect, the present invention relates to methods for inhibiting TNF family ligand-induced TR2 activity (eg, cell proliferation, development of hematopoiesis).
. The method involves administering to a cell expressing a TR2 polypeptide an effective amount of a TR2 receptor ligand, analog or antagonist capable of reducing TR2 receptor-mediated signaling. Preferably, TR2 receptor-mediated signaling is increased to treat the disease. Here, increased cell proliferation is shown.
Antagonists may include solubilized forms of the TR2 receptor and antibodies to TR2 polypeptides that block TR2 receptor-mediated signaling. Preferably, TR2 receptor-mediated signaling is reduced to treat the disease.

In a further aspect, the present invention relates to a method for increasing cell proliferation induced by a TNF family ligand. The method comprises administering to a cell expressing a TR2 polypeptide an effective amount of an agonist capable of increasing TR2 receptor-mediated signaling. Preferably, TR2 receptor-mediated signaling is increased to treat the disease. Here, reduced cell proliferation is shown.
Agonists of the present invention include T2 that stimulates TR2 receptor-mediated signaling.
Monoclonal antibodies to the R2 polypeptide are included. Preferably, TR
Increase 2 receptor-mediated signaling and treat disease.

By “agonist” is intended naturally occurring and synthetic compounds that can promote cell proliferation and differentiation mediated by a TR2 polypeptide. Such agonists include factors that increase the expression of the TR2 receptor or increase the sensitivity of the expressed receptor. By "antagonist" is intended naturally occurring and synthetic compounds that can inhibit TR2-mediated cell proliferation and differentiation. Such antagonists include TR2
Factors that reduce the expression of the receptor or reduce the sensitivity of the expressed receptor. Whether some candidate "agonists" or "antagonists" of the present invention can promote or inhibit cell proliferation and differentiation is determined using TNF family ligand / receptor cell response assays known in the art. (A more detailed description is given below).

[0302] One such screening technique involves the use of cells that express the receptor (eg, transfected CHO cells) in a system that measures extracellular pH changes caused by receptor activation (eg, Scien
ce 246: 181-296 (October 1989)). For example, a compound can be contacted with a cell that expresses a receptor polypeptide of the invention, and a second messenger response (eg, signal transduction or pH change)
Can be measured to determine if a potential compound activates or inhibits the receptor.

Another such screening technique involves introducing RNA encoding the receptor into Xenopus oocytes to transiently express the receptor. The receptor oocyte can then be contacted with a receptor ligand, and the compound can be screened, followed by inhibition or activation of a calcium signal if screening for a compound that is believed to inhibit receptor activation. Can be detected.

Another method is to screen for compounds that inhibit activation of the receptor polypeptide of the antagonist of the invention by determining inhibition of binding of the labeled ligand to cells having the receptor on its surface. Is included.
Such a method involves transfecting a eukaryotic cell with DNA encoding the receptor, such that the cell expresses the receptor on its surface, and the cell in the presence of a labeled form of a known ligand. Is contacted with a compound. The ligand can be labeled, for example, by radioactivity. The amount of labeled ligand bound to the receptor is measured, for example, by measuring the radioactivity of the receptor. If the compound binds to the receptor as determined by a decrease in labeled ligand that binds to the receptor, the binding of the labeled ligand to the receptor is inhibited.

The solubilized forms of the polypeptides of the present invention can be utilized in the ligand binding assays described above. These forms of the TR2 receptor are contacted with the ligand in the extracellular medium after secretion of the receptor. Then, the secreted protein is TR2
A determination is made as to whether to bind to the receptor ligand.

Additional screening assays for agonists and antagonists of the invention are described in Tartaglia, L .; A. And Goeddel, D .; V. ,
J. Biol. Chem. 267 (7): 4304-4307 (1992).

Thus, in a further aspect, the candidate agonist or antagonist is TN
Screening methods are provided for determining whether a cellular response to an F family ligand can be enhanced or inhibited. The method comprises contacting a cell expressing the TR2 polypeptide with the candidate compound and a TNF family ligand, assaying the cellular response, and comparing the cellular response to a standard cellular response. Are assayed when contact is made with the ligand in the absence of the candidate compound, whereby an increase in the cellular response above the standard indicates that the candidate compound is an agonist of the ligand / receptor signaling pathway. And a reduced cellular response as compared to a standard indicates that the candidate compound is an antagonist of the ligand / receptor signaling pathway. By "assaying a cellular response", qualitatively or quantitatively measuring the cellular response to a candidate compound and / or TNF family ligand (eg, determining or estimating an increase or decrease in T cell proliferation or in tritiated thymidine labeling) That is intended). According to the present invention, a cell expressing a TR2 polypeptide comprises:
It may be contacted with a TNF family ligand administered either endogenously or exogenously.

In a further aspect, using a thymocyte proliferation assay, both ligands and potential drug candidates can be identified. For example, thymocytes are separated from tissue and grown in culture. DNA precursor incorporation (e.g., < ³ > H-thymidine or 5-bromo-2'-deoxyuridine (BrdU)) is monitored as a parameter of DNA synthesis and cell growth. Cells with BrdU incorporated into DNA can be detected using a monoclonal antibody against BrdU and measured by a secondary antibody conjugated with an enzyme or a fluorescent dye. The reaction is quantified by fluorimetry or by spectrophotometry. Two control wells and experimental wells are prepared as described above, and TNF-β or cognate ligand is added to all wells, while the solubilized receptor polypeptide of the invention contains the compound to be screened. It is added separately to the second control well together with the well. The ability of the compound being screened to stimulate or inhibit the interaction can then be quantified.

Agonists according to the present invention include compounds (eg, TNF family ligand peptide fragments, transforming growth factor β, and neurotransmitters (eg, glutamate, dopamine, N-methyl-D-aspartate). Preferred agonists include polyclonal and monoclonal antibodies raised against the TR2 polypeptide or a fragment thereof Such agonist antibodies raised against the TNF family receptor include Tartaglia, LA et al. Proc. Natl. Acad. Sc.
i. USA 88: 9292-9296 (1991); and Tartagl.
ia, L .; A. And Goeddel, D .; V. J. Biol. Chem. 2
67 (7): 4304-4307 (1992). See also PCT Application Publication No. WO 94/09137. More preferred agonists include chemotherapeutic agents (eg, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate, and vincristine). Other agonists include ethanol and β-
Amyloid peptide (Science 267: 1457-145).
8 (1995)).

Antagonists according to the present invention include soluble forms of the TR2 receptor (eg, FIGS. 1A-1 containing a ligand binding domain from the extracellular region of the full length receptor).
B, a fragment of the TR2 receptor shown in B). Such a soluble form of the receptor, which may be naturally occurring or synthetic, comprises TN
Antagonizes TR2, TR2-SV1 or TR2-SV2-mediated signaling by competing with the cell surface bound form of the receptor for binding to F-family ligands. Antagonists of the present invention also include TNF family ligands and TNFs as described below in Examples 5 and 6.
Antibodies specific for the R2-Fc fusion protein are included.

By “TNF family ligand” is intended a naturally occurring ligand, a recombinant ligand, and a synthetic ligand capable of binding to a member of the TNF receptor family and inducing its ligand / receptor signaling pathway. . Members of the TNF ligand family include, but are not limited to: TNF-α, lymphotoxin-α (also known as LT-α, TNF-β), LT-β (complex heteromeric LT-β). FasL, CD40L, CD27L, CD30L, 4-IBBL, OX4
0L, and nerve growth factor (NGF).

The experiments set forth in Example 6 demonstrate that the TR2 receptors of the present invention can induce lymphocyte proliferation. Further, such proliferation can be inhibited by a TR2 protein fragment fused to an Fc antibody fragment. Therefore, TR
Two receptor / Fc fusion proteins, and nucleic acid molecules encoding such proteins, are specifically included within the scope of the present invention. These fusion proteins include fusion proteins having the amino acid sequence of the extracellular domain of the TR2 protein of the present invention. Some examples of TR2 extracellular domains that are useful in preparing a TR2 receptor / Fc fusion protein include amino acids 1-192, 37-192, 50-192 and 100-192 in SEQ ID NO: 2.

TNFα was shown to protect mice from infection with Herpes simplex virus type 1 (HSV-1). Rossol-Voth, R.A. J
. Gen. Virol. 72: 143-147 (1991). Although the mechanism of the protective effect of TNFα is unknown, it appears that neither interferon nor killing by NK cells is involved. One member of the TNFR family has been shown to mediate HSV-1 entry into cells. Montgomery, R .; Et al., Eur. Cyto
kin Newt. 7: 159 (1996). In addition, antibodies specific for this TNFR extracellular domain block HSV-1 entry into cells. Accordingly, TR2 receptors of the present invention include both TR2 amino acid sequences and antibodies that can prevent TNFR-mediated virus entry into cells. Such sequences and antibodies may function by either competing with TNFRs located on the cell surface for binding to the virus, or by directly blocking the binding of the virus to cell surface receptors.

Similarly, antibodies specific for the extracellular domain of the TR2 receptor of the present invention, as well as other TR2 antagonists, can also block HSV-1 entry into cells. Therefore, these antagonists are effective in treating and preventing Herpes simplex infection.

[0315] Antibodies according to the present invention can be prepared by any of a variety of methods using the TR2 receptor immunogens of the present invention. Such TR2 receptor immunogens include or consist of the ligand binding domain, extracellular domain, transmembrane domain, intracellular domain or any combination thereof of the TR2 receptor, SEQ ID NO: 26, FIGS. 1A-1B. The TR2 receptor protein and TR2-SV1 (FIGS. 4A-4C (SEQ ID NO: 5)) and TR2-SV2 (FIGS. 7A-7C (SEQ ID NO: 8)) polypeptides shown in (SEQ ID NO: 2)
Any of these may or may not include a leader sequence) as well as polypeptide fragments of the receptor.

Polyclonal Antibody Agonists or Antagonists According to the Invention and Mono
Clonal antibody agonists or antagonists include Tartaglia and
Goeddel, J .; Biol. Chem. 267 (7): 4304-4307
(1992); Tartaglia et al., Cell 73: 213-216 (19
93) and those published in PCT Application Publication No. WO 94/09137
Can be triggered according to the law. As used herein, the term “antibody” (Ab)
Alternatively, a "monoclonal antibody" (mAb) is an intact component capable of binding an antigen.
Offspring and fragments thereof (e.g., Fab fragments and F (ab ') _Two (Such as fragments). Fab fragment and F
(Ab ')_TwoThe fragment lacks the intact antibody Fc fragment,
Tissue non-specific disappears more quickly from circulation and has less intact antibodies
(Wahl et al., J. Nucl. Med. 24: 316-325 (
1983)).

In a preferred method, the antibodies according to the invention are mAbs. Such mA
b can be prepared using hybridoma technology (Kohler and Mil)
1stein, Nature 256: 495-497 (1975) and U.S. Pat. No. 4,376,110; Harlow et al., Antibodies; AL
laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor,
NY, 1988; Monoclonal Antibodies and Hy.
bridgemas: A New Dimension in Biological
al Analyzes, Plenum Press, New York, NY
, 1980; Campbell, "Monoclonal Antibody.
Technology ", Laboratory Technologies in
Biochemistry and Molecular Biology,
Volume 13 (Burdon et al., Eds.), Elsevier, Amsterdam (1
984)).

[0318] Proteins and other compounds that bind the TR2 receptor domain are also candidate agonists and antagonists according to the present invention. Such binding compounds can be "captured" using a yeast two-hybrid system (Fields and Song, Nature 340: 245-246 (1989)). A modified version of the yeast two-hybrid system is described by Roger Brent and his coworkers (Gyuris, J. et al., Cell 75: 791-803 (1993).
Zervos, A .; S. Et al., Cell 72: 223-232 (1993).
). Preferably, this yeast two-hybrid system is used according to the present invention and comprises the ligand binding domain, extracellular domain of the TR2 receptor,
Captures compounds that bind to the intracellular domain and the transmembrane domain. Such compounds are good candidate agonists and antagonists of the present invention.

Using the two-hybrid assay described above, the intracellular domain of the TR2 receptor, or a portion thereof, can be used to identify cellular proteins that interact with the receptor in vivo. Such assays can also be used to identify ligands with potential agonist or antagonist activity of TR2 receptor function. This screening assay has been used previously to identify proteins that interact with the cytoplasmic domain of mouse TNF-RII, and has led to the identification of two receptor binding proteins. Rothe, M .; Et al., Cell 78:68.
1 (1994). Such proteins and amino acid sequences that bind to the cytoplasmic domain of the TR2 receptor are good candidate agonists and antagonists of the present invention.

[0320] Other screening techniques include the use of cells (eg, transfected CHO cells) that express the polypeptide of the invention in a system that measures extracellular pH changes caused by receptor activation. (For example, S
science 246: 181-296 (1989)). In another example, a potential agonist or antagonist can be contacted with a cell that expresses a polypeptide of the invention, and a second messenger response (eg, signal transduction) is measured and the potential antagonist or agonist is efficacious. May be determined.

[0321] TR2 receptor agonists can be used to stimulate ligand activation (eg, inhibition of tumor growth and necrosis of certain implantable tumors). The agonist also
Used, cell differentiation (eg, T-cell, fibroblast and hematopoietic cell differentiation)
Can be stimulated. Agonists for the TR2 receptor also protect the host against microorganisms and related diseases (Listeria monocytogenes).
And enhance the role of TR2 in the prevention of Chlamidiae. This agonist is also used and the detrimental effects of ionizing radiation produced during the course of radiation therapy (enzyme denaturation, lipid peroxidation, and DN
A damage).

Agonists to the receptor polypeptides of the present invention can be used to enhance the role of TNF in protecting the host against microorganisms and to prevent related diseases. This agonist may also be used to remove the deleterious effects of ionizing radiation produced during the course of radiotherapy (eg, enzyme denaturation, lipid peroxidation, and D
NA damage).

This agonist is also used to mediate antiviral responses, regulate proliferation, mediate immune responses, and increase the rate of lymphocyte proliferation and differentiation by increasing the rate of disease (
For example, one can treat immunodeficiencies associated with HIV).

An antagonist to a polypeptide of the invention can be used to inhibit ligand activation (eg, stimulation of tumor growth and necrosis of certain implantable tumors). This antagonist may also be used to inhibit cell differentiation, such as T cell, fibroblast and hematopoietic cell differentiation. Antagonists can also be used to treat autoimmune diseases (eg, graft-versus-host reaction and allograft rejection), and T-cell mediated autoimmune diseases (eg, AIDS). T cell proliferation has been shown to be stimulated through the type 2 TNF receptor. Thus, antagonizing the receptor can block T cell proliferation and treat T cell mediated autoimmune diseases.

The immunodeficient condition that defines AIDS is secondary to a decrease in the number and function of CD4 ⁺ T lymphocytes. Recent reports estimate daily CD4 ⁺ T cell loss between 3.5 × 10 ⁷ and 2 × 10 ⁹ cells (Wei X. et al.
Et al., Nature 373: 117-122 (1995)). One cause of CD4 ⁺ T cell depletion in the background of HIV infection is thought to be HIV-induced apoptosis. Indeed, HIV-induced apoptotic cell death has been demonstrated to be more significant not only in vitro, but also in infected individuals (Am
eisen, J .; C. , AIDS 8: 1197-1213 (1994); Fi.
nkel, T .; H. And Banda, N .; K. , Curr. Opin. Imm
unol. 6: 605-615 (1995); Muro-Cacho, C .; A.
J. et al. Immunol. 154: 5555-5566 (1995)). In addition, apoptosis and CD4 ⁺ T lymphocyte depletion have been demonstrated in different animal models of AIDS (Brunner, T. et al., Nature 373: 441-444 (1995).
Gougeon, M .; L. Et al., AIDS Res. Hum. Retrovi
9: 553-563 (1993)), and apoptosis is not observed in those animal models where viral replication does not result in AIDS (Gougeon, ML et al., AIDS Res. Hum.
. Retroviruses 9: 553-563 (1993)). Further data indicate that uninfected but primed or activated T lymphocytes from HIV infected individuals undergo apoptosis after encountering the TNF family ligand FasL. Using a monocyte cell line that produces death after HIV infection, it has been demonstrated that infection of U937 cells with HIV results in de novo expression of FasL and FasL-mediated HIV-induced apoptosis (Badley, AD et al.). J. Virol. 70: 199-206 (1996)). In addition, TNF family ligands are detected in uninfected macrophages, and after HIV infection, their expression is up-regulated, resulting in the selective killing of uninfected CD4 ⁺ T lymphocytes (Badley, A D. et al., J. Virol.
99-206 (1996)).

As shown in Example 6, the TR2 receptor shown in FIGS. 1A-1B is expressed on CD4 ⁺ T lymphocytes and is able to induce lymphocyte proliferation. Thus, the invention provides a method for treating an HIV ⁺ individual, comprising administering an agonist of the invention to increase the rate of proliferation and differentiation of CD4 ⁺ T lymphocytes. Such agonists include factors that can induce TR2 receptor expression (eg, TNFα, PMA and DMSO) or factors that can promote the signal of such receptors that induce proliferation and differentiation of lymphocytes. . The modes of administration and dosing are discussed in detail below.

[0327] In allograft rejection, the immune system of the recipient animal is not primed first for a response. Because most parts of the immune system are primed only by surrounding antigens. Tissues from other members of the same species are not present in the same state, for example, in the presence of viruses and bacteria. In the case of allograft rejection, an immunosuppressive regimen is created to prevent the immune system from reaching an efficacious stage. However, the immune profile of xenograft rejection may be more similar to disease regression than to allograft rejection. In the case of disease relapse, the immune system is already activated as evidenced by the destruction of native islet cells. Thus, in disease relapse, the immune system is already at the effector stage. Antagonists of the invention may suppress the immune response to both allografts and xenografts by reducing the rate of TR2-mediated lymphocyte proliferation and differentiation. Such antagonists include the TR2-Fc fusion proteins described in Examples 5 and 6. Accordingly, the present invention further provides a method for suppressing an immune response.

In addition, TNF-α is shown to prevent diabetes in animal species in which this distress tends to be due to autoimmunity. Porter, A .; , Tibtech 9
158-162 (1991). Thus, the agonists and antagonists of the present invention may be useful in treating autoimmune diseases such as type 1 diabetes.

Further, the role played by TR2 receptors in cell proliferation and differentiation indicates that agonists or antagonists of the invention may be used to treat disease states involving aberrant cellular expression of these receptors. In some situations, the TR2 receptor may induce an inflammatory response, and antagonists may be useful as agents to block this response. Thus, TR2 receptor antagonists (eg, solubilized forms of TR2 receptor; neutralizing antibodies)
Can be useful for treating inflammatory diseases such as rheumatoid arthritis, osteoarthritis, psoriasis, sepsis, and inflammatory bowel disease.

An antagonist to the TR2 receptor may also be used to treat and / or prevent septic shock, which remains in a severe clinical condition. Septic shock is not directly attributable to pathogens, but rather to protein factors (eg, TNF).
And an exacerbated host response mediated by IL-1). For example,
It is shown that lipopolysaccharides induce the release of TNF which results in a strong and transient rise in their serum concentrations. TNF causes shock and tissue damage when administered in excess. Thus, antagonists for the TR2 receptor are T
It is believed to block the effects of NF and treat or prevent septic shock. These antagonists can also be used to treat meningococcal bacteremia in children that correlates with high serum levels of TNF.

Among the disorders that can be treated by antagonists to the TR2 receptor are TNF receptor ligands, and bacterial infectious cachexia and inflammation mediated by cerebral malaria. TR2 receptor antagonists can also be used to treat inflammation mediated by a ligand for a receptor such as TNF.

In certain embodiments, the antagonist according to the invention is selected from the group consisting of SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1), FIGS. 4A-4C (SEQ ID NO: 4) or FIGS.
A nucleic acid corresponding to the sequence contained in SEQ ID NO: 7) or its complementary strand, and / or
Alternatively, it is a nucleic acid corresponding to the deposited nucleotide sequence of ATCC Deposit No. 97059, 97058 or 97057. In one embodiment, the antisense sequence is produced internally by the organism, and in another embodiment, the antisense sequence is administered separately (eg, O'Connor, J. Neuroch).
em. 56: 560 (1991)), and Oligodeoxynucleoo.
tides as Antisense Inhibitors of Gen
e Expression, CRC Press, Boca Raton, FL
(1988)). Using antisense technology, antisense DN
Gene expression can be controlled through A or RNA or through triple helix formation. Antisense technology is described, for example, in Okano, J .; Neurochem.
56: 560 (1991); Oligodeoxynucleotides a
s Antisense Inhibitors of Gene Express
session, CRC Press, Boca Raton, FL (1988). Triple helix formation is described, for example, by Lee et al., Nucleic A.
cids Research 6: 3073 (1979); Cooney et al., S.
science 241: 456 (1988); Darvan et al., Science.
251: 1300 (1991). This method uses the complementary D
Based on binding of polynucleotide to NA or RNA.

For example, the 5 'coding portion of a polynucleotide encoding a mature polypeptide of the present invention can be used to design an antisense RNA oligonucleotide approximately 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to the region of the gene involved in transcription, thereby preventing transcription and production of this receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the receptor polypeptide.

[0334] In one embodiment, a TR2 receptor antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof is transcribed to produce an antisense nucleic acid (RNA) of the invention. Such a vector contains a sequence encoding a TR2 receptor antisense nucleic acid. Such vectors may remain episomal or may integrate into the chromosome as long as they are transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmids, viruses or others known in the art, which are used for replication and expression in vertebrate cells. Expression of the sequence encoding the TR2 receptor, or a fragment thereof, can be driven by any promoter known in the art to act in vertebrate, preferably human cells. Such a promoter can be inducible or constitutive. Such promoters include the SV40 early promoter region (Bernoist and Chambon, Nature 29).
: 304-310 (1981)), a promoter contained in the 3 'long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22: 787-7).
97 (1980)), herpes thymidine promoter (Wagner et al., Pro.
c. Natl. Acad. Sci. U. S. A. 78: 1441-1445 (1
981)), the regulatory sequence of the metallothionein gene (Brinster et al., Nat).
296: 39-42 (1982)) and the like, but are not limited thereto.

The antisense nucleic acids of the present invention include a sequence that is complementary to at least a portion of a TR2 receptor gene RNA transcript. However, preferably, there is no need for perfect complementarity. As used herein, "complementary to at least a portion of RNA"
The sequence means a sequence having sufficient complementarity that can hybridize with RNA and form a stable duplex. In the case of a double-stranded TR2 receptor antisense nucleic acid, the single-stranded DNA Can be tested in this way, or triplex formation can be assayed. The ability to hybridize depends on both the degree of complementarity and the length of the antisense nucleic acid. In general, the longer the hybridizing nucleic acid, the more bases are mismatched with the TR2 receptor RNA, and
It may contain a stable duplex (which may be triplex) and form a risk.
One skilled in the art can ascertain the tolerable degree of mismatch by determining the melting point of the hybridized complex using standard procedures.

The 5 ′ end of the messenger (eg, up to the 5 ′ untranslated sequence and AUG
Oligonucleotides that are complementary (including the start codon) should work most efficiently at inhibiting translation. However, sequences complementary to the 3 'untranslated sequence of mRNA have also been shown to be effective in inhibiting translation of mRNA. In general, Wagner, R.A. , Nature 372: 333-335 (1
994). Thus, SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1),
4A-4C (SEQ ID NO: 4) or the 5 ′ untranslated region (non-coding region) or 3 ′ untranslated region (TR) of the TR2 receptor shown in FIGS.
Oligonucleotides complementary to any of the (non-coding regions) can be used in antisense methods to inhibit translation of endogenous TR2 receptor mRNA. mRNA
The oligonucleotide complementary to the 5 'untranslated region of should include the complement of the AUG start codon. Antisense oligonucleotides complementary to the mRNA coding region are less effective inhibitors of translation, but can be used in accordance with the present invention. Whether designed to hybridize to the 5 'region, 3' region or coding region of a TR2 receptor mRNA, the antisense nucleic acid is at least 6 nucleotides in length, and more preferably from 6 to about 50 nucleotides. Should be in the range of the length. In certain aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

The polynucleotide of the present invention may be DNA or RNA or a chimeric mixture thereof or a derivative or modified version thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, molecular stability, hybridization, and the like.
The oligonucleotides may be linked to other attached groups (eg, peptides (eg, to target host cell receptors in vivo), or cell membranes (eg, Le).
tsinger et al., Proc. Natl. Acad. Sci. 86: 6553-
6556 (1989); Lamaitre et al., Proc. Natl. Acad.
Sci. 84: 648-652 (1987); PCT Publication No. published on December 15, 1988; or WO88 / 09810) or the blood-brain barrier (eg, PCT Publication No. published on April 25, 1988). WO89 / 10
134, a hybridisation-triggered cleaving factor.
age agent) (eg, Kroll et al., BioTechniques 6).
: 958-976 (1988)) or intercalating agents (see, for example, Zon, Pharm. Res. 5: 539-549 (1988)). To this end, the termini of the oligonucleotide can be conjugated to another molecule, such as a peptide, a hybridization triggered cross-linking agent, a transport factor, a hybridization triggered fission factor, and the like.

The antisense oligonucleotides include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil,
-Carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylcuosin,
Inosine, N6-isopentenyl adenine, 1-methyl guanine, 1-methyl inosine, 2,2-dimethyl guanine, 2-methyl adenine, 2-methyl guanine, 3-methyl cytosine, 5-methyl cytosine, N 6-adenine, 7 -Methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylcuosin, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyl Adenine, uracil-5-oxyacetic acid (v), wybutoxos
ine), pseudouracil, cueosine, 2-thiocytosine, 5-methyl-
2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v)
Selected from the group including, but not limited to, 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. At least one modified base moiety.

The antisense oligonucleotide also includes at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense oligonucleotide is a phosphorothioate, phosphorodithioate, phosphoramidothioate, phosphoramidate, phosphordiamidate, methylphosphonate, alkyl phosphotriester, and formacetal. And at least one modified phosphate backbone selected from the group including, but not limited to, (formacetal) or an analog thereof.

In yet another embodiment, the antisense oligonucleotide is an α-anomeric oligonucleotide. Alpha-anomeric oligonucleotides form specific duplex hybrids with complementary RNA, whose strands are parallel to each other, as opposed to normal beta units (Gautier et al., Nucl. Acids Res. 15).
: 6625-6641 (1987)). This oligonucleotide is 2'-O-
Methyl ribonucleotides (Inoue et al., Nucl. Acids Res. 15
: 6131-6148 (1987)) or a chimeric RNA-DNA analog (
Inoue et al., FEBS Lett. 215: 327-330 (1987)).

The polynucleotides of the present invention can be prepared by standard methods known in the art (eg, automated D
NA synthesizer (for example, the device is Biosearch, Applied Biosy
(commercially available from Stems et al.). For example, phosphorothioate oligonucleotides can be prepared by the method of Stein et al. (Nucl.
. Acids Res. 16: 3209 (1988)), and the methylphosphonate oligonucleotide is a controlled pore glass.
lled pore glass polymer support (Sarin et al., Proc.
Natl. Acad. Sci. U. S. A. 85: 7448-7451 (19)
88)).

Although antisense nucleotides complementary to the coding region sequence of the TR2 receptor can be used, antisense nucleotides complementary to the transcribed untranslated region are most preferred.

Potential antagonists according to the present invention also include catalytic RNAs, ie, ribozymes (see, eg, PCT Publication WO 90/11364 (October 4, 1990)
Sarver et al., Science, 247: 1222-1225 (1).
990)). Although ribozymes that cleave mRNA at a site-specific recognition sequence can be used to destroy TR2 receptor mRNA, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations determined by flanking regions that form complementary base pairs with the target mRNA. The only requirement is that the target mRNA has the following two base sequences: 5'-UG-3 '. The construction and production of hammerhead ribozymes is well known in the art and is described in Haseloff and Gerlach, Natu.
re, 334: 585-591 (1988). T
Many potential hammerhead types within the R2 receptor sequence (SEQ ID NO: 25, FIGS. 1A-1B (SEQ ID NO: 1) FIGS. 4A-4C (SEQ ID NO: 4) and FIGS. 7A-7C (SEQ ID NO: 7)) There is a ribozyme cleavage site. Preferably, the ribozyme is such that the cleavage recognition site is located near the 5 'end of the TR2 receptor mRNA of interest; that is, to increase efficiency and minimize intracellular accumulation of non-functional mRNA transcripts. Is operated.

In the case of the antisense approach, the ribozymes of the invention can be composed of modified oligonucleotides (eg, improved in stability, targeting, etc.) and delivered to cells expressing the TR2 receptor in vivo. It should be. A ribozyme-encoding DNA construct can be introduced into a cell in the same manner as described above for the introduction of antisense encoding DNA. A preferred method of delivery involves using a DNA construct that "encodes" a ribozyme under the control of a strong constitutive promoter (such as, for example, a pol III or pl II promoter), thereby resulting in a transfected cell. Destroys the endogenous TR2 message and produces sufficient ribozyme to inhibit translation. Because ribozymes are catalytic, unlike antisense molecules, lower intracellular concentrations are required for efficiency.

The compounds and pharmaceutical compositions of the invention are preferably administered prior to use in humans.
It is tested in vitro for the desired therapeutic and prophylactic activity and then in vivo. For example, in vitro assays to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include the effect of the compound on a cell line or patient tissue sample. The effect of a compound or composition on a cell line and / or tissue sample can be determined using techniques known to those of skill in the art, including but not limited to inhibiting or stimulating growth. In vitro assays that can be used to determine whether administration of a particular compound is desirable, in accordance with the present invention, include in vitro cell culture assays, in which a patient's tissue sample is grown in culture. And is exposed to or otherwise administered with the compound, and the effect of such compound on the tissue sample is observed.

[0347] Endogenous gene expression can also be reduced by inactivating or "knocking out" the TR2 receptor gene and / or its promoter using targeted homologous recombination (eg, Smithies et al., Nature). 3
17: 230-234 (1985); Thomas and Capecchi, C.
cell 51: 503-512 (1987); Thompson et al., Cell.
5: 313-321 (1989); each of which is incorporated herein by reference in its entirety). For example, a variant, non-functional polynucleotide (or completely unrelated D) of the present invention flanked by DNA homologous to an endogenous polynucleotide sequence (either the coding or regulatory region of this gene).
NA sequences) can be used with or without a selectable and / or negative selectable marker to transfect cells expressing a polypeptide of the invention in vivo. In another embodiment, using techniques known in the art,
Knockouts are made in cells that contain the gene of interest but do not express it. Insertion of this DNA construct via targeted homologous recombination results in inactivation of the targeted gene. Such approaches are of particular interest in research and agriculture, where modifications to embryonic stem cells can be used to generate progeny of animals with inactive target genes (eg, Thomas and Capecchi 19).
87 and Thompson 1989, supra). However, this approach uses a suitable viral vector, as will be apparent to those skilled in the art, and
Where the NA construct is administered directly to the required site in vivo or is targeted, it may be routinely adapted for use in humans. The content of each document cited in this paragraph is incorporated herein by reference in its entirety.

In other embodiments, the antagonists according to the invention include soluble forms of the TR2 receptor (eg, SEQ ID NO: 26, FIGS. 1A-1B (SEQ ID NO: 2), FIG. 4A
4C (SEQ ID NO: 5) or FIGS. 7A-7C (SEQ ID NO: 8)
Fragment of the full-length receptor, which contains a ligand binding domain from the extracellular region of the full-length receptor. Such soluble forms (naturally occurring or synthetic) of the TR2 receptor antagonize signaling mediated by the TR2 receptor by competing with the cell surface bound form of the receptor for binding to TNF family ligands. Nize. Antagonists of the present invention also include antibodies specific for TNF family ligands and TR2 receptor-Fc fusion proteins.

By “TNF family ligand” is intended naturally occurring, recombinant and synthetic ligands capable of binding members of the TNF receptor family and induce and / or block the ligand / receptor signaling pathway. Members of the TNF ligand family include TNF-α
, Lymphotoxin-α (also known as LT-α, TNF-β), LT-β (
Found in the heterotrimeric complex LT-α2-β), FasL, V
EGI (International Publication WO 96/14328), AIM-I (International Publication WO 96/14328)
97/33899), AIM-II (International Publication No. WO 97/34911), APRIL (J. Exp. Med. 188 (6): 1185-1190),
Endokine-α (WO 98/07880), Neutrokine-α (WO 98/80)
No. 18921), CD40L, CD27L, CD30L, 4-1BBL, OX4
0L and nerve growth factor (NGF), but are not limited thereto.

TNF-α has been shown to protect mice from infection with herpes simplex type 1 (HSV-1). Rossol-Voth et al. Gen. Virol. 72
143-147 (1991). The mechanism of the protective effect of TNF-a is unknown, but does not appear to be involved in either interferon or NK cell killing. One member of this family has been shown to mediate HSV-1 entry into cells. Montgomery et al., Eur. Cytokine Newt. 7:
159 (1996). Furthermore, antibodies specific for the extracellular domain of TNF-α
Blocks entry of HSV-1 into cells. Thus, the TR2 receptor antagonists of the present invention include both the TR2 receptor amino acid sequence and an antibody capable of preventing the virus from entering the cell mediated. Such sequences and antibodies
It may function by competing with the localized cell surface for binding to the virus or by directly blocking the binding of the virus to cell surface receptors.

[0351] Antibodies according to the present invention can be prepared by any of a variety of standard methods using the TR2 receptor immunogenicity of the present invention. Such TR2 receptor immunogens include SEQ ID NO: 26, FIGS. 1A-1B (SEQ ID NO: 2), FIGS. 4A-4C (SEQ ID NO: 5) and FIGS. 7A-7C (SEQ ID NO: 8) (these are: A TR2 receptor protein, which may or may not include a leader sequence, as well as a ligand binding domain, an extracellular (eg, one or more cysteine repeat regions) domain, a transmembrane domain, an intracellular domain of the TR2 receptor Or a polypeptide fragment of the receptor, including combinations thereof.

Polyclonal or monoclonal antibody agonists or antagonists according to the present invention can be prepared using methods disclosed herein and / or methods known in the art (eg, Tartaglina and Goeddel, J. Biol. Ch.
em. 267: 4304-4307 (1992); Tartaglia et al., Ce.
II 73: 213-216 (1993), as well as PCT application WO 94/0.
9137, the method of which is described in US Pat. Specific to a polypeptide of the invention having the amino acid sequence of SEQ ID NO: 5, SEQ ID NO: 8 or SEQ ID NO: 26.

Gene shuffling, motif shuffling, exon shuffling,
The technique of and / or codon shuffling (collectively referred to as "DNA shuffling") can be used to modify the activity of TR2, thereby efficiently generating TR2 agonists and antagonists. Generally, U.S. Patent Nos. 5,605,793, 5,811,238, and 5,830,72.
No. 5, No. 5,834,252 and No. 5,837,458, and P
atten, P .; A. Et al., Curr. Opinion Biotechnol.
8: 724-33 (1997); Harayama, S .; , Trends Bi
oTechnol. 16 (2): 76-82 (1998); Hansson, L.
. O. J. et al. Mol. Biol. 287: 265-76 (1999); and Lorenzo, M .; M. And Blasco, R.A. , Biotechniq
es 24 (2): 308-13 (1998), each of which is hereby incorporated by reference. In one embodiment, the change in the TR2 polynucleotide and corresponding polypeptide is DNA
This can be achieved by shuffling. DNA shuffling involves assembling two or more DNA segments into the desired TR2 molecule by homologous recombination or site-specific recombination. In another embodiment, the TR2 polynucleotide and corresponding polypeptide have an error-prone P-type prior to recombination.
It can be altered by subjecting it to random mutagenesis by CR, random nucleotide insertion or other methods. In another embodiment, one or more components, motifs, sections, portions, domains, fragments, etc. of the TR2 are one or more components, motifs, segments of one or more heterologous molecules.
on), parts, domains, fragments and the like. In a preferred embodiment, the heterologous molecule includes, for example, TNF-α lymphotoxin-α (LT
-Α, also known as TNF-β), LT-β (complex heterotrimer LT-
α2-β), OPGL, FasL, CD27L, CD30L, C
D40L, 4-1BBL, DcR3, OX40L, TNF-γ (International Publication No. WO96 / 14328), AIM-I (International Publication No. WO97 / 33899)
No.), AIM-II (International Publication No. WO97 / 34911), APRIL (
J. Exp. Med. 188 (6): 1185-1190), endokine (e
ndokine) -α (WO 98/07880), neutrokine-α (WO 98/18921),
OPG and OX40L and Neutrokine-
α (WO 98/18921), nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40, and 4-IBB;
DR3 (International Publication No. WO97 / 33904), DR4 (International Publication No. W
O98 / 32856), TR5 (International Publication No. WO98 / 30693),
TR6 (International Publication No. WO98 / 30694), TR7 (International Publication No. W
O98 / 41629), TRANK, TR9 (International Publication No. WO 98/56).
892), TR10 (International Publication No. WO 98/54202), 312C2
(International Publication No. WO98 / 06842), TR12, and TNF-R1
, TRAMP / DR3 / APO-3 / WSL / LARD, TRAIL-R1 / D
R4 / APO-2, TRAIL-R2 / DR5, DcR1 / TRAIL-R3 /
TRAOD / LIT, DcR2 / TRAIL-R4, CAD, TRAIL, TR
AMP and v-FLIP.

In a further preferred embodiment, the heterologous molecule is any member of the TNF family.

Therapeutic and Other Uses Tumor necrosis factor (TNF) family ligands are known to be among the most pleiotropic cytokines. This induces a number of cellular responses including cytotoxicity, antiviral activity, immunomodulatory activity, and transcriptional regulation of several genes (Goeddel DV, et al., Tumor Necrosis Facto).
r: Gene Structure and Biological Acti
vices "Symp. Quant. Biol. 51: 597-609, Co
ld Spring Harbor (1986); Beatler, B .; And Cerami, A .; , Annu. Rev .. Biochem. 57: 505-51
8 (1988); Old, L .; J. , Sci. Am. 258: 59-75 (19
88); , FEBS Lett. 285: 199-224 (1
991)). TNF family ligands induce these various cellular responses by binding to TNF-family receptors.

A TR2 polynucleotide or polypeptide, or an agonist of TR2, can be used for treatment of an infectious agent. For example, an infectious disease can be treated by increasing the immune response, particularly by increasing B cell proliferation and differentiation. The immune response can be increased either by enhancing an existing immune response or by starting a new immune response. Alternatively, a TR2 polynucleotide or polypeptide, or an agonist or antagonist of TR2, can also directly inhibit an infectious agent, without necessarily eliciting an immune response.

As described above, TR2 polynucleotides and polypeptides, and anti-TR2 antibodies may have abnormally high or low expression of TR2, TR2-SV1 and / or TR2-SV2, and / or TR2, TR2-SV1. And / or diagnostic of conditions associated with TR2-SV2 activity. TR2, T
R2-SV1 and / or TR2-SV2 are expressed and TR2, TR2
Considering cells and tissues whose activity is altered by 2-SV1 and / or TR2-SV2, the T
A substantially altered (increased or decreased) level of expression of R2, TR2-SV1 and / or TR2-SV2 is detected in the body system (TR2, TR2-S
It is readily apparent that V1 and / or TR2-SV2 are expressed and / or activated) resulting in pathological conditions.

[0358] The extracellular domain of each protein causes TR2
, TR2-SV1 and / or TR2-SV2 expressing cells, the extracellular domain of each protein is released in a soluble form, whereby TR2, TR2
If SV1 and / or TR2-SV2 polypeptides (particularly soluble forms of each extracellular domain) can be added from an exogenous source to an individual's cells, tissues or body, the polypeptide will Modulating activity on any of the target cells will also be appreciated by those skilled in the art. Because of TR2 of the present invention
Polypeptides are members of the TNF family. Also, cells expressing the type II transmembrane protein can be added to cells, tissues or the body of an individual, such that the added cells are TR2, TR2-SV1 and / or TR2.
Binds to cells that express the receptor for 2-SV2, thereby allowing TR2,
Cells expressing TR2-SV1 and / or TR2-SV2 can cause an effect (e.g., fanciful proliferation or cytotoxicity) on receptor-bearing target cells.

In one embodiment, the invention relates to target cells (eg, TR2, TR2-SV1).
B cells expressing TR2-SV2 receptor and / or TR2,
A composition comprising a polypeptide of the invention (eg, a TR2 associated with a heterologous polypeptide, heterologous nucleic acid, toxin or prodrug) into a TR2-SV1 and / or monocyte expressing a cell surface bound form of TR2-SV2. , TR2-SV1 and / or
Or TR2-SV2 polypeptide, or anti-TR2 antibody, anti-TR2-SV1
Antibody and / or a composition comprising an anti-TR2-SV2 antibody). TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the invention, or anti-TR2 antibody, anti-TR2-SV1 antibody and / or anti-TR
A 2-SV2 antibody may be associated with a heterologous polypeptide, heterologous nucleic acid, toxin or prodrug via hydrophobic, hydrophilic, ionic and / or covalent bonds.

In one embodiment, the present invention relates to a polypeptide of the present invention (eg, TR2, TR2-SV1 and / or TR2-) related to a heterologous polypeptide or nucleic acid.
SV2, or anti-TR2 antibody, anti-TR2-SV1 antibody and / or anti-TR2
-SV2 antibody) for the specific delivery of the composition of the present invention to cells. In one embodiment, the invention provides a method for delivering a therapeutic protein into a targeted cell. In another embodiment, the invention provides a single-stranded nucleic acid (eg, an antisense or ribozyme) or a double-stranded nucleic acid (eg, that can integrate into the genome of a cell or can replicate episomally and be transcribed) DNA) to the targeted cells.

In another embodiment, the present invention relates to a polypeptide of the present invention (eg, TR2, TR2-SV1 and / or TR) associated with a toxin or a cytotoxic prodrug.
2-SV2, or anti-TR2 antibody, anti-TR2-SV1 antibody and / or anti-T
Methods for specific destruction of cells (e.g., destruction of tumor cells) by administering an R2-SV2 antibody).

In certain embodiments, the present invention relates to a cell of the B-cell lineage, comprising administering a TR2, TR2-SV1 and / or TR2-SV2 or anti-TR2 antibody associated with a toxin or a cytotoxic prodrug. For example, methods for the specific destruction of B-cell associated leukemia or lymphoma) are provided.

“Toxin” refers to an endogenous cytotoxic effector system, radioisotope, holotoxin (
holoxin), a modified toxin, a catalytic subunit of a toxin, a cytotoxin (cytotoxic agent), or any molecule or enzyme that is not normally present in or on cells that cause cell death under defined conditions and Means a compound that activates. Toxins that can be used in accordance with the methods of the present invention include, but are not limited to, radioisotopes known in the art, compounds that bind to an intrinsic or induced endogenous cytotoxic effector system (Eg, antibodies (or their complement-fixing containing portions), thymidine kinase, endonuclease, RNAse
, Alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin
, Pokeweed antiviral proteins, alpha sarcin and cholera toxin. “Toxin” also refers to cytostatic or cytocidal agents, therapeutic agents or radioactive metal ions (eg, α-emitters (eg, ²¹³ Bi)) or other radioisotopes (eg, ¹⁰³ Pd, ¹³³ Xe). , ¹³¹ I, ⁶⁸ Ge, ⁵⁷ Co, ⁶⁵ Zn, ⁸⁵ S
r, ³² P, ³⁵ S, ⁹⁰ Y, ¹⁵³ Sm, ¹⁵³ Gd, ¹⁶⁹ Yb, ⁵¹ Cr, ⁵⁴ Mn, ⁷⁵ Se
, ¹¹³ Sn, ⁹⁰ yttrium, ¹¹⁷ tin, ¹⁸⁶ Rhenium, ¹⁶⁶ Holmium, and ^{18 8} rhenium); including and fluorescent labels (e.g., fluorescein and rhodamine), and biotin; luminescent labels (e.g., luminol).

[0364] Techniques known in the art can be applied to label the antibodies of the present invention. Such techniques include the use of bifunctional binders (see, for example, US Pat.
No. 56,065; No. 5,714,631; No. 5,696,239; No. 5,652,361; No. 5,505,931; No. 5,489, 425; Nos. 5,435,990; 5,428,139; 5,342,6
Nos. 4,274,119; 4,994,560; and 5,8
No. 08,003; the contents of each of which are incorporated herein by reference in their entirety). A cytotoxin or cytotoxic agent includes any agent that is harmful to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, methine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine,
Doxorubicin, daunorubicin, dihydroxyanthracindione (dihy
droxy anthracin dione), mitoxantrone, mitramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoid, procaine, tetracaine, lidocaine, propranolol, and puromycin, and analogs or homologs thereof. Therapeutic agents include antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., chlormethamine, thioepa (th
ioepa) chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide (cyclophosphamide)
de), busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamineplatinum (II) (DDP), cisplatin, anthracycline (eg, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactino) Mycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (
anthramycin) (AMC)), and mitotic inhibitors (eg, vincristine and vinblastine).

“Cytotoxic prodrug” refers to a non-toxic compound that is converted to a cytotoxic compound by an enzyme normally present in the cell. Cytotoxic prodrugs that may be used in accordance with the methods of the present invention include glutamyl derivatives of benzoic acid mustard alkylating agents, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubicin, and phenoxyacetamide derivatives of doxorubicin. But not limited to these.

A condition caused by a decrease in TR2, TR2-SV1 and / or TR2-SV2 activity in a standard or normal level individual (particularly a disorder of the immune system) is indicated by TR2, TR2-SV1 and / or TR2-SV2 It will be appreciated that the treatment may be by administration of a polypeptide (in the form of a soluble extracellular domain or a whole protein expressed by the cell) or an agonist. Accordingly, the present invention also provides a method of treating an individual in need of an increased level of TR2, TR2-SV1 and / or TR2-SV2 activity, the method comprising the step of treating TR2, TR2-SV1 and / or An effective amount of an isolated TR2, TR2-SV1 and / or TR2-SV2 to increase the level of TR2-SV2 activity
Administering a pharmaceutical composition comprising the polypeptide or agonist thereof to such an individual).

A condition caused by a decrease in TR2, TR2-SV1 and / or TR2-SV2 activity in a standard or normal level individual (particularly a disorder of the immune system) is indicated by TR2, TR2-SV1 and / or TR2-SV2 It can also be treated by administration of a polypeptide (in the form of a soluble extracellular domain or a whole protein expressed by a cell) or an agonist (eg, an anti-TR2 antibody).
Understood. Thus, the present invention also provides reduced TR2, TR2-SV1 and / or
Or a method of treating an individual in need of a level of TR2-SV2 activity (this method comprises treating TR2, TR2-SV1 and / or TR2-
An effective amount of an isolated TR2, TR2-SV1 to reduce SV2 activity levels;
And / or administering to such an individual a pharmaceutical composition comprising a TR2-SV2 polypeptide or an antagonist thereof).

A TR2 polynucleotide or polypeptide of the invention, and / or TR
Two agonists or antagonists can be used to treat infectious agents. For example, an infectious disease can be treated by increasing the immune response, particularly by increasing the proliferation and differentiation of B and / or T cells. The immune response can be increased either by enhancing an existing immune response or by starting a new immune response. Alternatively, a TR2 polynucleotide,
An agonist of the polypeptide or TR2 may also directly inhibit the infectious agent without necessarily eliciting an immune response.

The virus can cause a disease or condition that can be treated by a TR2, TR2-SV1 and / or TR2-SV2 polynucleotide or polypeptide, or an agonist or antagonist of TR2, TR2-SV1 and / or TR2-SV2. It is an example of an infectious agent. Examples of viruses include, but are not limited to, the following DNA and RNA viruses and virions: arbovirus, adenoviridae, arenaviridae, arterivirus, birnaviridae, bunyaviridae, calcivirus. Family, Circoviridae, Coronaviridae, Dengue fever, E
BV, HIV, flaviviridae, hepadnaviridae (hepatitis), herpesviridae (eg, cytomegalovirus, herpes simplex, herpes zoster),
Mononegavirus (for example, Paramyxoviridae, Measles virus, Rhabdoviridae), Orthomyxoviridae (for example,
Influenza A, influenza B, and parainfluenza), papillomavirus, papovaviridae, parvoviridae, picornaviridae, poxviridae (eg, smallpox or vaccinia), reoviridae (eg,
Rotavirus), Retroviridae (HTLV-I, HTLV-II, lentivirus), and Togaviridae (e.g., Rubivirus). Viruses that fall into these families can cause a variety of diseases or conditions, including but not limited to: arthritis, bronchiolitis, respiratory syncytial virus, encephalitis, ocular infections (eg, conjunctivitis) Keratitis), chronic fatigue syndrome, hepatitis (type A, type B, type C, type E, chronic activity, delta), Japanese encephalitis B
Type, Argentine hemorrhagic fever, chinnia, Rift Valley fever, yellow fever, meningitis, opportunistic infections (eg, AIDS), pneumonia, Burkitt's lymphoma, chickenpox, hemorrhagic fever, measles, mumps, parainfluenza Rabies, common cold, polio, leukemia, rubella, sexually transmitted diseases, skin diseases (eg, caposi, warts), and viremia. TR
2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides, or TR2, TR2-SV1 and / or TR2-SV
With two agonists or antagonists, any of these conditions or diseases can be treated, prevented, diagnosed and / or detected. In certain embodiments, a TR2, TR2-SV1 and / or TR2-SV2 polynucleotide, polypeptide, or agonist is used for the treatment, prevention and / or diagnosis of: meningitis, dengue, EBV, And / or hepatitis (eg, hepatitis B). In further specific embodiments, the TR2, TR2-SV1 and / or TR2-SV2 polynucleotides, polypeptides, or agonists are used to treat a patient non-responsive to one or more other commercially available hepatitis vaccines. Is done. In a more particular embodiment, the polynucleotide, polypeptide or agonist of TR2, TR2-SV1 and / or TR2-SV2 is AI.
Used to treat, prevent and / or diagnose DS. In a further specific embodiment, the polynucleotides, polypeptides, agonists and / or antagonists of TR2, TR2-SV1 and / or TR2-SV2 receptor are for treating, preventing and / or diagnosing patients with cryptosporidiosis. used.

Similarly, a polynucleotide or polypeptide of TR2, TR2-SV1 and / or TR2-SV2 that can cause a disease or condition, and / or
Alternatively, bacterial or fungal factors that can be treated or detected by agonists or antagonists of TR2, TR2-SV1 and / or TR2-SV2 include, but are not limited to, the following Gram-negative and Gram-positive bacteria and bacteria, and fungi: Not: Actinomycetales (eg, Co
rynebacterium, Mycobacterium, Norcardi
a), Cryptococcus neoformans, Aspergill
ossis, Bacillaceae (eg, Anthrax, Clostri
Dium), Bacteroidaceae, Blastomycosis, B
ordetella, Borrelia (for example, Borrelia burg
dorferi), Brucellosis, Candidiasis, Cam
pyrobacter, Coccidioidomycosis, Crypto
coccosis, Dermatocycoses, E.C. coli (for example, E
terotoxogenic E .; coli and Enterohemorr
magic E. coli), Enterobacteriaceae (Kle
bsiella, Salmonella (for example, Salmonella ty
phi, and Salmonella paratyphi), Serrati
a, Yersinia), Erysipelothrix, Helicobac
ter, Legionellosis, Leptospirosis, List
eria, (eg, Listeria monocytogenes), My
coplasmates, Mycobacterium leprae, V
ibrio cholerae, Neisseriaceae (for example, Aci
netobactor, Gonorrhea, Menigococcal), M
eisseria meningitidis, Pasteurellacea
Infections (eg, Actinobacillus, Heamophilus (
For example, Heamophilus influenza B), Pasteurell
a), Pseudomonas, Rickettsiaceae, Chlamy
diaceae, Syphilis, Shigella spp. , Staph
ylococcal, Meningiococcal, Pneumococca
l and Streptococcal (eg, Streptococcus)
pneumoniae and Group B Streptococcus). These bacterial or fungal families can cause diseases or conditions including, but not limited to: bacteremia, endocarditis, ocular infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic. Infections (eg, AIDS-related infections), periungitis, prosthesis-related infections, Reiter's disease, respiratory tract infections (eg, pertussis or pyometra), sepsis, Lyme disease, cat scratching disease, dysentery, Paratyphoid fever, Food poisoning, typhoid fever, pneumonia, gonorrhea, meningitis (eg, meningitis A and B), chlamydia, syphilis, diphtheria, leprosy, tuberculosis, tuberculosis, lupus, botulism, gangrene, tetanus, impetigo , Rheumatic fever, scarlet fever, sexually transmitted diseases, skin diseases (eg, cellulitis, dermatomycosis (de)
rmatocycoses)), toxemia, urinary tract infections, wound infections. TR2, T
Using R2-SV1 and / or TR2-SV2 polypeptides or polynucleotides, or TR2, TR2-SV1 and / or TR2-SV2 agonists or antagonists to treat, prevent, or diagnose any of these conditions or diseases And / or may be detected. In certain embodiments, T
R2 polynucleotides, polypeptides, or agonists thereof are used to treat: tetanus, diphtheria, botulinum, and / or meningitis B.

In addition, a parasitic agent that can be treated or detected by a TR2, TR2-SV1 and / or TR2-SV2 polynucleotide or polypeptide, or an agonist of TR2, TR2-SV1 and / or TR2-SV2 causes Diseases or conditions include, but are not limited to, the following families or classes: amoebiasis, babesiosis, coccidiosis, cryptosporidiosis, dientamoebiasis, cross-breeding, ectoparasites, giardia flagella Worms, helminthiasis, leishmaniasis, theileriosis, toxoplasmosis, trypanosomiasis, and trichomonas (Trichomonas)
omonas) disease, as well as Sporozoan disease (eg, Pla
smodium virax, Plasmodium falciparium
, Plasmodium malariae and Plasmodium ov
ale). These parasites can cause a variety of diseases or conditions, including but not limited to: scabies, tsutsugamushi disease, ocular infections, intestinal diseases (eg, dysentery, giardiasis), liver disease, lung Diseases, opportunistic infections (eg,
AIDS-related), malaria, pregnancy complications, and toxoplasmosis. TR2, T
Using R2-SV1 and / or TR2-SV2 polynucleotides or polypeptides or TR2, TR2-SV1 and / or TR2-SV2 agonists or antagonists to treat, prevent, or diagnose any of these conditions or diseases And / or can be used to detect. In certain embodiments, the TR2, TR2-SV1 and / or TR2-SV2 polynucleotides, polypeptides, or agonists thereof are used to treat, prevent, and / or diagnose malaria.

The TR2 receptor polynucleotides, polypeptides, agonists or antagonists of the present invention may be provided by a defective or insufficient amount of a TR2, TR2-SV1 and / or TR2-SV2 receptor polypeptide, agonist or antagonist (directly). Or (indirectly) may be used in developing treatments for any disorder mediated, which may be administered to a patient (eg, a mammal, preferably a human) suffering from such a disorder. Alternatively, gene therapy approaches
It can be applied to treat such disorders. Disclosure of the TR2 receptor nucleotide sequence herein provides for the detection of defective TR2 receptor genes and normal T2
It allows their replacement with the gene encoding the R2 receptor. Defective genes can be detected in in vitro diagnostic assays and by comparing the nucleotide sequence of a TR2 receptor gene from a patient at risk of having a deficiency in this gene to the TR receptor nucleotide sequences disclosed herein.

In another embodiment, a polypeptide of the invention comprises an AIM against a different cell type
Used as a research tool to study biological effects resulting from inhibiting the II / TR2 receptor and / or lymphotoxin-α / TR2 receptor interaction. TR2 receptor polypeptides can also be used in in vitro assays to detect AIM II, lymphotoxin-α or TR2 receptor, or their interaction.

In another embodiment, a purified TR2 receptor polypeptide or antagonist is used to inhibit binding of AIM-II or lymphotoxin-α to endogenous cell surface AIM-II and / or lymphotoxin-α receptor. You. Certain ligands of the TNF family (AIM II and lymphotoxin-α are members of this) have been reported to bind to more than one different cell surface receptor protein. Similarly, AIM II and lymphotoxin-α are thought to bind to multiple cell surface proteins. By binding AIM II and / or lymphotoxin-α, the soluble TR2 of the invention
Receptor polypeptides can be used to inhibit the binding of AIM II and / or lymphotoxin-α to AIM II and / or lymphotoxin-α receptor proteins that are distinct from the TR2 receptor, as well as the cell surface TR2 receptor. Thus, in another embodiment, a TR2 receptor polynucleotide, polypeptide, agonist or antagonist is used to inhibit the biological activity of AIM II and / or lymphotoxin-α in an in vitro or in vivo procedure. By inhibiting the binding of AIM II and lymphotoxin-α to cell surface receptors, TR2 receptor polynucleotides, polypeptides, agonists or antagonists also result from the binding of AIM II and / or lymphotoxin-α to endogenous receptors. Inhibits biological activity. Various forms of the TR2 receptor can be used, including, for example, the TR2 receptor fragments, derivatives and variants described above that can bind to AIM II and / or lymphotoxin-α. In one preferred embodiment, the soluble TR2 receptor polypeptide inhibits the biological activity of AIM II (eg, the A2 of cells susceptible to such apoptosis).
Used to inhibit IM II-mediated apoptosis). In another preferred embodiment, the soluble TR2 receptor polypeptide inhibits the biological activity of lymphotoxin-α (eg, elicits inflammatory and immune responses, maintains lymphoid tissue,
B-cell proliferation).

In a further embodiment, a TR2 receptor polynucleotide, polypeptide,
The agonist or antagonist is administered to a mammal (eg, a human) to test for an AIM II-mediated disorder and / or a lymphotoxin-α-mediated disorder. Such AIM II- and / or lymphotoxin-α-mediated disorders include conditions caused (directly or indirectly) or exacerbated by AIM II and / or lymphotoxin-α.

Diseases associated with increased cell survival or inhibition of apoptosis include cancers (eg, follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including: colon cancer, heart tumor, pancreatic cancer , Melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, gastric cancer, neuroblastoma, myxoma, fibroid, lymphoma, endothelioma, osteoblastoma, giant cell tumor of bone Autoimmune disorders (eg, multiple sclerosis, Sjogren's syndrome, Graves' disease, Hashimoto's thyroiditis, including, but not limited to, osteosarcoma, chondrosarcoma, adenoma, breast, prostate, Kaposi's sarcoma and ovarian cancer) Autoimmune diabetes, biliary cirrhosis, Behcet's disease
e), Crohn's disease, polymyositis, systemic lupus erythematosus and immune-associated glomerulonephritis, autoimmune gastritis, autoimmune thrombocytopenic purpura and rheumatoid arthritis) and viral infections (eg, herpes virus, poxvirus and Adenovirus), inflammation, graft versus host disease (acute and / or chronic), acute graft rejection, and chronic graft rejection. In a preferred embodiment, the TR2 receptor polynucleotides, polypeptides, or antagonists of the invention are used to inhibit cancer growth, progression, and / or metastasis, particularly as listed in the above or below paragraphs. Is done.

Additional diseases or conditions associated with increased cell survival include, but are not limited to, the progression and / or metastasis of malignancies and related disorders such as: Leukemias (acute leukemias, such as Acute lymphocytic leukemia, including acute myeloid leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia) and chronic leukemia (eg, chronic myeloid (granulocytic) ) Leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (eg, Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors ( Sarcomas and carcinomas (eg, fibrosarcoma, myxosarcoma,
Liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, hemangiosarcoma, endothelial sarcoma (endoth)
elisarcoma), lymphatic sarcoma, lymphatic endothelioma, periosteoma, mesothelioma,
Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer,
Prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous carcinoma, papillary carcinoma, papillary carcinoma, cystic adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocellular carcinoma, bile duct Cancer, choriocarcinoma, seminoma, embryonic cancer, Wilms tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, skull Pharyngoma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma)
, But not limited to).

Diseases associated with increased apoptosis include, but are not limited to, AIDS; neurodegenerative disorders (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa) Autoimmune disorders (eg, multiple sclerosis, Sjogren's syndrome, Graves' disease, Hashimoto's thyroiditis, autoimmune diabetes, biliary cirrhosis, Behcet's disease)
Behcet's disease), Crohn's disease, polymyositis, systemic lupus erythematosus and immune-associated glomerulonephritis, autoimmune gastritis, idiopathic thrombocytopenic purpura and rheumatoid arthritis), myelodysplastic syndrome (eg, aplastic Anemia), graft-versus-host disease (acute and / or chronic), ischemic injury (such as caused by myocardial infarction, stroke and reperfusion injury), liver injury or disease (eg, hepatitis-related liver injury, cirrhosis, Ischemia / reperfusion injury, cholestasis (cholest
osis) (bile duct injury) and liver cancer); toxicant-induced liver disease (such as caused by alcohol), septic shock, ulcerative colitis, cachexia and anorexia. In a preferred embodiment, TR2 receptor polynucleotides, polypeptides, agonists and / or antagonists are used to treat the above diseases and disorders.

Many pathologies associated with HIV are mediated by apoptosis, including HIV-induced nephropathy and HIV encephalitis. Thus, in a further preferred embodiment, the TR2 receptor polynucleotides, polypeptides of the invention,
Agonists or antagonists are used to treat AIDS and AIDS-related pathologies.

Another embodiment of the present invention is directed to the use of TR2 receptor polynucleotides, polypeptides or antagonists to reduce AIM II-mediated death of T cells in HIV infected patients. The role of T cell apoptosis in the development of AIDS has been the subject of much research (eg, Meyaard et al., Scie).
257: 217-219 (1992); Groux et al. Exp. M
ed. , 175: 331 (1992); and Cell Activation.
and Apotosis in HIV infection, Andri
eu and Lu, Plenum Press, New York, 101-1
14 (1995), see Oyaizu et al.). Fas-mediated apoptosis has been associated with T cell loss in HIV individuals (Katsi
kis et al. Exp. Med. 181: 2029-2036 (1995)).
T cell apoptosis also appears to occur through multiple mechanisms. For example,
At least some of the T cell deaths found in HIV patients appear to be mediated by AIM II.

Activated human T cells undergo programmed cell death (apoptosis) upon activation through the CD3 / T cell receptor complex (activation induced cell death (
AICD). AICD of CD4 T cells isolated from asymptomatic individuals infected with HIV has been reported (Grou
x et al., supra). Thus, AICD may play a role in CD4 + T cell depletion and the development of AIDS in HIV-infected individuals. Therefore, the present invention
Provided is a method of inhibiting AIM II-mediated T cell death in an IV patient, the method comprising administering to the patient a TR2 receptor polynucleotide, polypeptide or antagonist of the invention, preferably a soluble TR2 receptor polypeptide. Process. In one embodiment, the patient is asymptomatic when treatment with the TR2 receptor polynucleotide, polypeptide or antagonist is initiated. If desired, prior to treatment, peripheral blood T cells can be extracted from the HIV patient and tested for susceptibility to AIM II-mediated cell death by means known in the art. In one embodiment, a patient's blood or plasma is contacted ex vivo with a TR2 receptor polypeptide of the present invention. This T
The R2 receptor polypeptide can be bound to a suitable chromatography matrix by means known in the art. The patient's blood or plasma flows through a chromatography column containing the TR2 receptor polypeptide bound to the matrix and is then returned to the patient. The immobilized TR2 receptor polypeptide binds AIM II and, thus, removes AIM II from the patient's blood.
Remove protein.

In a further embodiment, a TR2 receptor polynucleotide, polypeptide or antagonist of the invention is administered in combination with other inhibitors of T cell apoptosis. For example, as described above, Fas-mediated apoptosis has also been associated with loss of T cells in HIV individuals (Katsikis et al.,
J. Exp. Med. 181: 2029-2036 (1995)). Therefore, F
Patients susceptible to both as ligand mediated and AIM II mediated T cell death are treated with both agents that block AIM II / AIM II receptor interactions and agents that block Fas ligand / Fas interaction. obtain. Suitable agents for blocking the binding of Fasi ligand to Fas include soluble Fas polypeptides; multimeric forms of soluble Fas polypeptides (eg, dimers of sFas / Fc); transmission of biological signals that cause apoptosis. Anti-Fas antibody that binds Fas without binding; anti-Fas ligand antibody that blocks binding of Fas ligand to Fas; and mutein of Fas ligand that binds Fas but does not transmit a biological signal that causes apoptosis But not limited thereto. Preferably, the antibodies used according to this method are monoclonal antibodies. Examples of suitable agents for blocking the Fas ligand / Fas interaction (including blocking anti-Fas monoclonal antibodies) are described in WO 95/10540, which is hereby incorporated by reference.

In another example, an agent that blocks TRAIL binding to TRAIL receptor is administered with a TR2 receptor polynucleotide, polypeptide, or antagonist of the invention. Such agents include, but are not limited to: soluble TRAIL receptor polypeptides (eg,
Solubilized form of OPG, DR4 (WO98 / 32856); TR5 (WO98 / 3
0693); DR5 (WO98 / 41629); and TR10 (WO98 / 5
4202)); a multimeric form of a soluble TRAIL receptor polypeptide; and a TRAIL receptor antibody, which binds the TRAIL receptor without transmitting a biological signal that causes apoptosis, and blocks TRAIL binding to one or more TRAIL receptors. Binds anti-TRAIL antibodies, and TRAIL receptors, but does not transmit biological signals that cause apoptosis.
TRAIL mutein. Preferably, the antibodies used in this method are monoclonal antibodies.

Another embodiment of the present invention relates to TR2 as a regulator of B cell proliferation and differentiation.
Orientation for use. The assays and experiments described herein clearly provide the scientific rationale for the use of TR2 as a regulator of B cell proliferation and differentiation. The possible uses of soluble or membrane-bound TR2, their native ligands and various ligand antagonists are diverse and include the treatment of autoimmune disorders and immunodeficiencies resulting from infections, anti-neoplastic therapies and / or inherited disorders. Even more preneoplastic monoclonal hypergammaglobulinemia and neoplastic B-cell disorders (eg, multiple myeloma) have T
R2 or its ligand may be used.

Accordingly, TR2 or an induced functional agonist (eg, an amino acid sequence contained in the extracellular domain of an anti-TR2 antibody, TR2 and TR2 ligand (eg, TR2
(Including soluble forms with -Fc)) may find application as follows: As an agent that directs the individual immune system to the development of a hormonal response such as to a TH1 cell response (ie, TH2).

As an antigen for the production of antibodies that inhibit or enhance a TR2-mediated response.

As a means to activate T cells.

As a means of modulating secreted cytokines induced by TR2.

As antagonists of TR2 (including binding and / or inhibitory antibodies), antisense nucleic acids, ribozymes, soluble forms of TR2 (eg, TR2-fc) and TR ligands. They are expected to be able to reverse many activities of the above-mentioned receptors and to find clinical or practical applications such as: Antagonists of TR2 activity also treat infection with herpes virus Or can be used to prevent. Such antagonists include full-length and mature TR2 polypeptides of the invention, TR2 fragments (eg, soluble fragments), and antibodies having specificity for the TR2 polypeptide. While not wishing to be limited to a particular mechanism, TR2 antagonists are believed to function in the treatment or prevention of herpes virus infection by blocking herpes virus entry into cells.

A further condition, disease, or condition that can be treated by a TR2 polynucleotide or polypeptide, an agonist of TR2, is osteomyelitis.

Preferably, treatment using a TR2 polynucleotide or polypeptide, or an agonist of TR2, is by either administering an effective amount of the TR2 polypeptide to the patient or removing cells from the patient. Yes, the cells can be supplied with a TR2 polynucleotide and the engineered cells can be returned to the patient (ex vivo treatment). Further, as further described herein, a TR2 polypeptide or polynucleotide can be used as an adjuvant in a vaccine to elicit an immune response against an infectious disease.

In another embodiment, the TR2, TR2-SV1 and / or TR of the invention
2-SV2 polynucleotides or polypeptides and / or their agonists and / or agonists are used for the treatment, prevention, and / or diagnosis of: inner ear infections (eg, otitis media), and other infections (Streptoc)
occus pnuemoniae and other pathogenic organisms).

In certain embodiments, TR2, TR2-VS1 and / or TR2-S
V2 polynucleotides or polypeptides, or agonists or antagonists thereof (eg, anti-TR2, anti-TR2-SV1 and / or anti-TR2-S
V2 antibodies) are used in the treatment or prevention of disorders, characterized by defective serum immunoglobulin production, repeated infection, and / or dysfunction of the immune system. Further, TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or polypeptides, or agonists or antagonists thereof (eg, anti-TR2, anti-TR2-SV1, and / or anti-TR2-SV2 antibodies) can be used in joints, bones, Skin infections and / or parotid, blood-bone infections (eg,
Sepsis, meningitis, septic arthritis, and / or osteomyelitis), autoimmune diseases (eg, the diseases described in the present invention), inflammatory disorders, and malignant diseases, and / or their infections, diseases, disorders. And / or malignant diseases (CVID, other primary immunodeficiencies, HIV disease, CLL, recurrent bronchitis, sinusitis, otitis media, conjunctivitis, pneumonia, hepatitis, meningitis, shingles (eg, severe shingles) Shingles) and / or any disease or condition associated with (including, but not limited to) Pneumocystis.

The TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or polypeptides, agonists or antagonists thereof of the present invention may be used for the diagnosis, prognosis, or diagnosis of one or more of the following diseases, disorders, or conditions related thereto: Can be used for treatment or prevention: primary immunodeficiency, immune-mediated thrombocytopenia, Kawasaki disease, bone marrow transplantation (eg, recent bone marrow transplantation in adults or children), chronic B-cell lymphocytic leukemia, HIV infection (eg, , Adult or pediatric HIV infection), chronic inflammatory demyelinating polyneuropathy, and purpura after transfection.

Further, the TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or polypeptides, or agonists or antagonists thereof, of the present invention may be used to diagnose one or more of the following diseases, disorders, or conditions associated therewith: Foresight,
Can be used for treatment or prophylaxis: Guillain-Barre syndrome, anemia (eg, anemia associated with parvovirus B19), disease in patients with stable multiple myeloma at high risk of infection (eg, recurrent infection) Autoimmune hemolytic anemia (eg, warm autoimmune hemolytic anemia), thrombocytopenia (eg, neonatal thrombocytopenia), and immune-mediated neutropenia, transplantation (eg, CMV-yang). Sexual organ cytomegalovirus (CMV) -negative recipient), hypogammammaglobulin
emia (e.g., low gamma globulin (e.g., hypogammammaglobulinemiic neonate with risk factors for infection or pathological condition), epilepsy, (e.g., refractory epilepsy), systemic vasculature (systemic vasculature)
lytic syndrome), myasthenia gravis (eg, decompensation in myasthenia gravis), dermatomyositis and polymyositis.

[0396] Further preferred embodiments of the present invention include TR2, TR in the following applications.
2-SV1 and / or TR2-SV2 polypeptide, TR2, TR2-S
V1 and / or TR2-SV2 polynucleotides, and the use of functional agonists thereof, including but not limited to: Animals (e.g., mice, rats, hamsters, guinea pigs, pigs, micro-pigs, chickens, camels, goats, horses, cows,
Sheep, dogs, cats, non-human primates, and humans, most preferably humans)
Administered to boost the immune system. One or more antibodies (eg, IgG, IgA, Ig)
M, and IgE), to induce higher affinity antibody production (eg, IgG, IgA, IgM, and IgE), and / or to increase the immune response. In certain non-exclusive embodiments, the TR of the present invention
2, TR2-SV1 and / or TR2-SV2 polypeptides, and / or agonists thereof, can be administered to boost the immune system to produce increased amounts of IgG. In another specific, non-exclusive embodiment, the TR2, TR2-SV1, and / or TR2-SV2 polypeptides of the invention, and / or agonists thereof, are immunized to produce increased amounts of IgA. It can be administered to boost the system. In another specific non-exclusive embodiment, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the invention, and / or agonists thereof, comprise an immune system for producing increased amounts of IgM. Can be administered to boost

Animals that are unable to produce a functional endogenous antibody molecule, including but not limited to those listed above, and also including transgenic animals, or other susceptible endogenous immunity Administration to animals without a system. However, these animals can produce human immunoglobulin molecules by means of a reconstituted or partially reconstituted immune system from another animal (eg, published PCT application no. WO98 / 24893, WO / 9634096, WO / 9633735,
And WO / 9110741).

A vaccine adjuvant that enhances the immune response to a particular antigen. In certain embodiments, a vaccine adjuvant comprises a TR2, TR2, or TR2 described herein.
-SV1 and / or TR2-SV2 polypeptide. In another specific embodiment, the vaccine adjuvant comprises a TR2, TR2,
2-SV1 and / or TR2-SV2 polynucleotides (ie, TR2
2, TR2-SV1, and / or TR2-SV2 polynucleotides are genetic vaccine adjuvants). As described herein, TR2, T
The R2-SV1 and / or TR2-SV2 polynucleotides can be administered using known techniques, including but not limited to liposome delivery, recombinant vector delivery, naked DNA injection, and gene gun delivery ).

An adjuvant to enhance a tumor-specific immune response.

An adjuvant to enhance an anti-viral immune response. Anti-viral immune responses that can be enhanced using the compositions of the present invention as adjuvants include those described herein or other known viruses and virus-related diseases, or conditions, in the art. However, the present invention is not limited to these. In certain embodiments, the compositions of the invention are used as adjuvants to enhance an immune response to a virus, disorder, or condition selected from the group consisting of: AIDS, meningitis, dengue, EBV, and Hepatitis (eg, hepatitis B). In another specific embodiment, the composition of the invention comprises the following: HIV / AIDS, RS virus, dengue, rotavirus, Japanese encephalitis, influenza A and B, parainfluenza, measles,
Used as an adjuvant to enhance the immune response to a virus, disease, or condition selected from the group consisting of cytomegalovirus, rabies, Junin, chikungunya, Rift Valley fever, herpes simplex, and yellow fever. In another specific embodiment, the compositions of the invention are used as adjuvants to enhance an immune response to the HIV gp120 antigen.

An adjuvant for enhancing an anti-bacterial or anti-fungal immune response. Anti-bacterial or anti-fungal immune responses that can be enhanced using the compositions of the present invention as adjuvants include bacteria or fungi and other diseases or conditions described herein or known in the art. Related bacteria or fungi are included. In certain embodiments, the composition of the invention is for enhancing an immune response to a bacterium or fungus, disease, or condition selected from the group consisting of: tetanus, diphtheria, botulinum, and meningitis type B. Used as an adjuvant. In another specific embodiment, the composition of the invention comprises the following: cholera, leprosy, typhoid, paratyphi, Meisseriameningitis, Streptococcus pneumoniae, group B Streptococcus, Shigella, enterotoxic Escherichia coli, intestinal Bleeding E. coli, Borrelia burgdo
rferi, and a bacterium or fungus selected from the group consisting of Plasmodium (malaria), which is used as an adjuvant to enhance an immune response to a disease or condition.

An adjuvant for enhancing an anti-parasite immune response. Antiparasitic immune responses that can be enhanced using the compositions of the present invention as adjuvants include parasites and diseases or conditions associated with the parasites described herein or known in the art. In certain embodiments, the compositions of the present invention are used as adjuvants to enhance the immune response against parasites. In another specific embodiment, the compositions of the invention are used as adjuvants to enhance the immune response against Plasmodium (malaria).

As a stimulus as a response of B cells to pathogens.

Prior to receiving immunosuppressive therapy, it could be an agent that raises an individual's immune status.

As Agents To Induce High Affinity Antibodies As Agents To Increase Serum Immunoglobulin Concentrations As Agents To Promote Recovery Of Immunocompromised Individuals Bone marrow transplants and / or other transplants (eg allogeneic or xenogeneic organ transplants) as agents to boost
As an enhancer of the immune system before, during, or after. For transplantation, the compositions of the present invention may be administered before, simultaneously with, and / or after transplantation. In certain embodiments, the compositions of the invention are administered after transplantation, prior to the onset of T cell population recovery. In another specific embodiment, the composition of the invention is administered initially after transplantation, after the onset of T cell population recovery, but before full recovery of the B cell population.

The compositions of the present invention are as agents for boosting immune responsiveness among B cell immunodeficient individuals (eg, individuals who have undergone partial or complete splenectomy). TR2, TR
B-cell immunodeficiencies that can be restored or treated by administration of a 2-SV1 and / or TR2-SV2 polypeptide or a polynucleotide of the invention, or an agonist thereof include X-linked severe combined immunodeficiency (SCID), SC
ID-autosome, adenosine deaminase deficiency (ADA deficiency), X-linked agammaglobulinemia (XLA), Bruton's disease, congenital agammaglobulinemia, X-linked infant agammaglobulinemia, acquired agammaglobulin Blood, adult-onset agammaglobulinemia, late-onset agammaglobulinemia, hypogammaglobulinemia, hypergammaglobulinemia, transient hypergammaglobulinemia in infants, unspecified hypergammaglobulinemia, Agammaglobulinemia, unclassifiable immunodeficiency (CVID) (acquired), Viscott-Aldrich syndrome (WAS), X-linked immunodeficiency with excess IgM, non-X-linked immunodeficiency with excess IgM, selective I
gA deficiency, IgG subclass deficiency (with or without IgA deficiency), antibody deficiency with normal or elevated Igs, immunodeficiency with thymoma, Ig heavy chain deficiency, kappa chain deficiency, B cell lymphoproliferative disorder (BLPD), selective IgM immunodeficiency, recessive agammaglobulinemia (Swiss type), reticulodysplasia, neonatal neutropenia, severe congenital leukopenia, lymphoplasty with immunodeficiency-development Insufficiency or dysplasia, ataxia-telangiectasia, dwarfism, X-linked lymphoproliferative syndrome (XLP), Neserof syndrome with Igs-mixed immune deficiency, purine nucleoside phosphorylase deficiency (PNP), MHC class II deficiency (insufficient lymphocyte syndrome) and severe combined immunodeficiency include, but are not limited to.

As an agent to boost immune responsiveness between individuals with an acquired defect in B cell function. Conditions that result in a loss of acquired B cell function that can be restored or treated by administration of a TR2, TR2-SV1 and / or TR2-SV2 polypeptide or polynucleotide of the invention, or an agonist thereof, include HIV infection , AIDS, bone marrow transplantation, and B-cell chronic lymphocytic leukemia (CLL)
), But is not limited thereto.

As an agent to boost immunoreactivity between individuals with temporary immune deficiencies. Conditions that produce a temporary immune deficiency that can be restored or treated by administration of a TR2, TR2-SV1 and / or TR2-SV2 polypeptide or a polynucleotide of the invention, or an agonist thereof, include viral infections (eg, , Influenza), malnutrition-related conditions, recovery from infectious mononucleosis, or stress-related conditions, recovery from measles, recovery from blood transfusions, recovery from surgery, However, the present invention is not limited to these.

As a regulator of antigen presentation by monocytes, dendritic cells, and / or B cells. 1
In one embodiment, TR2, TR2-SV1 and / or TR2-SV2
The polypeptide (soluble, membrane-bound or transmembrane form) or polynucleotide is
Enhance antigen presentation or antagonize antigen presentation in vitro or in vivo. Further, in a related embodiment, this enhancement or antagonization of antigen presentation may be used in anti-tumor treatment or may modulate an immune response.

As a mediator of the mucosal immune response. The expression of TR2 by monocytes, and the responsiveness of B cells to this factor, indicate that: It may be involved in the exchange of signals between B cells and monocytes or may be involved in their differentiated progeny. This activity is similar in many ways to CD40-CD154 signaling between B and T cells. Thus, TR2 may be a key regulator of T-cell independent immune responses to environmental pathogens. In particular, an unusual B cell population (C
D5 +), which is associated with mucosal sites and is responsible for most of innate immunity in humans, responds to TR2, thereby enhancing individual protective immune status.

As a means to induce tumor growth, then to make the means more susceptible to anti-neoplastic agents. For example, multiple myeloma is a slowly dividing disease,
Thus, it is resistant to virtually all anti-neoplastic therapies. If these cells are grown more rapidly, their sensitivity profile is likely to change.

As a B cell-specific binding protein to which specific activators or inhibitors of cell proliferation can be attached. The results focus on the activity of such activators, or inhibitors, into normal, diseased, or neoplastic B cell populations.

As a means of detecting lineage B cells due to the advantage of specificity. This application may require labeling the protein with biotin or other agents (described herein) to provide a means of detection.

Pathology (eg, AIDS, chronic lymphocyte injury and / or Common V
as a stimulator of the production of B cells in variable Immunodeficiency.

As part of the B cell selection device. Its function is to obtain B from heterogeneous mixtures of cell types.
Is to isolate cells. T2 can bind to a solid support, to which B cells specifically bind. Unbound cells are washed and bound cells are subsequently eluted. Non-limiting use of this selection allows for the elimination of tumor cells (eg, from bone marrow or peripheral blood) prior to transplantation.

As a treatment for lymphoid tissue production and / or regeneration following surgery, trauma, genetic defects.

As a gene-based therapy for genetically inherited disorders that result in immunodeficiency (eg, observed in SCID patients).

As an antigen to raise antibodies to inhibit or enhance TR2, TR2-SV1 and / or TR2-SV2-mediated responses.

As a means of activating monocytes / macrophages to protect against parasite diseases affecting monocytes (eg, Leshmania).

As a pretreatment of bone marrow samples prior to transplantation. Such treatment enhances B cell presentation and then promotes recovery.

As a means of modulating the secreted cytokines induced by TR2, TR2-SV1 and / or TR2-SV2.

The TR2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides, or agonists, of the present invention may be administered in vitro or in vivo.
Can be used to adjust gE concentration.

Thus, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides of the invention, or agonists thereof, may be used for the treatment, prevention and / or diagnosis of an IgE-mediated allergic reaction. Such allergic reactions include, but are not limited to, asthma, rhinitis and eczema.

In certain embodiments, the TR2, TR2-SV1 and / or T2 of the invention
The R2-SV2 polypeptide or polynucleotide, or agonist thereof, is administered for the treatment, prevention, diagnosis and / or amelioration of a selective IgA deficiency.

In another embodiment of the present invention, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides of the invention, or agonists thereof, treat, prevent, diagnose and treat telangiectasia. And / or administered to improve.

In another particular aspect, the TR2, TR2-SV1 and / or T of the present invention
The R2-SV2 polypeptide or polynucleotide, or agonist thereof, is administered to treat, prevent, diagnose, and / or ameliorate non-typeable immunodeficiency.

In another specific aspect, the TR2, TR2-SV1 and / or T of the present invention
The R2-SV2 polypeptide or polynucleotide, or agonist thereof, is administered to treat, prevent, diagnose and / or ameliorate X-linked agammaglobulinemia.

In another specific aspect, the TR2, TR2-SV1 and / or T2 of the present invention
R2-SV2 polypeptides or polynucleotides, or agonists thereof, are administered to treat, prevent, diagnose and / or ameliorate severe combined immunodeficiency (SCID).

In another specific aspect, the TR2, TR2-SV1 and / or T of the present invention
The R2-SV2 polypeptide or polynucleotide, or agonist thereof, is administered to treat, prevent, diagnose, and / or ameliorate Viscott-Aldrich syndrome.

In another particular aspect, the TR2, TR2-SV1 and / or T2 of the present invention
The R2-SV2 polypeptide or polynucleotide, or agonist thereof, is administered to treat, prevent, diagnose, and / or ameliorate X-linked immunodeficiency with excess IgM.

In another specific embodiment, a TR2, TR2-SV1 and / or TR2-SV2 polypeptide or polynucleotide of the invention, or an agonist or antagonist thereof (eg, an anti-TR2 antibody) is a chronic myeloid leukemia. Acute myeloid leukemia, leukemia, histiocytic leukemia, monocytic leukemia (e.g., acute monocytic leukemia), leukemic reticulopathy, Stilling monocytic leukemia, and / or monocytes and / or monocytes Administered to treat, prevent, diagnose, and / or ameliorate other leukemias derived from cells and / or tissues.

In another specific embodiment, the TR2, TR2-SV1 and / or TR2 of the present invention
Alternatively, a TR2-SV2 polypeptide or polynucleotide or an agonist thereof is administered to treat, prevent, diagnose, and / or ameliorate a monocytic leukemia response, for example, as seen with tuberculosis.

In another specific embodiment, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides of the invention, or agonists thereof, are monocytic leukocytosis, monocytic leukopenia. Is administered to treat, prevent, diagnose, and / or ameliorate the disease, monocytopenia, and / or monocytosis.

In another particular embodiment, the TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or polypeptides of the invention and / or anti-TR2 antibodies and / or agonists or antagonists thereof are used. To treat, prevent, detect and / or diagnose a primary B lymphocyte disorder and / or disease, and / or a condition associated therewith. In one embodiment, such a primary B lymphocyte disorder, disease and / or condition is characterized by a complete or partial loss of humoral immunity. Primary B lymphocyte disorders, diseases, and disorders characterized by a complete or partial loss of humoral immunity and that can be prevented, treated, detected and / or diagnosed using the compositions of the present invention. And / or conditions associated therewith include, but are not limited to, X-linked agammaglobulinemia (XLA), severe combined immunodeficiency (SCID), and selective IgA deficiency.

In a preferred embodiment, TR2, TR2-SV1 and / or TR2
-A disease or disorder affecting any one or more various mucous membranes of the body or a condition associated with any one or more various mucous membranes of the body using SV2 polynucleotides, polypeptides and / or agonists thereof. Treat, prevent, and / or
Or diagnose. Such diseases or disorders include, but are not limited to, for example, mucositis, mucosal destruction, mucosal colitis, mucosal leishmaniasis (eg, American leishmaniasis, skin) Flambesia, nasopharyngeal leishmaniasis, and new world leishmaniasis), mucocutaneous lymph node syndrome (for example, Kawasaki disease), small intestinal mucositis, mucosal epidermoid carcinoma, mucosal epithelioid tumor, mucosal epithelial dysplasia, mucoid Adenocarcinoma, mucoid degeneration, myxoid degeneration; mucosal degeneration; mucosal tumor disease, mucoid medial degeneration (eg, cystic medial necrosis), mucolipidosis (eg, mucolipidosis I, mucolipidosis II, mucolipidosis III, mucolipidosis) IV, mucolytic disorders, mucous membrane enteritis, intestinal mucositis, mucopolysaccharidosis ( For example, type I mucopolysaccharidosis (ie, Hurler syndrome), IS type mucopolysaccharidosis (ie, Cheyer syndrome or V type mucopolysaccharidosis), type II mucopolysaccharidosis (ie, Hunter syndrome) ), Mucopolysaccharidosis type III (i.e., Sanfilipo syndrome), mucopolysaccharidosis type IV (i.e., Morquio syndrome), mucopolysaccharidosis type VI (i.e., Maroto-Lamy syndrome), mucopolysaccharide type VII Body deposits (ie, mucopolysaccharidosis due to β-glucuronidase deficiency) and mucosulfatosis), mucopolydiabetes, mucopurulent conjunctivitis, purulent mucus, mucormycosis (ie, zygomycosis, mucosal disease) (Ie, bovine viral diarrhea), mucinous colitis (eg, mucous colitis and mucosal colitis), and mucovisidosis (Eg, cystic fibrosis, cystic fibrosis of the pancreas, Clark-Haddfield syndrome, fibrocystic disease of the pancreas, mucovisidosis, and hypermucositis) In highly preferred embodiments, TR2, TR2-SV1 and / or Or a TR2-SV2 polynucleotide,
The polypeptides, and / or their agonists and / or antagonists, are used to treat, prevent, and / or diagnose mucositis, particularly as associated with chemotherapy.

In a preferred embodiment, TR2, TR2-SV1 and / or TR2-
SV2 polynucleotides, TR2, TR2-SV1 and / or TR2-S
V2 polypeptides, and / or agonists and / or antagonists thereof, are used to treat, prevent and / or diagnose a disease or disorder affecting sinusitis or a condition associated with sinusitis. .

A polynucleotide of TR2, TR2-SV1 and / or TR2-SV2,
Additional conditions, diseases or conditions that can be treated, prevented and / or diagnosed by a TR2, TR2-SV1 and / or TR2-SV2 polypeptide, or an agonist of TR2, TR2-SV1 and / or TR2-SV2 are:
Osteomyelitis.

A polynucleotide of TR2, TR2-SV1 and / or TR2-SV2,
Additional conditions, diseases or conditions that can be treated, prevented and / or diagnosed by a TR2, TR2-SV1 and / or TR2-SV2 polypeptide, or an agonist of TR2, TR2-SV1 and / or TR2-SV2 are:
It is endocarditis.

As antagonists of TR2, TR2-SV1 and / or TR2-SV2, binding and / or inhibiting antibodies, antisense nucleic acids, ribozymes, and TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the present invention Is mentioned. They are expected to reverse the activities of many of the above ligands, as well as find clinical or practical applications such as: Methods to block various aspects of the immune response to foreign factors or self. Examples include autoimmune diseases such as lupus and arthritis, and immune responsiveness to skin allergies, inflammation, bowel disease, wounds and pathogens. Although our recent data have directly addressed the potential role of TR2 in B cell and monocyte-related pathology, it is possible that other cell types may gain expression or responsiveness to TR2. Remains possible. Thus, like CD40 and its ligands, T
R2 is regulated by the state of the immune system and the microenvironment in which cells are located.

[0440] Treatment to prevent B cell proliferation and immunoglobulin secretion associated with autoimmune diseases such as idiopathic thrombocytopenic purpura, systemic lupus erythematosus and MS.

Inhibitors of graft versus host disease or transplant rejection.

B-cell malignancies such as ALL, Hodgkin's disease, non-Hodgkin's lymphoma, chronic lymphocytic leukemia, plasmacytoma, multiple myeloma, Burkitt's lymphoma, and EBV
The treatment of a transformed disease.

Monoclonal hypergammaglobulinemia of indeterminate significance (monoclonalg)
ammopathy of undetermined significan
ce) (MGUS), treatment of chronic hypergammaglobulinemia events in diseases such as Waldenstrom's disease, associated idiopathic monoclonal gammopathy, and plasmacytoma.

Treatment to reduce cell proliferation of large B-cell lymphoma.

Means for reducing the involvement of B cells and immunoglobulins associated with chronic myeloid leukemia.

[0446] Immunosuppressants.

The TR2, TR2-SV1 and / or TR2-SV2 polypeptides or TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or antagonists of the present invention may be an Ig in vitro or in vivo.
Can be used to adjust E concentration.

In another embodiment, the TR2, TR2-SV1 and / or T2 of the invention
R2-SV2 polypeptide or TR2, TR2-SV1 and / or T
R2-SV2 polynucleotides or their antagonists are IgE
It can be used for the treatment, prevention and / or diagnosis of a mediated allergic reaction, including but not limited to asthma, rhinitis and eczema.

ERK1, COX2 and Cycli associated with TR2-induced B cell activation
Inhibitors of signaling pathways involving nD2.

The applications cited above have uses in a variety of hosts. Such hosts include humans, mice (murine), rabbits, goats, guinea pigs, camels, horses, mice, rats, hamsters, pigs, mini pigs (mic).
ro-pig), chickens, goats, cows, sheep, dogs, cats, non-human primates, and humans. In certain embodiments, the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat. In a preferred embodiment, the host is a mammal. In a most preferred embodiment, the host is human.

Agonists and antagonists can be used in compositions with a pharmaceutically acceptable carrier, for example, as described herein.

[0464] Antagonists may be used, for example, in certain autoimmune and chronic inflammatory and infectious diseases, to be TR2-mediated, TR2-SV1-mediated and / or TR2-
SV2-mediated chemotaxis and activation of macrophages and their precursors, and neutrophils, basophils, B lymphocytes and some T cell subsets (eg, activated T cells and CD8 cytotoxicity) T cells) as well as natural killer cells. Examples of autoimmune diseases include multiple sclerosis and insulin-dependent diabetes. Antagonists are also used to treat, prevent and / or diagnose infectious diseases (including silicosis, sarcoidosis, idiopathic pulmonary fibrosis) by preventing mononuclear phagocyte recruitment and activation. Can be done. They can also be used to treat, prevent, and / or diagnose idiopathic eosinophilia syndrome by preventing eosinophil production and migration. Endotoxin shock can also be treated with antagonists by blocking the migration of macrophages and their production of TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the invention. Antagonists can also be used to treat atherosclerosis by preventing monocyte infiltration in the arterial wall. Antagonists also inhibit histamine-mediated allergic reactions and immunological disorders (late allergic reactions, chronic urticaria, and atopic dermatitis, by inhibiting chemokine-induced mast cells and basophil degranulation and histamine release). ) To treat, prevent, and / or
Or it can be used to diagnose. IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema can also be treated. Antagonists can also be used to treat, prevent and / or diagnose chronic and acute inflammation by preventing the attraction of monocytes to the wound area. Chronic and acute inflammatory lung diseases are caused by sequestration of mononuclear phagocytes in the lung
As such, antagonists can also be used to modulate normal lung macrophage populations. Antagonists can also be used to treat, prevent, and / or diagnose rheumatoid arthritis by preventing attracting monocytes into synovial fluid in the joints of a patient. Monocyte influx and activation plays an important role in the pathogenesis of both osteoarthritis and inflammatory arthropathy. Antagonists can be used to disrupt a deleterious cascade mainly attributed to IL-1 and TNF, which inhibits the biosynthesis of other inflammatory cytokines. In this way, antagonists can be used to inhibit inflammation. Antagonists may also inhibit the prostaglandin-independent fever induced by TR2, TR2-SV1 and / or TR2-SV2.
pendent fever). Antagonists may also treat cases of bone marrow defects (eg, aplastic anemia and myelodysplastic syndrome)
Can be used to treat, prevent, and / or diagnose. Antagonists can also be used to treat, prevent and / or diagnose asthma and allergy by blocking eosinophil accumulation in the lungs. Antagonists also
It can be used to treat, prevent and / or diagnose subepithelial basement membrane fibrosis, a hallmark feature of asthmatic lungs. Antagonists can also be used to treat, prevent, and / or diagnose lymphomas, such as, but not limited to, a broad list of one or more lymphomas provided herein.

The TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the present invention, and / or their agonists and / or antagonists may be a mammal. In a (preferably human), various immune system-related disorders and / or conditions associated with these disorders can be used to treat, prevent and / or diagnose. Many autoimmune disorders result from improper recognition of self as a foreign substance by immune cells. This improper recognition results in an immune response that leads to destruction of the host tissue. Thus, the TR2, TR2-SV1 and / or T2 of the present invention that can inhibit an immune response, particularly B cell proliferation and / or production of immunoglobulins.
Administration of R2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides, and / or agonists and / or antagonists thereof is effective for treatment in the treatment and / or prevention of autoimmune disorders Can be Thus, in a preferred embodiment, the TR2, TR2-SV1 and / or TR2-SV2 antagonists of the invention (eg, TR2, TR2-SV1 and / or TR2-SV2 polypeptide fragments and anti-TR2 antibodies) are autoimmune. Used for the treatment, prevention and / or diagnosis of disorders.

A TR2, TR2-SV1 and / or TR2-SV2 polynucleotide, a TR2, TR2-SV1 and / or TR2-SV2 polypeptide of the invention, and / or TR2, TR2-SV1 and / or TR2-SV
Autoimmune disorders and conditions associated with these disorders that can be treated, prevented and / or diagnosed with two antagonists (eg, anti-TR2 antibodies) include, but are not limited to: autoimmune hemolysis Anemia, autoimmune neonatal thrombocytopenia, idiopathic thrombocytopenia purpura
ocytopenia purpura), autoimmune cytopenia, hemolytic anemia, antiphospholipid syndrome, dermatitis, allergic encephalomyelitis, myocarditis, recurrent polychondritis, rheumatic heart disease, glomerulonephritis (for example, IgA nephropathy), multiple sclerosis, neuritis, uveoconjunctivitis, multiple endocrine diseases, purpura (eg, Hen)
loch-Scoenlein purpura), Reiter's disease, Stiff man syndrome,
Autoimmune pneumonia, Guillain-Barre syndrome, insulin-dependent diabetes, and autoimmune inflammatory eye diseases.

Additional (highly likely) autoimmune disorders that can be treated, prevented and / or diagnosed using the compositions of the present invention include, but are not limited to: autoimmune thyroid Inflammation, thyroid dysfunction (ie, Hashimoto's thyroiditis), (often characterized by, for example, cell-mediated and humoral thyroid cytotoxicity), systemic lupus erythematosus (often, eg, circulating immune complexes and Eg, characterized by locally produced immune complexes, Goodpasture's syndrome (often characterized by, for example, anti-basement membrane antibodies), pemphigus (often characterized by, eg, epidermal acantholytic antibodies), eg (A) Graves' disease (often characterized by, for example, TSH receptor antibodies) Receptor autoimmunity such as (b) myasthenia gravis (often characterized by, for example, acetylcholine receptor antibodies), and (c) insulin resistance (often characterized by, for example, insulin receptor antibodies). Autoimmune hemolytic anemia (often, for example, antibody-sensitized R
Autophagic thrombocytopenic purpura (often characterized, for example, by phagocytic cells of platelets sensitized to antibodies).

Additional (highly likely) autoimmune disorders that can be treated, prevented and / or diagnosed using the compositions of the present invention include, but are not limited to, rheumatoid arthritis ( Often, for example, characterized by immune complexes in joints), scleroderma (schlerod) with anti-collagen antibodies
erma) (often characterized by, eg, nucleoli and other nuclear antibodies), mixed connective tissue disease (often, eg, characterized by antibodies to extractable nuclear antigens (eg, ribonucleoproteins)), Polymyositis / dermatomyositis (
Often, eg, characterized by non-histone ANA), pernicious anemia (often, eg, characterized by anti-mural cells, microsomes and endogenous factor antibodies), idiopathic Addison's disease (often, eg, humoral and cell-mediated) , Infertility (often characterized, for example, by anti-sperm antibodies), glomerulonephritis such as primary glomerulonephritis and IgA nephropathy (often, eg, glomerular basement membrane) Pemphigus bullosa (often characterized by IgG and complement in the basement membrane), Sjogren's syndrome (often, for example, characterized by antibodies or immune complexes)
Multiple tissue antibodies, and / or characterized by specific non-histone ANA (SS-B)), diabetes mellitus (often characterized by cell-mediated and humoral islet cell antibodies), and asthma Or adrenergic drug resistance, including adrenergic drug resistance with cystic fibrosis (often characterized by β-adrenergic receptor antibodies).

Additional (potentially) autoimmune disorders that can be treated, prevented and / or diagnosed using the compositions of the present invention include, but are not limited to, chronic active liver disease ( Often, for example, characterized by smooth muscle antibodies), primary biliary cirrhosis (often, for example, characterized by mitochondrial antibodies), and other endocrine deficiencies (often, for example, in some cases, specific tissue antibodies) Vitiligo (often characterized by melanocyte antibodies), vasculitis (often characterized by Ig and complement in the vessel wall and / or low serum complement), po
st-MI (often characterized by, for example, myocardial antibodies), open heart syndrome (often characterized by, for example, myocardial antibodies), hives (often, for example, characterized by IgG and IgM antibodies to IgE) Atopic dermatitis (often characterized by IgG and IgM antibodies to IgE), asthma (often characterized by IgG and IgM to IgE), inflammatory myopathy, and many others. Other inflammatory, granulomatous, degenerative, and atrophic disorders.

In a preferred embodiment, the autoimmune disease and the disorders and / or conditions associated with the above diseases and disorders are treated with an anti-TR2 antibody, an anti-TR2-SV1 antibody and / or an anti-TR2-SV2 antibody, Prevented and / or diagnosed.

In certain preferred embodiments, rheumatoid arthritis is treated, prevented and / or treated with anti-TR2, anti-TR2-SV1 and / or anti-TR2-SV2 antibodies and / or other antagonists of the invention. Diagnosed.

In certain preferred embodiments, lupus is an anti-TR2 antibody, anti-TR2
-Treated, prevented and / or diagnosed using SV1 antibodies and / or anti-TR2-SV2 antibodies and / or other antagonists.

In certain preferred embodiments, the nephritis associated with lupus is an anti-TR2 of the invention.
The antibody is treated, prevented and / or diagnosed using antibodies, anti-TR2-SV1 and / or anti-TR2-SV2 antibodies and / or other antagonists.

In certain embodiments, TR2, TR2-SV1 and / or TR2-
SV2 polynucleotide or TR2, TR2-SV1 and / or TR
2-SV2 polypeptides or their antagonists (eg, anti-TR
2 antibodies, anti-TR2-SV1 antibodies and / or anti-TR2-SV2 antibodies) are used to treat or prevent systemic lupus erythematosus and / or to treat or prevent a disease, disorder or condition associated therewith. TR of the present invention
2, a lupus-related disease, disorder, which can be treated or prevented using a TR2-SV1 and / or TR2-SV2 polynucleotide or a TR2, TR2-SV1 and / or TR2-SV2 polypeptide, or an antagonist thereof. Or conditions include, but are not limited to: hematological disorders (eg, hemolytic anemia, leukopenia, lymphopenia, and thrombocytopenia), immunological disorders (eg, DNA and anti-Sm antibodies) rash, photophobia, mouth ulcer, arthritis, fever, fatigue, weight loss, serositis (eg, pleurisy (pleuricy)), renal disorder (eg, nephritis), neurological disorder (eg, , Seizures, peripheral neuropathy, CNS-related disorders), gastrointestinal disorders, Lenneau's phenomenon, and pericarditis)
. In a preferred embodiment, TR2, TR2-SV1 and / or TR2
A polynucleotide of SV2 or TR2, TR2-SV1 and / or T
R2-SV2 polypeptides or antagonists thereof (eg, anti-T
R2 antibodies, anti-TR2-SV1 antibodies and / or anti-TR2-SV2 antibodies) can be used to treat or prevent systemic lupus erythematosus-related kidney damage.
In a most preferred embodiment, TR2, TR2-SV1 and / or TR2
A 2-SV2 polynucleotide or a TR2, TR2-SV1 and / or TR2-SV2 polypeptide, or an antagonist thereof (eg, an anti-TR2 antibody, an anti-TR2-SV1 antibody and / or an anti-TR2-SV2 antibody) is
Used to treat or prevent systemic lupus erythematosus-related nephritis.

Similarly, as in asthma (especially allergic asthma) or other respiratory problems,
Allergic reactions and allergic conditions are also TR2, TR2-SV1 of the present invention.
And / or TR2-SV2 polynucleotide or TR2, TR2-S
V1 and / or TR2-SV2 polypeptides, and / or their agonists and / or antagonists. In addition, these molecules can be used to treat, prevent and / or diagnose anaphylaxis, hypersensitivity or blood group incompatibility to antigenic molecules.

The TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the present invention and / or agonists and / or antagonists thereof are also used. , Organ rejection or graft versus host disease (GVHD) and / or conditions associated therewith can be treated, prevented and / or diagnosed. Organ rejection is caused by host immune cell destruction of the transplanted tissue via the immune response. Similarly, the immune response is also involved in GVHD, where exogenous transplanted immune cells destroy host tissues. A polynucleotide of TR2, TR2-SV1 and / or TR2-SV2 of the present invention or TR2, TR2-SV1 and / or TR2-SV2 that inhibits an immune response, particularly T cell proliferation, differentiation or chemotaxis. Administration of polypeptides, and / or agonists and / or antagonists thereof, can be an effective treatment in preventing organ rejection or GVHD.

Similarly, a TR2, TR2-SV1 and / or TR2-SV2 polynucleotide or TR2, TR2-SV1 and / or TR2-SV of the present invention
Two polypeptides, and / or agonists or antagonists thereof, may also be used to modulate inflammation. For example, TR2, TR2-SV of the present invention
1 and / or TR2-SV2 polynucleotide or TR2, TR2-
SV1 and / or TR2-SV2 polypeptides, and / or agonists or antagonists thereof, can inhibit the proliferation and differentiation of cells involved in the inflammatory response. These molecules can be used to treat chronic prostatitis, granulomatous prostatitis, malakoplacia, infection-related inflammation (eg, septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury Associated inflammation,
For inflammation associated with endotoxin death, inflammation associated with arthritis, inflammation associated with complement-mediated hyperacute rejection, inflammation associated with nephritis, inflammation associated with lung injury induced by cytokines or chemokines, inflammatory bowel disease It can treat, prevent and / or diagnose both chronic and acute inflammatory conditions, including associated inflammation, inflammation associated with Crohn's disease or inflammation resulting from overproduction of cytokines (eg, TNF or IL-1). .

In certain embodiments, the anti-TR2, anti-TR2-SV1 and / or anti-TR2-SV2 antibodies of the invention are used to treat, prevent, modulate, detect and / or diagnose inflammation. .

In certain embodiments, the anti-TR2, anti-TR2-SV1 and / or anti-TR2-SV2 antibodies of the invention are used to treat, prevent, modulate, detect and / or diagnose an inflammatory disorder. Is done.

In another specific embodiment, the anti-TR2, anti-TR2-SV1 and / or anti-TR2-SV2 antibodies of the invention treat, prevent, modulate, detect and / or diagnose allergy and hypersensitivity. Used for

Antibodies to TR2, TR2-SV1 and / or TR2-SV2 may
To treat, prevent and / or diagnose DS, by inhibiting neutrophil infiltration into the lungs after a disorder, TR2, TR2-SV1 and / or TR2-S
Binds to the activity of V2 and TR2, TR2-SV1 and / or TR2-S
It can be used to inhibit V2. The agonists and antagonists of the present invention may be used in a composition with a pharmaceutically acceptable carrier, for example, as described hereinafter.

A TR2, TR2-SV1 and / or TR2-SV2 and / or TR2 receptor polynucleotide or a TR2, TR2-SV1 and / or TR2-SV2 and / or TR2 receptor polypeptide of the present invention, and / or Agonists or antagonists treat pulmonary system diseases and disorders (eg, bronchi such as sinus pulmonary and bronchial infections) and conditions associated with such diseases and disorders, and other bronchial diseases and disorders, Used to prevent and / or diagnose. In certain embodiments, such diseases and disorders include, but are not limited to: bronchial adenoma, bronchial asthma (eg, bronchial pneumonia (bronch)
ial pneumonia, bronchopneumonia and tuberculous bronchial pneumonia), chronic obstructive pulmonary disease (COPD), bronchial polyps, bronchiectasis (eg, dry bronchiectasis, columnar bronchiectasis and cystic bronchiectasis), Bronchiolar adenocarcinomas, bronchiolar carcinomas, bronchiolitis (e.g., exudative bronchiolitis, occlusive fibrous bronchiolitis and proliferative bronchiolitis, etc.), bronchiolo-alveolar carcinoma, bronchioles Inflammatory asthma, bronchitis (eg, asthmatic bronchitis, Castellani bronchitis, chronic bronchitis, Croup's bronchitis, fibrinous bronchitis, hemorrhagic bronchitis, infectious bronchitis in birds, obstructive bronchitis, formation Bronchitis, pseudomembranous bronchitis, septic bronchitis and parasitic bronchitis Bronchitis, etc.), central bronchial granulomatosis, bronchial edema, bronchoesophageal fistula, bronchiogenic carcinoma, bronchial cyst, broncholithiasis, bronchial malacia, bronchial mycosis (eg, bronchopulmonary aspergillosis, etc.), broncho-pulmonary Spirochetosis, hemorrhagic bronchitis, bronchial leak, bronchospasm, bronchial drip bleeding, bronchial stenosis, biot respiration, bronchial respiration, Kussmaul respiration, Kussmaul-Keen respiration, respiratory acidosis, respiratory alkalosis, neonatal respiratory distress Syndrome, respiratory dysfunction, upper respiratory sclerosis, respiratory syncytial virus, etc.

In certain embodiments, the TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the invention, and / or agonists and / or Or antagonists are used to treat, prevent and / or diagnose chronic obstructive pulmonary disease (COPD).

In another embodiment, the TR2, TR2-SV1 and / or T2 of the invention
R2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides, and / or agonists and / or antagonists thereof, may be, for example, cystic fibrosis (eg, cystic fibrosis of the pancreas, Clark-Hudfield syndrome, including fibrous cystic diseases of the pancreas, fibroses such as mucovisidosis and hypermucus, endocardial myocardial fibrosis, idiopathic retroperitoneal fibrosis, pial fibrosis, mediastinum Fibers such as fibrosis, nodular subepithelial fibroplasia, central venous fibrosis, perimuscular fibrosis, pipe axial fibrosis, replacement fibrosis, subadventurous fibrosis and Simmerz ceramic pipe striatum fibrosis Disease (f
used to treat, prevent and / or diagnose fibrosis and conditions associated with (but not limited to) ibrose.

TNF family ligands are known to be the most pleiotropic cytokines and have a number of cellular responses, including cytotoxicity, antiviral activity, immunomodulatory activity, and transcriptional regulation of some genes. (DV Goeddel et al., "Tumor Necrosis Factors: Gene Struct."
ure and Biological Activities ", Symp.
Quant. Biol. 51: 597-609 (1986), Cold Spr.
ing Harbor; B. Beutler, and A.J. Cerami, Ann
u. Rev .. Biochem. 57: 505-518 (1988); J. O
ld, Sci. Am. 258: 59-75 (1988); Fiers, FE
BS Lett. 285: 199-224 (1991)). TR2, T of the present invention
TNF-family ligands, including R2-SV1 and / or TR2-SV2 polypeptides, induce these various cellular responses by binding to TNF-family receptors. TR2, TR2-SV1 and / or T
R2-SV2 polypeptides are believed to elicit strong cellular responses, including any genotypic, phenotypic and / or morphological changes, to cells, cell lines, tissues, tissue cultures or patients. . As indicated, such cellular responses include normal physiological responses to TNF family ligands, as well as diseases associated with increased apoptosis and inhibition of apoptosis. Apoptosis (
(Programmed cell death) is a physiological mechanism involved in the loss of peripheral B and / or T lymphocytes of the immune system, and its inability to regulate apoptosis, which can lead to many different pathogenic processes ( JC Ameisen, AID
S8: 1197-1213 (1994); H. Krammer et al., Cur
r. Opin. Immunol. 6: 279-289 (1994)).

Using the TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the present invention, and their agonists and antagonists for diagnosis,
Diseases associated with increased inhibition of cell survival or apoptosis that can be treated or prevented include cancers such as follicular lymphomas, carcinomas with p53 mutations and hormone-dependent tumors such as colon, heart, pancreatic, black Tumor, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, gastric cancer, neuroblastoma, myxoma, fibroid, lymphoma,
Endothelioma, osteoblastoma, giant cell tumor, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer,
Autoimmune disorders (eg, systemic lupus erythematosus and rheumatoid arthritis-associated rheumatoid arthritis); viral infections (eg, herpesvirus, poxvirus, and adenovirus) Inflammation; graft-versus-host disease; acute and chronic graft rejection. Therefore, in a preferred embodiment, the TR2, TR2-S of the present invention
V1 and / or TR2-SV2 polynucleotide or TR2, TR2
-SV1 and / or TR2-SV2 polypeptides and / or agonists or antagonists thereof for treating, preventing and / or diagnosing autoimmune diseases and / or these cancers disclosed herein. (Eg, lymphocytic leukemia (eg, MLL and chronic lymphocytic leukemia (CLL)
) And follicular lymphoma) are used to inhibit the growth, progression and / or metastasis of cancer. In another embodiment, the TR2 of the present invention;
TR2-SV1 and / or TR2-SV2 polynucleotide or TR
2. The polypeptide of TR2-SV1 and / or TR2-SV2 activates, differentiates or activates cancerous cells or tissues (eg, B cell lineage-related cancers (eg, CLL and MLL), lymphocytic leukemia or lymphoma). Used to proliferate, thereby treating those cells for cancer treatment (eg, chemotherapy or radiation therapy)
Make them more vulnerable to

Further, in another embodiment, a TR2, TR2-SV1 and / or TR2-SV2 polynucleotide or TR2, TR2-SV1 and / or TR2-SV2 polypeptide of the present invention, and / or an agonist thereof Or antagonists are used to inhibit the growth, progression and / or metastasis of a malignant disease, and are used in leukemias (acute leukemias such as acute lymphocytic leukemia, acute myeloid leukemia (myeloblastic leukemia, Including leukemia, myelomonocytic leukemia, monocytic leukemia and erythroleukemia) and chronic leukemia (eg, chronic myeloid (granulocytic) leukemia and chronic lymphocytic acute leukemia), polycythemia vera, lymphoma (Eg, Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenst Laem macroglobulinemia, heavy chain disease and solid tumors (fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelial sarcoma, lymphatic sarcoma, lymphatic endothelioma, periosteoma , Mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary Cancer, papillary adenocarcinoma, cystic adenocarcinoma, medullary carcinoma, primordial bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonic carcinoma, Wilms tumor, cervix, testicular cancer, Lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma,
Astrocytoma, medulloblastoma, craniopharyngioma, ventricular ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma , Sarcomas and carcinomas such as, but not limited to, neuroblastomas and retinoblastomas.

Diagnosis and treatment using TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the present invention, and / or agonists or antagonists thereof Or diseases associated with increased apoptosis that can be prevented include AIDS; neurodegenerative diseases (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration); Syndromes (eg, aplastic anemia), ischemic wounds (wounds caused by myocardial infarction, stroke and reperfusion injury), toxin-induced liver diseases (eg, diseases caused by alcohol), septic shock, cachexia Quality, loss of appetite. Thus, a TR2, TR2-SV1 and / or TR2-SV2 polynucleotide or a TR2, TR2-SV1 and / or TR2-SV2 polypeptide of the invention,
And / or their agonists or antagonists are used for treating, preventing and / or diagnosing the above diseases and disorders.

In a preferred embodiment, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the present invention, and / or agonists or antagonists thereof (eg, anti-TR2 antibodies) are isolated from human reticulosarcoma U937 cells. Inhibits proliferation in a dose-dependent manner. In a further preferred embodiment, the TR2, TR2-SV1 and / or TR2-SV2 polypeptides of the invention, and / or agonists or antagonists thereof (eg, TR2 antibodies) comprise PC-3 cells, HT-29 cells, HeLa cells, MCF-7 cells and A
Inhibits the growth of 293 cells. In a highly preferred embodiment, the TR of the present invention
2, TR2-SV1 and / or TR2-SV2 polynucleotides or TR2, TR2-SV1 and / or TR2-SV2 polypeptides, and / or agonists or antagonists thereof (e.g., TR2 antibody) are useful for prostate cancer, colon Inhibits the growth, progression and / or metastasis of cancer, cervical carcinoma and breast cancer.

Thus, in a further preferred embodiment, the present invention relates to a method for enhancing apoptosis induced by a TNF family ligand, said method expressing a TR2, TR2-SV1 and / or TR2-SV2 receptor. An effective amount of TR2, TR2-SV1 and / or T that can increase or decrease TR2, TR2-SV1 and / or TR2-SV2-mediated signaling in cells that
Administering R2-SV2 or an agonist or antagonist thereof. Preferably, TR2, TR2-SV1 and / or TR2-SV
2-mediated signaling is increased or decreased to treat, prevent and / or diagnose a disease, where reduced apoptosis or reduced cytokine and adhesion molecule expression is indicated. The agonist or antagonist is TR2,
Soluble forms of TR2-SV1 and / or TR2-SV2 and TR2, T
It may include monoclonal antibodies to the R2-SV1 and / or TR2-SV2 polypeptides.

In a further aspect, the present invention relates to a method for inhibiting apoptosis induced by a TNF family ligand, the method comprising TR2, TR2-
Cells expressing the receptor for SV1 and / or TR2-SV2 have TR2, T
Administering an effective amount of an agonist or antagonist capable of increasing or decreasing R2-SV1 and / or TR2-SV2-mediated signaling. Preferably, TR2, TR2-SV1 and / or TR2-SV2-mediated signaling is increased or decreased to treat, prevent and / or diagnose a disease,
Here, increased apoptosis or NF-κB expression is shown. The agonist or antagonist may be TR2, TR2-SV1 and / or TR2-SV2
And monoclonal antibodies against TR2, TR2-SV1 and / or TR2-SV2 polypeptides.

This polypeptide may also regulate angiogenesis since TR2, TR2-SV1 and / or TR2-SV2 belong to the TNF superfamily. Furthermore, since TR2, TR2-SV1 and / or TR2-SV2 inhibit immune cell function, this polypeptide has broad anti-inflammatory activity. TR2, TR
2-SV1 and / or TR2-SV2 may stimulate the invasion and activation of host defense cells (eg, cytotoxic T cells and macrophages)
And by inhibiting tumor angiogenesis, it can be used as an anti-neovascular agent to treat, prevent and / or diagnose solid tumors. One skilled in the art will recognize other non-cancer applications where vascular growth is not desired. They can also be used to enhance host defense against resistant chronic and acute infections, such as mycobacterial infections through the induction and activity of bactericidal leukocytes. TR2, TR2-SV
1 and / or TR2-SV2 also inhibit T-2 by inhibiting IL-2 biosynthesis for the treatment of T-cell mediated autoimmune diseases and lymphocytic leukemia, including, for example, chronic lymphocytic leukemia (CLL). Can be used to inhibit cell growth. T
R2, TR2-SV1 and / or TR2-SV2 can also be used to stimulate wound healing, via both debris removal and recruitment of connective tissue promoting inflammatory cells. In a similar manner, TR2, TR2-SV1 and / or TR2
2-SV2 can also be used to treat, prevent and / or diagnose other fibrotic disorders, including cirrhosis, osteoarthritis and pulmonary fibrosis. TR2, TR
2-SV1 and / or TR2-SV2 also increase the presence of eosinophils, which have the unique function of killing parasite larvae (e.g., schistosomiasis, trichinosis and roundworm) that invade tissues. . It also regulates the activation and differentiation of various hematopoietic progenitor cells (eg, releases mature leukocytes from the bone marrow following chemotherapy (
I.e. stem cell mobilization)) can be used to regulate hematopoiesis.
TR2, TR2-SV1 and / or TR2-SV2 also treat sepsis,
It can be used for prevention and / or diagnosis.

The polynucleotides and / or polypeptides of the invention, and / or agonists or antagonists thereof, may be used for angiogenesis, wound healing (eg,
It is useful in promoting wounds, burns, and fractures) and in regulating hematopoiesis. The polynucleotides and / or polypeptides of the invention, and / or their agonists and / or antagonists, are also useful as adjuvants to enhance immune responsiveness to certain antigens, antiviral immune responses.

More generally, the polynucleotides and / or polypeptides thereof and / or agonists and / or antagonists thereof of the invention are useful in modulating (ie, increasing or decreasing) an immune response. For example,
Whether the polynucleotides and / or polypeptides of the invention may be useful in preparing or recovering from surgery, trauma, radiation therapy, chemotherapy, and transplantation,
Alternatively, it has been used to boost immune response and / or recovery in elderly and immunocompromised individuals. Alternatively, the polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful, for example, as immunosuppressants in the treatment or prevention of autoimmune disorders. In certain embodiments, the polynucleotides and / or polypeptides of the invention have a chronic inflammatory, allergic or autoimmune condition (eg, a condition described herein or otherwise known in the art). ) Is used to treat or prevent.

Preferably, TR2, TR2-SV1 and / or TR2-SV2 polynucleotides or polypeptides, and / or TR2, TR2-SV1 and / or TR2-SV2 agonists or antagonists (eg,
Treatment with an anti-TR2 antibody) may be by administering to a patient an effective amount of a TR2, TR2-SV1 and / or TR2-SV2 polypeptide of the invention, or an agonist or antagonist thereof, or removing cells from the patient. , TR
2. Either by supplying the polynucleotides of TR2-SV1 and / or TR2-SV2 to the cells and returning the engineered cells to the patient (ex vivo treatment). Further, as further discussed herein, TR2, TR2-SV1 and / or TR2-SV2 polypeptides or polynucleotides are used as adjuvants in vaccines to elicit an immune response against infectious diseases. Can be done.

The agonists and antagonists can be used in a composition with a pharmaceutically acceptable carrier (eg, as described herein).

All of the above applications can be used in veterinary medicine as well as in human treatment regimens.

The applications listed above find use in a wide variety of hosts. Such hosts include, but are not limited to, humans, mice, rabbits, goats, guinea pigs, camels, horses, mice, rats, hamsters, pigs, micro-pigs, chickens, goats, Cows, sheep, dogs, cats, non-human primates and humans. In certain embodiments, the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat. In a preferred embodiment, the host is a mammal. In a most preferred embodiment, the host is human.

Cardiovascular Injury The TR2 polynucleotides, polypeptides, agonists or antagonists of the present invention can be used to treat cardiovascular disorders, including peripheral arterial disease such as limb ischemia.

[0488] Cardiovascular disorders include arterio-arterial fistulas.
stula), arteriovenous fistula, cerebral arteriovenous congenital anomaly, congenital heart defect (congeni)
tal heart defects), cardiovascular abnormalities such as pulmonary valve atresia, and scimitar syndrome. Congenital heart defects include aortic constriction, triatrial heart, coronary vessel anomalies.
, Cross heart, right thoracic heart, patent ductus arteri
osus), Ebstein malformation, Eisenmenger complex, left ventricular dysgenesis syndrome, left thoracic heart, tetralogy of Fallot, transposition of great arteries, right ventricle of both great vessels, tricuspid regurgitation, remnant ductus arteriosus , And heart septal defect
ts) (eg, aortopulmonary septum defect)
eptal defect, endocardial bed deficiency, Ryutanbache syndrome, trilogy of Fallot, ventricular heart septum (ventricular heart sep)
tal defects))).

Cardiovascular disorders also include arrhythmias, carcinoid heart disease, high cardiac output (hi
gh cardiac output, low cardiac output (low cardiac)
output), cardiac tamponade, endocarditis (including bacterial), cardiac aneurysm,
Cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, cardiac hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction cardiac rupture (post-inf)
arct heart rupture, ventricular septal rupture, heart valve disease,
Myocardial disease, myocardial ischemia, endocardial effusion, epicarditis (including infarct and tuberculosis),
Air pericardiopathy, post-pericardiotomy syndrome, right heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complication (cardiovascular pregnancy)
complications, scimitar syndrome, cardiovascular syphilis, and heart diseases such as cardiovascular tuberculosis.

The arrhythmia includes sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes syndrome, leg block, sinoatrial block, long QT syndrome (long
QT syndrome, accessory contractions, Lone-Gangong-Levine syndrome, Mahaim-type pre-excita syndrome
sion syndrome), Wolf-Parkinson-White syndrome, sinus dysfunction syndrome, tachycardia, and ventricular fibrillation. Tachycardia includes paroxysmal tachycardia,
Supraventricular tachycardia, ventricular specific rhythm promotion, atrioventricular nodal reentrant tachycardia (atrioventri
Circular nodal reentry tachycardia), ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia (sinoatrial no)
dal reentry tachycardia), sinus tachycardia, torsade
De pointes, and ventricular tachycardia.

The heart valve disease includes aortic valve dysfunction, aortic stenosis, heart murmur (hea)
murmurs), aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral dysfunction, mitral stenosis, pulmonary valve regurgitation, pulmonary valve dysfunction, pulmonary valve stenosis, tricuspid Examples include atresia, tricuspid dysfunction, and tricuspid stenosis.

The myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, hypovalvular aortic stenosis, hypovalvular pulmonary artery stenosis, restricted cardiomyopathy, Chagas cardiomyopathy, intracardiac Membrane fibroelastosis, endocardial myocardial fibrosis, Keynes syndrome, myocardial reperfusion injury, and myocarditis.

Myocardial ischemia includes angina, coronary aneurysm, coronary atherosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction, and myocardial stunnin
g) coronary artery disease.

Cardiovascular diseases also include aneurysms, angiogenesis, hemangiomatosis, bacterial hemangioma symptoms, Hippel-Lindau disease (Hippel-Lindau disease).
), Klipel-Tornonnay-Weber Syndrome, Sturge-Weber Syndrome,
Vasomotor edema, aortic disease, Takayasu arteritis, aortitis, Lurish syndrome,
Arterial occlusive disease, arteritis, arteritis, arteritis nodosa, cerebrovascular disorder, diabetic vascular disorder, diabetic retinopathy, embolism, thrombosis, acrolysis, hemorrhoid, liver Venous obstruction disorder, hypertension, hypotension, ischemia, peripheral vascular disorder, phlebitis, pulmonary vein obstruction disease, Raynaud's disease, CREST syndrome, retinal vein occlusion, scimitar syndrome, superior vena cava syndrome, telangiectasia, telangiectasia Ataxia (ataci)
a telangiectasia), hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcers, vasculitis, and vascular diseases such as venous insufficiency.

[0495] Aneurysms include dissecting aneurysms, pseudoaneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, cardiac aneurysms, and iliac aneurysms Is mentioned.

Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasia, mesenteric vascular occlusion, Moyamoya disease, renal artery occlusion, retinal artery occlusion, and obstructive thrombus Vasculitis.

Cerebrovascular disorders include carotid artery disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformations, cerebral artery disease, cerebral obstruction and thrombosis, Carotid thrombosis, sinus thrombosis, Wallenberg syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage (subaraxhnoid hemorr)
hage), cerebral infarction, cerebral ischemia (including transient), subclavian artery stealing syndrome, periventricular leukomalacia,
Vascular headache, cluster headache, migraine, and vertebrobasi
lar) dysfunction.

Embolisms include air embolism, amniotic fluid embolism, cholesterol embolism, toe cyanosis syndrome, fat embolism, pulmonary embolism, and thromboembolism. Thrombosis includes coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid thrombosis,
Sinus thrombosis, Wallenberg syndrome, and thrombophlebitis.

[0499] Ischemia includes cerebral ischemia, ischemic colitis, compartment syndrome, precompartment syndrome, myocardial ischemia, reperfusion injury, and peripheral limb ischemia. As vasculitis, aoritis, arteritis, Behcet syndrome, Churg-Strauss syndrome, mucocutaneous lymph node syndrome, obstructive thrombotic vasculitis, irritable vasculitis, Schoenlein-Henoch purpura. ), Allergic cutaneous vasculitis and Wegener's granulomatosis.

In one embodiment, a TR2 receptor polynucleotide, polypeptide, agonist or antagonist of the present invention is used for treating thrombotic microangiopathy. One such disorder is thrombotic thrombocytopenic purpura (TTP)
(Kwaan, HC, Semin. Hematol. 24:71 (1
987); Thompson et al., Blood 80: 1890 (1992)).
Increasing TTP-related mortality was reported in US S. Centers for Disease
Control (Torok et al., Am. J. Hemat.
ol. 50:84 (1995)). Patients affected by TTP (HIV + and HI
(Including V-patients) induces apoptosis of human endothelial cells of microvascular origin in the skin, but not human endothelial cells of macrovascular origin (L
aurence et al., Blood 87: 3245 (1996)). Therefore, TT
The plasma of P patients is thought to contain one or more factors that directly or indirectly induce apoptosis. Another thrombotic microangiopathy is hemolytic uremic syndrome (HUS) (Moake, JL, Lancet, 343: 393, (1994);
Melnyk et al., Arch. Intern. Med. , 155: 2077, (1
995); Thompson et al., Supra). Thus, in one embodiment, the invention relates to the use of the TR2 receptor to treat a condition often referred to as "adult HUS" (although children can be affected as well). H associated with childhood / diarrhea
The disorder known as US differs in etiology from adult HUS. In another embodiment, conditions characterized by coagulation of small blood vessels can be treated using the TR2 receptor. Such conditions include, but are not limited to, those described herein. For example, cardiac problems seen in about 5-10% of pediatric AIDS patients are thought to involve coagulation of small blood vessels. Disruption of microvessels in the heart has been reported in multiple sclerosis patients. As a further example, the treatment of systemic lupus erythematosus (SLE) is contemplated. In one embodiment, the patient's blood or plasma is contacted ex vivo with a TR2 receptor polypeptide of the present invention. The TR2 receptor polypeptide of the present invention can be bound to a suitable chromatography matrix using techniques known in the art. According to this embodiment, the patient's blood or plasma is
It flows through a chromatography column containing a TR2 receptor polynucleotide and / or polypeptide of the invention bound to a matrix. The immobilized TR2 receptor binds to AIM II and thus removes AIM II from the patient's blood.
Remove the II protein. Alternatively, a TR2 receptor polynucleotide, polypeptide, agonist or antagonist of the invention may be administered in vivo to a patient affected by thrombotic microangiopathy. In one embodiment, the T
A soluble form of the R2 receptor polypeptide is administered to the patient. Accordingly, the present invention provides a method for treating thrombotic microangiopathy, comprising using an effective amount of a TR2 polypeptide receptor polynucleotide, polypeptide, agonist or antagonist. TR2 receptor polypeptides can be used in in vivo or ex vivo procedures to inhibit AIM-II mediated damage to microvascular (eg, apoptotic) endothelial cells.

[0501] Without intending to be bound by theory, cells expressing TR2 may have AIM I
It is believed to interact with cells that express I.

The TR2 receptor polynucleotides, polypeptides, agonists or antagonists of the invention can be used in combination with other agents useful in treating a particular disorder. For example, Laurence et al., Blood 87: 3245 (19
96), the TTP of microvascular endothelial cells was
Some reduction in plasma-mediated apoptosis was achieved by using normal plasma depleted of anti-Fas blocking antibody, aurin tricarboxylic acid, or cryoprecipitate. Accordingly, patients can be treated with a polynucleotide and / or polypeptide of the invention in combination with an agent that inhibits Fas ligand-mediated apoptosis of endothelial cells, such as those described above. In one embodiment, both a TR2 receptor polynucleotide, polypeptide, agonist or antagonist and an anti-FAS blocking antibody are administered to a patient suffering from a disorder characterized by thrombotic microangiopathies such as TTP or HUS. . Examples of blocking monoclonal antibodies directed to the Fas antigen (CD95) are described in WO 95/10540, which is incorporated herein by reference.

The naturally occurring balance between endogenous stimulators and inhibitors of angiogenesis is such that inhibitory effects predominate. Rastinejad et al., Cell
56: 345-355 (1989). Neovascularization is performed under normal physiological conditions (
For example, in rare instances that occur in wound healing, tissue regeneration, embryonic development, and the female reproductive process, angiogenesis is tightly regulated and spatially and temporally limited. Under conditions of pathological angiogenesis that characterize solid tumor growth,
These regulatory controls fail.

Unregulated angiogenesis becomes pathological and sustains the progression of many neoplastic and non-neoplastic diseases. Many serious diseases are abnormal neovascularization (including solid tumor growth and metastasis, arthritis, some types of eye disorders, and psoriasis)
Dominated by See, for example, Moses et al., Biotech. 9: 630-6
34 (1991); Folkman et al. Engl. J. Med.
333: 1757-1763 (1995); Auerbach et al. Micr
ovasc. Res. 29: 401-411 (1985); Folkman, A.
dvances in Cancer Research, Klein and W
Einhouse, Academic Press, New York, 17
5-203 (1985); Patz, Am. J. Opthalmol. 94:
715-743 (1982); and Folkman et al., Science 22.
1: 719-725 (1983). In many pathological conditions, the process of angiogenesis contributes to the disease state. For example, significant data has been accumulated that suggests that solid tumor growth is dependent on angiogenesis. Fol
Kman and Klagsbrunn, Science 235: 442-447.
(1987).

The present invention provides for the treatment of a disease or disorder associated with neovascularization by administration of a TR2 receptor polynucleotide and / or polypeptide of the invention, including TR2 receptor agonists and / or antagonists. Malignant and metastatic conditions that can be treated with the polynucleotides and polypeptides of the present invention include malignancies, solid tumors, and cancers described herein and otherwise known in the art. (For a review of such disorders, see Fishman et al., Medicine, Second Edition, JB Lipp.
incott Co. , Philadelphia (1985)).
.

Further, the TR2 receptor polynucleotides and polypeptides of the present invention (T
Ocular disorders associated with neovascularization that can be treated with R2 receptor agonists and TR2 receptor antagonists include neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis Macular degenerative retinopathy, corneal transplant neovascularization, and other inflammatory diseases of the eye, tumors of the eye, and diseases associated with choroidal or iris neovascularization. See, for example, Waltman et al., Am. J. Ophthal. 85: 7
04-710 (1978), and Gartner et al., Surv. O
phthal. 22: 291-312 (1978).

In addition, TR2 receptor polynucleotides and polypeptides of the present invention (T
Disorders that can be treated with R2 receptor agonists and TR2 receptor antagonists) include hemangiomas, arthritis, psoriasis, angiofibromas, atherosclerotic plaques, delayed wound healing, granulation, hemophilic joints, These include, but are not limited to, hyperplastic scars, pseudoarthritis, Ausler-Weber syndrome, purulent granulomas, scleroderma, trachoma, and vascular adhesions.

The polynucleotides and / or polypeptides of the invention, and / or agonists and / or antagonists thereof, are useful in diagnosing and treating or preventing a wide range of diseases and / or conditions. Such diseases and conditions include cancers (eg, immune cell-associated cancers, breast cancer, prostate cancer, ovarian cancer, follicular lymphoma, cancers associated with mutations or alterations in p53, brain tumors, bladder cancers, cervical cancers, Colorectal cancer, colorectal cancer, non-small cell lung cancer, small cell lung cancer, gastric cancer, etc., lymphoproliferative disorders (eg, lymphadenopathy), microbial (eg, viruses, bacteria, etc.) infections (eg, HIV) -1 infection, HIV-2 infection, herpes virus infection (HSV-1, HS
V-2, CMV, VZV, HHV-6, HHV-7, EBV, adenovirus infection, poxvirus infection, human papillomavirus infection, hepatitis infection (eg, HAV, HBV, HCV, etc.) , Helico
pylori infection, invasive Staphylococcia, etc.)
Parasite infection, nephritis, bone disease (eg, osteoporosis) and bone formation (eg, regulation of osteoclast differentiation), atherosclerosis, pain, cardiovascular disorders (eg, neovascularization, hypovascular Decreased formation or circulation (eg, ischemic disease (eg, myocardial infarction, stroke, etc.)), AIDS, allergy, inflammation, neurodegenerative disease (
For example, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, pigmentary retinopathy, cerebellar degeneration, etc., transplant rejection (acute and chronic), graft versus host disease, diseases caused by myelodysplasia ( Eg, aplastic anemia), joint tissue destruction in rheumatism, liver disease (eg, acute and chronic hepatitis, liver injury, and cirrhosis), autoimmune diseases (eg, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus) , Immune complex glomerulonephritis, myasthenia gravis, autoimmune diabetes, autoimmune thrombocytopenic purpura, Graves' disease, Hashimoto's thyroiditis, etc., cardiomyopathy (eg, dilated cardiomyopathy), diabetes, Diabetic complications (eg, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy), influenza, asthma, psoriasis, glomerulonephritis, septic shock And ulcerative colitis but are not limited to.

The polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are also useful as adjuvants for enhancing immune responsiveness and / or antiviral immune response to a particular antigen.

More generally, polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful in modulating (ie, increasing or decreasing) an immune response. For example, the polynucleotides and / or polypeptides of the invention may be useful in preparing or recovering from surgery, trauma, radiation therapy, chemotherapy, and transplantation, or immune response in elderly and immunocompromised individuals And / or may be used to boost recovery. Alternatively, the polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful, for example, as immunosuppressants in the treatment or prevention of autoimmune disorders. In certain embodiments, the polynucleotides and / or polypeptides of the invention have a chronic inflammatory, allergic or autoimmune condition (eg, a condition described herein or otherwise known in the art). ) Is used to treat or prevent.

All of the above applications can be used in veterinary medicine, as well as in human treatment regimens.

Gene Therapy In certain embodiments, a nucleic acid comprising a sequence encoding an antibody or a functional derivative thereof treats a disease or disorder associated with aberrant expression and / or activity of a polypeptide of the invention. Administered for gene therapy purposes to inhibit or prevent. Gene therapy refers to therapy performed by the administration of an expressed or expressible nucleic acid to a subject. In this embodiment of the invention, the nucleic acids produce their encoded protein, which mediates a therapeutic effect.

[0513] Any of the methods for gene therapy available in the art can be used according to the present invention. An exemplary method is described below.

For a general review of methods for gene therapy, see Goldspiel et al., 199
3, Clinical Pharmacy 12: 488-505; Wu and Wu, 1991, Biotherapy 3: 87-95; Tolstosh.
v, 1993, Ann. Rev .. Pharmacol. Toxicol. 32:
573-596; Mulligan, 1993, Science 260: 92.
6-932; and Morgan and Anderson, 1993, Ann.
. Rev .. Biochem. 62: 191-217; May, 1993, TIB.
TECH 11 (5): 155-215. Recombinant D that can be used
Methods generally known in the NA art are described in Ausubel et al.
993, Current Protocols in Molecular B
iology, John Wiley & Sons, NY; and Krieg
ler, 1990, Gene Transfer and Expressio
n, A Laboratory Manual, Stockton Press
, NY.

In a preferred aspect, the compound comprises a nucleic acid sequence encoding an antibody, wherein the nucleic acid sequence is an expression vector that expresses the antibody, or a fragment or chimeric protein thereof, or a heavy or light chain thereof, in a suitable host. Part of. In particular, such nucleic acid sequences have a promoter operably linked to the antibody coding region, wherein the promoter is inducible or constitutive, and optionally tissue-specific. In another particular embodiment, a nucleic acid molecule is used in which the sequence encoding the antibody and any other desired sequences are flanked by regions that promote homologous recombination at the desired site in the genome, and thus the antibody nucleic acid (Koller and Smithies, 1989, Proc. Na).
tl. Acad. Sci. USA 86: 8932-8935; Zijlstr.
a, et al., 1989, Nature 342: 435-438). In certain embodiments, the expressed antibody molecule is a single-chain antibody; or the nucleic acid sequence comprises a sequence encoding both the heavy and light chains of the antibody or a fragment thereof.

Delivery of a nucleic acid to a patient can be direct (where the patient is directly exposed to the nucleic acid or nucleic acid-bearing vector) or indirect (where the cells are first transduced with the nucleic acid in vitro). Converted and then implanted into the patient). These two approaches are known, respectively, as in vivo gene therapy or as ex vivo gene therapy.

In certain embodiments, a nucleic acid sequence is administered directly in vivo, where the nucleic acid sequence is expressed to produce an encoded product. This can be accomplished by any of a number of methods known in the art (eg, by constructing them as part of a suitable nucleic acid expression vector and administering it intracellularly (eg, defective or attenuated). Retrovirus or other viral vector (US Pat.
980,286) or by naked DNA.
Or by bombardment of fine particles (eg, a gene gun; B
iolistic, Dupont), or by coating with lipids or cell surface receptors, or by transfecting the drug, or by encapsulation in liposomes, microparticles, or microcapsules, or by nucleating them. By conjugating with a peptide that is known to enter, and by conjugating and administering a ligand that undergoes receptor-mediated endocytosis (eg, Wu and Wu, 1987, JB).
iol. Chem. 262: 4429-4432) (which can be used to target cell types that specifically express the receptor), and the like. In another embodiment, a nucleic acid-ligand complex may be formed, wherein:
Ligands include fusogenic viral peptides that disrupt endosomes, so that nucleic acids avoid lysosomal degradation. In yet another embodiment, nucleic acids can be targeted in vivo for cell-specific uptake and expression by targeting specific receptors (eg, P
CT Publication No. WO92 / 06180 (April 16, 1992 (Wu et al.)); WO92 / 22635 (December 23, 1992 (Wilson et al.)); WO92 / 20316 (November 1992) 26 (Findeis et al.); See WO 93/14188 (July 22, 1993 (Clarke et al.); WO 93/20221 (October 14, 1993 (Young)). Alternatively, the nucleic acid can be introduced inside the cell and incorporated into host cell DNA for expression by homologous recombination (Koller and Smith).
ies, 1989, Proc. Natl. Acad. Sci. USA 86: 8
933-8935; Zijlstra et al., 1989, Nature 342: 4.
35-438).

In a specific embodiment, a viral vector comprising a nucleic acid sequence encoding an antibody of the invention is used. For example, a retroviral vector can be used (M
iller et al., 1993, Meth. Enzymol. 217: 581-599
checking). These retroviral vectors lack retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA. Nucleic acid sequences encoding antibodies used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient. Further details on retroviral vectors can be found in Boesen et al., 1994, Biotherapy 6: 291-302 (which describes a retroviral vector for delivering the mdrI gene to hematopoietic stem cells to make them more resistant to chemotherapy. Which describes the use of viral vectors). Other references describing the use of retroviral vectors in gene therapy are: : Clowes et al., 1994, J. Mol. Clin. Invest. 93:64
4-651; Kiem et al., 1994, Blood 83: 1467-1473;
Salmons and Gunzberg, 1993, Human Gene T.
herpy 4: 129-141; and Grossman and Wils
on, 1993, Curr. Opin. in Genetics and De
vel. 3: 110-114.

[0519] Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to the respiratory epithelium. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenovirus has the advantage that it can infect non-dividing cells. Kozarsky and Wilson, 1993
, Current Opinion in Genetics and Dev
element 3: 499-503 provides an overview of adenovirus-based gene therapy. Bout et al., 1994, Human Gene Therapy.
5: 3-10 showed the use of adenovirus vectors to transfer genes to the airway epithelium of rhesus monkeys. Other examples of the use of adenovirus in gene therapy are described in Rosenfeld et al., 1991, Science 252: 431-434.
Rosenfeld et al., 1992, Cell 68: 143-155; Mas.
Trangeli et al., 1993, J. Mol. Clin. Invest. 91: 225-
234; PCT Publication No. WO 94/12649; and Wang et al., 1995,
Gene Therapy 2: 775-783. In a preferred embodiment, an adenovirus vector is used.

The adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med.
. 204: 289-300; U.S. Patent No. 5,436,146).

Another approach to gene therapy involves transferring the gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer involves the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate cells that take up and express the transferred gene.
The cells are then delivered to the patient.

In this embodiment, a nucleic acid is introduced into the cells prior to in vivo administration of the resulting recombinant cells. Such introduction can be performed by any method known in the art, including, but not limited to: transfection, electroporation, microinjection, viruses including nucleic acid sequences. Vector or bacteriophage vector infection, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, and the like. Numerous techniques are known in the art for introducing foreign genes into cells (eg, Loeffler and Behr, 199).
3, Meth. Enzymol. 217: 599-618; Cohen et al., 19
93, Meth. Enzymol. 217: 618-644; Cine, 19
85, Pharmac. Ther. 29: 69-92), and may be used in accordance with the invention provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for a stable transfer of the nucleic acid into the cell, so that the nucleic acid is expressible by the cell, preferably
It is hereditary and expressible by the progeny of the cell.

[0523] The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (eg, hematopoietic stem cells or hematopoietic progenitor cells) are preferably administered intravenously. The amount of cells contemplated for use depends on the desired effect, patient condition, etc., and can be determined by one skilled in the art.

Cells into which nucleic acids can be introduced for purposes of gene therapy include any desired available cell type, including but not limited to: epithelial cells, endothelial cells,
Keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells; In particular, hematopoietic stem cells or hematopoietic progenitor cells (eg, cells obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.).

In a preferred embodiment, the cells used for gene therapy are autologous to the patient.

In embodiments where recombinant cells are used in gene therapy, the nucleic acid sequence encoding the antibody is introduced into the cell such that the nucleic acid sequence is expressible by the cell or progeny thereof, and then the recombinant cell is Administered in vivo for therapeutic effect. In a specific embodiment, stem cells or progenitor cells are used. Any stem and / or progenitor cells that can be isolated in vitro and maintained in vitro can potentially be used according to this embodiment of the invention (
For example, PCT Publication No. WO 94/08598 (April 28, 1994): St
emmple and Anderson, 1992, Cell 71: 973-98.
5; Rheinwald, 1980, Meth. Cell Bio. 21A: 2
29; and Pittelkow and Scott, 1986, Mayo C
linic Proc. 61: 771).

In a specific embodiment, the nucleic acid to be introduced for gene therapy purposes contains an inducible promoter operably linked to the coding region so that expression of the nucleic acid is properly transcriptionally induced. It can be controlled by controlling the presence or absence of the factor.

Dosage Forms The agonists or antagonists described herein can be administered to cells expressing the receptor of the invention in vitro, ex vivo, or in vivo. By administering an "effective amount" of an agonist or antagonist, an amount of a compound that is sufficient to enhance or inhibit a cellular response to a TNF family of ligands and that comprises the polypeptide is contemplated. In particular, an amount effective to enhance or inhibit TR2 receptor-mediated activity by administration of an "effective amount" of the agonist or antagonist is contemplated. It will be appreciated that if cell proliferation and / or differentiation is enhanced, an agonist according to the invention may be co-administered with a TNF family ligand. One skilled in the art will understand that the effective amount of an agonist or antagonist can be determined empirically and can be used in pure form or in the form of a pharmaceutically acceptable salt, ester or prodrug. The agonist or antagonist may be administered in a composition in combination with one or more pharmaceutically acceptable excipients.

The compositions of the present invention can be administered alone or in combination with other adjuvants. Adjuvants that may be administered with the compositions of the present invention include, but are not limited to: alum, alum and deoxycholate (I
(MunoAg), MTP-PE (Biocine Corp.), QS21 (
Genentech, Inc. ), BCG, and MPL. In certain embodiments, the compositions of the present invention are administered in combination with alum. In another specific embodiment, the compositions of the invention are administered in combination with QS-21. Additional adjuvants that can be administered with the compositions of the present invention include, but are not limited to: monophosphoryl lipid immunomodulator, AdjuVax
100a, QS-21, QS-18, CRL1005, aluminum salt, MF
-59, and virosome adjuvant technology. Vaccines that can be administered with the compositions of the present invention include, but are not limited to: MMR (measles, mumps, rubella), polio, varicella, tetanus / diphtheria, hepatitis A, B
Hepatitis, Haemophilus influenzae B, pertussis, pneumonia,
Vaccines directed to protection against influenza, Lyme disease, rotavirus, cholera, yellow fever, Japanese encephalitis, polio, rabies, typhoid fever, and pertussis, and PNEUMOVAX-23 ^™ . The combination may be administered either simultaneously (eg, as a mixture), separately but simultaneously or simultaneously; or sequentially. This includes the indication that the combined agents are administered together as a therapeutic mixture, and also allows the combined agents to be administered separately but all at once (eg, to the same individual through separate intravenous lines). )) The procedure to be administered. Administration in “combination” further includes administering one of the predetermined compounds or agents first, followed by the second separately.

In another specific embodiment, the compounds of the invention are used in combination with PNEUMOVAX-23 ^™ to treat, prevent and / or diagnose infection and / or any disease, disorder, and / or condition related thereto. Used in combination. In one embodiment, a composition of the invention is used to treat, prevent, and / or diagnose any Gram-positive bacterial infection and / or any disease, disorder, and / or condition related thereto, with PNEUMOVAX-23. Used in combination with ^TM .
In another embodiment, the compounds of the invention are infected and / or any disease, disorder, and / or Enterococcus and / or Streptoc.
Used in combination with PNEUMOVAX-23 ^™ to treat, prevent and / or diagnose a condition involving one or more members of the genus occus. In another embodiment, the compounds of the invention are used to treat, prevent, and / or diagnose conditions associated with infection and / or any disease, disorder, and / or one or more members of the group B Streptococcus. It is used in combination with -23 ^TM. In another embodiment, the compound of the invention is infected and / or any disease, disorder, and / or Streptococcus pneumoni.
PNEUMOV for treating, preventing and / or diagnosing a condition associated with ae
Used in combination with AX-23 ^™ .

The compositions of the present invention can be administered alone or in combination with other therapeutic agents.
These therapeutic agents include TNF, TNF blocking agents (eg, antibodies that specifically bind to TNF (eg, TNF-α, TNF-β or TNF-γ)), chemotherapeutic agents, anti-opportunistic infectious agents, Examples include, but are not limited to, viral agents, antibiotics, steroidal and non-steroidal anti-inflammatory agents, immunosuppressants, conventional immunotherapeutics and cytokines. The combination may be administered either concomitantly (eg, as a mixture), separately (but simultaneously or immediately); or sequentially. This includes presentations where the combined agents are administered together as a therapeutic mixture, and also procedures where the combined agents are administered separately but simultaneously (eg, via separate intravenous lines of the same subject). . “Combined” administration further includes separate administration of one of the compounds or agents, giving a first administration and then a second administration.

In one embodiment, the compositions of the invention are administered in combination with other members of the TNF family. TNF, T that can be administered with the composition of the present invention
NF-related or TNF-like molecules include, but are not limited to: soluble forms of TNF-α, lymphotoxin-α (LT-α, TNF-
also known as β), LT-β (found in the complex heterotrimer LT-α2-β), OPGL, CD27L, CD30L, CD40L, 4-1BB
L, DcR3, OX40L, TNF-γ (International Application Publication No. WO 96/1432)
8), AIM-I (International Application Publication No. WO97 / 33899), AIM-II (
International Application Publication No. WO 97/34911), APRIL (J. Exp. Med.
188 (6): 1185-1190), Endokine (International Application Publication Number WO9)
8/07880), TR6 (International Application Publication No. WO98 / 30694), OPG
(International Application Publication No. WO98 / 18921), and Neutrokine-α (International Application Publication No. WO98 / 18921), TWEAK, OX40, and nerve growth factor (NGF) and soluble forms of Fas, CD30, CD27, CD40 and 4-. IBB, TR2 (International Application Publication No. WO 96/34095), DR3 (
International application publication number WO97 / 33904), DR4 (International application publication number WO98
/ 32856), TR5 (International Application Publication Number WO98 / 30693), TR7 (
International Application Publication No. WO98 / 41629), TRANK, TR9 (International Application Publication No. WO98 / 56892), TR10 (International Application Publication No. WO98 / 5420)
2) 312C2 (International Application Publication No. WO 98/06842), TR12 and soluble forms of CD154, CD70 and CD153.

In another embodiment, a composition of the present invention is administered in combination with one or more TNF blocking agents. TNF blocking agents are believed to be useful in treating arthritis (rheumatoid arthritis).

In a preferred embodiment, a composition of the invention comprises a CD40 ligand (CD40
L), a soluble form of CD40L (eg, AVREND ^™ ), a biologically active fragment, variant, or derivative of CD40L, an anti-CD40L antibody (eg,
Agonist or antagonist antibodies) and / or anti-CD40 antibodies (
(Eg, agonistic or antagonistic antibodies).

In certain embodiments, the compositions of the invention are administered in combination with an antiretroviral agent, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor, and / or a protease inhibitor. Nucleoside reverse transcriptase inhibitors that can be administered in combination with the compositions of the present invention include:
Examples include, but are not limited to: RETROVIR ^™ (Zidovudine / AZT), VIDEX ^™ (Zidanosin / ddI), HIVID ^™ (Zalcitabine / ddC), ZERIT ^™ (Stavudine / d4T), EPIVIR ^™ (Lamivudine / 3TC). , And COMBIVIR ^™ (Zidovudine / Lamivudine). Non-nucleoside reverse transcriptase inhibitors that may be administered in combination with the compositions of the present invention include, but are not limited to: VIRAMUNE ^™ (
Nevirapine), RESCRIPTOR ^™ (Delavirgin), and SUSTIV
A ^TM (efavirenz). Protease inhibitors that can be administered in combination with the compositions of the present invention include, but are not limited to: CR
IXIVAN ^™ (Indinavir), NORVIR ^™ (Ritonavir), INVI
RASE ^™ (Saquinavir), and VIRACEPT ^™ (Nelfinavir). In certain embodiments, anti-retroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and / or protease inhibitors are used in any combination with the compositions of the present invention to treat AIDS and / or HIV. Infection can be prevented or treated.

In another embodiment, the compositions of this invention may be administered in combination with an anti-opportunistic infection agent. Anti-opportunistic infection agents that can be administered in combination with the compositions of the present invention include, but are not limited to: TRIMETHOP
RIM-SULFAMETHOXAZOLE ^™ , DAPSON ^™ , PENTA
MIDINE ^™ , ATOVAQONE ^™ , ISONIAZID ^™ , RIFAB
UTIN ^™ , PYRAZINAMIDE ^™ , ETHAMBUTOL ^™ , RIFA
BUTIN ^™ , CLARITROMYCIN ^™ , AZITHROMYCIN ^™ , GANICLOVIR ^™ , FOSCARNET ^™ , CIDOFOVIR ^™ ,
FLUCONAZOLE ^™ , ITRACONAZOLE ^™ , KETOCONAZ
OLE ^™ , ACYCLOVIR ^™ , FAMCICOLVIR ^™ , PYRIMET
HAMINE ^™ , LEUCOVORIN ^™ , NEUPOGEN ^™ (filgrastim / G-CSF) and LEUKINE ^™ (sargramostim (sargra)
most) / GM-CSF). In certain embodiments, the compositions of the present invention are formulated with TRIMETHOPRIM-SULFAMETHOXAZOLE ^™ , DAPS
Used in any combination with ONE ^™ , PENTAMIDINE ^™ , and / or ATOVAQONE ^™ , an opportunistic Pneumocystc.
arinii pneumonia infection may be treated or prevented prophylactically. In another specific embodiment, the compositions of the present invention are prepared using ISONIAZID ^™ , RIFAMPIN ^™ , PYR
Be used in any combination with AZINAMIDE ^TM, and / or ETHAMBUTOL ^TM, may prophylactically treat or prevent an opportunistic Mycobacterium avium complex infection. In another particular embodiment, the compositions of the invention may be used in any combination with RIFABUTIN ^™ , CLARITROMYCIN ^™ , and / or AZITHROMYCIN ^™ to preventively treat or prevent opportunistic Mycobacterium tuberculosis infection. In another specific embodiment, the composition of the present invention comprises GANCI
It can be used in any combination with CLIVIR ^™ , FOSCARNET ^™ , CIDOFOVIR ^™ to prevent or treat opportunistic cytomegalovirus infection. In another specific embodiment, the composition of the present invention is FLUCONAZ
OLE ^™ , ITRACONAZOLE ^™ , and / or KETOCONAZO
It can be used in any combination with LE ^™ to preventively treat or prevent opportunistic fungal infections. In another specific embodiment, the composition of the present invention is ACYCLO
It can be used in any combination with VIR ^™ and / or FAMCICOLVIR ^™ to prevent or treat opportunistic herpes simplex virus type I and / or II infection. In another specific embodiment, the composition of the present invention is
Any combination with YRIMETHAMINE ^™ and / or LEUCOVORIN ^™ may be used to prophylactically treat or prevent opportunistic Toxoplasma gondii infection. In another specific embodiment, the compositions of the present invention used in any combination with LEUCOVORIN ^TM, and / or NEUPOGEN ^TM, may prophylactically treat or prevent an opportunistic bacterial infection.

In a further embodiment, a composition of the present invention is administered in combination with an antiviral agent. Antiviral agents that can be administered with the compositions of the present invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantadine.

In a further embodiment, the compositions of the present invention may be administered in combination with an antibiotic drug. Antibiotics that can be administered with the compositions of the present invention include, but are not limited to, amoxicillin, aminoglycosides, β-
Lactam (glycopeptide), β-lactamase, clindamycin, chloramphenicol, cephalosporin, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolone, macrolide, metronidazole, penicillin, quinolone, rifampin, streptomycin , Sulfonamide, tetracycline, trimethoprim, trimethoprim-sulfantoxazole (trim
ethoprim-sulfamthoxazole), and vancomycin.

Conventional non-specific immunosuppressants that may be administered in combination with the compositions of the present invention include, but are not limited to: steroids, cyclosporins, cyclosporin analogs, cyclophosphamide, methylprednisone , Prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells.

In certain embodiments, a composition of the present invention is administered in combination with an immunosuppressant. Immunosuppressant preparations that can be administered with the compositions of the present invention include, but are not limited to: ORTHOCLONE ^™ (OKT3)
^{, SANDIMMUNE TM / NEORAL TM / SANGDYA} TM ( cyclosporine), PROGRAM ^TM (tacrolimus), CELLCEPT ^TM (mycophenolate (mycophenolate)), azathioprine, glucocorticosteroids (glucorticosteroids), and RAPAMUNE ^TM (sirolimus (sirolimus)). In certain embodiments, an immunosuppressive agent may be used to prevent rejection of an organ or bone marrow transplant.

In a preferred embodiment, the compositions of the invention are administered in combination with a steroid treatment. Steroids that can be administered in combination with the compositions of the present invention include oral corticosteroids, prednisone, and methylprezonisolone (eg,
V-methylpresonidone). In certain embodiments, the compositions of the present invention are administered in combination with prednisone. In a more particular embodiment, the compositions of the invention are administered in combination with presonidone and an immunosuppressant. Immunosuppressants that can be administered in combination with the compositions of the present invention and prednisone include, but are not limited to, azathioprine, cyclophosphamide, and cyclophosphamide IV. In another specific embodiment, the compositions of the invention are administered in combination with methylpresonidone. In a more specific embodiment, the compositions of the invention are administered in combination with methylpresonidone and an immunosuppressant. Immunosuppressants that can be administered in combination with the compositions of the present invention and methylpresonidone are the immunosuppressants described herein, including azathioprine, cyclophosphamide, and cyclophosphamide IV However, it is not limited to these.

In a preferred embodiment, the compositions of the invention are administered in combination with an antimalarial. Antimalarials that can be administered in combination with the compositions of the present invention include, but are not limited to, hydroxychloroquine, chloroquine, and / or quinacrine.

In a preferred embodiment, the compositions of the invention are administered in combination with an NSAID.

In a non-exclusive embodiment, the composition of the present invention comprises 1,2,3,4,5,10
Administered in combination with the following drugs:

[0545]

(Equation 6) .

In a preferred embodiment, the compositions of the invention are administered in combination with one, two, three, four, five or more of the following drugs: methotrexate, sulfasalazine, sodium gold thiomalate, auranofin, cyclosporine , Penicillamine, azathioprine, antimalarial (eg, as described herein), cyclophosphamide, chlorambucil, gold, ENBREL ^™ (Etanercept)
), Anti-TNF antibodies, and presonidone.

In a more preferred embodiment, the composition of the present invention comprises an antimalarial drug, methotrexate, anti-TNF antibody, ENBRELTM, and / or safrasalazine (
suflasalazine). In one embodiment, the compositions of the present invention are administered in combination with methotrexate. In another embodiment, a composition of the present invention is administered in combination with an anti-TNF family. In another embodiment, a composition of the present invention comprises methotrexate and anti-T
It is administered in combination with an NF antibody. In another embodiment, the compositions of the present invention are administered in combination with safrasalazine. In another embodiment, a composition of the present invention is administered in combination with methotrexate, an anti-TNF antibody, and safrasalazine. In another embodiment, a composition of the present invention is administered in combination with ENBREL ^™ . In another embodiment, the composition of the present invention is an ENBR
It is administered in combination with EL ^™ and methotrexate. In another embodiment, the compositions of the present invention are administered in combination with ENBREL ^™ , methotrexate, and safrasalazine. In another embodiment, the composition of the present invention comprises
It is administered in combination with NBREL ^™ , methotrexate, and sabosalazin. In other embodiments, one or more antimalarial drugs are combined with one of the combinations listed above. In certain embodiments, the compositions of the invention are administered in combination with an antimalarial (eg, hydroxychloroquine), ENBREL ^™ , methotrexate, and safrasalazine. In another specific embodiment, the compositions of the invention are administered in combination with an antimalarial drug (eg, hydroxychloroquine), safrasalazine, an anti-TNF antibody, and methotrexate.

In a further embodiment, the compositions of the present invention are administered alone or in combination with one or more intravenous immunoglobulin preparations. Intravenous immunoglobulin preparations that can be administered in combination with the compositions of the present invention include GAMMER ^™ , IVEE
GAM ^™ , SANDOGLOBULIN ^™ , GAMMMAGARD S / D ^™ ,
And GAMIMUNE ^™ . In certain embodiments, a composition of the present invention is administered in combination with an intravenous immunoglobulin preparation in transplantation therapy (eg, bone marrow transplantation).

In a further embodiment, a composition of the present invention is administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that can be administered in combination with the compositions of the present invention include, but are not limited to, glucocorticoids and non-steroidal anti-inflammatory agents, aminoaryl carboxylic acid derivatives, aryl acetic acid derivatives,
Arylbutyric acid derivative, arylcarboxylic acid derivative, arylacetic acid derivative, arylbutyric acid derivative, arylcarboxylic acid, arylpropionic acid derivative, pyrazole, pyrazolone, salicylic acid derivative, thiazinecarboxamide, ε-acetamidocaproic acid, S-adenosylmethionine, 3 -Amino-4-hydroxybutyric acid, amixetrine, benzadac, benzidoamine, bucolome, difenpyramide, ditazole, emorfazone, guaiazulene, nabumetone, nimesulide, orgothein, oxaseprol, paraniline, perisoxproxil, pifoxompicol proqu
azone), proxazole, and tenidap.

In another embodiment, a composition of the present invention is administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered in combination with the compositions of the present invention include antimicrobial derivatives (eg, doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (eg, tamoxifen); antimetabolites (eg, fluorofuran Syl, 5-FU, methotrexate, floxuridine, interferon α-2b, glutamic acid, plicamycin
cin), mercaptopurine, and 6-thioguanine); cytotoxic agents (eg, carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin C, busulfan, Cis-platin and vincristine sulfate)
Hormones (eg, medroxyprogestrone, estramustine sodium phosphate, ethinylestradiol, estradiol, megestrol acetate,
Methyltestosterone, dimethylstilbestrol diphosphate, chlorotrianisene, and test lactone); nitrogen mustard derivatives (eg, mephalen, chorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (eg, Betamethasone sodium phosphate); and others (eg, dicarbazine, asparaginase, mitotene, vincristine sulfate, vinblastine sulfate, and etoposide).

In certain embodiments, the compositions of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincrysin, and presonidone) or any combination of compositions of CHOP. In another embodiment, a composition of the invention is administered in combination with Rituximab. In a further embodiment, a composition of the present invention comprises Rituxmab and CHOP, or Ri.
Administered with any combination of the compositions of tuxmab and CHOP.

In a further embodiment, the compositions of the present invention may be administered in combination with a cytokine. Cytokines that can be administered with the compositions of the present invention include, but are not limited to, GM-CSF, G-CSF, IL2
, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13,
IL15, anti-CD40, CD40L, IFN-α, IFN-β, IFN-γ, T
NF-α, and TNFβ. In another embodiment, the compositions of the present invention may be administered with any interleukin. These interleukins include:
These include, but are not limited to: IL-1α, IL-1β, IL-
2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9
, IL-10, IL-11, IL-12, IL13, IL-14, IL-15,
IL-16, IL-17, IL-18, IL-19, IL-20, IL-21 and IL-22. In a preferred embodiment, the compositions of the invention are administered in combination with IL-4 and IL-10. Both IL-4 and IL-10 are
Enhancing TR2-mediated B cell proliferation has been observed by the present inventors.

In a further embodiment, a composition of the present invention is administered with a chemokine. In another embodiment, the composition of the present invention comprises chemokine β-8, chemokine β
-1 and / or macrophage inflammatory protein-4. In a preferred embodiment, the compositions of the invention are administered with the chemokine β-8.

In a further embodiment, a composition of the present invention is administered in combination with an IL-4 antagonist. IL-4 antagonists that can be administered with the compositions of the present invention include, but are not limited to: soluble IL-4 receptor polypeptide, multimeric forms of soluble IL-4 receptor polypeptide; Anti-IL-4 receptor antibodies that bind to IL-4 receptor without transforming the induced biological signal, IL-4, one or more IL-4 of IL-4
Anti-IL-4 antibodies that block binding to the IL-4 receptor and variants of IL-4 that bind to the IL-4 receptor but do not transduce the biological signal induced by IL-4. Preferably, the antibodies used according to the method are monoclonal antibodies, including antibody fragments (eg, fragments as described herein).

In a further embodiment, the compositions of the present invention are administered in combination with a hematopoietic growth factor. Hematopoietic growth factors that can be administered with the compositions of the present invention are LEUK
INE ^™ (SARGRAMOSTIM ^™ ) and NEUPOGEN ^™ (FILG
RASTIM ^™ ).

In a further embodiment, a composition of the present invention is administered in combination with an antigenic protein. Antigenic proteins that can be administered with the compositions of the present invention include, but are not limited to: Glioma-derived growth factor (GD
GF) (disclosed in European Patent No. EP-399816); Platelet derived factor A (PDGF-A) (disclosed in European Patent No. EP-682110); Platelet derived growth factor B (PDGF-B) (Europe) Placental growth factor (PlGF) (disclosed in International Application Publication No. WO 92/06194); placental growth factor-2 (PlGF-2) (Hauser et al., Gorwt).
h Factors, 4: 259-268 (1993)); Vascular endothelial growth factor (VEGF) (disclosed in International Application Publication No. WO 90/13649); Vascular endothelial growth factor-A (VEGF-A) ( European Patent No. EP-506577
Vascular endothelial growth factor-2 (VEGF-2) (International Application Publication No. W
O96 / 39515); vascular endothelial growth factor-B186 (VEGF-
B186) (disclosed in International Application Publication No. WO 96/26736); Vascular endothelial growth factor-D (VEGF-D) (disclosed in International Application Publication No. WO 98/02543); Vascular endothelial growth factor-D (VEGF-D) D) (International application publication number WO98
/ 07832); and vascular endothelial growth factor-E (VEGF-E) (
German Patent No. DE19639601). The above references are incorporated herein by reference.

In a further embodiment, a composition of the present invention is administered in combination with a fibroblast growth factor. Fibroblast growth factors that can be administered with the compositions of the present invention include, but are not limited to: FGF-1, FGF-2
, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8
, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, F
GF-14 and FGF-15.

In a further embodiment, the compositions of the present invention are administered in combination with other therapeutic or prophylactic regimes, such as, for example, radiation therapy. Such treatment may be administered consequently and / or concomitantly.

When administered to a human patient, all daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sonologic judgment. The particular therapeutically effective dose level for any particular patient will depend on factors well known in the medical arts.

As a general suggestion, the total pharmaceutically effective amount of TNFR polypeptide administered parenterally per dose will be about 1 μg / kg / day to 10 mg / k per patient body weight.
g / day, but as noted above, this is subject to therapeutic discretion. More preferably, the dose is at least about 0.01 mg / kg / day, and most preferably, between about 0.01 mg / kg / day and 1 mg / kg / day for humans (for hormones). When administered sequentially, the TNFR polypeptide is typically administered at a dose rate of about 1 μg / kg / hr to about 50 μg / kg / hr, by 1-4 injections per day, or For example, it may be administered either by continuous subcutaneous infusion using a minipump. Intravenous bag solutions may also be used.

The present invention provides methods for treatment, inhibition and prevention by administering to a subject an effective amount of a compound or pharmaceutical composition of the invention, preferably an antibody of the invention. In a preferred aspect, the compound is substantially purified (eg, substantially free of substances that limit its effect or produce undesired side effects). The subject is preferably
Animals including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, and the like, and are preferably mammals, and most preferably humans.

The formulations and methods of administration that can be used when the compound comprises a nucleic acid or an immunoglobulin are described above; further suitable formulations and routes of administration are selected from those described herein below. Can be done.

A pharmaceutical composition comprising a TR2 receptor polypeptide of the present invention may be administered orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (powder, ointment, drop, or transdermal patch). ), Buccally, or as an oral or nasal spray. By "pharmaceutically acceptable carrier" is meant a non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation auxiliary of any type.
The term "parenteral," as used herein, refers to intravenous, intramuscular, intraperitoneal,
Refers to modes of administration including intrasternal, subcutaneous, and intraarticular injection and infusion.

The compositions may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. These compositions include solutions, suspensions, emulsions, tablets,
It can take the form of pills, capsules, powders, sustained release formulations and the like.

The TR2 compositions of the present invention are also suitably administered by sustained release systems. Suitable examples of sustained release compositions include suitable polymeric substances (eg, semi-permeable polymer matrices (eg, films or microcapsules) in the form of shaped articles), suitable hydrophobic substances (eg, acceptable oils). Or an ion exchange resin, and poorly soluble derivatives (eg, poorly soluble salts).

A variety of delivery systems are known and can be used to administer the compounds of the invention (eg, liposomes, microparticles, microcapsules, encapsulation in recombinant cells capable of expressing the compounds). , Receptor-mediated endocytosis (
See, for example, Wu and Wu, J. et al. Biol. Chem. 262: 4429-443
2 (1987)), construction of nucleic acids as part of retroviruses or other vectors). Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compound or composition may be administered by any convenient route, such as by infusion or bolus injection, by absorption through epithelial or mucosal linings such as oral, rectal and intestinal mucosa, and other It can be administered together with a biologically active agent. Administration can be systemic or local. In addition, the pharmaceutical compounds or compositions of the present invention can be administered by any suitable route, including intraventricular and intrathecal injections; intraventricular injection can be, for example, an intraventricularly attached reservoir such as an Ommaya reservoir. It may be desirable to introduce it into the central nervous system (which can be facilitated by a catheter). Pulmonary administration may also be used, for example, with the use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In certain embodiments, it may be desirable to administer the pharmaceutical compounds or compositions of the invention locally to the area in need of treatment; this is not a limitation, but includes, for example, surgery. By local injection, topical application (eg, in combination with a post-operative wound dressing), by injection, by catheter, by suppository, or by an implant (this implant may be a membrane such as a sialastic membrane or Including porous, non-porous, or glue-like materials). Preferably, when administering a protein of the invention, including an antibody, care must be taken to use materials to which the protein does not absorb.

In another embodiment, the compound or composition can be delivered into vesicles, especially liposomes (Langer, Science 249: 1527-1533 (
1990); Treat et al., Liposomes in the Therap.
y of Infectious Disease and Cancer, L
opez-Berstein and Fidler (eds.), Liss, New
York, pp. 353-365 (1989); Lopez-Berstein,
See pages 317-327 of the same book; see broadly the same book).

In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump may be used (Lang
er, (supra); Sefton, CRC Crit. Ref. Biomed. E
ng. 14: 201 (1987); Buchwald et al., Surgery 88.
: 507 (1980); Saudek et al. Engl. J. Med. 321:
574 (1989)). In another embodiment, a polymeric material may be used (Medical Applications of Control).
led Release, Langer and Wise (eds.), CRC Pre
s. , Boca Raton, Florida (1974); Control.
ed Drug Bioavailability, Drug Product
Design and Performance, Smolen and Bal
1 (eds), Wiley, New York (1984); Ranger and P.
eppas, J .; Macromol. Sci. Rev .. Macromol. Ch
em. 23:61 (1983); Levy et al., Science 2
28: 190 (1985); During et al., Ann. Neurol. 25: 3
51 (1989); Howard et al. Neurosurg. 71: 105 (
1989)). In yet another embodiment, the controlled release system can be placed near the therapeutic target, ie, the brain, and thus requires only a portion of the systemic dose (eg, Goodson, Medical Applicat).
ions of Controlled Release, (supra), Volume 2,
Pp. 115-138 (1984)).

The sustained release matrix may be polyactide (US Pat. No. 3,773,919, EP 58,481), a copolymer of L-glutamic acid and γ-ethyl-L-glutamic acid (Sidman, U. et al., Biopolymers 22). : 547-
556 (1983)), poly (2-hydroxyethyl methacrylate) (R.
Langer et al. Biomed. Mater. Res. 15: 167-27
7 (1981); Langer, Chem. Tech. 12: 98-
105 (1982)), ethylene vinyl acetate (R. Langer et al., Ibid.), Or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).

[0572] Sustained-release compositions also include liposome-encapsulated compositions of the invention (see generally, Langer, Science 249: 1527-1533 (1990)).
Treat et al., Liposomes in the Therapy of;
Infectious Disease and Cancer, Lopez-
Berestein and Fidler (eds.), Liss, New York,
317-327 and 353-365 (1989)). TNFR polypeptide-containing liposomes are prepared by methods known per se: DE 3,218
Epstein et al., Proc. Natl. Acad. Sci. (US
A) 82: 3688-3692 (1985); Hwang et al., Proc. Nat
l. Acad. Sci. (USA) 77: 4030-4034 (1980); E
P 52,322; EP 36,676; EP 88,046: EP 143.
949; EP 142,641; Japanese Patent Application 83-118008; U.S. Patent Nos. 4,485,045 and 4,544,545;
324. Generally, liposomes are small (about 200-800 Angstroms) unilamellar forms, with a lipid content greater than about 30 mole% cholesterol, and the proportion selected is adjusted for optimal TNFR polypeptide treatment.

In a still further embodiment, a composition of the present invention is delivered by a pump (Langer, supra; Sefton, CRC Crit. Ref. Biom).
ed. Eng. 14: 201 (1987); Buchwald et al., Surger.
y 88: 507 (1980); Saudek et al. Engl. J. Med.
321: 574 (1989)).

[0573] Another controlled release system is Langer.
(Science 249: 1527-1533 (1990)).

In certain embodiments, where the compound of the present invention is a nucleic acid encoding a protein, the nucleic acid comprises it as part of a suitable nucleic acid expression vector and is administered such that it is intracellular. (Eg, by using retroviral vectors (see US Pat. No. 4,980,286)) or by direct injection, or by microparticle bombardment (eg, a gene gun; Biolist).
ic, Dupont) or by coating with lipids or cell surface receptors or transfectants, or in conjunction with a homeobox-like peptide known to enter the nucleus (eg, J
Oliot et al., Proc. Natl. Acad. Sci. USA 88: 186
4-1868 (1991)) and the like, to enhance the expression of the encoded protein. Alternatively, the nucleic acid can be introduced intracellularly and integrated into host cell DNA by homologous recombination for expression.

The present invention also provides for pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of the compound, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" has been approved by the Federal regulatory authority or the U.S. Government for use in animals, and more particularly in humans, or Means listed in the recognized pharmacopeias.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers include sterile liquids such as water and oils, including oils of petroleum, animal, plant, or synthetic origin (eg, peanut oil, soybean oil, mineral oil, sesame oil, and the like). Can be Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene Glycol, water, ethanol and the like. The composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. These compositions may take such forms as solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
Examples of suitable pharmaceutical carriers are described in W. "Remingto by Martin
n's Pharmaceutical Sciences ". Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

In a preferred embodiment, the compositions are formulated according to conventional procedures, as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the components are either separated or mixed together in a single dosage form, for example, in an ampoule or sachet (showing a fixed amount of active agent).
Supplied as a lyophilized powder or water-free concentrate in a sealed container such as a sachet. If the composition is to be administered by infusion, the composition can be dispensed into infusion bottles containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

The compounds of the present invention may be formulated as neutral or salt forms. Pharmaceutically acceptable salts include salts formed with anions such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, and sodium, potassium, ammonium, calcium, ferric hydroxide And cations such as cations derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine and the like.

The amount of a compound of the present invention that is effective in treating, suppressing, and preventing a disease or disorder associated with abnormal expression and / or activity of a polypeptide of the present invention is determined by standard clinical techniques. obtain. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be used in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses can be extrapolated based on dose-response curves obtained from in vitro or animal model test systems.

For antibodies, the dosage administered to a patient is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg / kg and 20 mg / kg of the patient's body weight, more preferably between 1 mg / kg and 10 mg / kg of the patient's body weight. Generally, human antibodies have a longer half-life in the human body than antibodies from other species, due to the immune response to the foreign polypeptide. Thus, lower dosages and less frequent administration of human antibodies is often possible. Further, the dosage and frequency of administration of the antibodies of the invention can be reduced by enhancing antibody uptake and tissue penetration (eg, into the brain) by modifications (eg, such as lipidation).

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. A notice in a format prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceutical or biological products may be included in such containers as appropriate. This notice represents the agency's approval of manufacture, use or sale for human administration.

Diagnostics and Imaging Labeled antibodies that specifically bind to a polypeptide of interest, and derivatives and analogs thereof, are used for diagnostic purposes to allow for abnormal expression and expression of a polypeptide of the invention. Diseases and / or disorders associated with / or activity may be detected, diagnosed or monitored. The present invention provides for the detection of abnormal expression of a polypeptide of interest, comprising the steps of (a) using one or more antibodies specific for the polypeptide of interest in a cell or body fluid of an individual. Assaying the expression of the polypeptide of the invention, and (b) comparing the level of gene expression to the level of standard gene expression, whereby the assayed assay is compared to the standard level of expression. An increase or decrease in the level of polypeptide gene expression indicates abnormal expression.

The present invention provides a diagnostic assay for diagnosing a disorder, comprising:
a) assaying the expression of the polypeptide of interest in cells or body fluids of the individual using one or more antibodies specific for the polypeptide of interest; and Comparing the level of gene expression, whereby an increase or decrease in the assayed polypeptide gene expression level compared to its standard expression level is indicative of a particular disorder. For cancer, the presence of relatively high amounts of transcripts in biopsy tissue from an individual may be indicative of a predisposition to the development of the disease, or may provide a means for detecting the disease before the actual clinical symptoms appear. Can provide. A more conclusive diagnosis of this type may allow health professionals to use preventive measures, or allow early aggressive treatment, thereby preventing the development or further progression of cancer.

The antibodies of the present invention can be used to assay protein levels in biological samples using classical immunohistological methods known to those of skill in the art (eg, Jalk
anen, M .; J. et al. Cell. Biol. 101: 976-185 (198)
5); Jalkanen, M .; J. et al. Cell. Biol. 105: 3087
-3096 (1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays (eg, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA)).
). Suitable antibody assay labels are known in the art, and are enzymatic labels (eg, glucose oxidase); and radioisotopes (eg, iodine ( ¹²⁵ I, ¹²¹ I), carbon ( ¹⁴ C), sulfur ( ³⁵ S). ), tritium ⁽³ H
), Indium ⁽¹¹² an In), and technetium ⁽⁹⁹ Tc); luminescent labels (e.g., luminol); and fluorescent labels (e.g., fluorescein and rhodamine), and biotin.

One aspect of the present invention is the detection and diagnosis of a disease or disorder associated with abnormal expression of a polypeptide of interest in an animal, preferably a mammal, and most preferably a human. In one embodiment, the diagnosis comprises (a) administering to the subject an effective amount of a labeled molecule that specifically binds to the polypeptide of interest (eg, parenterally, subcutaneously, or intraperitoneally). (B) removing the unbound labeled molecule to background levels to allow for preferential enrichment of the labeled molecule at the site in the subject where the polypeptide is expressed for)
Waiting for a time interval after administration; (c) determining a background level;
And (d) detecting the labeled molecule in the subject, so that
Detection of a labeled molecule above this background level indicates that the subject has a particular disease or disorder associated with abnormal expression of the polypeptide of interest. Background levels can be determined by a variety of methods, including comparing the amount of labeled molecule detected with standard values previously determined for a particular system.

It will be understood in the art that the size of the subject and the imaging system used will determine the amount of imaging moiety needed to produce a diagnostic image. In the case of a radioisotope moiety, for a human subject, the amount of radioactivity injected is typically ⁹⁹ Tc, in the range of about 5-20 m Curie. The labeled antibody or labeled antibody fragment then accumulates preferentially at locations of the cell containing the particular protein. In vivo imaging of tumors is described by S.M. W. Burchiel et al., "Im
munopharmacokinetics of Radiolabeled
Antibodies and Their Fragments "(Tum
or Imaging, Chapter 13: The Radiochemical De
tection of Cancer, S.M. W. Burchiel and B.A. A
. Rhodes, Masson Publishing Inc. (1982
).

Depending on a number of variables, including the type of label used and the mode of administration, the labeled molecule may be preferentially concentrated at a site in the subject, and may be conjugated. The time interval after administration for unlabeled molecules to be removed to background levels is 6-48 hours or 6-24 hours or 6-12 hours. In another embodiment, the time interval after administration is 5-20 days or 5-10 days.

In one embodiment, monitoring the disease or disorder is performed by repeating the method for diagnosing the disease or disorder (eg, one month after the initial diagnosis, the first 6 months after diagnosis, 1 year after initial diagnosis, etc.).

[0588] The presence of a labeled molecule can be detected in a patient using methods known in the art for in vivo scanning. These methods depend on the type of label used. One of skill in the art can determine the appropriate method for determining a particular label. Methods and devices that can be used in the diagnostic methods of the present invention include computer-assisted tomography (CT), whole body scans (eg, protons).
n) Emission tomography (PET)), magnetic resonance imaging (MRI), and ultrasound diagnostics.

In certain embodiments, the molecule is labeled with a radioisotope and a radiation responsive surgical instrument.
(Thurston et al., US Pat. No. 5,441,050)
To detect in patients. In another embodiment, the molecule is labeled with a fluorescent compound and detected in a patient using a fluorescence-responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and detected in the patient using positron emission tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and detected in the patient using magnetic resonance imaging (MRI). (Kit) The present invention provides a kit that can be used in the above method. In one embodiment, the kit comprises, in one or more containers, an antibody of the invention, preferably a purified antibody. In certain embodiments, a kit of the invention comprises a substantially isolated polypeptide comprising an epitope. This epitope specifically immunoreacts with the antibodies contained in the kit. Preferably, the kit of the present invention further comprises a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kit of the invention comprises means for detecting the binding of the antibody to the polypeptide of interest (eg, the antibody comprises a detectable substrate (eg, a fluorescent compound,
(An enzyme substrate, radioactive or luminescent compound) or a secondary antibody recognizing the primary antibody can be conjugated to a detectable substrate).

In another particular embodiment of the invention, the kit is a diagnostic kit for use in screening serum containing antibodies specific for proliferative and / or cancerous polynucleotides and polypeptides. is there. Such a kit can include a control antibody that does not react with the polypeptide of interest. Such a kit may comprise a substantially isolated polypeptide antigen comprising the epitope. This epitope specifically immunoreacts with at least one anti-polypeptide antigen antibody. Further, such kits include means for detecting the binding of the above-described antibody to the antigen (eg, the antibody is conjugated to a fluorescent compound (eg, fluorescein or rhodamine, which can be detected by flow cytometry). obtain). In certain embodiments, the kit may comprise a recombinantly produced polypeptide antigen or a chemically synthesized polypeptide antigen. The polypeptide antigens of the kit can also be attached to a solid support.

[0591] In a more specific embodiment, the detection means of the above kit comprises a solid support to which the above polypeptide antigen is attached. Such a kit may also include a non-attached reporter-labeled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the reporter-labeled antibody described above.

In a further embodiment, the present invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the present invention. The diagnostic kit comprises a substantially isolated antibody that specifically immunoreacts with a polypeptide or polynucleotide antigen, and a means for detecting binding of the polynucleotide or polypeptide antigen to the antibody. Prepare. In one embodiment, the antibodies are attached to a solid support. In certain embodiments, the antibodies may be monoclonal antibodies. This detection means of the kit may include a secondary labeled monoclonal antibody. Alternatively or additionally, the detection means may include a labeled competitor antigen.

In one diagnostic configuration, a test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by a method of the invention. After binding of the specific antigen-antibody to the reagent and removal of unbound serum components by washing, the reagent is reacted with a reporter-labeled anti-human antibody to bind the bound anti-antigen on the solid support. A reporter is bound to this reagent in proportion to the amount of antibody. The reagent is washed again to remove unbound labeled antibody and the amount of reporter bound to the reagent is determined. Typically, the reporter is an enzyme, which is incubated with the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO). Is detected.

The solid surface reagents in the above assays are prepared by known techniques for attaching protein materials to solid support materials (eg, polymer beads, dipsticks, 96-well plates or filtration materials). These attachment methods generally include non-specific adsorption of the protein to the support or chemically reactive groups on the solid support (typically by free amine groups) (eg, activated carboxyl groups) on the solid support. , Hydroxyl groups, or aldehyde groups). Alternatively, streptavidin-coated plates can be used in combination with a biotinylated antigen.

Thus, the present invention provides an assay system or kit for performing this diagnostic method. The kit generally comprises a support having a recombinant antigen attached to the surface,
And a reporter-labeled anti-human antibody for detecting the surface-bound anti-antigen antibody.

The present invention will be more readily understood by reference to the following examples, as generally described in the present invention, but the following examples are provided for illustrative purposes, Not intended as a limitation.

Example 1 Expression and Purification of TR2 in E. coli The bacterial expression vector pQE60 is used for bacterial expression in this example (
QIAGEN, Inc. , 9259 Eton Avenue, Chatswo
rth, CA, 91311). pQE60 is resistant to ampicillin antibiotics ("Am
p ^r ") and encodes a bacterial origin of replication (" ori "), an IPTG-inducible promoter, a ribosome binding site (" RBS "), QIAGEN Inc. Six codons encoding histidine residues, and an appropriate single chromosome, permitting affinity purification using nickel-nitrilo-triacetic acid ("Ni-NTA") affinity resin available from Contains restriction enzyme cleavage sites. These elements consist of six His residues (ie, “6 × His”) in which the DNA fragment encoding the polypeptide is covalently linked to the carboxyl terminus of the peptide.
Such that they can be inserted in such a way as to produce a polypeptide having a "tag"). However, in this example, the sequence encoding the polypeptide is 6
Translation of the His codon is prevented, and thus the polypeptide is inserted such that it is produced without a 6 × His tag.

[0598] DN encoding a desired portion of the TR2 protein lacking a hydrophobic leader sequence
The A sequence anneals to the amino-terminal sequence of the desired portion of the TR2 protein,
It is then amplified from the deposited cDNA using PCR oligonucleotide primers that anneal to the sequence in the deposited construct 3 'to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5 'and 3' sequences, respectively.

To clone the mature protein, the 5 ′ primer comprises an underlined NcoI restriction site followed by 18 nucleotides complementary to the amino-terminal coding sequence of the mature TR2 sequence of FIGS. 1A-1B: 5 'CGC CCATGG CCCCAGCTCTGCCGTCCT3' (SEQ ID NO: 14). Of course, those skilled in the art will understand that the position of the protein coding sequence at which the 5 'primer begins may be varied to amplify the desired portion of the complete protein, shorter or longer than the mature form. The 3 'primer is an underlined HindIII restriction site and a 1' complementary to the 3 'end of the nucleotide sequence shown in FIGS. 1A-1B, encoding the extracellular domain of the TR2 receptor.
It has the sequence: 5'CGC AAGCTT ATGTTGGAGCTGCTGGTCCC3 '(SEQ ID NO: 15), comprising 8 nucleotides.

The amplified TR2 DNA fragment and the pQE60 vector
The digested with oI and HindIII, then the digested DNA are ligated together. Inserting the TR2 DNA into the restricted pQE60 vector places the TR2 protein coding region, including its associated stop codon, downstream from the in-frame with the IPTG-inducible promoter and initiation AUG. This related stop codon prevents translation of the six histidine codons downstream of the insertion site.

The ligation mixture was prepared using the method of Sambrook et al., Molecular Cloning:
a Laboratory Manual, 2nd edition; Cold Spring
Harbor Laboratory Press, Cold Spring
Harbor, N .; Y. Competent E. coli using standard procedures as described in (1989). E. coli cells. Multiple copies of the plasmid pREP4, which expresses the lac repressor and has kanamycin resistance (
"Kan ^r "). E. coli strain M15 / rep4 is used in practicing the exemplary examples described herein. This strain (this is TR2
Is the only strain that is suitable for expressing the protein of
QIAGEN Inc. , (Supra). Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA is confirmed by restriction analysis, PCR and DNA sequencing.

The clones containing the desired constructs were isolated overnight in liquid culture in LB medium supplemented with both ampicillin (100 μg / ml) and kanamycin (25 μg / ml).
"O / N") Proliferate. The O / N culture is used to inoculate a large scale medium at a dilution of about 1:25 to 1: 250. Cells are grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6. Then, isopropyl-bD-
Thiogalactopyranoside ("IPTG") was added to a final concentration of 1 mM and lac was added.
Inactivating the I repressor induces transcription from the lac repressor sensitive promoter. The cells are subsequently incubated for a further 3-4 hours. The cells are then harvested by centrifugation.

The cells were then purified with 6M guanidine-H to purify the TR2 protein.
Stir at 4 ° C. in Cl, pH 8 for 3-4 hours. Cell debris is removed by centrifugation, and the supernatant containing TR2 is dialyzed against 50 mM Na acetate buffer (pH 6) supplemented with 200 mM NaCl. Alternatively, the protein is purified using 500 mM NaCl containing protease inhibitors, 20% glycerol,
Dialysis against 5 mM Tris / HCl pH 7.4 allows the protein to be successfully refolded. After reconstitution, the protein can be purified by ion exchange chromatography, hydrophobic interaction chromatography, and size exclusion chromatography. Alternatively, a pure TR2 protein can be obtained using an affinity chromatography step such as an antibody column. Store the purified protein at 4 ° C or freeze at -80 ° C.

Example 2 Example 2 (a): Cloning and Expression of a Soluble Fragment of the TR2 Protein in a Baculovirus Expression System In this example, the plasmid shuttle vector pA2GP was used to associate its native The cloned DNA encoding the mature extracellular domain of the TR2 receptor protein shown in FIGS. 1A-1B, lacking the secretory signal (leader) sequence, is inserted into a baculovirus. This protein is used as a baculovirus leader, and in Summers et al., A Manual of Me.
foods for Baculovirus Vectors and In
sec Cell Culture Procedures, Texas A
gricultural Experimental Station Bull
Expression was performed using standard methods as described in letin No. 1555 (1987). This expression vector is Autographa californic.
a Contains the strong polyhedrin promoter of nuclear polyhedrosis virus (AcMNPV) followed by the secretory signal peptide (leader) of the baculovirus gp67 protein, and contains convenient restriction sites such as BamHI, XbaI, and Asp718. The simian virus 40 ("SV40") polyadenylation site is used for efficient polyadenylation. For easy selection of the recombinant virus, the plasmid was placed in the same orientation, under the control of the weak Drosophila promoter, under the control of E. coli. the β-galactosidase gene from E. coli, followed by the polyadenylation signal of the polyhedrin gene. The inserted gene is D-type of the wild-type virus.
A viable virus expressing the cloned polynucleotide is flanked by flanking viral sequences for cell-mediated homologous recombination with NA.

As will be readily appreciated by those skilled in the art, if necessary, as long as the construct provides appropriately arranged signals for transcription, translation, secretion, etc., including signal peptides and in-frame AUGs. Other baculovirus vectors can be used in place of the vectors described above (eg, pAc373, pVL941, and pAcIM1). For example, such vectors are described in Luckow et al., Virlog.
y 170: 31-39.

The mature extracellular domain of the TR2 receptor protein in the deposited plasmid (ATCC Deposit No. 97059) (amino acids 37-20 shown in FIGS. 1A-1B)
The cDNA sequence essentially encoding 0) is replaced with the relevant 5 'sequence of the gene and 3'
'Amplified using PCR oligonucleotide primers corresponding to the sequence. Each of the above 5 ′ primers has the sequence: 5′CGC GGATCC CGGAGCCCCCTGCTAC3 ′ (SEQ ID NO: 16)
), Which is underlined with the BamHI restriction enzyme site, Kozak, M
. , J. et al. Mol. Biol. 196: 947-950 (1987), efficient signals for initiating translation of eukaryotic cells, followed by FIGS.
B contains 15 bases (starting at nucleotide 354) of the coding sequence of the TR2 protein. The 3 'primer has the sequence: 5' CGC GGTACATTGTGGGAGCTGCTGGTCCC 3 '(SEQ ID NO: 17), which has an underlined Asp718 restriction site followed by 17 nucleotides complementary to the coding sequence in FIGS. 1A-1B. including.

The amplified fragment was prepared using a commercially available kit (“Geneclean” BIO).
101 Inc. , La Jolla, Ca) using a 1% agarose gel. This fragment was then digested with BamHI and Asp718 and purified on a 1% agarose gel. This fragment is designated herein as "F1".

The plasmid was digested with the restriction enzymes BamHI and Asp718 and dephosphorylated using calf intestinal phosphatase. This DNA was then transferred to a commercially available kit ("
Geneclean "BIO 101 Inc. , La Jolla, Ca) using a 1% agarose gel. This vector DNA is designated herein as "V1".

The fragment F1 and the dephosphorylated plasmid V1 are ligated with T4 DNA ligase. E. FIG. E. coli HB101 cells are transformed with the ligation mixture,
Then, the cells were seeded on a culture plate. XL-1 Blue (Stratagene
Cloning Systems, La Jolla, CA). E. coli hosts can also be used. Bacteria containing the plasmid with the human TR2 receptor gene were identified using PCR. In the PCR method, due to one of the primers used to amplify the gene and a second primer well in the vector, only bacterial colonies containing the TR2 gene fragment show amplification of the DNA. The sequence of the cloned fragment is
Confirmed by sequencing. This plasmid is referred to herein as pBacTR2.
-T.

[0609] 5 μg of the plasmid pBacTR2-T was transferred to Felgner et al., Proc. N
atl. Acad. Sci. USA 84: 7413-7417 using the lipofection method described by (1987), a commercially available linearized baculovirus DNA of 1.0 [mu] g ( "BaculoGold ^TM baculovirus D
NA ", Pharmingen, San Diego, CA. ) And co-transfected. 1 μg of BaculoGold ^™ viral DNA and 5
μg of plasmid pBacTR2-T was added to 50 μl of serum-free Grace's medium (Li
fe Technologies Inc. , Gaithersburg, MD
) Were mixed in sterile wells of a microtiter plate containing Then, 10μ
1 lipofectin and 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. This transfection mixture was then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates with 1 ml of serum-free Grace's medium. The plate was rocked back and forth to mix the newly added solution. The plate is then placed at 27 ° C.
And incubate for 5 hours. After 5 hours, the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. Return the plate to the incubator and continue culturing at 27 ° C for 4 days.

After 4 days, supernatants were collected and plaque assays were performed as described by Summers and Smith (supra). To allow easy identification and isolation of gal-expressing clones producing blue-stained plaques, "Blue
Gal "(Life Technologies Inc., Gaithers)
burg). (A detailed description of this type of “plaque assay” is also available at Life Technologies Inc., G.
(also found in the Insect Cell Culture and Baculovirology User's Guide (pages 9-10) distributed at Aethersburg. After appropriate incubation, blue-stained plaques were picked with a micropipettor (eg, Eppendorf) tip. The agar containing the recombinant virus was then
Resuspended in a microcentrifuge tube containing 1 Grace's medium. Then, insect Sf9 cells seeded on a 35 mm dish were infected with the suspension containing the recombinant baculovirus. After 4 days, the supernatants of these culture dishes are collected and then they are stored at 4 ° C. This recombinant virus is called VTR2-T.

To confirm the expression of the genes used, Sf9 cells were transformed with 10% heat-inactivated F
Grow in Grace's medium supplemented with BS. Cells were infected at a multiplicity of infection of about 2 ("M
OI ") was infected with the recombinant baculovirus V-TR2-T. After 6 hours, the medium was removed and SF900 II free of methionine and cysteine.
Medium (Life Technologies Inc., Rockville,
(Available from MD). After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi of ³⁵ S-cysteine (available from Amersham) are added to the radiolabeled protein. The cells are incubated for a further 16 hours, and the cells are then collected by centrifugation. SDS for protein in supernatant and intracellular protein
-PAGE followed by analysis by autoradiography. Microsequencing of the amino-terminal amino acid sequence of the purified protein was used to determine the amino-terminal sequence of the mature protein and the breakpoint and length of the secretory signal peptide. Example 2 (b): Cloning and Expression of TR2 Protein in Baculovirus Expression System Similar to the cloning and expression of the truncated version of the TR2 receptor described in Example 2 (a), a recombinant baculovirus was made. did. This is shown in FIG.
-1B (SEQ ID NO: 2).

In this example, using the plasmid shuttle vector pA2, the cloned DNA encoding the complete protein, including its naturally associated secretory signal (leader) sequence, was inserted into the baculovirus and matured. Express the TR2 protein. Other properties of the pA2 vector are similar to those described for the pA2 GP vector used in Example 2 (a).

In the deposited plasmid, cDN encoding the full length TR2 protein
The A sequence (including the AUG initiation codon and the naturally associated leader sequence shown in FIGS. 1A-1B (SEQ ID NO: 2)) was synthesized using PCR oligonucleotide primers corresponding to the 5 ′ and 3 ′ sequences of the gene. And amplify. The 5 ′ primer has the sequence: 5 ′ GCGC GGATCC ACCATGGAGCCTCCCTGGAGACTGG
3 '(SEQ ID NO: 18), which sequence is underlined in the BamHI restriction enzyme site, Kozak, M .; , J. et al. Mol. Biol. 196: 947-950 (19
87), comprising an efficient signal to initiate translation in eukaryotic cells, followed by 21 nucleotides (starting at the AUG start codon) of the sequence of the complete TR2 protein shown in Figures 1A-1B. . The 3 'primer has the sequence: 5' GCGC GGTAC TCTACCCCAGCAGGGGCGCCA3 '(
SEQ ID NO: 19), which comprises an underlined Asp718 restriction site followed by 21 nucleotides complementary to the 3 'non-coding sequence of FIGS. 1A-1B.

The amplified fragment was isolated and digested with restriction enzymes as described in Example 2 (a) to generate plasmid pBacTR2.

5 μg of pBacTR2 was combined with 1 μg of Ba in a total volume of 200 μl serum-free medium.
Co-transfected with culoGold ^™ (Pharmingen) viral DNA and 10 μl Lipofectin ^™ (Life Technologies, Inc). Primary virus was harvested 4-5 days post infection (pi) and used in plaque assays. Plaque purified virus was subsequently amplified and frozen as described in Example 2 (a).

For radiolabeling of expressed proteins, Sf9 cells were grown at 0.5 × 10 ⁶
Twelve well dishes with 2.0 ml of cell suspension containing cells / ml were seeded and allowed to attach for 4 hours. Using recombinant baculovirus, cells are
Infected at an MOI of 2. After 4 hours, the medium was replaced with 1.0 ml of serum-free medium (-Met / -Cys) depleted of methionine and cysteine. pi
On the third day, the culture medium was reconstituted with 2 μCi of each [ ³⁵ S] -Met and [ ³⁵ S]-
Replaced with 0.5 ml of -Met / -Cys containing Cys. Cells were labeled for 16 hours, after which the culture medium was removed and clarified by centrifugation (Supernatant). The cells are added to 0.2 ml of lysis buffer (2
0 mM HEPES, pH 7.9; 130 mM NaCl; 0.2 mM ED
TA; was dissolved by the addition of 0.5 mM DTT and 0.5% (v / v) NP-40) in this dish, then diluted with dH ₂ O up to 1.0 ml (cell extract (Cell Extract)). 30 μl of each supernatant and cell extract were separated by 15% SDS-PAGE. Protein gels were stained, destained, amplified, dried, and autoradiographed. The labeled band corresponding to the recombinant protein was visible after 16 to 72 hours of exposure.

Example 3: Cloning and Expression of TR2 in Mammalian Cells A typical mammalian expression vector contains a promoter element (which mediates the initiation of mRNA transcription), a protein coding sequence, and transcription termination and transcription. Signal required for polyadenylation of the product. Additional elements include enhancers, Kozak sequences, and intervening sequences flanking donor and acceptor sites for RNA splicing. Highly efficient transcription was achieved using the early and late promoters from SV40, the long terminal repeat (LTR) from retroviruses (eg, RSV, HTLVI, HIVI) and the early promoter of cytomegalovirus (CMV). obtain. However, cellular elements can also be used (eg, the human actin promoter). Expression vectors suitable for use in the practice of the present invention include, for example, PSVL and PVL.
MSG (Pharmacia, Uppsala, Sweden), pRSVca
t (ATCC 37152), pSV2dhfr (ATCC 37146), and vectors such as pBC12MI (ATCC 67109). Mammalian host cells that can be used include human Hela293 cells, H9 cells and Jurkat cells, mouse NIH3T3 cells and C127 cells, Cos
1 cells, Cos7 and CV1 cells, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary (CHO) -cells.

Alternatively, the gene can be expressed in a stable cell line that contains the gene that integrates into the chromosome. Co-transfection with a selectable marker (eg, dhfr, gpt, neomycin, or hygromycin) allows for the identification and isolation of the transfected cells.

The transfected gene can also be amplified to express large amounts of the encoded protein. DHFR (dihydrofolate reductase) markers are useful for developing cell lines with hundreds or thousands of copies of the gene of interest.
Another useful selectable marker is the enzyme glutamine synthase (GS) (Mur
phy et al., Biochem J .; 227: 277-279 (1991); Beb.
Bington, et al., Bio / Technology 10: 169-175 (1
992)). Using these markers, mammalian cells are grown in selective media and cells with the highest resistance are selected. These cell lines contain the amplified gene integrated into the chromosome. Chinese Hamster Ovary (CHO
) Cells and NSO cells are often used for the production of proteins.

The expression vectors pC1 and pC4 are compatible with the Rous sarcoma virus strong promoter (LTR) (Cullen et al., Molecular and Cellula).
r Biology, 438-47 (March 1985)) and fragments of the CMV-enhancer (Boshart et al., Cell 41: 521-530).
(1985)). Multiple cloning sites (eg, restriction site B
amHI, XbaI, and Asp718) facilitate cloning of the gene of interest. The vector further contains the 3 'intron, polyadenylation, and termination signal of the rat preproinsulin gene.

(Example 3 (a): Cloning and Expression in COS Cells) The expression plasmid pTR2HA was replaced with the cDNA encoding TR2 by the expression vector pcDNAI / Amp or pcDNAIII (this was Invitrogen).
, Inc. (Available from Co., Ltd.).

The expression vector pcDNAI / amp contains the following: E. coli effective for growth in E. coli and other prokaryotic cells. (2) ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) SV40 origin of replication for growth in eukaryotic cells; (4) CMV promoter, polylinker, SV40 intron; ( 5) A hemagglutinin fragment (ie, purified) in which the cDNA is conveniently placed under expression control of the CMV promoter and positioned such that it can be operably linked to the SV40 intron and polyadenylation signal by restriction sites in the polylinker. "HA" to make it easier
Tags), followed by a stop codon, and a polyadenylation signal. The HA tag is described in Wilson et al., Cell 37: 767 (1984).
) Corresponds to the epitope derived from the influenza hemagglutinin protein described by Fusion of the HA tag to the target protein allows for easy detection and recovery of the recombinant protein using an antibody that recognizes the HA epitope. p
cDNA III further contains a neomycin selectable marker.

The DNA fragment encoding TR2 is cloned into the polylinker region of the vector such that recombinant protein expression is driven by the CMV promoter. The plasmid construction strategy is as follows. The deposited plasmid TR2 cDNA was transformed into E. coli. Amplification is performed using primers containing convenient restriction sites, much as described above for the construction of vectors for expression of TR2 in E. coli. Suitable primers used in this example include: BamHI site underlined, Kozak sequence, A
5 'primer containing six additional codon of the coding region' of UG initiation codon, and full TR2 of 5, has the following sequence: 5'GCGC GGATCC ACCATGGAGCCTCCTGGAGACTGG
3 '(SEQ ID NO: 20). Underlined Xbal site, stop codon, HA tag, and one of the 3 'coding sequences
3 comprises nine base pairs 'primer, (3' having a sequence at the end) The following: 5'GCGC TCTAGA TCAAGCGTAGTCTGGGACGTCGTA
TGGGTAGGTGGTTTGGGCTCCTCCCC3 '(SEQ ID NO: 21).

The PCR amplified DNA fragment and the vector pcDNAI / Amp were
Digest with mHI and XbaI and then ligate. The ligation mixture is coli
SURE (Stratagene Cloning Systems, 110
99 North Torrey Pines Road, La Jolla,
(Available from CA 92037) and the transformed cultures are then plated on ampicillin media plates that are incubated to allow growth of ampicillin-resistant colonies. Plasmid DNA is isolated from resistant colonies and tested by restriction analysis or other means for the presence of the fragment encoding TR-2.

For the expression of recombinant TR2, COS cells were transformed as described, for example, in Sambrook et al.
Molecular Cloning: a Laboratory Manua
1, Cold Spring Laboratory Press, Cold
D. As described in Spring Harbor, New York (1989).
Transfect with the expression vector as described above using EAE-DEXTRAN. The cells are incubated under conditions for expression of TR2 by the vector.

The expression of the TR2-HA fusion protein can be determined, for example, by the method of Harlow et al., Antib.
odies: A Laboratory Manual, 2nd edition; Cold S
spring Harbor Laboratory Press, Cold S
Detection is by radiolabeling and immunoprecipitation using the method described in Spring Harbor, New York (1988). For this purpose, two days after transfection, the cells are labeled by incubating for 8 hours in a medium containing ³⁵ S-cysteine. Harvest cells and media and wash cells and detergent-containing RIPA buffer as described in Wilson et al. (Cited above): 150 mM NaCl, 1% NP-40, 0.1%
SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7
. Dissolve in 5. Proteins are precipitated from cell lysates and culture media using an HA-specific monoclonal antibody. Then, the precipitated protein was subjected to SDS-
Analyze by PAGE and autoradiography. An expression product of the expected size is observed in the cell lysate, which is not seen in the negative control.

Example 3 (b): Cloning and Expression in CHO Cells The vector pC4 is used for the expression of TR2 protein. Plasmid p
C4 is a derivative of plasmid pSV2-dhfr (ATCC Deposit No. 37146). This plasmid contains the mouse D under the control of the SV40 early promoter.
Includes HFR gene. Chinese hamster ovary cells or other cells lacking dihydrofolate activity transfected with these plasmids are selected from selective media (α minus MEM, LifeTec, supplemented with the chemotherapeutic agent methotrexate).
hnologies). Amplification of the DHFR gene in cells that are resistant to methotrexate (MTX) is well documented (eg, Alt, FW, Kellems, RM, Be.
rtino, J. et al. R. And Schimke, R .; T. , 1978, J. Mol. Bio
l. Chem. 253: 1357-1370; Hamlin, J. M .; L. And M
a, C.I. 1990, Biochem. et Biophys. Acta, 109
7: 107-143, Page, M .; J. And Sydenham, M .; A. 1
991, Biotechnology 9: 64-68). Cell growth at increasing concentrations of MTX results in resistance to the drug by overproducing the target enzyme DHFR as a result of amplification of the DHFR gene. The second gene is D
When linked to an HFR gene, they are usually co-amplified and over-expressed.
It is known in the art that this approach can be used to develop cell lines with more than 1,000 copies of the amplified gene. Subsequently, if the methotrexate is removed, a cell line is obtained that contains the amplified gene integrated into one or more chromosomes of the host cell.

The plasmid pC4 contains the Rous sarcoma virus (C) for expression of the gene of interest.
ullen et al., Molecular and Cellular Biolog.
y, March 1985: 438-47), a strong promoter for the long terminal repeat (LTR), and human cytomegalovirus (CMV) (Boshart et al., Ce).
11 41: 521-530 (1985)), including fragments isolated from enhancers of immediate-early genes. Downstream of the promoter are the following single restriction enzyme cleavage sites that allow for gene integration: BamHI, XbaI and Asp718. The plasmid contains a 3 'intron and a polyadenylation site of the rat preproinsulin gene behind these cloning sites.
Other high efficiency promoters may also be used for expression (eg, the human β-actin promoter, the SV40 early or late promoter, or long terminal repeats from other retroviruses (eg, HIV and HTLVI)). Clon
tech's Tet-Off and Tet-On gene expression systems and similar systems
It can be used to express the TR2 protein in a regulated manner in mammalian cells (Gossen, M., and Bujard, H. 1992, Proc
. Natl. Acad. Sci. ScL USA 89: 5547-5551). mRN
For polyadenylation of A, other signals, such as from the human growth hormone or globin gene, can be used as well. Stable cell lines containing the gene of interest integrated into the chromosome can also be selected for co-transfection with a selectable marker (eg, gpt, G418, or hygromycin).
Initially, it is advantageous to use more than one selectable marker (eg, G418 and methotrexate).

The plasmid pC4 is digested with the restriction enzymes BamHI and Asp718 and then dephosphorylated using bovine intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel.

The DNA sequence encoding the TR2 protein, including the leader sequence, was
Amplify using PCR oligonucleotide primers corresponding to the 'and 3' sequences. BamHI restriction enzyme sites underlined, followed by Kozak, M .; , J
. Mol. Biol. 196: 947-950 (1987) and effective signals for initiation of translation in eukaryotes, and FIGS.
The 5 'primer containing 21 bases of the coding sequence of the TR2 protein shown in B (SEQ ID NO: 1) has the following sequence: 5' GCGC GGATCC ACCATGGAGCCTCCCTGGAGACTGG
3 '(SEQ ID NO: 22). The underlined Asp718 restriction site followed by 21 nucleotides (FIG. 1A)
3 including a complementary) the untranslated region of the TR2 genes listed in ～1B (SEQ ID NO: 1) 'primers have the following sequences: 5'GCGC GGTACC TCTACCCCAGCAGGGGCGCCA3' (
SEQ ID NO: 19).

The amplified fragment was digested with the endonucleases BamHI and Asp71.
Digest at 8, then re-purify on a 1% agarose gel. The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. Then, E. E. coli HB101 or XL-1 Blue cells are transformed and bacteria containing the inserted fragment in plasmid pC4 are identified using, for example, restriction enzyme analysis.

[0633] Chinese hamster ovary cells lacking the active DHFR gene are used for transfection. 5 μg of expression plasmid pC4 was ligated with 0.5 μg of plasmid pSVn using Lipofectin (Felgner et al., Supra).
Co-transfect with eo. Plasmid pSV2-neo contains a dominant selectable marker (the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics, including G418). Cells are seeded in α-min MEM supplemented with 1 mg / ml G418. Two days later, cells are trypsinized and treated with 10, 25, or 50 ng / ml methotrexate and 1 mg / ml
Inoculate hybridoma cloning plates (Greiner, Germany) in α-minus MEM supplemented with G418. After about 10-14 days, a single clone is trypsinized and then different concentrations of methotrexate (50 nM
, 100 nM, 200 nM, 400 nM, 800 nM) into 6-well petri dishes or 10 ml flasks. The clones growing at the highest concentration of methotrexate were then replaced by higher concentrations of methotrexate (1 μM, 2 μM, 5 μM).
Transfer to a new 6 well plate containing (μM, 10 mM, 20 mM). The same procedure is repeated until a clone is obtained that grows at a concentration of 100-200 μM. The expression of the desired gene product is analyzed, for example, by SDS-PAGE and Western blot or by reverse phase HPLC analysis.

Example 4: Tissue Distribution of TR2 mRNA Expression Northern blot analysis is performed to determine expression of the TR2 gene in human tissues, particularly using the method described by Sambrook et al. (Cited above). CDN containing the entire nucleotide sequence of the TR2 protein (SEQ ID NO: 1)
The A probe was used for the rediprime ^™ DNA labeling system (Amersham Li
labeled with ³² P using a fe Science) according to the manufacturer's instructions. After labeling, the probe was applied to a CHROMA SPIN-100 ^™ column (Clontech).
Laboratories, Inc. ) Is the manufacturer's protocol number PT120
Purify using according to 0-1. Various human tissues are then examined for TR2 mRNA using the purified labeled probe.

Multiples containing various human tissues (H) or human immune system tissues (IM)
Tissue Northern (MTN) blots were obtained from Clontech and ExpressHyb ^™ hybridization solution (Clo
ntech) according to the manufacturer's protocol number PT1190-1 and probed with a labeled probe. After hybridization and washing, the blot is mounted and exposed to film overnight at -70 ° C, and the film is developed according to standard procedures.

Example 5 (Example 5 (a): Expression and Purification of TR2-Fc (TR2-Ig Fusion Protein) and Split TR2) The putative transmembrane domain of the translated TR2 receptor was To identify the layered helix, Goldman et al. (Ann. Rev. of Biophy).
s. Biophys. Chem. 15: 321-353 (1986)). The region upstream of this transmembrane domain, encoding the putative leader peptide and extracellular domain, was selected for production of the Fc fusion protein. HTXBS4 with a BglII site (single underline), a factor Xa protease site, and an Asp718I site (double underline) at the 3 ′ end
Primers were designed to PCR the corresponding coding region from 0. TR
This primer pair (18-mer: 18 nucleotides of the sequence encoding 2)

[0637]

Embedded image (SEQ ID NO: 23) and reverse primer 53 mer:

[0638]

Embedded image PCR with (SEQ ID NO: 24) yielded one band of the expected size. This was cloned into COSFclink to obtain a TR2-Fclink plasmid. The PCR product was digested with EcoRI and Asp718I and
Ligation to the SFclink plasmid (Johansen et al., J. Biol. C
hem. 270: 9449-9471 (1995)) to produce TR2-Fclink.

COS cells were transiently transfected with TR2-Fclink and the resulting supernatant immunoprecipitated with protein A agarose. Western blot analysis of immunoprecipitates with goat anti-human Fc antibody showed a strong band consistent with the expected size for glycosylated TR2-Fc (greater than 47.5 kD). A 15 L transient COS transfection was performed and the resulting supernatant was purified (see below). Mice were immunized with the purified protein following DNA injection for production of the mAb.

CHO cells were transfected with TR2-Fclink to produce stable cell lines. Five strains were selected for growth by dot blot analysis and adapted to a shake flask. The strain with the highest TR2-Fc protein expression level was identified by Western blot analysis. T purified from the supernatant of this strain
R2-Fc protein was used for cell binding studies by flow cytometry.
Used either as an intact protein or after factor Xa cleavage and biotinylation (see below).

Clone HTXBS40 is an allelic variant of TR2 that differs from the sequence found in FIGS. 1A-1B (SEQ ID NO: 1) in the following respects:
It contains guanine at nucleotide 314, thymine at nucleotide 386, and cytosine at nucleotide 627.

A plasmid suitable for expression of the extracellular domain of TR2 was constructed as follows to immunize mice for production of anti-TR2 mAb. Fc fragment
Removed from TR2-Fclink by glII / XbaI digestion, Kleno
The w was used to fill the overhang and the blunt ends of the plasmid were religated. The resulting frameshift was originally TR2 due to the addition of the BglLL site.
-A stop codon was introduced immediately after the amino acid introduced into Flink. Therefore,
At the C-terminus of the extracellular domain of TR2, this constructed (TR2exlink)
Followed by only two amino acids (RS).

Example 5 (b): Purification of TR2-Fc from CHO E1A conditioned medium, followed by TR2 cleavage and biotinylation (Assay) The purity of the purified product was determined under reducing conditions and Monitored on 15% Laemmli SDS-PAGE gel electrophoresed under non-reducing conditions. The protein concentration was monitored by _A280 , assuming an extinction coefficient of 0.7 for the receptor and 1.28 for the chimera (both calculated from the sequence). The extinction coefficient was confirmed by AAA.

(Protein G Chromatography of TR2-Fc Fusion Protein) All steps described below were performed at 4 ° C. 15 L of CHO conditioned medium (CM
) (Filtered at 0.2μ after harvest in cell culture) was applied to a 5 x 10 cm column of Protein G at a linear flow rate of 199 cm / h. This column is 100 mM
Wash with glycine (pH 2.5) and add 20 mM sodium phosphate, 150
It was equilibrated with mM sodium chloride (pH 7 before sample application). After loading with CM, the column was loaded with 5 column volumes of 20 mM sodium phosphate, 150 mM.
Wash with mM sodium chloride (pH 7) and 100 mM glycine (pH
2.5). 435 ml of the eluate was immediately added to 3M Tris (pH 8).
. Neutralized in 5) and filtered through 0.2μ. A ₂₈₀ , based on extinction coefficient 1.28,
65 mg of protein was recovered at 0.15 mg / ml.

(Concentration / Dialysis) 385 ml of the Protein G eluate was concentrated in an Amicon stirred cell fitted with a 30K membrane to a final concentration of 1.7 to 34 ml. This concentrate was dialyzed against buffer.

(Factor Xa Cleavage and Purification to Produce Free Receptor) 6 ml (10.2 mg) of TR2-Fc was added to 50 μg of factor Xa,
An e: s ratio of 1: 200 resulted. This mixture was incubated at 4 ° C. overnight.

(Protein G Chromatography of Free TR2 Receptor) Protein G in a 1 ml column was separated from 2
Equilibrated in 0 mM sodium phosphate, 150 mM sodium chloride (pH 6.5). The cleaved receptor was passed through the column three times, and the column was then washed with 20 mM sodium phosphate, 150 mM until no A ₂₈₀ absorbance was seen.
Washed with mM sodium chloride (pH 6.5). This column is filled with 2.5 ml of 10
Elute with 0 mM glycine (pH 2.5) and 83 μl of 3 M Tris (pH 8.
Neutralized in 5). TR2 eluted in the unbound fraction.

(Concentration) The unbound fraction (about 12 ml) derived from the protein G column was subjected to A ₂₈₀ , extinction coefficient 0
. Cen until approximately 1 ml at a final concentration of 3.5 mg / ml estimated by 7
Concentrated in tricon 10K cell (Amicon).

(Mono S Chromatography) The concentrated sample was diluted to 5 ml with 20 mM sodium phosphate (pH 6) and equilibrated in 20 mM sodium phosphate (pH 6) with 0.5 × 5c
m Mono S column at a linear flow rate of 300 cm / h. The column was washed with 20 mM sodium phosphate (pH 6) and eluted with a 20 column volume linear gradient from 20 mM sodium phosphate (pH 6) to 20 mM sodium phosphate, 1 M sodium chloride (pH 6). TR2 protein eluted in the unbound fraction.

(Concentration / Dialysis) The 3 ml unbound fraction from the Mono S column was centrifuged on a Centricon 10
Concentrated to 1 ml as above using a K cell and dialyzed against 20 mM sodium phosphate, 150 mM sodium chloride, pH 7. The concentration after dialysis was 2.1 mg / ml.

Biotinylation 2.1 mg / ml of TR2 at 100 mg borate (pH 8)
. Dialyzed against 5). A 20-fold molar excess of NHS-LC Biotin was added, and the mixture was left on a rotating plate at 4 ° C. overnight. Biotinylated T
R2 was treated with 20 mM sodium phosphate, 150 mM sodium chloride (pH 7)
Dialyzed against, sterile filtered, and stored at -70 ° C. Biotinylation was performed on a Western blot scanned with streptavidin HRP, followed by development with ECL reagent.

Example 6 Membrane-bound Formation of TR2 Receptor Induces Lymphocyte Proliferation and Differentiation
A member of the tumor necrosis factor (TNFR) / nerve growth factor receptor (NGFR) superfamily contains three to six cysteine-rich motifs of about 30 to 40 amino acids in the extracellular portion of the molecule. Characterized by the presence of repetitions (
Mallett, S.M. And Barclay, A .; N. , Immunol. To
day 12: 220 (1991)). The crystal structure of TNFR-I indicated that the cysteine-enriched motif (TNFR domain) consisted of three extended chains of residues held together by a disulfide-bonded twisted ladder (Banner).
, D. W. Et al., Cell 73: 431 (1993)). These receptors contain a hinge-like region immediately adjacent to the transmembrane domain, which lacks cysteine residues and serine, threonine, which tend to be glycosylated with O-linked sugars. And a high proportion of proline. The cytoplasmic portion of these molecules shows limited sequence similarity, a finding that may be the basis for various cell signaling. Currently, members identified from human cells include: CD40 (Stamenkovic, I. et al., EM
BOJ. 8: 1403 (1989)), 4-1BB (Kwon, BS and Weissman, SM, Proc. Natl. Acad. Sci. US
A 86: 1963 (1989)), OX-40 (Mallett, S. et al., E
MBOJ. 9: 1063 (1990)), TNFR-I (Loetscher).
, H .; Et al., Cell 61: 351 (1990); Schall, T .; J. Et al.,
Cell 61: 361 (1990)), TNFR-II (Smith, CA).
. Et al., Science 248: 1019 (1990)), CD27 (Van
Lier, R .; A. J. et al. Immunol. 139: 1589 (1987))
, Fas (Itoh, N. et al., Cell 66: 233 (1991)), NGF.
R (Johnson, D. et al., Cell 47: 545 (1986)), CD3.
0 (Durkop, H. et al., Cell 68: 421 (1992)) and LT.
BR (Beans, M. et al., Genomics 16: 214 (1993)).
A viral open reading frame encoding a soluble TNFR has also been identified, such as: SFV-T2 (Smith, CA et al., Sci.
ence 248: 1019 (1990)), Va53 (Howard, ST).
. Et al., Virology 180: 633 (1991)), G4RG (Hu, F
. -Q. Et al., Virology 204: 343 (1994)) and crmB.
(Smith, GL, J. Gen. Viol. 74: 1725 (1993).
).

Recent in-depth studies have shown that these molecules are involved in various biological activities, such as: Cell proliferation (Banchereau, J. et al., Science
e 251: 70 (1991); Pollok, K .; E. FIG. J. et al. Immuno
l. 150: 771 (1993); Baum, P .; R. EMBO J. et al. 13
: 3992 (1994)), cell survival (Grass, H.-J et al., Blood).
83: 2045 (1994); Torcia, M .; Et al., Cell 85: 345.
-356 (1996)), and cell death (Tartaglia, LA et al., C.I.
ell 74: 845 (1993); Gillette-Ferguson, I.
. And Sidman, C .; L. , Eur. J. Immunol. 24: 118
1 (1994); Krammer, P .; H. Et al., Curr. Opin. Immu
nol. 6: 279 (1994)).
stage, R.A. J. , Curr. Opin. Immunol. 6: 407 (19
94); A. Et al., Cell 75: 959 (1994)).

With their biological significance and diverse membership of this superfamily, we have predicted that there will be additional members of this superfamily. By searching the EST database, we have identified new members of the TNFR family. We report here the first characterization of a molecule called TR2.

Materials and Methods Identification and Cloning of New Members of the TNFR Superfamily Over 500 Different cDNA Libraries (Adams, MD et al., Sc
252: 1651 (1991); Adams, M .; D. Et Nat
355: 632 (1992)).
ST) The cDNA database is stored using the blastn algorithm and tblast.
n algorithm (Altschul, S, F. et al., J. Mol. Biol. 21).
5: 403 (1990)) was used to screen for sequence similarity to the cysteine-rich motif of the TNFR superfamily. T at the amino acid level
One EST (denoted HT1SB52) showing significant identity to NFR-II was identified from a human T cell line library. Using this sequence, 5 ′ of human leukocytes (Clontech, PT1155-1. Cat. # 7301-1) was used.
Using the cDNA for -RACE-, the deleted 5 'end was cloned by RACE (rapid amplification of cDNA ends). This sequence has four additional ESTs (HT
OBH42, HTOAU65, HLHA49 and HTXBS40). Complete sequencing of these and other cDNAs indicates that they contain the same open reading frame homologous to the TNFR superfamily and that TR2
Showed that it was called. Analysis of some other ESTs and cDNAs has additional sequences inserted into the open reading frames identified above,
It was also shown that some cDNAs could represent various partially spliced mRNAs.

Cells The myeloid and B cell lines studied exhibit cell types in different stages of differentiation. KGla and PLB 985 (Koeffler, H. et al., Blood.
56: 265 (1980); Tucker, K .; Et al., Blood 70: 372.
(1987)) to Phillip Koeffler (UCLA School)
of Medicine) and BJA-B as Z.I. Jonak (Smi
thKline Beecham) and TF 274, a stromal cell line characteristic of osteoblasts, was generated from the bone marrow of a healthy adult male donor (Tan & Jonak, unpublished). All other cell lines were purchased from American Type
Obtained from Culture Collection (Rockville, MD). Monocytes were prepared by differential centrifugation of peripheral blood mononuclear cells (PBMC) and attachment to tissue culture dishes. CD19 ⁺ , CD4 ⁺ and CD8 ⁺ were converted to immunomagnetic beads (
(Dynal, Lake Success, NY). Endothelial cells from human coronary arteries were cloned into clones (Clonetics,
CA).

(RNA and DNA Blot Hybridization) Total RNA from adult tissues is purchased from Clontech (Palo Alto, Calif.) Or TriReagent (Molecular Research).
ch Center, Inc. , Cincinnati, OH) from early cells and cell lines. 5-7.5 μg of total RNA was fractionated (Sambr) in a 1% agarose gel containing formaldehyde as described.
OK et al., Molecular Cloning, Cold Springs.
Harbor (1989)) and by vacuum blotting, Zeta-
Quantitative transfer to a probe nylon membrane (Biorad, Hercules, CA). The blot was prehybridized, hybridized with the ³² P-labeled XhoI / EcoRI fragment of the TR2 or OX-40 probe, washed under stringent conditions, and exposed to X-ray film.

High molecular weight human DNA was digested with various restriction enzymes and 0.8% agarose
Differentiated in sgel. The DNA is denatured, neutralized and transferred to a nylon membrane, and ³² It hybridized with P-labeled TR-2 or its variant cDNA.

In Situ Hybridization and FISH Detection In Situ Hybridization and FI at the TR2 Position in Human Chromosomes
SH detection was performed as previously described (Heng, HHQ, et al., Pr.
oc. Natl. Acad. Sci. USA 89: 9509 (1992); H.
eng, H .; H. Q. Et al., Human Molecular Genetics
3:61 (1994)). The FISH signal and DAPI banding pattern were separately recorded by taking pictures and the FI with chromosomal band
Assignment of SH mapping data was achieved by overlaying the FISH signal with the DAPI banded chromosome (Heng, HHQ and Tsui, LC-Chromosomea. 102: 325 (1993)).
).

(Generation of Recombinant TR2-Fc Fusion Protein) TR5 containing the entire putative open reading frame of the extracellular domain
The 'position was amplified by the polymerase chain reaction (Saiki, RK, et al., Science 239: 487 (1988)). For correctly directed cloning, a HindIII site at the 5 ′ end of the forward primer and a BglII site at the 5 ′ end of the reverse primer were created. Fc of human IgG ₁
Portions were PCR amplified from ARH-77 (ATCC) cell RNA and pGem7
It was cloned at the SmaI site of the vector (Promega). The Fc fragment containing the hinge, CH ₂ , and CH ₃ domain sequences contained a BglII site at its 5 ′ end and an XhoI site at its 3 ′ end. TR2 cDN
HindIII-BglII fragment of A is inserted upstream of the human IgG ₁ Fc, and in-frame fusion was confirmed by sequencing. TR2-F
The c fragment was released by digesting the plasmid with HindIII-XhoI and cloned into the pcDNA3 expression plasmid.

The TR2-Fc plasmid linearized with PvuI was coprecipitated with calcium phosphate.
NIH3T3 was transferred by method. At 400 μg / ml G418
After selection, neomycin resistant colonies were selected and expanded. Anti-human IgG ₁ ELISA using³²Northern analysis using a P-labeled TR2 probe was used.
A clone was selected that produced high levels of TR2-Fc in the supernatant. Go
In some experiments, in treated Chinese hamster ovary (CHO) cells
A slightly different engineered TR2-Fc was used. TR2-Fc
Purified by protein G chromatography and the TR2-Fc fusion tag
The amino acid sequence at the N-terminus of the protein was determined by an automatic peptide sequencer (ABI).
Was decided. Using TR2-Fc, a polyclonal rabbit anti-TR2 antibody was
Produced.

(Blocking of MLR-mediated PBMC Amplification) PBMCs were purified by Ficoll gradient centrifugation at 400 × g for 40 minutes.
Isolated from healthy adult volunteers. Collect PBMC and 10% FBS
RPMI 1640 (GIBCO-BRL) supplemented with L-glutamine at 300 μg / ml and genetomycin at 50 μg / ml.
) And adjusted to 1 × 10 ⁶ cells / ml for two donors and 2 × 10 ⁵ cells / ml for the third donor.

50 μl of each cell suspension was added to a 96 well (round bottom) plate (Falcon, F
ranklin Lakes, NS) with 50 μl of TR2-Fc, IL-5R.
-Added with Fc, anti-CD4 mAb or control mAb. Plates were incubated for 96 hours at 37 ° C. in 5% CO ₂ . Then, 1 μCi of [ ³ H] -methylthymidine (ICN Biomedicals, Costa M)
esa, CA) was added over an additional 16 hours. Cells were harvested and radioactivity counted.

(Results and Discussion) (TR2 is a Novel Member of the TNFR Superfamily) FIGS. 1A-1B (SEQ ID NO: 2) show one of the isolated cDNAs (HLHAB49).
2 shows the amino acid sequence of TR2 deduced from the two longest open reading frames. Comparisons with other sequenced cDNAs and ESTs in the database are based on position 17 (either Arg or Lys) of the protein sequence shown in FIGS. 1A-1B (amino acid residues 20 and 5 in SEQ ID NO: 2) and 41 (Se
potential allelic variants that result in amino acid changes in either r or Phe).

The open reading frame is 283 with a calculated molecular weight of 30,417
Encodes amino acids. The TR2 moiety was expected to be a receptor. Therefore, potential signal sequences and transmembrane domains were explored. Hydrophobic stretch of 23 amino acids towards the C-terminus (amino acids 201-225) (FIG. 1)
A-1B) have been assigned as transmembrane domains. Because it potentially creates a single-stranded helix span, but the signal sequence is less clear. The potential ectodomain TR2 was expressed in NIH3T3 or CHO cells as an Fc fusion protein, and the N-terminal amino acid sequence of the recombinant TR2-Fc protein was determined in both cases. Processed mature T
The N-terminal sequence of R2 began at amino acid 37, indicating that the first 36 amino acids constitute the signal sequence (FIGS. 1A-1B).

[0666] Using polyclonal rabbit antibodies raised against TR2, native TR
The molecular size of 2 was determined to be 38 kD by Western analysis.
Since the processed TR2 protein backbone consists of 247 amino acids with an Mr of 26,000, the protein must be post-translationally modified. Two potential asparagine-like glycosylation sites are at amino acid position 11
0 and 173 (FIGS. 1A-1B). Together with other members of the TNFR family, TR2 has been identified by X-ray crystallography (Banner et al., Cell 73: 431).
(1993)) and represents a repeating structural unit (Banner, DW et al., Cell 73: 431 (199).
3)). FIG. 16 shows that TR2 (SEQ ID NO: 2), THFR-1 (SEQ ID NO: 10),
NFR-II (SEQ ID NO: 11), CD40 (SEQ ID NO: 12), and 4-1BB
The potential TNFR domains aligned in (SEQ ID NO: 13) are shown. TR2 is
It contained two complete TNFR domains and two incomplete TNFR domains.

The TR2 cytoplasmic tail (TR2 cy) contains CD40cy and 4-1BBcy.
Appear to be more closely related to that of Fas and TNFR-1
Does not include the death domain found in the intracellular domain. Moderate homology, but
Thr ²⁶⁶ of TR2 is aligned with Thr ^{233 of} 4-1BB and Thr ^{254 of} CD40. This can be important. Because Inui et al. (Inui, S
Eur J. et al. Immunol. 20: 1747 (1990)) is Thr ^{25 4} is found to be essential for CD40 signaling, and CD40 of Th
When r254 was mutated, CD40bd did not bind to CD40cy (
Hu, H .; M. J. et al. Biol. Chem. 269: 30069 (1994)
). Signals through 4-1BB and CD40 have been shown to be costimulatory for T cells and B cells, respectively (Banchereau, j.
And Rousset, F .; , Nature 353: 678 (1991); H
urtaldo, J .; J. et al. Immunol. 155: 3360 (1995)
).

[0668]

[Table 5] TR2 RNA Expression Tissue distribution of TR2 RNA expression was determined using human tissue RNA blots. TR2 RNA was detected in lung, spleen and thymus at relatively high levels in some tissues (Table V), but not in brain, liver or skeletal muscle by this method (Table V). ). TR2 was also expressed on monocytes, CD19 ⁺ B cells, and quiescent or PMA and PHA treated CD4 ⁺ or CD8 ⁺ T cells. It was only weakly expressed in bone marrow and endothelial cells (Tables V and VI), but expression was observed in the hematopoietic cell line KGla (Table V). For comparison, the tissue distribution of OX-40 (another member of the TNFR superfamily) was examined (Table V). Unlike TR2, OX-40 was not detected in any of the tissues tested, and activated T cells and KG1
a). Some cell lines are negative for TR2 expression, including TF274 (bone marrow stroma), MG63 and T
E85 (osteosarcoma), RL95-2 (endometrial sarcoma), MCF-7 and T-47
D (breast cancer cells), BE, HT 29 (colon cancer cells), HTB-11 and IMR
TR2 was found in rhabdomyosarcoma HTB-82, although -32 (neuroblastoma) (data not shown).

Several cell lines were tested for inducible TR2 expression. HL60, U937
And THP1 (which belong to the myelomonocytic junction) all express the differentiation agent PM
Increased TR2 expression in response to A or DMSO. Increased expression in response to these agents was observed in KGla and Jurkat cells.
In contrast, PMA did not induce TR2 expression in MG63, but unexpectedly, THF-α was expressed.

In almost all cases, the major mRNA is about 1.7 kb in size, but some higher molecular weight species can be detected in some tissues.
Although many of the sequenced cDNAs and ESTs contain inserts in the coding region that show partial splicing, we found that by Western blot,
Only one major protein was detected, suggesting that if they encode alternative proteins, they are not clear in the cells we tested. A number of higher MW mRNAs show that TR2
This raises the possibility that it can be regulated at the level of RNA maturation.

[0671]

[Table 6] (TR2 Map at 1P36.2-P36.3) The FISH mapping procedure was applied to localize the TR2 gene to specific human chromosomal regions. Assignment of the hybridization signal to the short arm of the first chromosome was obtained with the aid of DAPI banding. A total of 10 metastatic diagrams were photographed showing that the TR2 gene maps to the first chromosomal region p36.2-p36.3. TR2 position is CD30 (Smit
h, C.I. A. Et al., Cell 73: 1349-1360 (1993)), 4-1.
BB (Kwon, BS et al., J. Immunol. 152: 2256-226).
2 (1994); Goodwin, R .; G. FIG. Et al., Eur. J. Immunol.
23: 2631-2641 (1993)), OX-40 (Birkelland,
M. L. Et al., Eur. J. Immunol. 25: 956-930 (1995)
), And TNFR-II (Baker, E., et al., Cytogent. & Ce).
11 Genet. 57: 117-118 (1991)), suggesting that it evolves via a localized gene duplication phenomenon. Interestingly, all these receptors have a stimulatory phenotype in T cells in response to cognate ligand binding, as opposed to Fas and TNFR-I, which stimulate apoptosis. This encourages the inventors to test whether TR2 is involved in lymphocyte stimulation.

(TR2-Fc Coordinates with MLR-Mediated Proliferation of PBMCs) To determine the possible involvement of cell surface TR2 and its ligands in lymphocyte proliferation, we performed an allogeneic MLR. The proliferative response was tested. TR2-F
When c was added to the culture, a significant decrease in maximal response was observed (p <0.05).
Addition of TR2-Fc at 100 μg / ml inhibited growth by 53%. No significant inhibition of proliferation was observed with control IL-5R-Fc. Surprisingly, at high concentrations (10-100 μg / ml), IL-R5-Fc
Has been shown to enhance proliferation. The anti-CD4 mAb assayed at the same time was 60%
Inhibited MLR-mediated proliferation to the contrary, the control anti-IL-5 mAb failed to inhibit proliferation. It is well known that the major component of the MLR proliferative response is T-cell dependent; thus, inhibiting the interaction of TR2 with its ligand prevents optimal T lymphocyte activation and proliferation It seems. 1 to 1
Inhibition of MLR proliferation by TR2-Fc at a concentration of 00 μg / ml was
Preferred, comparable to the biological effects seen with other TNFR-Fc superfamily members such as Fc (unpublished results, Jeremy Harro
p).

[0673] Accordingly, the present inventors have identified additional members of the TNF receptor superfamily. The member either plays a direct role in T cell stimulation, or binds to a ligand that can stimulate T cell proliferation via one or more receptors, which can include TR2. Consistent with the direct role for TR2 is the similarity between the cytoplasmic domain and CD40 and 4-1BB. We are currently trying to identify which TR2 binds to this ligand to clarify its role.

Example 7 Gene Therapy Using Endogenous TR2 Receptor Gene Another method of gene therapy according to the invention is described, for example, in US Pat. No. 5,641, issued June 24, 1997. 670; International Application Publication No. WO 96/29411 published September 26, 1996; International Application Publication No. WO 94/12650 published August 4, 1994; Koller et al., Proc. Natl. Ac
ad. Sci. USA 86: 8932-8935 (1989); and Zijl.
operably linking the endogenous TR2 receptor sequence to the promoter by homologous recombination, as described in Stra et al., Nature 342: 435-438 (1989). The method involves the activation of a gene that is present in the target cell but is not expressed in that cell, or that is expressed at a lower level than desired. A polynucleotide construct is made, the polynucleotide construct comprising a promoter and a target sequence, wherein the target sequence is an endogenous TR
It is homologous to the 5 'non-coding sequence of the two receptors and is adjacent to the promoter. Since the target sequence is located sufficiently near the 5 'end of the TR2 receptor gene, the promoter is operably linked to the endogenous sequence during homologous recombination. The promoter and target sequence can be amplified using PCR. Preferably, the amplified promoter contains different restriction sites at the 5 'and 3' ends. Preferably, the 3 'end of the first target sequence contains the same restriction sites as the 5' end of the amplified promoter, and the 5 'end of the second target sequence is the 3' end of the amplified promoter. Contains the same restriction sites as

The amplified promoter and the amplified target sequence are digested with appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter sequence and the digested target sequence are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under appropriate conditions for ligation of the two fragments. The construct is size-fractionated on an agarose gel and then purified by phenol extraction and ethanol precipitation.

In this example, the polynucleotide construct is administered as a naked polynucleotide by electroporation. However, the polynucleotide construct is also administered with a transfection-enhancing agent (eg, liposomes, viral sequences, viral particles, precipitants, etc.). Such delivery methods are known in the art.

[0677] Once the cells are transfected, homologous recombination occurs resulting in a promoter operably linked to the endogenous TR2 receptor gene sequence. This results in the expression of the TR2 receptor in the cell. Expression can be detected by immunological staining or any other method known in the art.

[0678] Fibroblasts are obtained from the subject by skin biopsy. The resulting tissue is placed in DMEM and 10% fetal calf serum. Fibroblasts in the exponential or early stationary phase are trypsinized and rinsed off the plastic surface using nutrient media. An aliquot of the cell suspension is removed for counting and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is washed with 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KC
1, 0.7 mM Na2HPO4, 6 mM dextrose).
The cells are re-centrifuged, the supernatant is aspirated, and the cells are resuspended in electroporation buffer containing 1 mg / ml acetylated bovine serum albumin. The final cell suspension contains approximately 3 × 10 ⁶ cells / ml. Electroporation should be performed immediately after resuspension.

[0679] Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting the TR2 receptor locus, plasmid pUC18 (MBI Fermentas, Amherst, NY) was converted to Hind.
Digest with dIII. A CMV promoter was added to the XbaI site at the 5 'end and 3
Amplify by PCR using the BamHI site at the 'end. Two TR2 receptor gene non-coding sequences are amplified by PCR: one TR2 non-coding sequence (TR2 gene fragment 1) is amplified using a 5 'HindIII site and a 3' Xba site; the other TR2 The receptor gene non-coding sequence (TR2 gene fragment 2) is amplified using a BamHI site at the 5 'end and a HindIII site at the 3' end. The CMV promoter and TR2 gene fragment were ligated with the appropriate enzymes (CMV promoter-XbaI and Bam
HI; TR2 gene fragment 1-XbaI; TR2 gene fragment 2-
BamHI) and ligated together. The resulting ligation product was purified with HindI.
II and ligated with the HindIII digested pUC18 plasmid.

Add the plasmid DNA to a sterile cuvette equipped with a 0.4 cm electrode gap (Bio-Rad). The final DNA concentration is generally at least 120 μg /
ml. Then, 0.5 ml of the cell suspension (containing approximately 1.5 × 10 ⁶ cells) is added to the cuvette and the cell suspension and DNA solution are mixed gently. Electroporation was performed using a Gene-Pulser device (Bio-
Rad). The capacitance and voltage are set to 960 μF and 250-300 V, respectively. As the voltage increases, the number of viable cells decreases, but the percentage of viable cells that stably integrate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 ms should be observed.

The electroporated cells are maintained at room temperature for approximately 5 minutes, then the contents of the cuvette are gently removed using a sterile transfer pipette. Cells
10 ml of pre-warmed nutrient medium (DM with 15% bovine serum in a 0 cm dish)
EM) and incubate at 37 ° C. The next day, the medium is aspirated and replaced with 10 ml of fresh medium and incubated for an additional 16-24 hours.

The engineered fibroblasts can then be used alone or in cytodex (cyt).
odex) Injected into the host either after growing to confluence on 3 microcarrier beads. Here, the fibroblasts produce a protein product. The fibroblasts can then be introduced into the patient as described above.

Example 8 Assay to Detect Stimulation or Inhibition of B Cell Proliferation and Differentiation Background: The generation of a functional humoral immune response depends on the lytic and B lineage cells and their microenvironment. It requires both cognate signaling between and. The signal may impart a positive stimulus that allows the B-lineage cell to continue its programmed development, or a negative stimulus that directs the cell to block its current developmental pathway. To date, a number of stimulatory and inhibitory signals (IL-2, IL-
4, IL-5, IL-6, IL-7, IL-10, IL-13, IL-14 and IL-15) have been found to affect B cell responsiveness. Interestingly, these signals, by themselves, are weak effectors, but in combination with various costimulatory proteins, induce activation, proliferation, differentiation, homing, tolerance, and death in B cell populations . One of the best studied classes of B cell costimulatory proteins is the TNF superfamily. In this family, CD40, CD27 and CD30 have their respective ligands CD154
, CD70 and CD153 have been found to regulate various immune responses. Assays that allow detection and / or observation of the proliferation and differentiation of B cell populations and their precursors are useful in determining the effects that various proteins can have on these B cell populations in terms of proliferation and differentiation. It is a useful tool for Listed below are two assays designed to allow the detection of differentiation, proliferation, or inhibition of B cell populations and their precursors.

Experimental Procedures: In vitro assays-Purified TR2 receptor protein, or truncated forms thereof, induces activation, proliferation, differentiation, or inhibition and / or death in B cell populations and their precursors (or Inhibit), assayed for their ability. The activity of the TR2 receptor protein on purified human tonsil B cells, qualitatively measured over a dose range of 0.1 to 10,000 ng / ml, is assayed in a standard B lymphocyte costimulation assay. In the assay, purified tonsil B cells were purified from formalin-fixed Staphyloco.
Cultured in the presence of either C. aureus Cowan I (SAC) or an immobilized anti-human IgM antibody as a priming agent. IL-2
And second signals, such as IL-15, are SAC and I cross-linked to induce B cell proliferation as measured by tritiated thymidine incorporation.
Synergizes with gM. New synergistic agents can be easily identified using this assay. This assay involves isolating human tonsillar B cells by magnetic bead (MACS) removal of CD3 positive cells. The resulting cell population is greater than 95% B cells, as assessed by CD45R (B220) expression. Various dilutions of each sample were placed in individual wells of a 96-well plate and the wells were filled with culture medium (10% FBS, 5 × 10 ⁻⁵ M 2M
E, 10 ⁵ B cells suspended in 100 U / ml penicillin, RPMI 1640 containing 10 μg / ml streptomycin, and 10 ⁻⁵ dilution of SAC are added in a total volume of 150 μl. Growth or inhibition is quantified by a 20 hour pulse (1 μCi / well) with 3H-thymidine (6.7 Ci / mM) starting 72 hours after addition of the factor. Positive and negative controls are IL-2 and medium, respectively.

A soluble form of TR2, consisting of the extracellular domain of TR2, linked to the Fc portion of a human IgGl immunoglobulin molecule was prepared. The ability of this protein to alter the proliferative response of human B cells was evaluated in a standard costimulation assay. Briefly, human tonsillar B cells were purified by magnetic bead (MACS) removal of CD3 positive cells. The resulting cell population was routinely greater than 95% B cells, as assessed by the expression of CD19 and CD20 staining. Various dilutions of rHuNeutrokine-α (WO 98/18921) or the control protein rHuIL-2 are placed in individual wells of a 96-well plate, and the culture medium (10% FBS, 5 × 10 ⁻⁵ M 2ME, 100U / ml
Penicillin, 10 μg / ml streptomycin, and 10 ⁻⁵ dilution of formalin-fixed Staphylococcus aureus Cowan I (S
AC) (also known as Pansorbin (Pan))
10 ⁵ B cells suspended in 40) were added in a total volume of 150 μl. Then, T
R2-Fc was added at various concentrations. The plate was then placed in the incubator (37
5% CO ₂ , 95% humidity) for 3 days. Growth is initiated 72 hours after addition of the factor with a 20 hour pulse (1 μCi) using ³ H-thymidine (6.7 Ci / mM).
/ Well). Positive and negative controls are
These are IL-2 and medium, respectively.

The results of three such experiments show that TR2-Fc shows that S
It was found to cause a dose-dependent inhibition of B cell proliferation in a costimulation assay using Taphylococcus aureus Cowan I (SAC) and Neutrokine-α as the second signal. The inhibition observed in both experiments was 50% at concentrations as low as 20 ng / mL of TR2-Fc.
Was bigger than. Other tumor necrosis factor receptor (THFR) fusion proteins (
For example, DR4-Fc (WO 98/32856), TR6-Fc (WO 98/32
It is important to note that / 31799), and TR9-Fc (WO 98/56892)) did not inhibit proliferation.

To determine whether the inhibitory activity of TR2-Fc is specific for Neutrokine-α and SAC-stimulated cells, or to determine whether it is a more common negative regulator of B cell proliferation A similar experiment was performed where tonsillar B cells were stimulated with IL-2 and SAC. The result is that TR2-Fc also
FIG. 17 shows that it induced a dose-dependent inhibition of IL-2-driven B cell proliferation (see FIG. 17). Consistent with previous experiments, 50% inhibition was approximately 20 ng / mL TR2-F
c. Thus, TR2-Fc appears to negatively regulate B cell proliferation independent of B cell stimulation with Neutrokine-α.

In Vivo Assay-BALB / c mice were treated with buffer alone or 2 mg / Kg
Of the TR2 receptor protein, or a shortened form thereof, twice daily (ip). Mice receive this treatment for four consecutive days, and when they are killed, various tissues and sera are collected for analysis. Comparison of H & E portions from normal and TR2 receptor protein-treated spleens indicates that TR2 receptor protein activity on spleen cells (eg, diffusion of periarterial lymphatic sheath, and / or significant increase in nucleated cellularity in red pulp region) ). This means that B
It may indicate activation of differentiation and proliferation of a cell population. Anti-CD4, a B cell marker
Using immunohistochemical studies using 5R (B220), any physiological changes to splenocytes (eg, splenic tissue disruption) can be broadly defined by B that penetrate established T cell areas. Determine if it is due to increased B cell presentation in the cell zone.

Using flow cytometric analysis of spleens from TR2 receptor protein-treated mice, does the TR2 receptor protein specifically increase the percentage of ThB +, CD45R (B220) dulB cells observed in control mice? Indicates whether or not.

Similarly, the expected result of increased mature B cell presentation in vivo is a relative increase in serum Ig titers. Thus, serum IgM and IgA levels are not
Compared with R2 receptor protein treated mice.

Example 9 Isolation of Antibody Fragments Directed to a Polypeptide of the Invention from a Library of scFvs A naturally-occurring V gene isolated from human PBL was isolated from a polypeptide of the invention by (
Donors are constructed into libraries of antibody fragments that contain reactivity against them, whether or not exposed (see, eg, US Pat. No. 5,885,793, which is incorporated by reference in its entirety). (Incorporated herein)).

Experimental Procedures: Rescue of Library A library of scFv is constructed from human PBL RNA as described in WO 92/01047. To rescue phage displaying antibody fragments, approximately 10 ⁹ E. coli harboring phagemids were rescued. E. coli, 50 ml of 2 × TY (containing 1% glucose and 100 μg / ml ampicillin) (2 × TY-AMP-GL)
U) and inoculate 0.8 O.S. D. Propagate to growth. 5 ml of this culture was used to inoculate 50 ml of 2 × TY-AMP-GLU and 2 × 10 ⁸
TU Δgene 3 helper (M13Δgene III, PCT Publication WO92 / 01)
047) is added and the culture is incubated at 37 ° C. for 45 minutes without shaking, then for 45 minutes at 37 ° C. with shaking. The culture is incubated at 4000 r. p. m. And resuspend the pellet in 2 liters of 2 × TY (containing 100 μg / ml ampicillin and 50 μg / ml kanamycin) and grow overnight. The phage was transferred to WO92
Prepared as described in WO / 01047.

The M13Δ gene III is prepared as follows: The M13Δ gene III helper phage does not encode the gene III protein. Therefore, phage displaying antibody fragments (phagemids) have a greater binding avidity for the antigen. During phage morphogenesis, infectious M13Δgene III particles are generated by growing helper phage in cells carrying a pUC19 derivative that supplies the wild-type gene III protein. The culture is incubated for 1 hour at 37 ° C. without shaking, then for another hour at 37 ° C. with shaking. Centrifuge the cells (IEC-Centra 8,400r)
. p. m. For 10 minutes), 100 μg / ml ampicillin and 25 μg / ml
2 x TY broth containing 2 ml of kanamycin (2 x TY-AMP-KAN) 3
Resuspended in 00 ml and grown overnight at 37 ° C. with shaking. The phage particles were purified and concentrated from the culture medium by two PEG precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS, and passed through a 0.45 μm filter (Minisart NML; Sartorius) to about 10 ¹³ A final concentration of transduction units / ml (ampicillin resistant clone) is obtained.

(Library Panning) Immunotubes (Nunc)
4 ml of either 100 mg / ml or 10 mg / ml of the light polypeptide
Coat overnight in PBS with. Tube is 2% Marvel-PB
Block with S for 2 hours at 37 ° C., then wash 3 times in PBS. About 10 ¹³ Apply TU phage to tube and tumbl up and down on turntable
For 30 minutes at room temperature, then let sit for another 1.5 hours.
Good. Tubes were washed 10 times with PBS 0.1% Tween-20 and 1 times with PBS.
Wash 0 times. Add 1 ml of 100 mM triethylamine and on the turntable
The phage is eluted by spinning up and down for 15 minutes at
. Neutralize immediately with 5 ml of 1.0 M Tris-HCl, pH 7.4. Then
Incubating the eluted phage with the bacteria for 30 minutes at 37 ° C
Phage using 10 ml of mid-logarithmic E. coli. TG1
Dye. Then, E. coli with 1% glucose and 100 μg / ml
Plate on TYE plate containing picillin. Then obtained
The bacterial library was rescued with the Δ gene 3 helper phage as described above.
Prepare the phage for the next round of selection. This process is then
Repeat for a total of four rounds of purity purification, with tube washing on the third and fourth rounds.
Increase to 20 with PBS, 0.1% Tween-20 and 20 with PBS
.

(Characterization of Binder) Using phage eluted from the third and fourth rounds of selection, E. coli E. coli HB 2151 and soluble scFv
From a single colony for the assay (Marks et al., J. Mol. B.
iol. 222: 581-597 (1991)). 50 mM bicarbonate, pH 9
. An ELISA is performed using microtiter plates coated with any of the polypeptides of the invention in 10 pg / ml. Positive clones in the ELISA were PCR fingerprinted (eg, WO92 / 0104).
7) and then further characterized by sequencing.

Example 10 Methods for Determining Changes in TR2 Receptor Gene RN from whole family or individual patients presenting the phenotype of interest (eg, disease)
A is isolated. Next, cDNA is generated from these RNA samples using protocols known in the art (see Sambrook). Next, this cDNA was prepared using a primer surrounding the target region in SEQ ID NO: 1,
Used as a CR template. Suggested PCR conditions are Sidrans
ky, D.S. Et al., Science 252: 706 (1991), using 95 ° C for 30 seconds; 52-58 ° C for 60-120 seconds; and 70 ° C.
And 35 cycles of 60 to 120 seconds.

Next, the PCR product was purified using SequiTherm Polymerase (Epi
sequence, using a primer labeled with T4 polynucleotide kinase at its 5 'end. TR
The intron-exon boundaries of selected exons of the two receptors are also determined and the genomic PCR products are analyzed to confirm the results. Next, PCR products with suspected mutations in the TR2 receptor are cloned and sequenced to confirm the results of direct sequencing.

The TR2 receptor PCR product was prepared as described in Holton, T .; A. And Graha
mM. W. , Nucl. Acids Res. , 19: 1156 (1991).
And cloned into a T-tail vector as described in
The sequence is determined using ed States Biochemical. Affected individuals are identified by mutations in the TR2 receptor that are not present in unaffected individuals.

[0699] Genomic rearrangements are also observed as a way to determine changes in the TR2 receptor gene. Genomic clones isolated using techniques known in the art can be isolated from digoxigenin deoxy-uridine 5'-triphosphate (Boehringer
Nick translation using Mannheim) and Johnso
n. C et al., Meth. Cell Biol. 35: 73-99 (1991)
Perform FISH as described in. Hybridization with a labeled probe is performed using a large excess of human cot-1 DNA for specific hybridization of the TR2 receptor to the genomic locus.

The chromosomes are counterstained with 4,6-diamino-2-phenylidol and propidium iodide to generate a combination of C and R bands. Aligned images for accurate mapping were obtained using a triple band filter set (Chroma Tec).
hnology, Brattleboro, VT) and a cooled charge-coupled device camera (
Photometrics, Tucson, AZ) and a variable excitation wavelength filter (Johnson, C et al., Genet. Anal. Tech. Appl. 8:
75 (1991)). Isee Graphica
l Program System (Invision Corporation)
ion, Durham, NC) using image acquisition, analysis and chromosome fractionation (
Fragmental length measurement. (Probe hybridized) TR
Chromosomal changes in the genomic region of the two receptors are identified as insertions, deletions and translocations. These TR2 receptor changes are used as diagnostic markers for related diseases.

Example 11 Method of Detecting Abnormal Levels of TR2 Receptor in a Biological Sample A TR2 polypeptide can be detected in a biological sample and if an increase or decrease in TR2 is detected In particular, this polypeptide is a marker of a particular phenotype. It is understood that there are a number of detection methods and, therefore, those skilled in the art can modify the following assays to suit their particular needs.

For example, an antibody sandwich ELISA is used to detect the TR2 receptor in a sample (preferably in a biological sample). The wells of the microtiter plate are coated with a final concentration of 0.2-10 μg / ml of an antibody specific for TR2. This antibody is either monoclonal or polyclonal and is produced by techniques known in the art. This well is blocked so that non-specific binding of the TR2 receptor to the well is reduced.

Next, the coated wells are incubated with the sample containing the TR2 receptor for more than 2 hours at room temperature. Preferably, serial dilutions of the sample should be used to confirm the results. The plate is then washed three times with deionized or distilled water to remove unbound TR2 receptor.

Next, 50 μl of the specific antibody-alkaline phosphatase conjugate was added to 25-400 n.
g and incubate at room temperature for 2 hours. The plate is again washed three times with deionized or distilled water to remove unbound conjugate.

Then, 75 μl of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate (NPP) substrate solution is added to each well and incubated for 1 hour at room temperature to allow cleavage of the substrate and fluorescence. enable. This fluorescence is measured with a microtiter plate reader. A calibration curve is created using experimental results from serial dilutions of control samples, plotting sample concentration on the X-axis (log scale) and fluorescence or absorbance on the Y-axis (uniform scale). Interpolate the polypeptide concentration in the sample using the standard curve. The concentration of the TR2 receptor polypeptide in the sample is then interpolated using a calibration curve based on the fluorescence measured for the sample.

Example 12 Method of Treating a Reduced Level of TR2 Receptor The present invention relates to a method for treating an individual in need of decreasing the level of TR2 receptor biological activity in the body. The method comprises treating a therapeutically effective amount of T
Administering a composition comprising an R2 receptor antagonist to such an individual. Preferred antagonists for use in the present invention are TR2 receptor-specific antibodies.

It is further understood that conditions caused by reduced levels of normal or normal expression of the TR2 receptor in an individual can be treated by administering the TR2 receptor, preferably in a soluble and / or secreted form. . Accordingly, the invention also provides a method of treating an individual in need of increasing levels of a TR2 receptor polypeptide. The method involves administering to such an individual a pharmaceutical composition comprising an amount of TR2 receptor that increases the level of biological activity of the TR2 receptor in such an individual.

For example, patients with reduced levels of TR2 receptor polypeptide have
Receive daily doses of 0.1-100 μg / kg of polypeptide for consecutive days. Preferably, the polypeptide is in a soluble and / or secreted form.

Example 13 Method of Treating Elevated Levels of TR2 Receptor The present invention also relates to a method for treating an individual in need of an increased level of TR2 receptor biological activity in the body, comprising: The method comprises treating a therapeutically effective amount of TR.
Administering a composition comprising two receptors or an agonist thereof to such an individual.

[0710] The production of the TR2 receptor is inhibited using antisense technology. This technique is one example of a method for reducing the level of a TR2 receptor polypeptide (preferably in soluble and / or secreted form) due to various etiologies, such as cancer.

For example, patients diagnosed with abnormally elevated levels of TR2 receptor may receive antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0.
Administer intravenously at 21 mg / kg / day for 21 days. If determined to be sufficiently resistant to the treatment, the treatment is repeated after a 7 day washout period. Formulations of antisense polynucleotides are provided in Example 10.

Example 14: Methods of Treatment Using Gene Therapy-Ex Vivo One method of gene therapy transplants fibroblasts capable of expressing soluble and / or mature TR2 receptor polypeptide into a patient. Generally, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in a tissue culture medium and divided into small pieces. A small chunk of tissue is placed on the wet surface of a tissue culture flask and approximately 10 pieces are placed in each flask. The flask is inverted, closed tightly, and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted, the tissue mass remains fixed at the bottom of the flask, and fresh medium (eg, Ham's F12 medium containing 10% FBS, penicillin and streptomycin) is added. The flask is then incubated at 37 ° C. for about one week.

At this point, fresh medium is added and then changed every few days. After another two weeks of culture, a monolayer of fibroblasts appears. The monolayer is trypsinized and scaled up to a larger flask.

The Moloney murine sarcoma virus long terminal repeat is flanked by pMV-7 (Kirsc
hmeier, P .; T. Et al., DNA, 7: 219-25 (1988)).
After digestion with RI and HindIII, it is treated with calf intestinal phosphatase.
The linear vector is fractionated on an agarose gel and purified using glass beads.

[0715] The cDNA encoding the TR2 receptor can be amplified using PCR primers corresponding to the 5 'and 3' end coding sequences, respectively. Preferably, the 5 'primer contains an EcoRI site and the 3' primer contains a HindIII site. Equivalent amounts of Moloney murine sarcoma virus linear scaffold and amplified EcoR
The I and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for joining the two fragments. The ligation mixture was then used and E.I. E. coli HB101. It is then plated on agar containing kanamycin to confirm that the vector contains the properly inserted TR2 receptor.

[0714] Amphotropic pA317 or GP + am12 packaging cells were
Dulb containing 0% calf serum (CS), penicillin and streptomycin
Grow to confluent density in tissue culture in ecco modified Eagle's medium (DMEM). Next, the MSV vector containing the TR2 receptor gene is added to the medium and the packaging cells are transduced with the vector. At this time, the packaging cells produce infectious virus particles containing the TR2 receptor gene (
Here, the packaging cell is called a producer cell).

[0717] Fresh media is added to the transduced producer cells, and the media is then removed from a 10 cm plate of confluent producer cells. Spent media containing infectious viral particles is filtered through a millipore filter to remove detached producer cells, and the media is then used to infect fibroblasts. Remove the medium from the subconfluent plate of fibroblasts and immediately replace the medium from the producer cells.
The medium is removed and replaced with fresh medium. If the virus titer is high,
Virtually all fibroblasts are infected and selection is not required. If the titer is very low, it is necessary to use a retroviral vector with a selectable marker such as neo or his. Once the fibroblasts are efficiently infected, the fibroblasts are analyzed to determine if the TR2 receptor protein is being produced.

Next, engineered fibroblasts were used alone or with cytodex 3 (cytotoxin).
dex 3) After being grown to confluence on microcarrier beads, transplanted into a host either.

Example 15 Methods of Treatment Using Gene Therapy-In Vivo Another aspect of the invention is the use of in vivo gene therapy methods to treat disorders, diseases, and conditions. This method of gene therapy involves naked nucleic acids (DNA, R, R) in animals to increase or decrease the expression of TR2 receptor polypeptides.
NA, and antisense DNA or RNA) TR2 receptor sequences. A TR2 receptor polynucleotide can be operably linked to a promoter or any other genetic element required for expression of a TR2 receptor polypeptide by a target tissue. Techniques and methods for such gene therapy and delivery are known in the art and are described, for example, in International Application Publication No. WO 90/1109.
2, International Application Publication No. WO 98/11779; U.S. Patent Nos. 5,693,622, 5,705,151, and 5,580,859;
Et al., Cardiovasc. Res. 35: 470-479 (1997); Ch.
ao J .; Et al., Pharmacol. Res. 35: 517-522 (1997)
Wolff J.). A. Neuromuscul. Disord. 7:31
4-318 (1997); Schwartz B .; Et al., Gene Ther. 3
: 405-411 (1996); Et al., Circulati
on 94: 3281-3290 (1996), incorporated herein by reference.

The TR2 receptor polynucleotide constructs can be produced by any method that delivers an injectable substance to the cells of an animal, such as injection into the interstitial space of tissue (heart, muscle, skin, lung, liver, intestine, etc.). Can be delivered. TR2 receptor polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

The term “naked” polynucleotide, DNA or RNA, refers to any delivery vehicle (viral sequence, virus particle, liposome formulation, lipofectin, or lipofectin) that acts to assist, facilitate, or facilitate entry into cells. (Including a precipitant and the like). However, TR2 receptor polynucleotides also
Liposomal formulations (eg, Felg) that can be prepared by methods well known to those of skill in the art.
ner p. L. (1995) Ann. NY Acad. Sci. 772: 1
26-139 and Abdallah B.A. (1995) Biol. Cell
85: 1-7).

[0722] The TR2 receptor polynucleotide vector construct used in the gene therapy method is preferably a construct that is not integrated into the host genome and does not contain sequences allowing replication. Any strong promoter known to those of skill in the art
A can be used to drive expression. Unlike other gene therapy techniques, one major advantage of introducing a naked nucleic acid sequence into a target cell is the transient nature of polynucleotide synthesis in that cell. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide for the production of a desired polypeptide for a period of up to six months.

The TR2 receptor polynucleotide constructs can be expressed in tissues (muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney,
(Including the gallbladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eyes, glands, and connective tissue). The interstitial space of this tissue may contain intercellular fluid, mucopolysaccharide matrix (reticulated fibers of organ tissue, elastic fibers in the walls of blood vessels or chambers, collagen fibers in fibrous tissue), or muscle cells. Includes the same matrix in the overlying connective tissue or in the bone hiatus. This is also the space occupied by the circulating plasma and the lymph of the lymph channels. Delivery of muscle tissue to the interstitial space is preferred for reasons discussed below. They can be conveniently delivered by injection into the tissue containing these cells. They are preferably delivered to and expressed in differentiated, persistent, non-dividing cells, but are delivered and expressed in non-differentiated cells or in fully differentiated cells (eg, blood stem cells). Or dermal fibroblasts). In vivo, muscle cells, in their ability to take up and express polynucleotides,
Especially qualified.

For naked TR2 receptor polynucleotide injections, effective dosages of DNA or RNA range from about 0.05 g / kg body weight to about 50 mg / kg body weight. Preferably, the dosage will be from about 0.005 mg / kg to about 20 mg / kg, and more preferably, from about 0.05 mg / kg to about 5 mg / kg. Of course, as the skilled artisan will appreciate, this dosage will vary according to the tissue site of injection. Appropriate and effective dosages of nucleic acid sequences can be readily determined by one skilled in the art, and will depend on the condition being treated and the route of administration. A preferred route of administration is
By parenteral injection route into the interstitial space of the tissue. However, other parenteral routes may also be used, including, for example, inhalation of an aerosol formulation, particularly for delivery to lung or bronchial tissue, the throat, or the mucous membrane of the nose. In addition, naked T
R2 receptor polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in this procedure.

The dose response effect of the injected TR2 receptor polynucleotide in muscle in vivo is determined as follows. Suitable TR2 receptor template DNA for the production of mRNA encoding a TR2 receptor polypeptide is prepared according to standard recombinant DNA methodology. The template DNA, which can be either circular or linear, is either used as naked DNA or complexed with liposomes. The quadriceps of the mouse are then injected with various amounts of template DNA.

[0724] Female and male Balb / C mice, 5-6 weeks old, were given 0.3 ml of 2.5%
Anesthetize by injecting Avertin intraperitoneally. A 1.5 cm incision is made in the anterior thigh and the quadriceps are visualized directly. TR2 receptor template DNA
In a 0.1 ml carrier, use a 1 cc syringe through a 27-gauge needle for 1 minute, about 0.5 cm from the distal insertion site of the muscle to the knee, about 0.2 cm
Inject at a depth of. Sutures are made over the injection site for future positioning and the skin is closed with a stainless steel clip.

After an appropriate incubation time (eg, 7 days), a muscle extract is prepared by cutting the entire quadriceps. Every fifth 15 μm section of each quadriceps is histochemically stained for TR2 receptor protein expression. The time course for TR2 receptor protein expression can be performed in a similar manner, except that quadriceps from different mice are harvested at different times. TR in muscle after injection
Persistence of 2-receptor DNA can be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatant from injected and control mice. The results of the above experiments in mice show that the naked D2
NA can be used to extrapolate appropriate dosages and other treatment parameters in humans and other animals.

Example 16 Gene Therapy Using Endogenous TR2 Receptor Gene Another method of gene therapy according to the present invention is described in, for example, US Pat. No. 5,641,670, issued Jun. 24, 1997. No. WO 96/29411 published on September 26, 1996; WO 94/12650 published August 4, 1994; Koller et al., Proc. Natl. Ac
ad. Sci. USA 86: 8932-8935 (1989); and Zijl.
operably linking the endogenous TR2 receptor sequence to the promoter by homologous recombination, as described in Stra et al., Nature 342: 435-438 (1989). The method involves the activation of a gene that is present in the target cell but is not expressed in that cell, or that is expressed at a lower level than desired. A polynucleotide construct is generated that includes a promoter sequence and a target sequence that is adjacent to the promoter sequence and that is homologous to the 5 'non-coding sequence of the endogenous TR2 receptor. Because the target sequence is sufficiently close to the 5 'end of the TR2 receptor, the promoter is operably linked to the endogenous sequence during homologous recombination. The promoter sequence and the target sequence can be amplified using PCR. Preferably, the amplified promoter has a 5 'end and a 3' end.
Contains different restriction sites at the ends. Preferably, the 3 'end of the first target sequence is
It contains the same restriction sites as the 5 'end of the amplified promoter, and the 5' end of the second target sequence contains the same restriction sites as the 3 'end of the amplified promoter.

The amplified promoter and the amplified target sequence are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter sequence and the digested target sequence are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under appropriate conditions for ligation of the two fragments. The construct is size-fractionated on an agarose gel and then purified by phenol extraction and ethanol precipitation.

In this example, the polynucleotide construct is administered as a naked polynucleotide by electroporation. However, the polynucleotide construct is also administered with a transfection-enhancing agent (eg, liposomes, viral sequences, viral particles, precipitants, etc.). Such delivery methods are known in the art.

[0731] Once the cells are transfected, homologous recombination occurs resulting in a promoter operably linked to the endogenous TR2 receptor sequence. This results in the expression of the TR2 receptor in the cell. Expression can be detected by immunological staining or any other method known in the art.

[0732] Fibroblasts are obtained from the subject by skin biopsy. Place the resulting tissue in DMEM and 10% fetal calf serum. Fibroblasts in the exponential or early stationary phase are trypsinized and rinsed off the plastic surface using nutrient media.
An aliquot of the cell suspension is removed for counting and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is washed with 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl
, 0.7 mM Na ₂ HPO ₄ , 6 mM dextrose). The cells are re-centrifuged, the supernatant is aspirated, and the cells are resuspended in electroporation buffer containing 1 mg / ml acetylated bovine serum albumin. The final fine suspension contains approximately 3 × 10 ⁶ cells / ml. Electroporation,
Should be performed immediately after resuspension.

[0733] Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting the TR2 receptor locus, plasmid pUC18 (MBI Fermentas, Amherst, NY) was converted to Hind.
Digest with dIII. A CMV promoter was added to the XbaI site at the 5 'end and 3
'Amplify by PCR to include a terminal BamHI site. Two TR2 receptor non-coding sequences are amplified by PCR: one TR2 receptor non-coding sequence (TR2 receptor fragment 1) is amplified to include a 5 ′ HindIII site and a 3 ′ Xba site; The TR2 receptor non-coding sequence (TR2 receptor fragment 2) is amplified to include a BamHI site at the 5 'end and a HindIII site at the 3' end. The CMV promoter and the TR2 receptor fragment were converted to the appropriate enzymes (CMV promoter-XbaI and BamHI; TR2 receptor fragment 1-XbaI; T
R2 receptor fragment 2-BamHI) and ligated together. The resulting ligation product is digested with HindIII and ligated with the HindIII digested pUC18 plasmid.

Add the plasmid DNA to a sterile cuvette equipped with a 0.4 cm electrode gap (Bio-Rad). The final DNA concentration is generally at least 120 μg /
ml. Then, 0.5 ml of the cell suspension (containing approximately 1.5 × 10 ⁶ cells) is added to the cuvette and the cell suspension and DNA solution are mixed gently. Electroporation was performed using a Gene-Pulser device (Bio-
Rad). The capacitance and voltage are set to 960 μF and 250-300 V, respectively. As the voltage increases, the number of viable cells decreases, but the percentage of viable cells that stably integrate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 ms should be observed.

The electroporated cells are maintained at room temperature for approximately 5 minutes, and the contents of the cuvette are then gently removed using a sterile transfer pipette. Cells
10 ml of pre-warmed nutrient medium (DM with 15% bovine serum in a 0 cm dish)
EM) and incubate at 37 ° C. The next day, the medium is aspirated and replaced with 10 ml of fresh medium and incubated for an additional 16-24 hours.

The engineered fibroblasts can then be used alone or by cytodex (cytdex).
odex) Injected into the host either after growing to confluence on 3 microcarrier beads. Here, the fibroblasts produce a protein product. The fibroblasts can then be introduced into the patient.

Example 17 Production of Antibodies Using Hybridoma Technology The antibodies of the invention can be prepared by various methods. (Edited by Ausubel et al.,
1998, Current Protocols in Molecular
Biology, John Wiley & Sons, NY, Chapter 2). As one example of such a method, cells expressing TR2 are administered to an animal to induce the production of serum containing polyclonal antibodies. In a preferred method, a preparation of the TR2 protein is prepared and purified to be substantially free of natural contaminants. Such a preparation is then introduced into an animal to produce a higher specific activity polyclonal antiserum.

[0738] Monoclonal antibodies specific for the TR2 polypeptide are prepared using hybridoma technology (Kohler et al., Nature 256: 495 (
1975); Kohler et al., Eur. J. Immunol. 6: 511 (19
76); Kohler et al., Eur. J. Immunol. 6: 292 (1976)
); Hammerling et al .: Monoclonal Antibodies.
and T-Cell Hybridomas, Elsevier, N.W. Y. ,
563-681 (1981)). Generally, animals (preferably mice) are TR
Immunized with two polypeptides, or more preferably, cells expressing a secreted TR2 polypeptide. Such polypeptide-expressing cells are preferably supplemented with 10% fetal calf serum (inactivated at about 56 ° C.) in any suitable tissue culture medium, and contain about 10 g / l of non-essential amino acids, about 1 Cultured in Earle's modified Eagle's medium supplemented with 2,000 U / ml penicillin, and about 100 μg / ml streptomycin.

[0739] The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line can be used according to the present invention;
It is preferred to use the parental myeloma cell line (SP2O) available from CC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then are described in Wands et al. (Gastroenterology 80: 225-232 (
1981)) by cloning by limiting dilution. The hybridoma cells resulting from such a selection are then assayed to identify clones that secrete antibodies capable of binding the TR2 polypeptide.

Alternatively, additional antibodies that can bind to the TR2 polypeptide can be generated in a two-step procedure using anti-idiotypic antibodies. Such methods take advantage of the fact that antibodies are themselves antigens, and thus it is possible to obtain antibodies that bind to a second antibody. According to this method, an animal, preferably a mouse, is immunized using a protein-specific antibody. The spleen cells of such animals are then used to produce hybridoma cells. The hybridoma cells are then screened to identify a clone that produces an antibody whose ability to bind to a TR2 protein-specific antibody can be blocked by the TR2 polypeptide. Such antibodies include anti-idiotypic antibodies to TR2 protein-specific antibodies and are used to immunize animals to induce the formation of additional TR2 protein-specific antibodies.

For in vivo use of antibodies in humans, the antibodies are “humanized”. Such antibodies can be produced by using a genetic construct derived from a hybridoma cell producing the monoclonal antibody described above. Methods for producing chimeric and humanized antibodies are known in the art and are discussed below (for a review, see Morrison, Science 229: 1202 (1
985); Oi et al., BioTechniques 4: 214 (1986); C
abilly et al., U.S. Patent No. 4,816,567; Taniguchi et al., E.
P 171496; Morrison et al., EP 173494; Neuberg.
er et al., WO 8615333; Robinson et al., WO 8702671;
Boulianne et al., Nature 312: 643 (1984); Neub.
erger et al., Nature 314: 268 (1985)).

Example 18: Expression pattern of TNF receptor expression in human tissues Northern blot analysis is performed to determine the level of TNF receptor expression in human tissues. All cellular RNA samples were prepared using the RNAzol ^™ B system (Bio
tecx Laboratories, Inc. , Houston, Tex. )
To isolate. Approximately 10 μg of total RNA isolated from each specific human tissue is separated on a 1% agarose gel and blotted onto nylon filters (Sambrook, Fritsch, and Maniatis, Molecu.
lar Cloning, Cold Spring Harbor Press
, (1989)). The labeling reaction was performed using 50 ng of the DNA fraction and Stran.
Perform according to the tagene Prime-It kit. The labeled DNA is
select-G-50 column (5 Prime-3 Prime, Inc. Bo)
(ulder, CO). The filter was then
Hybridization was performed overnight at 65 ° C. using NaPO ₄ (pH 7.4) and a radiolabeled full-length TNF receptor gene (1,000,000 cpm / ml) in 7% SDS. After two washes with 0.5 × SSC, 0.1% SDS at room temperature and two washes at 60 ° C., then expose the filter to intensifying screen at −70 ° C. overnight.

It is clear that the invention can be carried out in other ways than those described in detail in the foregoing description and examples.

Many modifications and variations of the present invention are possible in light of the above teachings, and are thus within the scope of the appended claims.

The entire disclosure of all publications (patents, patent applications, literature articles, laboratory manuals, books, or other documents) cited herein is hereby incorporated by reference.

[0746]

[Table 7]

[0747]

[Table 8]

[0748]

[Table 9]

[Sequence list]

[Brief description of the drawings]

1A-1B show the nucleotide sequence of the TR2 receptor (SEQ ID NO: 1) and the deduced amino acid sequence (SEQ ID NO: 2). This protein has a predicted leader sequence of approximately 36 amino acid residues (underlined) (amino acid residues -36 to -1 of SEQ ID NO: 2).
And an estimated molecular weight of about 30,417 kDa. About 37 to about 2 amino acid residues
00 (amino acid residues 1-164 of SEQ ID NO: 2) constitutes the extracellular domain; about 201 to about 225 (amino acid residues 165-189 of SEQ ID NO: 2) constitute the transmembrane domain (underlined) And about 226 to about 283 (amino acid residues 190 to 247 of SEQ ID NO: 2) constitute an intracellular domain. Two potential asparagine-linked glycosylation sites are at amino acid positions 110 and 173 (amino acid 7 of SEQ ID NO: 2).
4th to 137th).

1A-1B show the nucleotide sequence of the TR2 receptor (SEQ ID NO: 1) and the deduced amino acid sequence (SEQ ID NO: 2). This protein has a predicted leader sequence of about 36 amino acid residues (underlined) (-35 to -1 in SEQ ID NO: 2) and about 30 amino acids.
, 417. About 37 to about 200 amino acid residues (amino acid residues 1 to 164 of SEQ ID NO: 2) make up the extracellular domain; about 201 to about 225 (
Amino acid residues 165 to 189 of SEQ ID NO: 2 constitute the transmembrane domain (underlined); and about 226 to about 283 (amino acid residues 190 to 247 of SEQ ID NO: 2) constitute the intracellular domain. Two potential asparagine-linked glycosylation sites are located at amino acids 110 and 173 (amino acids 74-137 of SEQ ID NO: 2).

FIG. 2 shows a region of similarity between the amino acid sequence of the TR2 receptor protein of FIGS. 1A-1B and the amino acid sequence of the mouse CD40 protein (SEQ ID NO: 3).

FIG. 3 shows an analysis of the amino acid sequence of the TR2 receptor of FIGS. 1A-1B. α
Region, β region, turn region, and coil region; hydrophilicity and hydrophobicity; amphipathic region; flexible region; antigenicity index and surface probability. "Antigenicity Index-James
In the “son-Wolf” graph, amino acid residues 39 to 70 of FIGS.
, 106-120, 142-189, and 276-283 (amino acid residues 3-34, 70-84, 106-153, and 240-247 of SEQ ID NO: 2)
This corresponds to the indicated high antigenic region of the TR2 receptor protein.

4A-4C show the nucleotide sequence of the TR2-SV1 receptor (SEQ ID NO: 4) and the deduced amino acid sequence (SEQ ID NO: 5). This protein contains approximately 36
Deduced leader sequence for amino acid residues (underlined) (amino acid residue -36 of SEQ ID NO: 5)
-1) and an estimated molecular weight of about 19.5 kDa.

4A-4C show the nucleotide sequence of the TR2-SV1 receptor (SEQ ID NO: 4) and the deduced amino acid sequence (SEQ ID NO: 5). This protein contains approximately 36
Deduced leader sequence for amino acid residues (underlined) (amino acid residue -36 of SEQ ID NO: 5)
-1) and an estimated molecular weight of about 19.5 kDa.

4A-4C show the nucleotide sequence of the TR2-SV1 receptor (SEQ ID NO: 4) and the deduced amino acid sequence (SEQ ID NO: 5). This protein contains approximately 36
Deduced leader sequence for amino acid residues (underlined) (amino acid residue -36 of SEQ ID NO: 5)
-1) and an estimated molecular weight of about 19.5 kDa.

FIG. 5 shows the region of similarity between the amino acid sequence of the full-length TR2-SV1 receptor protein and the amino acid sequence of the human type 2 TNF receptor (SEQ ID NO: 6).

FIG. 6 shows an analysis of the amino acid sequence of the TR2-SV1 receptor. α region, β
Regions, turn regions, and coil regions; hydrophilic and hydrophobic; amphiphilic regions; flexible regions; antigenicity indicators and surface probabilities. "Antigenicity Index-Jameson-
4A-4C, the amino acid residues 39-70, 99-
136, and 171-185 (amino acid residues 3-34, 63-1 of SEQ ID NO: 5)
00, and 135-149) correspond to the indicated highly antigenic region of the TR2-SV1 receptor protein.

FIGS. 7A-7C show the nucleotide sequence (SEQ ID NO: 7) and the deduced amino acid sequence (SEQ ID NO: 8) of the TR2-SV2 receptor. This protein lacks a putative leader sequence and has a putative molecular weight of about 14 kDa.

FIGS. 7A-7C show the nucleotide sequence (SEQ ID NO: 7) and the deduced amino acid sequence (SEQ ID NO: 8) of the TR2-SV2 receptor. This protein lacks a putative leader sequence and has a putative molecular weight of about 14 kDa.

7A-7C show the nucleotide sequence of the TR2-SV2 receptor (SEQ ID NO: 7) and the deduced amino acid sequence (SEQ ID NO: 8). This protein lacks a putative leader sequence and has a putative molecular weight of about 14 kDa.

FIG. 8 shows the amino acid sequence of TR2-SV2 receptor protein and human type 2 TN
The region of similarity between the F receptor amino acid sequence (SEQ ID NO: 9) is shown.

FIG. 9 shows an analysis of the amino acid sequence of the TR2-SV2 receptor. α region, β
Regions, turn regions, and coil regions; hydrophilic and hydrophobic; amphiphilic regions; flexible regions; antigenicity indicators and surface probabilities. "Antigenicity Index-Jameson-
In the "Wolf" graph, amino acid residue 56 of FIGS. 7A-7C (SEQ ID NO: 8)
-68 and 93-136 correspond to the indicated high antigenic region of the TR2-SV2 receptor protein.

FIG. 10 shows the region of similarity between the amino acid sequence of the TR2 receptor protein of FIGS. 1A-1B and the amino acid sequence of the TR2-SV1 receptor protein of FIGS. 4A-4C.

FIG. 11 shows a region of similarity between the amino acid sequence of the TR2 receptor protein of FIGS. 1A-1B and the amino acid sequence of the TR2-SV2 receptor protein of FIGS. 7A-7C.

FIG. 12 shows the amino acid sequence of TR2-SV1 receptor protein and TR2-S
The region of similarity between the amino acid sequence of the V2 receptor protein is shown.

13A-13D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV1 receptor protein of FIGS. 4A-4C. Show.

FIGS. 13A-13D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV1 receptor protein of FIGS. 4A-4C. Show.

FIGS. 13A-13D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV1 receptor protein of FIGS. 4A-4C. Show.

FIGS. 13A-13D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV1 receptor protein of FIGS. 4A-4C. Show.

FIGS. 14A-14D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV2 receptor protein of FIGS. 7A-7C. Show.

FIGS. 14A-14D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV2 receptor protein of FIGS. 7A-7C. Show.

FIGS. 14A-14D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV2 receptor protein of FIGS. 7A-7C. Show.

FIGS. 14A-14D show regions of similarity between the nucleotide sequence encoding the TR2 receptor protein of FIGS. 1A-1B and the nucleotide sequence encoding the TR2-SV2 receptor protein of FIGS. 7A-7C. Show.

FIGS. 15A-15F show regions of similarity between the nucleotide sequence encoding the TR2-SV1 receptor protein and the nucleotide sequence encoding the TR2-SV2 receptor protein.

15A-15F show regions of similarity between the nucleotide sequence encoding the TR2-SV1 receptor protein and the nucleotide sequence encoding the TR2-SV2 receptor protein.

15A-15F show regions of similarity between the nucleotide sequence encoding the TR2-SV1 receptor protein and the nucleotide sequence encoding the TR2-SV2 receptor protein.

FIGS. 15A-15F show regions of similarity between the nucleotide sequence encoding the TR2-SV1 receptor protein and the nucleotide sequence encoding the TR2-SV2 receptor protein.

FIGS. 15A-15F show regions of similarity between the nucleotide sequence encoding the TR2-SV1 receptor protein and the nucleotide sequence encoding the TR2-SV2 receptor protein.

FIGS. 15A-15F show regions of similarity between the nucleotide sequence encoding the TR2-SV1 receptor protein and the nucleotide sequence encoding the TR2-SV2 receptor protein.

FIG. 16 shows an alignment of the amino acid sequence of the TR2 receptor of FIGS. 1A-1B (SEQ ID NO: 2) with other TNFR family members. The amino acid sequence of TR2 is TNFR-I (SEQ ID NO: 10), TNFR-II (SEQ ID NO: 11)
, CD40 (SEQ ID NO: 12), and 4-1BB (SEQ ID NO: 13) were aligned on the basis of sequence homology and conserved cysteine residues. Cysteine repeat regions are represented by amino acid residues 5-40, 41-84, 85-127 of SEQ ID NO: 2.
, And 128-166, respectively, and the cysteine repeat regions AD
Called.

FIG. 17 shows the effect of TR2 on B cell in vitro proliferation. B lymphocytes were purified from human tonsils by immunomagnetic selection. The cells were cultured for 72 hours, followed by 10% FBS, 4 mM 1-glutamine, 5 × 10 ⁻⁵ M 2ME, 100 U /
ml penicillin, 100 [mu] g / ml streptomycin, and the indicated factors with RPMI1640 medium supplemented with 24 hours and ³ H-thymidine pulse.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 38/00 A61K 45/00 4C086 45/00 48/00 4C087 48/00 A61P 19/02 4H045 A61P 19 / 02 29/00 29/00 35/00 35/00 37/04 37/04 G01N 33/15 Z G01N 33/15 33/50 Z 33/50 33/53 D 33/53 33/566 33/566 33 / 577 B 33/577 C07K 14/715 // C07K 14/715 16/18 16/18 C12P 21/08 C12N 15/09 ZNA A61K 37/02 C12P 21/08 C12N 15/00 ZNAA (31) Priority claim number 60 / 135,169 (32) Priority date May 20, 1999 (May 20, 1999) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 147,383 (32) Priority date August 6, 1999 (August 8, 1999) (33) Countries claiming priority US (US) (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA ( BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS , JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG , US, UZ, VN, YU, ZA, ZW (72) Inventor D, Jian United States 20853, Maryland, Rockville, Manorfield Road 5502 (72) Inventor Rosen, Craig A. United States Maryland 20882, Layton'sville, Rolling Hill Road 22400 (72) Inventor Genz, Reyner El. United States Maryland 20850, Rockville, Mount Prospect Drive 13608 F-term (reference) 2G045 AA40 CB01 DA12 DA13 DA36 DA77 DA78 FB02 FB03 4B024 AA01 AA11 BA63 CA04 DA02 DA06 EA04 EA06 GA11 GA18 GA19 HA12 HA15 4B064 AG27 CA10 DA05 A08 DA14 AA13 AA16 BA01 BA02 BA08 BA22 BA41 CA18 CA53 CA59 DA53 MA02 MA22 MA28 MA32 MA35 MA37 MA43 MA52 MA55 MA56 MA59 MA60 MA63 MA66 NA14 ZA962 ZB092 ZB112 ZB262 4C085 AA13 AA14 AA16 BA99 BB42 CC22 CC23 GG01 MA02 MA02 A02 MA02 MA02 MA37 MA41 MA43 MA52 MA55 MA59 MA60 MA63 MA66 NA14 ZA96 ZB09 ZB11 ZB26 4C087 AA01 AA02 BB48 CA04 MA02 MA17 MA22 MA23 MA28 MA32 MA52 MA55 MA59 MA60 MA63 MA66 NA14 ZA96 ZB09 ZB11 ZB26 4H045 AA10 DA30 DAA30

Claims (40)

[Claims] 1. A method for treating arthritis or inflammation, the method comprising the following: a therapeutically effective amount of the following: (a) an antibody that binds to a polypeptide consisting of amino acids -36 to 247 of SEQ ID NO: 2. A first therapeutic agent; and (b) a second therapeutic agent selected from the group consisting of: (i) a tumor necrosis factor blocking agent; (ii) an immunosuppressant; (iii) an anti-inflammatory agent; Administering to an individual an antimalarial agent; and (v) an antimetabolite agent. 2. The method of claim 1, wherein said first therapeutic agent comprises an antibody that binds to a polypeptide consisting of amino acids 1-164 of SEQ ID NO: 2. 3. The method according to claim 1, wherein said antibody is a monoclonal antibody. 4. The method according to claim 1, wherein said antibody is a polyclonal antibody. 5. The method according to claim 1, wherein said antibody is a chimeric antibody. 6. The method according to claim 1, wherein said antibody is a humanized antibody. 7. The method according to claim 1, wherein said antibody is a single-chain Fv antibody. 8. The method of claim 1, wherein said antibody is a Fab antibody fragment. 9. The method of claim 1, wherein the first therapeutic agent and the second therapeutic agent are administered to the individual at the same time. 10. The method of claim 1, wherein said first therapeutic agent and said second therapeutic agent are administered to said individual at different times. 11. The method according to claim 11, wherein the tumor necrosis factor blocking agent comprises an antibody that binds to a protein selected from the group consisting of: (a) TNF-α; (b) TNF-β; and (c) TNF-γ. The method of claim 1, comprising: 12. The immunosuppressant comprises: (a) cyclosporine; (b) cyclophosphamide; (c) methylprednisone; (d) prednisone; (e) azathioprine; (f) FK-506; 2. The method of claim 1, wherein the method is selected from the group consisting of: (g) 15-deoxyspagarin. 13. The method of claim 1, wherein the antimalarial agent is selected from the group consisting of: (a) hydroxychloroquine; (b) chloroquine; and (c) quinacrine. 14. The method of claim 1, wherein said antimetabolite is methotrexate. 15. A composition comprising: (a) a first therapeutic agent comprising an antibody that binds to a polypeptide consisting of amino acids -36 to 247 of SEQ ID NO: 2; and (b) a group consisting of: A second therapeutic agent selected comprising: (i) a tumor necrosis factor blocking agent; (ii) an immunosuppressant; (iii) an anti-inflammatory agent; (iv) an antimalarial agent; and (v) an anti-metabolite agent. ,Composition. 16. A method for the treatment of arthritis or inflammation, comprising administering to an individual a therapeutically effective amount of the composition of claim 15. 17. The composition of claim 17, further comprising a pharmaceutically acceptable carrier or excipient.
A composition according to claim 15. 18. A method for the treatment of arthritis, comprising administering to an individual a therapeutically effective amount of the composition of claim 17. 19. A method for treating cancer, comprising: (a) an antibody comprising an antibody that binds to a polypeptide consisting of amino acids -36 to 247 of SEQ ID NO: 2. (B) a second therapeutic agent selected from the group consisting of: (i) a chemotherapeutic agent; (ii) an antibiotic; (iii) an antimetabolite agent; and (iv) an immunosuppressant. Administering to an individual. 20. The method of claim 19, wherein said cancer is a B cell lineage related cancer. 21. The method of claim 20, wherein said B cell lineage related cancer is a B cell lymphoma. 22. The method of claim 19, wherein said first therapeutic agent comprises an antibody that binds to a polypeptide consisting of amino acids 1-164 of SEQ ID NO: 2. 23. The method of claim 19, wherein the first therapeutic agent and the second therapeutic agent are administered to the individual at the same time. 24. The method of claim 19, wherein said first therapeutic agent and said second therapeutic agent are administered to said individual at different times. 25. The chemotherapeutic agent is selected from the group consisting of: (a) doxorubicin; (b) bleomycin; (c) daunorubicin; (d) dactinomycin; and (e) mitomycin C. The method according to claim 19. 26. A composition comprising: (a) a first therapeutic agent comprising an antibody that binds to a polypeptide consisting of amino acids -36 to 247 of SEQ ID NO: 2; and (b) a group consisting of: A second therapeutic agent of choice: (i) a chemotherapeutic agent; (ii) an antibiotic; (iii) an antimetabolite agent; and (iv) an immunosuppressive agent. 27. A method for the treatment of cancer, comprising a therapeutically effective amount of a method.
A method comprising administering to the individual a composition according to claim 1. 28. The composition of claim 28, further comprising a pharmaceutically acceptable carrier or excipient.
A composition according to claim 26. 29. A method for the treatment of a cancer, comprising a therapeutically effective amount of a method.
A method comprising administering to the individual a composition according to claim 1. 30. A method for the treatment of cancer, comprising the steps of: (a) connecting amino acids 1 to 2 of SEQ ID NO: 2, covalently linked to the Fc region of an immunoglobulin;
A first therapeutic agent comprising 164; and (b) a second therapeutic agent selected from the group consisting of: (i) a chemotherapeutic agent; (ii) an antibiotic; (iii) an antimetabolite agent; iv) administering to the individual an immunosuppressant. 31. The method of claim 30, wherein said cancer is a B cell lineage-related cancer. 32. The method of claim 31, wherein said B cell lineage related cancer is a B cell lymphoma. 33. The method of claim 30, wherein said first and second therapeutic agents are administered to said individual at the same time. 34. The method of claim 30, wherein said first therapeutic agent and said second therapeutic agent are administered to said individual at different times. 35. A method for treating an immunodeficiency or enhancing a leukocyte response in vivo to an antigen, comprising the steps of: (a) amino acids -36 to SEQ ID NO: 2 of a therapeutically effective amount of: A first therapeutic agent comprising an antibody that binds to a polypeptide consisting of 247; and (b) a second therapeutic agent selected from the group consisting of: (i) a cytokine; (ii) an angiogenic factor; and ( iii) administering fibroblast growth factor to an individual. 36. The method of claim 35, wherein said immunodeficiency is a B cell immunodeficiency. 37. The method of claim 35, wherein said leukocytes are B cells. 38. The method of claim 35, wherein said first therapeutic agent comprises an antibody that binds to a polypeptide consisting of amino acids 1-164 of SEQ ID NO: 2. 39. The method of claim 35, wherein said first therapeutic agent and said second therapeutic agent are administered to said individual simultaneously. 40. The method of claim 35, wherein said first therapeutic agent and said second therapeutic agent are administered to said individual at different times.