JP2003512020A - Tumor necrosis factor receptor 6α and tumor necrosis factor receptor 6β - Google Patents

Abstract

  (57) [Summary] The present invention relates to a novel tumor necrosis factor receptor protein. In particular, isolated nucleic acid molecules encoding human TNFR-6α and TNFR-6β proteins are provided. Also provided are TNFR-6αβ and TNFR-6β polypeptides, as well as vectors, host cells and recombinant methods for producing TNFR-6αβ and TNFR-6β polypeptides. You. The present invention further relates to screening methods for identifying agonists and antagonists of TNFR-6α activity and TNFR-6β activity. Also provided are diagnostic methods for detecting an immune system-related disorder, and therapeutic methods for treating an immune system-related disorder.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to novel human genes that encode polypeptides that are members of the TNF receptor family. More specifically, tumor necrosis factor receptor-6α
And tumor necrosis factor receptor-6β.
Provided is an isolated nucleic acid molecule encoding a human polypeptide, referred to as "TNFR-6α and TNFR-6β" or, generally, "TNFR polypeptide". TNFR polypeptides are also provided, as are vectors, host cells, and recombinant methods for producing them. The invention further relates to screening methods for identifying agonists and antagonists of TNFR polypeptide activity. Further provided are diagnostic and therapeutic methods utilizing such compositions.

BACKGROUND OF THE INVENTION Many biological effects, such as response to specific stimuli and natural biological processes, are controlled by factors such as cytokines. Many cytokines act through the receptor by engaging the receptor and producing an intracellular response.

For example, tumor necrosis factor (TNF) α and β are cytokines that act through the TNF receptor and regulate a number of biological processes, including protection against infection and induction of shock and inflammatory disease. The TNF molecule is "TNF
Belong to the "ligand" superfamily and work with their receptors or counter ligands (the "TNF receptor" superfamily). To date, 9 members of the TNF ligand superfamily have been identified, and 10 members of the TNF receptor superfamily have been identified.
Individual members have been characterized.

Among the ligands, TNF-α, lymphotoxin-α (LT-α, TNF-
also known as β), LT-β (found in the complex heterotrimer LT-α2-β), FasL, CD40L, CD27L, CD30L, 4-lBBL,
OX40 and nerve growth factor (NGF). The TNF receptor superfamily includes p55TNF receptor, p75TNF receptor,
TNF receptor-related protein, FAS antigen or APO-1, CD40, C
D27, CD30, 4-lBB, OX40, low affinity p75 and NGF receptor (Meager, A., Biologicals, 22:29.
1-295 (1994)).

Many members of the TNF ligand superfamily are expressed by activated T cells. This means that these ligands are required for the interaction of T cells with other cell types that underlie cell ontogeny and function (Mea).
Ger, A .; , Above).

[0006] Considerable insight into the key functions of several members of the TNF receptor family has been gained by the identification and generation of mutants that disrupt expression of these proteins. For example, naturally occurring mutations in the FAS antigen and its ligands cause lymphoproliferative disorders (Watanabe-Fukunaga, R.,.
Et al., Nature 356: 314 (1992)), which may be reflected in the failure of programmed cell death. Mutations in the CD40 ligand cause an X-linked immunodeficiency condition characterized by high levels of immunoglobulin M and low levels of immunoglobulin G in plasma, which is defective T cell-dependent B cell activation. (Allen, RC et al., Science 25)
9: 990 (1993)). Targeted mutations of the low-affinity nerve growth factor receptor are associated with defective peripheral structure-sensitive innovations.
(Lee, KF et al.,
Cell 69: 737 (1992)).

TNF and LT-α are associated with two TNF receptors (55kd and 75kd).
TNF receptor). A number of biological effects (acting through their receptors) induced by TNF and LT-α include hemorrhagic necrosis of transplanted tumors, cytotoxicity, endotoxin shock, inflammation, immunomodulation,
Roles in proliferation and antiviral response, as well as protection against the harmful effects of ionizing radiation. TNF and LT-α are involved in the pathogenesis of a wide range of diseases, including endotoxin shock, cerebral malaria, tumors, autoimmune diseases, AIDS and graft host rejection (Beutler, B. and Von Huffel,
C. , Science 264: 667-668 (1994)). Mutations in the p55 receptor cause increased susceptibility to microbial infections.

In addition, the approximately 80 amino acid domain near the C-terminus of TNFR1 (p55) and Fas has been reported as a "death domain," responsible for programmed cell death signaling. (Tartagli
a et al., Cell 74: 845 (1993)). Apoptosis or programmed cell death is an important physiological process for normal development and homeostasis of multicellular organisms (H. Steller, Science 267, 14).
45-1449 (1995)). Disorders of apoptosis contribute to the etiology of several human diseases, including cancer, neurodegenerative disorders and acquired immunodeficiency syndrome (CB
． Thompson, Science 267, 1456-1462 (1995).
)). Recently, due to much interest, two cell surface death receptors (Fas /
Signaling and biological functions of APO-1 and TNFR-1) have been focused (JL Cleveland, JN Ihle, Cell.
81, 479-482 (1995); Fraser, G .; Evan, Cel
85,781-784 (1996); Nagata, P .; Golste
in, Science 267, 1449-56 (1995)). Both T
It is a member of the NF receptor family, which also includes, inter alia, TNFR-2, low affinity NGFR, CD40 and CD30 (C.
A. Smith et al., Science 248, 1019-23 (1990); M.
． Tewari, V .; M. Dixit, Modular Texts in M
olecular and Cell Biology M.D. Purton, H
eldin, Carl (Chapman and Hall, London,
1995)). Family members have been defined by the presence of cysteine-rich repeats in their extracellular domain, but Fas / APO-1 and TNF
R-1 also shares a region of homology within the cell, a well-designated "death domain" (which is slightly associated with the Drosophila suicide gene) (reaper) (P. Golstein, D. Marguet. , V. Depraete
Re, Cell 81, 185-6 (1995); White et al., Scie
nce 264, 677-83 (1994)). This shared death domain suggests that both receptors interact with a related set of signaling molecules that until recently remained unidentified. Activation of Fas / APO-1 recruits a death domain containing the adapter molecule FADD / MORT1 (A.
M. Chinanaiyan, K .; O'Rourke, M .; Tewari, V .; M
． Dixit, Cell 81, 505-12 (1995); P. Bold
in et al. Biol Chem 270, 7795-8 (1995); C
． Kischkel et al., EMBO 14, 5579-5588 (1995)),
This adapter molecule is in turn FLICE / MACH1 (pro-apoptosis (pro
-Apoptotic), which is a member of the ICE / CED-3 family of proteases) and possibly activates (M. Muzio et al., Cell
85, 817-827 (1996); P. Boldin, T .; M. Gon
charov, Y. V. Goltsev, D.M. Wallach, Cell 85
, 803-815 (1996)). While the central role of Fas / APO-1 is to induce cell death, TNFR-1 can signal an array of diverse biological activities, many of which express NF-kB. It results from its ability to activate (LA Tartaglia, DV Goeddel, Immunol T.
Oday 13, 151-3 (1992)). Therefore, TNFR-1 is
Recruit a multivalent adapter molecule TRADD such as D (also containing the death domain) (H. Hsu, J. Xiong, DV Goeddel, Cel
81, 495-504 (1995); Hsu, H .; -B. Shu, M .;
-P. Pan, D.M. V. Goeddel, Cell 84, 299-308 (1
996)). Through its association with many signaling molecules, including FADD, TRAF2, and RIP, TRADD can signal both apoptosis and NF-kB activation (H.Hsu, H.-B.Shu, M. .-P. Pan,
D. V. Goeddel, Cell 84, 299-308 (1996);
Hsu, J .; Huang, H .; -B. Shu, V .; Baichwall, D.M. V.
Goeddel, Immunity 4,387-396 (1996).

The effects of TNF family ligands and TNF family receptors are altered and affect multiple functions (both normal and abnormal) in the biological processes of mammalian systems. Therefore, there is a clear need for the identification and characterization of such receptors and ligands that affect the biological activity of both normal and disease states. In particular, it is necessary to isolate and characterize new members of the TNF receptor family.

SUMMARY OF THE INVENTION The present invention comprises TNFR (ie, a TNFR-6α or TNFR-6β polypeptide) (having the complete amino acid sequences set forth in SEQ ID NOS: 2 and 4, respectively), Or respectively ATCC Deposit No. 97810
And a nucleic acid molecule which comprises, or alternatively consists of, a polynucleotide encoding at least a portion of the complete amino acid sequence (encoded by the cDNA clone of the plasmid DNA deposited as 97809). The deposited TNFR-6α and TNFR-6β clones (which
The nucleotide sequence determined by sequencing FIGS. 1 and 2 (shown in SEQ ID NOS: 1 and 3, respectively) contains open reading frames encoding the complete polypeptide of 300 and 170 amino acid residues, respectively. Respectively,
N at nucleotide positions 25-27 and 73-75 of SEQ ID NOs: 1 and 3
It contains a start codon that encodes a terminal methionine.

The TNFR proteins of the invention share sequence homology with other TNF receptors. Splicing variants of TNFR-6α and TNFR-6β are TNFR
-I and TNFR-II human mRNA translation products (which also contain multiple conserved cysteine-rich domains) (Figure 3) (SEQ ID NOS: 5 and 6, respectively) and a high degree of sequence homology. Show.

The TNFR-6α and TNFR-6β polypeptides each have a putative leader sequence of 30 amino acids; and the putative mature TNFR-6α and TNFR-6.
The amino acid sequences of β-polypeptides are also amino acid residues 31-300 (respectively).
1 and 2 as SEQ ID NO: 2) and 31-170 (SEQ ID NO: 4).

Accordingly, one aspect of the present invention provides an isolated nucleic acid molecule comprising, or alternatively consisting of, a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) A nucleotide sequence encoding a TNFR polypeptide having the complete amino acid sequence of SEQ ID NO: 2 or 4, or ATCC
A nucleotide sequence encoding a TNFR polypeptide as encoded by the cDNA clone contained in accession number 78810 or 97809; (b
) A nucleotide sequence encoding a mature TNFR polypeptide having the amino acid sequence of positions 31-300 in SEQ ID NO: 2 or positions 31-170 in SEQ ID NO: 4, or the cDNA contained in ATCC Deposit No.97810 or 97809.
A nucleotide sequence encoding a mature TNFR polypeptide as encoded by an A clone; (c) positions 31-283 in SEQ ID NO: 2 or SEQ ID NO: 4.
A nucleotide sequence encoding the soluble extracellular domain of a TNFR polypeptide having the amino acid sequence of positions 31 to 166 therein, or ATCC Deposit No. 978.
10 or a nucleotide sequence encoding the soluble extracellular domain of a TNFR polypeptide as encoded by the cDNA clone contained in 97809; (d) positions 31-283 in SEQ ID NO: 2 or positions 31-283 in SEQ ID NO: 4.
A nucleotide sequence encoding a fragment of the TNFR polypeptide having the amino acid sequence of 166, or ATCC Deposit No. 78810 or 97809.
A nucleotide sequence encoding a fragment of a TNFR polypeptide as encoded by the cDNA contained therein, wherein the fragment is TNF.
R-6α and / or TNFR-6β functional activity); and (e) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c) or (d) above.

Further, an embodiment of the present invention is the above (a), (b), (c), (d) and (
at least 90% identical to any nucleotide sequence in e), and more preferably at least 80%, 85%, 90%, 92%, or 95%, 96%, 97.
An isolated nucleic acid molecule comprising, or alternatively consisting of, a polynucleotide having a nucleotide sequence that is%, 98% or 99% identical, or (a), (b), (c), (above). d) or (e) a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide, or alternatively comprises an isolated nucleic acid molecule consisting of these. This hybridizing polynucleotide does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A or T residues. A further nucleic acid embodiment of the invention is a TN having the amino acid sequence in (a), (b), (c) or (d) above.
It relates to an isolated nucleic acid molecule comprising or alternatively consisting of a polynucleotide encoding the amino acid sequence of the epitope-bearing portion of the FR polypeptide.

The present invention also relates to recombinant vectors comprising recombinant nucleic acid molecules of the present invention, by recombinant techniques, and host cells containing the recombinant vectors, as well as methods of making such vectors and host cells, and TNFRs. It relates to polypeptides or their use for the production of peptides.

The invention further provides an isolated TNFR polypeptide comprising an amino acid sequence selected from the group consisting of: (a) a full length TNFR having the complete amino acid sequence set forth in SEQ ID NO: 2 or 4. The amino acid sequence of the polypeptide or A
Amino acid sequence of a full-length TNFR polypeptide as encoded by the cDNA clone contained in TCC Deposit Nos. 97810 or 97809; (b) amino acids at positions 31-300 in SEQ ID NO: 2 or positions 31-170 in SEQ ID NO: 4. Amino acid sequence of mature TNFR polypeptide having sequence or ATCC
The amino acid sequence of the mature TNFR polypeptide as encoded by the cDNA clone contained in Deposit No. 78810 or 97809; (c) the amino acid sequence of positions 31-283 in SEQ ID NO: 2 or positions 31-166 in SEQ ID NO: 4. Or the amino acid sequence of the soluble extracellular domain of the TNFR polypeptide as encoded by the cDNA clone contained in ATCC Deposit No. 78810 or 97809; or (d) Amino acid sequence of a fragment of a TNFR polypeptide having the amino acid sequence of positions 31-283 in SEQ ID NO: 2 or positions 31-166 in SEQ ID NO: 4, or ATCC deposit no.
The amino acid sequence of a fragment of the TNFR polypeptide as encoded by the cDNA clone contained in 809 (wherein the fragment is TNF
R-6α and / or TNFR-6β functional activity).

The polypeptide of the present invention also has at least 80% identity to the amino acid sequence set forth in (a), (b), (c) or (d) above, more preferably at least 85.
% Identical, and even more preferably 90%, 92%, 95%, 96%, 97%
, A polypeptide having an amino acid sequence that is 98% or 99% identical, as well as at least 90% similarity, and more preferably at least 80%, 85%, 90%, 92% or 95% similarity to the above amino acids. It includes a polypeptide having an amino acid sequence.

A further embodiment of this aspect of the invention provides an amino acid sequence of an epitope-bearing portion of a TNFR polypeptide having the amino acid sequence set forth in (a), (b), (c) or (d) above. Including, with respect to peptides or polypeptides. A peptide or polypeptide having an amino acid sequence of the epitope-bearing portion of a TNFR polypeptide of the invention has at least 6 or 7 amino acids, preferably at least 9 amino acids.
Amino acid, and more preferably a portion of a polypeptide having at least about 30 amino acids to about 50 amino acids, but including an epitope-bearing polypeptide up to any length, and the entire amino acid sequence of a polypeptide of the invention described above. Also included in the invention are peptides or polypeptides comprising

In another embodiment, the present invention provides the above (a), (b), (c) or (d).
Provided is an isolated antibody that specifically binds to a TNFR polypeptide having the amino acid sequence set forth in (1). The invention further provides a method of isolating an antibody that specifically binds to a TNFR polypeptide having an amino acid sequence as described herein. Such antibodies are useful diagnostically or therapeutically as described below.

Tumor necrosis factor (TNF) family ligands are known to be the most pleiotropic cytokines, which are associated with many cellular responses (cytotoxicity, antiviral activity, immunomodulatory activity and some (Including transcriptional regulation of genes). The present invention also provides a pharmaceutical composition comprising a TNFR polypeptide, in particular a human TNFR polypeptide, which comprises, for example, infectious diseases including HIV infection, endotoxin shock, cancer, autoimmune disease, host resistance. Graft disease, acute graft rejection, chronic graft rejection, neurodegenerative disorders, myelodysplastic syndrome, ischemic injury (eg ischemic heart injury), toxin-induced liver disease, septic shock, cachexia and anorexia. Can be used for the treatment of Methods of treating an individual in need of a TNFR polypeptide are also provided.

The invention further provides compositions comprising a TNFR polynucleotide or TNFR polypeptide for administration to cells in vitro, cells ex vivo, and cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the composition comprises a TNFR polynucleotide for expressing the TNFR polypeptide in a host organism for treatment of a disease. Particularly preferred in this regard is its expression in human patients for the treatment of dysfunctions associated with aberrant endogenous activity of TNFR polypeptides.

In another aspect, an agonist and antagonist screening assay is provided that includes determining the effect of a candidate compound on a TNFR polypeptide that binds a TNF family ligand. More specifically, the method comprises contacting a TNF family ligand with a TNFR polypeptide and a candidate compound, and the TNFR polypeptide binding to the TNF family ligand is increased or decreased due to the presence of the candidate compound. And the step of measuring Increased binding of TNFR polypeptide over standard binding in this assay indicates that the candidate compound is an agonist of TNFR polypeptide binding activity, and decreased TNFR compared to standard.
FR polypeptide binding indicates that the compound is an antagonist of TNFR polypeptide binding activity.

TNFR-6α and TNFR-6β are expressed in endothelial cells, keratinocytes, normal prostate and prostate tumor tissues. For many disorders of these tissues or cells (especially the immune system), it is significant relative to "standard" TNFR gene expression levels, ie, TNFR expression levels in healthy tissue from individuals without immune system disorders. Higher or lower levels of TNFR gene expression may result in specific tissue (eg, cancerous tissue) or body fluid (eg, cancerous tissue) collected from an individual having such a disorder.
For example, in serum, plasma, urine, synovial fluid and spinal fluid). Therefore,
The present invention provides a diagnostic method useful during the diagnosis of such disorders, which comprises the following steps: (a) assaying the TNFR gene expression level in the cells or body fluids of the individual; (B) Standard TNFR gene expression level and this TNF
Comparing R gene expression levels, whereby increased or decreased assayed TNFR gene expression levels compared to standard expression levels are indicative of immune system impairment.

A further aspect of the invention relates to a method for treating an individual in need of increased levels of TNFR polypeptide activity in the body, the method comprising the step of isolating a therapeutically effective amount of the individual. And the step of administering a composition containing the TNFR polypeptide of the present invention or an agonist thereof.

Yet a further aspect of the present invention relates to a method for treating an individual in need of reduced levels of TNFR polypeptide activity in the body, the method comprising administering to such an individual a therapeutically effective amount of a TNFR antagonist. Administering a composition comprising. A preferred antagonist for use in the present invention is a TNFR-specific antibody.

(Detailed Description) The present invention provides a TNFR-6α polypeptide or a TNFR-6β polypeptide (
Generally, "T" has the amino acid sequences set forth in SEQ ID NOS: 2 and 4, respectively.
NFR polypeptide "), which provides an isolated nucleic acid molecule comprising, or alternatively consisting of, a polynucleotide encoding a NFR polypeptide (determined by sequencing the cloned cDNA). Figures 1 and 2 (SEQ ID NOS: 1 and 3)
The nucleotide sequences shown in are HPHAE52 and HTPCH8, respectively.
4 clones (these were the American Type on November 22, 1996).
eCulture Collection, 10801 University
y Boulevard, Manassas, Virginia 20110-
2209, and deposit numbers ATCC97810 and 978, respectively.
09 was given). The deposited clone is pBluescript SK (-) plasmid (Stratagene, L
a Jolla, CA).

The TNFR-6α and TNFR-6β proteins of the present invention are splice variants that share the same nucleotide and amino acid sequences over the N-terminal 142 residues of each protein. The amino acid sequences of these proteins are approximately 23% similar to the translation product of human TNFR-2 mRNA (FIG. 3) (SEQ ID NO: 6) and share with it multiple conserved cysteine-rich domains. . Importantly, these proteins share substantial sequence similarity across polypeptide sequences containing four repeating cysteine-rich motifs with significant inter-subunit homology. TNFR-2 is thought to exclusively mediate human T cell proliferation by TNF (PCT.
WO / 94/09137).

Nucleic Acid Molecules Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein include an automated DNA sequencer (eg, A
applied Biosystems, Inc. , Foster City, C
D determined using model 373) from A and determined herein
The entire amino acid sequence of the polypeptide encoded by the NA molecule was predicted by translation of the DNA sequence as determined above. Thus, as is known in the art for all DNA sequences determined by this automated approach, any nucleotide sequence determined herein may contain some errors. A nucleotide sequence determined by automated manipulation is typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. Is. The actual array is
It may be more accurately determined by other approaches, including manual DNA sequencing methods well known in the art. Also, as is known in the art, one insertion or one deletion in the determined nucleotide sequence may result in a predicted amino acid sequence encoded by the determined nucleotide sequence It causes a frameshift in the translation of the nucleotide sequence so that it completely differs from the amino acid sequence actually encoded by the sequenced DNA molecule, which frameshift begins at such an insertion or deletion.

By “nucleotide sequence” of a nucleic acid molecule or polynucleotide is intended, for DNA molecules or DNA polynucleotides, the sequence of deoxyribonucleotides, and for RNA molecules or RNA polynucleotides, the sequence of the corresponding ribonucleotides ( A, G, C and U) (each thymidine deoxyribonucleotide (T) in the deoxyribonucleotide sequence specified herein is intended to be replaced by the ribonucleotide uridine (U)).

Information provided herein (eg, FIG. 1 or 2 (SEQ ID NOS: 1 and 3))
Nucleic acid molecule of the invention encoding a TNFR polypeptide using standard cloning and screening procedures (eg m.
Procedure for cDNA cloning using RNA as starting material). As an illustration of the invention, the TNFR-6α clone and TNFR-6
β clones (FIGS. 1 and 2, respectively) were identified in cDNA libraries from the following tissues: endothelial cells, keratinocytes, normal prostate tissue and prostate tumor tissue.

The determined nucleotide sequences of the TNFR cDNAs of FIGS. 1 and 2 (SEQ ID NOS: 1 and 3) are open reading frames encoding proteins of 300 and 170 amino acid residues (FIGS. 1 and 2 (SEQ ID NOS: 1 and 3), respectively). 3) having an initiation codon at nucleotide positions 25-27 and 73-75 of the nucleotide sequence in))
including.

The open reading frames of the TNFR-6α and TNFR-6β genes are TNFR.
-2 shares sequence homology with the translation product of human mRNA to -2, which includes the soluble extracellular domains of residues 31-283 of SEQ ID NO: 2 and residues 31-166 of SEQ ID NO: 4, respectively.

As will be appreciated by those in the art, due to the potential for sequencing errors described above, the correct and complete TNFR polypeptide is encoded by the deposited cDNA, which is approximately 300 amino acids and 170 amino acids. And can be somewhat longer or shorter than this. More generally, the actual open reading frame is more likely in the range of ± 20 amino acids deduced from the N-terminal first methionine codon shown in FIGS. 1 and 2 (SEQ ID NOS: 1 and 3). Can range anywhere from ± 10 amino acids and this first methionine codon is in frame with the translated sequence shown in each respective figure. It is further understood that, depending on the analytical criteria used to identify the various functional domains, the exact "addresses" of the extracellular and transmembrane domains of the TNFR polypeptide are It can be slightly different. For example, the exact location of the extracellular domain or antigenic region in SEQ ID NO: 2 and SEQ ID NO: 4 may vary slightly depending on the criteria used to define that domain and antigenic region ( For example, this address may be "shifted" by about 1 to about 20 residues, more likely about 1 to about 5 residues).
. In any case, the invention further provides a polypeptide having various residues deleted from the N-terminus of the complete polypeptide, as further discussed below,
This includes polypeptides lacking one or more amino acids from the N-terminus of the extracellular domain described herein that make up the soluble forms of the extracellular domain of the TNFR-6α and TNFR-6β proteins. .

The amino acid sequence of the complete TNFR protein includes a leader sequence and mature protein, as set forth in SEQ ID NOs: 2 and 4. More specifically, the present invention relates to T
Nucleic acid molecules encoding mature forms of NFR proteins are provided. Therefore, based on the signal hypothesis, once the transport of growth protein chains across the crude endoplasmic reticulum is initiated, proteins secreted by mammalian cells have a signal or secretory leader sequence, which It is cleaved from the polypeptide, producing a secreted "mature" form of the protein. Even most mammalian and insect cells cleave secreted proteins with the same specificity. However, in some cases the cleavage of the secreted protein is not completely homogeneous and
Give rise to one or more mature species. Furthermore, it has long been known that the cleavage specificity of secreted proteins is ultimately determined by the primary structure of the complete protein, ie that this cleavage specificity is unique to the amino acid sequence of the polypeptide. There is. Accordingly, the present invention provides a mature TNF having the amino acid sequence encoded by the cDNA clone identified as ATCC Deposit No. 78810 or 97809.
A nucleotide sequence encoding an R polypeptide is provided. "CDNA contained in the plasmid deposited under ATCC Deposit No. 78810 or 97809
A "mature TNFR polypeptide having an amino acid sequence encoded by a clone" refers to a mammalian cell (eg, described below) in the complete open reading frame encoded by the human DNA sequence of the clone contained in the deposited vector. Such COS cells) refers to the mature form of the protein produced by expression.

In addition, methods are available to predict whether a protein will have a cleavage site for a secretory leader and its leader sequence. For example, McGeoc
h (Virus Res. 3: 271-286 (1985)) is a complete (
Information from the short N-terminal charged region of the (uncleaved) protein and the subsequent uncharged region is used. von Heinje's method (Nucleic Acids Res.
14: 4683-4690 (1986)), residues around the cleavage site, typically residues -13 to +2, where +1 indicates the amino terminus of the mature protein.
Use information from. The accuracy of cleavage site prediction of known mammalian secretory proteins for each of these methods is in the range of 75-80% (von Heinje).
, Above). However, the two methods do not necessarily make the same putative cleavage site for a given protein.

In this case, the deduced amino acid sequence of the complete TNFR polypeptide was determined by the computer program “PSORT” (Kyoto University, Institute for
Available from Dr. Kenta Nakai of Chemical Research (K. Nakai and M. Kanehisa, Genomics 1
4: 897-911 (1992)), which is a trained system for deducing the cellular location of proteins based on amino acid sequence). The method of McGeoch and von Heinje is incorporated as part of this computational prediction of localization. Analysis of the TNFR amino acid sequence by this program provided the following results: TNFR-6α and TNFR-6β
Encodes a mature polypeptide having the amino acid sequence of residues 31-300 and 31-170 of SEQ ID NOs: 2 and 4, respectively.

In certain preferred embodiments, TNFR-6α and TNFR-6β are
Encodes a mature polypeptide having the amino acid sequence of residues 31-299 and 31-169 of SEQ ID NOs: 2 and 4, respectively.

As indicated, the nucleic acid molecules of the invention may be in the form of RNA (eg, mRNA) or in the form of DNA (eg, obtained by cloning or synthetically produced, cDNA and genomic DNA. May be included). This D
NA may be double-stranded or single-stranded. Single-stranded DNA or single-stranded RNA may be the coding strand (also known as the sense strand) or the non-coding strand (also referred to as the antisense strand).

An "isolated" nucleic acid molecule is a nucleic acid molecule that has been removed from its natural environment, D
NA, or RNA is intended. For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules are recombinant DNA molecules maintained in a heterologous host cell, or in solution (
Partially or substantially) purified DNA molecules are included. An isolated RNA molecule comprises an RNA transcript of the DNA molecule of the invention in vivo or in vitro. However, mixed clonal libraries (eg genomic or cDNA
A library) and nucleic acids contained in clones that have not been isolated from other clones of the library (eg, in the form of a homogeneous solution containing clones without other members of the library). ), Or a chromosome isolated or removed from the cell or cell lysate (eg, “chromosomal transmission” when in karyotype)
) Is not "isolated" for the purposes of the present invention. As discussed further herein, an isolated nucleic acid molecule according to the present invention may be produced naturally, recombinantly or synthetically.

An isolated nucleic acid molecule of the present invention includes a DNA molecule containing an open reading frame (ORF) having initiation codons at positions 25-27 and 73-75 of the nucleotide sequences shown in SEQ ID NOs: 1 and 3, respectively. Is mentioned.

Further included is a DNA molecule comprising the coding sequence for the putative mature TNFR polypeptide set forth at positions 31-300 and 31-170 of SEQ ID NOs: 2 and 4, respectively.

Further included is a DNA molecule comprising the coding sequence for the putative mature TNFR polypeptide set forth at positions 31-299 and 31-169 of SEQ ID NOs: 2 and 4, respectively.

Furthermore, the isolated nucleic acid molecule of the present invention comprises a DNA molecule comprising a sequence which differs substantially from the sequence described above and which, due to the degeneracy of the genetic code, still contains the sequence encoding the TNFR protein. . Of course, the genetic code and species-specific codon preferences are well known to those of skill in the art. Thus, making degenerate variants of the above, eg, optimizing codon expression for a particular host (eg, changing codons in human mRNA to those preferred by a bacterial host such as E. coli). To let)
Are conventional to those skilled in the art.

In another aspect, the invention provides ATCC deposit no. 97810 or 97809.
There is provided an isolated nucleic acid molecule encoding a TNFR polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as. Preferably, this nucleic acid molecule encodes the mature polypeptide encoded by the deposited cDNA clone above.

The present invention further includes the nucleotide sequence shown in Figure 1 or 2 (SEQ ID NO: 1 or 3), or TNFRcDN contained in the above deposited clone.
Provided is an isolated nucleic acid molecule having the nucleotide sequence of A, or a nucleic acid molecule having a sequence complementary to one of the above sequences. Such isolated molecules, especially DNA molecules, are used, for example, as probes for genetic maps by in situ hybridization with chromosomes, and for detecting expression of the TNFR gene in human tissues, for example by Northern blot analysis. It is useful as a probe.

The present invention further relates to nucleic acid molecules encoding portions of the nucleotide sequences described herein as well as fragments of the isolated nucleic acid molecules described herein. In particular, the invention provides a polynucleotide having a nucleotide sequence representing a portion of SEQ ID NO: 1 or 3, which consists of positions 25-924 and 73-582 of SEQ ID NO: 1 and 3, respectively. Further contemplated is a polynucleotide encoding a TNFR polypeptide lacking the amino terminal methionine,
Such polynucleotides are at positions 28-924 and 76-58, respectively.
It has a nucleotide sequence consisting of 2 and showing portions of SEQ ID NOs: 1 and 3. Polypeptides encoded by such polynucleotides are also provided, such polypeptides comprising the amino acid sequences at positions 2-300 and 2-170 of SEQ ID NOs: 2 and 4, respectively.

The invention further provides a nucleic acid molecule having a nucleotide sequence for a broad portion of SEQ ID NOS: 1 and 3, such as: HELDI06R (SEQ ID NO: 17).
And HCEOW38R (SEQ ID NO: 18) relate to both SEQ ID NO: 1 and 3. Preferred are the polynucleotide fragments of SEQ ID NO: 1 and 3, which are not SEQ ID NO: 17 or 18, or neither of the subfragments of SEQ ID NO: 17 or 18. The sequences of HELDI06R and HCEOW38R are shown in FIG.

More generally, the nucleotide sequence of the deposited cDNA or FIG.
A fragment of the isolated nucleic acid molecule having the nucleotide sequence shown in (SEQ ID NO: 1 or 3) has a length of at least about 15 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and still More preferably a fragment of at least 40 nt is contemplated. These fragments have numerous uses, including, but not limited to, diagnostic probes and primers such as those described herein. Of course, long fragments of 50-300 nt in length are also deposited c
Useful according to the invention, as well as DNA or fragments corresponding to most, if not all, of the nucleotide sequences as shown in Figures 1 and 2 (SEQ ID NOS: 1 and 3). Especially preferred is a fragment containing at least 500 nucleotides that is at least 80%, 85%, 90%, 92% or 95% identical to the 500 contiguous nucleotides shown in SEQ ID NO: 1. For example, a cDNA deposited with a fragment that is at least about 20 nt in length.
Or a fragment containing 20 or more contiguous bases from a nucleotide sequence as shown in Figures 1 and 2 (SEQ ID NOS: 1 and 3). In this context, "approximately" means the size specifically mentioned,
And a few (5, 4, 3, 2 or 1) nucleotides at either or both ends, including larger or smaller sizes. Preferred nucleic acid fragments of the present invention include nucleic acids that encode the epitope-bearing portion of the TNFR polypeptide as identified in Figures 4 and 5 and described in more detail below.

Representative examples of TNFR-6α nucleic acid fragments of the present invention include, for example, fragments comprising or consisting of the following sequences: about nucleotide 1 to about nucleotide 25 of SEQ ID NO: 1. About nucleotide 26 to about nucleotide 75, about nucleotide 76 to about nucleotide 114, about nucleotide 1
15 to about nucleotides 162, about nucleotides 163 to about nucleotides 216,
About nucleotide 217 to about nucleotide 267, about nucleotide 268 to about nucleotide 318, about nucleotide 319 to about nucleotide 369, about nucleotide 370 to about nucleotide 420, about nucleotide 421 to about nucleotide 47.
1, about nucleotide 472 to about nucleotide 522, about nucleotide 523 to about nucleotide 573, about nucleotide 574 to about nucleotide 625, about nucleotide 626 to about nucleotide 675, about nucleotide 676 to about nucleotide 714, about nucleotide 715 to about nucleotide 765, About nucleotide 766
To about nucleotide 816, about nucleotide 817 to about nucleotide 867, about nucleotide 868 to about nucleotide 924, about nucleotide 925 to about nucleotide 975, or a complementary strand thereof, or the cDNA contained in the plasmid deposited as ATCC Deposit No. 97810. In this context "about" covers a range specifically stated, and a range greater or smaller by a few (5, 4, 3, 2, or 1) nucleotides at either or both termini. Including.

In a particular embodiment, the nucleic acid fragment of the invention comprises or consists of a polynucleotide sequence encoding the following amino acid residues or a complementary strand thereof: SEQ ID NO: 2 100-150 of
150-200, 200-300, 220-300, 240-300, 250-
300, 260-300, and / or 280-300 amino acid residues. Polynucleotides that hybridize to these polynucleotide fragments are also included in the invention.

Representative examples of TNFR-6β nucleic acid fragments of the invention include, for example, fragments comprising or consisting of the following sequences: about nucleotide 1 to about nucleotide 36 of SEQ ID NO: 3, About nucleotide 37 to about nucleotide 72, about nucleotide 73 to about nucleotide 123, about nucleotide 1
24 to about nucleotide 175, about nucleotide 176 to about nucleotide 216,
About nucleotide 217 to about nucleotide 267, about nucleotide 268 to about nucleotide 318, about nucleotide 319 to about nucleotide 369, about nucleotide 370 to about nucleotide 420, about nucleotide 421 to about nucleotide 47.
1, about nucleotide 472 to about nucleotide 522, about nucleotide 523 to about nucleotide 582, about nucleotide 583 to about nucleotide 622, about nucleotide 623 to about nucleotide 682, about nucleotide 683 to about nucleotide 750, about nucleotide 751 to about nucleotide 800, About nucleotide 801
To about nucleotide 850, about nucleotide 851 to about nucleotide 900, about nucleotide 901 to about nucleotide 950, about nucleotide 951 to about nucleotide 1000, about nucleotide 1001 to about nucleotide 1050, about nucleotide 1051 to about nucleotide 1100, about nucleotide 1101 to about Nucleotide 1150, about nucleotide 1151 to about nucleotide 1200, about nucleotide 1201 to about nucleotide 1250, about nucleotide 1251 to about nucleotide 13000, about nucleotide 1301 to about nucleotide 1350, about nucleotide 1351 to about nucleotide 1400, about nucleotide 1401 to about nucleotide 1450. , About nucleotide 1451 to about nucleotide 1500, about nucleotide 1501 to about Kureochido 1550, about nucleotides 1551～ about nucleotide 1600, from about nucleotide 1601～ about nucleotide 1650, from about nucleotide 1651～ about nucleotide 1667, or its complementary strand, or ATC,
C cDNA contained in the plasmid deposited under C Deposit No. 97809. In this context "about" covers a range specifically stated, and a range greater or smaller by a few (5, 4, 3, 2, or 1) nucleotides at either or both termini. Including.

In a particular embodiment, the nucleic acid fragment of the invention comprises, or consists of, a polynucleotide encoding the following amino acid residues or a complementary strand sequence thereof: Number 4 50-100
, 100-170, 110-170, 130-170, 140-170, 150
~ 170, and / or 160-170 amino acid residues. Polynucleotides that hybridize to these polynucleotide fragments are also included in the invention.

Preferably, the polynucleotide fragment of the present invention encodes a polypeptide demonstrating the functional activity of TNFR-6α and / or TNFR-6β.
Depending on the polypeptide demonstrating "functional activity", complete (full length) or mature TN
By a polypeptide that is capable of exhibiting one or more known functional activities associated with a FR-6α polypeptide and / or a TNFR-6β polypeptide. Such functional activities include biological activity (eg, inhibition or reduction of FasL-mediated apoptosis, inhibition or reduction of AIM-II-mediated apoptosis), antigenicity [anti-TNFR-6α antibody and / or anti-TNFR-6β. Ability to bind antibody (or compete with TNFR-6α and / or TNFR-6β polypeptide for binding)], immunogenicity (TNFR-6α polypeptide and / or
Or the ability to generate antibodies that bind to the TNFR-6β polypeptide), the ability to form multimers with the TNFR-6α and / or TNFR-6β polypeptides of the invention, and the TNFR-6α polypeptide and / or TNF.
Receptors or ligands for R-6β polypeptides (eg, Fas ligand and / or AIM-II (International Application Publication Number WO 97/34911, 1
Published September 25, 997))), but is not limited thereto.

The functional activity of TNFR-6α and / or TNFR-6β polypeptides, and fragments, variants, derivatives, and analogs thereof, can be assayed by a variety of methods.

For example, binding to anti-TNFR-6α and / or anti-TNFR-6β antibodies, or complete (full length) or mature TNFR-6α for binding to anti-TNFR-6α and / or anti-TNFR-6β antibodies. In one embodiment, various immunoassays known in the art can be used to assay the ability to compete with the polypeptide and / or TNFR-6β polypeptide. Such assays include radioimmunoassays, ELISAs (enzyme-linked immunosorbent assays), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (eg gold colloids, enzymes. Or using radioisotope labeling), Western blots, precipitation reactions, agglutination assays (eg gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. Competitive and non-competitive assay systems using various techniques, including but not limited to: In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in immunoassays and are within the scope of the invention.

In another embodiment, when a TNF-ligand is identified (eg Fas ligand and / or AIM-II (International Application Publication No. WO 97/34911, 1,
(Published September 25, 997)), or when the ability of a polypeptide fragment, variant, or derivative of the invention to multimerize is assessed, binding can be achieved, for example, by reducing and non-reducing gel chromatography, protein affinity. Assays can be performed by means well known in the art such as chromatography, as well as affinity blotting. Generally, Phizicky, E .; Et al, Micr
obiol. Rev. 59: 94-123 (1995). In another embodiment, the physiological correlation (signal transduction) of TNFR-6α and / or TNFR-6β binding to its substrate may be assayed.

Further, the assays described herein (see, eg, Examples 7-9).
And other assays known in the art include TNFR-6α polypeptide and / or
Or TNFR-6β polypeptides and fragments, variants, derivatives, and analogs thereof, inhibit or reduce biological activity associated with TNFR-6α and / or TNFR-6β (eg, FasL-mediated apoptosis in vitro or in vivo). Or to inhibit or reduce AIM-II mediated apoptosis in vitro or in vivo) can be routinely applied or modified.

For example, the ability of a TNFR polypeptide of the invention to reduce or block FasL-mediated apoptosis can be assayed using a Fas-expressing T cell line, such as Jurkat. In this assay, J treated with soluble FasL
urkat cells undergo apoptosis. Pretreatment of cells with TNFR and / or TNFR agonists prior to addition of FasL prevents the cells from undergoing apoptosis, and the same concentration of soluble FasL was added to the same concentration of Fas expressing cells as TNFR polypeptide or It produces a reduced level of apoptosis when compared to that observed when contacted in the absence of a TNFR agonist. Alternatively, mixing the FasL protein with TNFR and / or TNFR agonists also blocks the ability of FasL to bind Jurkat cells and mediate apoptosis (see, eg, Example 9).

In contrast, the TNFR antagonists of the present invention block TNFR-mediated inhibition of FasL-mediated apoptosis. Thus, a TNFR antagonist of the invention may be prepared, for example, by combining mature TNFR (which is known to bind FasL), the TNFR antagonist to be tested, and soluble FasL and contacting the combination with a Fas expressing cell line. Can be assayed by. TNFR
Antagonists reduce or block TNFR-mediated inhibition of FasL-mediated apoptosis. Therefore, mature TNFR, TNFR antagonist and soluble F
Fas-expressing T cells contacted with asL show elevated levels of apoptosis when compared to the same concentration of Fas-expressing cells contacted with the same concentration of mature TNFR and FasL in the absence of a TNFR antagonist.

Apoptosis can be measured, for example, by increased staining with Annexin, which selectively binds apoptotic cells. In another example, a decrease in cell number due to apoptosis can be detected by a decrease in ALOMER blue staining that detects viable cells.

[0061]   Other methods are known to those of skill in the art and are within the scope of this invention.

In a further embodiment, the polynucleotide of the invention encodes a functional attribute of TNFR-6α and / or TNFR-6β. Preferred embodiments of the invention in this regard are TNFR-6α polypeptides and / or TNFR-
Α-helix and α-helix forming region of 6β polypeptide (“α region”)
), Β-sheets and β-sheet forming areas (“β areas”), turns and turn forming areas (“turn areas”), coils and coil forming areas (“coil areas”).
, Hydrophilic regions, hydrophobic regions, α-amphipathic regions, β-amphipathic regions, flexible regions, surface-forming regions, and highly antigenic indicator regions.

Certain preferred regions in this regard are shown in FIG. 4 (Table I) and FIG. 5 (Table II). The data presented in Figures 4 and 5, and the data presented in Tables I and II, respectively, were obtained using the amino acid sequence of SEQ ID NO: 2 and the amino acid sequence of SEQ ID NO: 4, using the default parameters of the DNA * STAR computer algorithm. It only presents a different form of the same result that would be obtained if

As the preferable region described in FIG. 4 (Table I) and FIG. 5 (Table II), there are:
And regions of the type described above, which are identified by analysis of the amino acid sequence shown in Figure 2 and are not limited thereto. As shown in Figure 4 (Table I) and Figure 5 (Table II), such preferred regions include: Garnier-
Robson's α-region, β-region, turn region, and coil region, Chou
-Fasman α-region, β-region, and coil region, Kyte-Dool
Hydrophilic region of title, α-amphipathic region and β-amphipathic region of Eisenberg, flexible region of Karplus-Schulz, surface formation region of Emini, and Jameson-Wolf region with high antigenicity index. In this respect,
Among the highly preferred polynucleotides of the invention are some structural features of TNFR-6_ and / or TNFR-6β (eg some of the above features (
For example, there is a polynucleotide that encodes a polypeptide that includes the regions that combine 1, 2, 3 or 4)).

In addition, the data presented in columns VIII, IX, XIII, and XIV of Tables I and II are routinely used to determine regions of TNFR-6_ that indicate a likely degree of antigenicity. Can be done. Regions of high antigenicity are selected in column VI by selecting values that present regions of the polypeptide that appear to be exposed on the surface of the polypeptide in an environment where antigen recognition may occur in the process of initiation of the immune response.
Determined from data presented in II, IX, XIII, and / or XIV.

[0066]

[Table 1]

[0067]

[Table 2]

[0068]

[Table 3]

[0069]

[Table 4]

[0070]

[Table 5]

[0071]

[Table 6]

[0072]

[Table 7]

[0073]

[Table 8]

[0074]

[Table 9] Further preferred nucleic acid fragments of the present invention comprise or consist of nucleic acid molecules encoding one or more of the epitope-bearing portions of TNFR-6α and / or TNFR-6β. In particular, such nucleic acid fragments of the invention are
A nucleic acid molecule encoding the following: SEQ ID NO: 2 from about Phe-57 to about Thr-
117, about Cys-132 to about Thr-175, about Gly-185 to about Thr-
194, about Val-205 to about Asp-217, about Pro-239 to about Leu-.
H.264, and / or a polypeptide comprising or consisting of amino acid residues from about Ala-283 to about Pro-298. In a further embodiment, the nucleic acid fragment of the invention is about Ala-31 to about Thr-46 in SEQ ID NO: 4.
, About Phe-57 to about Gln-80, about Glu-86 to about His-106, about T.
HR-108 to about Phe-119, about His-129 to about Val-138, and / or about Gly-142 to about Pro-166, comprising a nucleic acid molecule encoding one or more of the epitope-bearing portions of TNFR-6β. Or consist of these.
In this context, "about" a range specifically recited and a range greater than or less than a few (5, 4, 3, 2, or 1) amino acids at either or both termini. including. These polypeptide fragments possess antigenic epitopes of the TNFR-6α and TNFR-6β polypeptides, respectively, by analysis of the Jameson-Wolf antigenic index, as shown in Figures 4 and 5 above. Has been decided. Furthermore, TNF
Polypeptide fragments harboring the antigenic epitopes of R-6α and / or TNFR-6β can be prepared by using the Jameson as shown in FIGS. 4 and 5 above.
Using the above analysis of the-Wolf Antigenicity Index, it can be easily determined by the person skilled in the art. Methods for determining other such epitope-bearing portions of TNFR-6α and / or TNFR-6β are described in detail below.

In a particular embodiment, the nucleic acid of the invention is 100,000 kb, 50,000 k
b, 10000 kb, 1000 kb, 500 kb, 400 kb, 350 kb, 3
00 kb, 250 kb, 200 kb, 175 kb, 150 kb, 125 kb, 1
00 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb, 20 kb, 1
It is less than 5 kb, 10 kb, 7.5 kb, or 5 kb in length.

In a further embodiment, the nucleic acid of the invention has at least 15, at least 30, at least 50, at least 100, or at least 250, at least 500, or at least 1000 contiguous nucleotides of the TNFR coding sequence. 1000 kb, 500 k, including, but flanking the 5'or 3'coding nucleotide sequence set forth in Figure 1 (SEQ ID NO: 1) or Figure 2 (SEQ ID NO: 3).
b, 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb,
It consists of genomic DNA of 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, or 5 kb or less. In a further embodiment, the nucleic acid of the invention comprises at least 15, at least 30, at least 50, at least 100, or at least 250, at least 500, or at least 1000 contiguous nucleotides of a TNFR coding sequence. Does not include all or part of any TNFR intron. In another embodiment, the nucleic acid comprising the TNFR coding sequence is a genomic flanking gene (ie, 5'to the TNFR gene in the genome.
Flanking or 3'side) coding sequences are not included. In other embodiments, the nucleic acids of the invention are 1000, 500, 250, 100, 50, 25, 20,
It does not contain the coding sequence of more than 15, 10, 5, 4, 3, 2, or 1 genomic flanking genes.

In another aspect, the invention relates to a nucleic acid molecule of the invention as described above (eg, a cDNA contained in a deposited plasmid such as ATCC Deposit No. 97810 or 97809) under stringent hybridization conditions. Provided is an isolated nucleic acid molecule that comprises or consists of a portion of a polynucleotide, or a polynucleotide that hybridizes to a fragment of the polynucleotide sequence disclosed in Figure 1 and / or Figure 2. “Stringent hybridization conditions” means 50% formamide, 5 × SSC (750 mM
NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH
7.6), 5 × Denhardt's solution, 10% dextran sulfate, and 20 μg / m
l Incubation in a solution containing denatured sheared salmon sperm DNA at 42 ° C. overnight, followed by washing the filters in 0.1 × SSC at about 65 ° C.

A polynucleotide that hybridizes to a “portion” of a polynucleotide is at least about 15 nucleotides (nt), and more preferably at least about 20 n.
A polynucleotide (either DNA or RNA) that hybridizes to a reference polynucleotide of t, even more preferably at least about 30 nt, and even more preferably about 30-70 (eg, 50) nt is contemplated. These include, but are not limited to, use as diagnostic probes and primers, discussed above and in more detail below.

A portion of a polynucleotide that is “at least about 20 nt in length” is, for example, a reference polynucleotide (eg, the deposited cDNA or the nucleotide sequence shown in FIG. 1 or 2 (SEQ ID NO: 1 or 3)). 2 from the nucleotide sequence
0 or more consecutive nucleotides are intended. In this context, "about" means a number (5, 4,
3, 2, or 1) nucleotides larger or smaller in size. Of course, a polynucleotide that hybridizes only to a poly A sequence (eg, the 3'terminal poly (A) range of a TNFR cDNA), or a complementary stretch of T (or U) residues, is Not included in the polynucleotides of the invention used to hybridize to portions of the nucleic acids of the invention. Because such a polynucleotide hybridizes to any nucleic acid molecule comprising a poly (A) stretch or its complement (eg, in particular any double-stranded cDNA clone generated using oligo dT as a primer). Because it soybeans.

As shown, the nucleic acid molecule of the present invention encoding a TNFR polypeptide is, by itself, a nucleic acid molecule encoding the amino acid sequence of the mature polypeptide; and the mature polypeptide and additional sequences (eg about 26 A coding sequence for a leader or secretory sequence of ~ 35 amino acids (eg, a sequence encoding a pre-, or pro-, or pre-pro-protein sequence); mature with or without the additional coding sequences described above. It may include, but is not limited to, a polypeptide coding sequence.

Additional non-coding sequences (eg, introns and non-coding 5 ′ and 3 ′ sequences (eg, transcription, transcribed non-playing roles in mRNA processing (eg, ribosome binding and mRNA stability)). Translation sequences (including splicing and polyadenylation signals); Additional coding sequences that encode additional amino acids (eg, coding sequences that provide additional functionality)
(Including but not limited to) the above protein sequences are also encoded by the nucleic acids of the invention.

Thus, the sequence encoding the polypeptide may be fused to a marker sequence (eg, a sequence encoding a peptide that facilitates purification of the fusion polypeptide).
In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexahistidine peptide, such as the pQE vector (QIAGEN), among others.
, Inc. , 9259 Eton Avenue, Chatsworth, CA
, 91311), many of which are commercially available.
Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821.
For example, hexahistidine provides convenient purification of the fusion protein, as described in -824 (1989). The "HA" tag is another peptide useful for purification that corresponds to an epitope from the influenza hemagglutinin protein, which is described by Wilson et al., Cell 37: 767 (1984). As discussed below, other such fusion proteins have the N
Alternatively, it comprises TNFR-6α or TNFR-6β fused to Fc at the C-terminus.

The present invention further relates to variants of the nucleic acid molecules of the invention, which variants encode proteins, analogs or derivatives of TNFR polypeptides. Variants may exist naturally as naturally occurring allelic variants. By "allelic variant" is intended one of several alternative forms of a gene that occupy a given locus on the chromosome of an organism. Genes II, Lewin, B.M. Edited by John Wiley & Sons,
New York (1985). Non-naturally occurring variants may be derived from mutagenesis techniques known in the art (oligonucleotide-mediated mutagenesis, alanine scanning, PC
R mutagenesis, site-directed mutagenesis (see, eg, Carter et al., Nucl. Aci).
ds Res. 13: 4331 (1986); and Zoller et al., Nucl.
． Acids Res. 10: 6487 (1982)), cassette mutagenesis (see, eg, Wells et al., Gene 34: 315 (1985)), limited selective mutagenesis (eg, Wells et al., Philos. Tran).
s. R. Soc. London SerA 317: 415 (1986)), but is not limited thereto).

Accordingly, the invention also relates to one or more amino acids deleted, added, or substituted to produce a TNFR polypeptide that is better adapted for expression, scale-up, etc. in a selected host cell. Variants of TNFR having residues (eg, derivatives and analogs) are included. For example, a cysteine residue can be deleted or replaced with another amino acid residue to eliminate a disulfide bridge; eg, an N-linked glycosylation site can be hyperglycosylated at the N-linked site. Can be modified or eliminated to achieve homogeneous product expression that is more easily recovered and purified from known yeast hosts. To this end, the TNFR of the invention
Various amino acid substitutions at one or both of the first amino acid position or the third amino acid position on any one or more glycosylation recognition sequences in the polypeptide, and / or any one or more such recognition sequences Amino acid deletions at the second position of TNFR prevent glycosylation of TNFR with modified tripeptide sequences (eg,
Miyajimo et al., EMBO J. et al. 5 (6): 1193-1197). Further, one or more amino acid residues (eg, arginine and lysine residues) of the polypeptides of the invention may be eliminated to eliminate unwanted processing by proteases (eg, furin or kexin).
It may be deleted or replaced by another residue. For example, carboxy terminal TNFR
Polypeptides of the invention, including polypeptide sequences, have amino acid residues corresponding to the arginine residues at positions 290 and / or 295 of SEQ ID NO: 2 that have been deleted or replaced with another residue. Can have.

Variants of the present invention include variants produced by nucleotide substitutions, deletions or additions. The substitution, deletion or addition can include one or more nucleotides. The variant may be altered in the coding regions, non-coding regions, or both. Changes in the coding regions may result in conservative or non-conservative amino acid substitutions, deletions or additions. Particularly preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the TNFR polypeptide or portions thereof. Conservative substitutions are also particularly preferred in this regard.

A mature protein having the amino acid sequence set forth in SEQ ID NOs: 2 and 4, or the mature TN encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97810 or ATCC Deposit No. 97809.
Highly preferred are nucleic acid molecules that encode FR polypeptide sequences.

A further embodiment is by: (a) a cDNA clone contained in a plasmid encoding a TNFR polypeptide having the complete amino acid sequence of SEQ ID NO: 2 or 4, or deposited as ATCC Deposit No. 97810 or 97809. A nucleotide sequence as encoded; (b) a mature T having the amino acid sequence at positions 31-300 or 31-170 in SEQ ID NO: 2 or 4, respectively.
Nucleotide sequence as encoded by the cDNA clone encoding the NFR polypeptide or contained in the plasmid deposited as ATCC Deposit No. 97810 or 97809; (c) 31 of SEQ ID NOS: 2 and 4, respectively.
A nucleotide sequence encoding the soluble extracellular domain of a TNFR polypeptide having amino acid sequences at positions -283 and 31-166; (d) encoding a fragment of TNFR polypeptide having the complete amino acid sequence in SEQ ID NO: 2 or 4? , Or the nucleotide sequence as encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 78810 or 97809, wherein the fragment is the functional activity of TNFR-6α and / or TNFR-6β. A nucleotide sequence having a functional activity of; and (e) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c) or (d) above. Polynucleotides Nucleotide sequences that are at least 90% identical, and more preferably at least 80%, 85%, 90%, 92%, or 95%, 96%, 97.
%, 98%, or 99% polynucleotides having nucleotide sequences that are identical, or isolated nucleic acid molecules that consist of these polynucleotides. The polypeptides encoded by these polynucleotides are also encompassed by the present invention.

A further embodiment of the invention is at least 90% identical to any of the nucleotide sequences of (a), (b), (c), (d) or (e) above, more preferably at least 80. %, 85%, 90%, 92%, or 95%, 96%, 97%
, A polynucleotide having a nucleotide sequence which is 98% or 99% identical,
Alternatively, under stringent hybridization conditions, the above (a), (b
), (C), (d) or (e), the isolated nucleic acid molecule comprising a polynucleotide that hybridizes to the polynucleotide. This hybridizing polynucleotide does not hybridize to a polynucleotide having a nucleotide sequence consisting of only A residues or T residues under stringent hybridization conditions. Further nucleic acid embodiments of the present invention are (a), (b) above.
, (C), (d) or (e), the isolated nucleic acid molecule comprising or consists of a polynucleotide encoding the amino acid sequence of the epitope-bearing portion of the TNFR polypeptide.

A nucleotide sequence of a polynucleotide is, for example, a reference nucleotide in which the nucleotide sequence encodes a TNFR polypeptide, such as a polynucleotide having a nucleotide sequence that is at least 95% “identical” to a reference nucleotide sequence that encodes a TNFR polypeptide. It is intended to be identical to the reference sequence except that it may contain up to 5 point mutations per 100 nucleotides of sequence respectively. In other words, the reference nucleotide sequence contains at least 80%, 8
Up to 5% of the nucleotides in the reference sequence may be deleted or replaced by another nucleotide in order to obtain a polynucleotide having a nucleotide sequence of 5%, 90%, 92% or 95% identical, Alternatively up to 5% of all nucleotides in the reference sequence can be inserted in the reference sequence.
These variations of the reference sequence may be dispersed either at the 5'or 3'terminal positions of the reference nucleotide sequence or at the nucleotides in the reference sequence, either individually or in one or more contiguous groups within the reference sequence, It can occur anywhere between these terminal parts. This reference sequence is the entire TNFR-6α shown in FIG. 1 (SEQ ID NOS: 1 and 2) and FIG. 2 (SEQ ID NOS: 3 and 4) as described herein.
And / or may be the entire TNFR-6β coding sequence, or any fragment, variant, derivative or analog thereof.

As a practical matter, any particular nucleic acid molecule can be used, for example, for at least the nucleotide sequence shown in FIG. 1 or 2 or at least for the nucleotide sequence contained in one or both of the deposited cDNA clones. 90%, 95%, 96%,
Whether 97%, 98%, or 99% identical is determined by known computer programs (eg, Bestfit program (Wisconsin Se).
sequence Analysis Package, Version 8 fo
r UNIX (registered trademark), Genetics Computer Group
, University Research Park, 575 Science
e Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman to find the best segment of homology between two sequences (Advances in Applied Mathematics 2:
482-489 (1981)). Using Bestfit or any other sequence alignment program, a particular sequence is compared to a reference sequence according to the invention, eg, 95
When determining% identity, it is understood that percent identity is calculated over the entire length of the reference nucleotide sequence, and gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are acceptable. Parameters are set as described above. The reference sequence (query sequence) is the entire TNFR or TNFR-6α polynucleotide fragment encoding the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1), FIG. 2 (SEQ ID NO: 3), as described herein. And / or a TNFR-6β polynucleotide fragment (eg, a polynucleotide encoding an amino acid sequence of any of the N- or C-terminal deletions described herein), variants, derivatives, or analogs.

In certain embodiments, the identity between the reference (query) sequence (sequence of the invention) and the subject sequence (also referred to as overall sequence alignment) is determined by the algorithm of Brutlag et al. (Comp. App. Biosci). . 6: 237-245 (1990)).
It is determined using the FASTDB computer program based on. The preferred parameters used in the FASTDB alignment of DNA sequences to calculate% identity are: Matrix = Unitary, k-tuple = 4, Mi.
smatch Penalty = 1, Joining Penalty = 30,
Randomization Group Length = 0, Cutoff
Score = 1, Gap Penalty = 5, Gap Size Penal
ty = 0.05, Window Size = 500 or the length of the nucleotide sequence of interest (whichever is shorter). According to this embodiment, the subject sequence is 5
When shorter than the query sequence due to the'or 3'deletions (not because of internal deletions), the FASTDB program calculates percent identity as:
Manual corrections are made to the results, taking into account the fact that the 5'and 3'truncations of the subject sequence are not considered. 5'end or 3 compared to the query sequence
For a subject sequence that is'truncated, the percent identity is calculated as the number of bases in the query sequence that are 5'or 3'of the subject sequence, unmatched / unaligned, as a percentage of the total bases in the query sequence. It is corrected by doing. The determination of whether nucleotides are matched / aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the FASTDB program above using the designated parameters to arrive at the final percent identity score. This corrected score is
It is used for the purpose of this embodiment. Only bases outside the 5'and 3'bases of the subject sequence that are not matched / aligned with the query sequence are calculated for the purpose of manually adjusting the percent identity score as shown in the FASTDB alignment. For example, a 90 base subject sequence is aligned with a 100 base query sequence to determine percent identity. The deletion occurs at the 5'end of the subject sequence, so the FASTDB alignment does not show a match / alignment of the first 10 bases at the 5'end.
Ten unpaired bases represent 10% of the sequence (number of bases at the unmatched 5'and 3'ends / total number of bases in the query sequence), so 10% of the F
Subtracted from the percent identity score calculated by the ASTDB program. If the remaining 90 residues were perfectly matched, the final percent identity would be 9
It is 0%. In another example, a 90 residue subject sequence is compared to a 100 base query sequence. In this case, the deletion is an internal deletion, so there are no bases at the 5'or 3'end of the subject sequence that are not matched / aligned with the query sequence. In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only the 5'and 3'end bases of the subject sequence that are not matched / aligned with the query sequence are manually corrected. No other manual correction is made for the purposes of this embodiment.

The present application also relates to the nucleic acid sequences shown in Figure 1 or Figure 2 (SEQ ID NO: 1 or 3), whether or not they encode a polypeptide having a functional activity of TNFR, the deposit Nucleic acid sequence of the cDNA and / or otherwise disclosed herein (eg, the N-terminal deletion and / or C disclosed herein).
A nucleic acid sequence encoding a polypeptide having a truncated amino acid sequence (eg, a nucleic acid molecule encoding amino acids Val-30 to His-300 of SEQ ID NO: 2)
At least 90%, 95%, 96%, 97%, 98%, or 99%
Nucleic acid molecules that are identical. This means that even if a particular nucleic acid molecule does not encode a polypeptide having TNFR functional activity, one of skill in the art would know how to use the nucleic acid molecule, eg, as a hybridization probe or polymerase chain reaction (PCR) primer. The reason is that I understand. TN
Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having FR functional activity include, among others: (1) TN in a cDNA library.
Isolation of the FR gene or allelic variants thereof; (2) In situ hybridization to metaphase chromosome spreads (eg, "FISH") to provide the correct chromosomal location of the TNFR gene (Verma et al., Human C.
homosomes: A Manual of Basic Techniq
ues, Pergamon Press, New York (1988)); and (3) Northern blot analysis to detect TNFR mRNA expression in specific tissues.

However, the nucleic acid sequence shown in FIG. 1 or 2 (SEQ ID NO: 1 or 3), or A
The nucleic acid sequence of a cDNA clone contained in a plasmid otherwise deposited as TCC Deposit No. 97810 or ATCC Deposit No. 97809, and / or otherwise disclosed herein (eg, herein). Encoding a polypeptide having a disclosed N-terminal and / or C-terminal deleted amino acid sequence) at least 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence Preferred is a nucleic acid molecule having a sequence which is in fact a nucleic acid molecule encoding a polypeptide having the functional activity of a TNFR (ie TNFR-6α and / or TNFR-6β) protein. By "a polypeptide having a functional activity of TNFR", TNFR-6α and / or TN of the present invention
A polypeptide exhibiting an activity similar to, but not necessarily identical to, the activity of the FR-6β protein (eg, complete (full length), mature and extracellular domains, as measured in a particular immunoassay or biological assay). ) Is intended. For example, TNFR-6α and / or TNFR-6β activity is TNFR-
The 6α and / or TNFR-6β polypeptide is a TNFR-6α and / or TNFR-6β ligand (eg, Fas Ligand and / or AI).
M-II (International Application Publication No. WO 97/34911 (published September 25, 1997)), and can be measured by determining its ability to bind. In another example, the functional activity of TNFR-6α and / or TNFR-6β determines the ability of a polypeptide (eg, a cognate ligand that is free or expressed on the cell surface) to induce apoptosis. It is measured by

TNF family ligands are TNFR-6α and TNFR-6β of the present invention.
It induces various cellular responses by binding to TNF-family receptors, including Cells expressing the TNFR protein are believed to have a strong cellular response to TNFR-I receptor ligands, including B lymphocytes (
CD19 +), both CD4 and CD8 + T lymphocytes, monocytes, and endothelial cells. By "cellular response to a TNF-family ligand" is intended any genotype, phenotype, and / or morphological change to a cell, cell line, tissue, tissue culture, or patient, which refers to the TNF-family. Induced by ligand. As shown, such cellular responses include TNF-
Also included are normal physiological responses to family ligands, as well as increased cell proliferation, such as by inhibition of apoptosis, or diseases associated with increased inhibition of cell proliferation.

Screening assays for the above are known in the art. One such screening assay is, for example, Science 246: 1.
81-296 (October 1989), cells expressing the receptor (eg, transfected CHO cells) in a system for measuring changes in extracellular pH caused by receptor activation. Including use. For example, a TNF-family ligand may be contacted with cells expressing a mature form of a receptor polypeptide of the invention and a second messenger response (eg, signal Transformation or pH change) can be measured.

Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art would appreciate ATCC Deposit No. 978.
At least 90%, 95%, 9 to the nucleic acid sequence of the cDNA deposited as 10 or 97809, or the nucleic acid sequence shown in Figure 1 or 2 (SEQ ID NOS: 1 and 3).
It is immediately recognized that many nucleic acid molecules having sequences that are 6%, 97%, 98%, or 99% identical encode polypeptides that "have TNFR protein activity." In fact, this is obvious to a person skilled in the art, even without having to carry out the comparative assay described above, since all of the degenerate variants of these nucleotide sequences encode the same polypeptide. It is further recognized in the art that for such nucleic acid molecules that are not degenerate variants, a reasonable number also encodes a polypeptide having TNFR protein activity. This can be accomplished by one of skill in the art, as described further below, either with or without the possibility of significantly affecting the function of the protein, such as one aliphatic substitution. Substitution of the second aliphatic amino acid for an amino acid) is sufficiently known.

Vectors and Host Cells The present invention also includes vectors containing the isolated nucleic acid molecules of the present invention, genetically engineered with recombinant vectors or otherwise engineered to produce the polypeptides of the present invention. Host cells and the production of TNFR polypeptides or fragments thereof by recombinant techniques.

In one embodiment, the polynucleotide of the invention is a vector (eg,
Cloning vector or expression vector). The vector can be, for example, a phage vector, a plasmid vector, a viral vector or a retroviral vector. Retroviral vectors can be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells. Generally, plasmid vectors are introduced in a precipitate, such as a calcium phosphate precipitate, or in complex with a charged lipid. If the vector is a virus, the vector can be packaged in vitro using a suitable packaging cell line and then transduced into host cells.

In general, recombinant expression vectors include origins of replication and selectable markers that allow for transformation of the host cell (eg, the E. coli ampicillin resistance gene and S.
． cerevisiae TRP1 gene), as well as promoters from highly expressed genes that direct transcription of downstream structural sequences. Such promoters include glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) among others.
), A-factor, acid phosphatase, or heat shock protein transcription encoding operons. The expression construct further comprises a site for transcription initiation, a site for transcription termination, and a ribosome binding site for translation in the transcribed region. The coding portion of the transcript expressed by the construct is preferably
It includes a translation initiation codon at the beginning of the translated polypeptide and a stop codon appropriately located at the end of the translated polypeptide (UAA, UGA or UAG). Heterologous structural sequences are assembled in appropriate phase with translation initiation and termination sequences, and, preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein that includes an N-terminal identification peptide that confers the desired characteristics, such as stabilization of the expressed recombinant product or simplified purification.

[0100] In one embodiment, the DNA of the present invention is, for example, a phage λPL promoter, E. coli, to name a few. E. coli lac, trp, phoA, and tac promoters, SV40 early and late promoters, and promoters of retroviral LTRs, as well as suitable heterologous regulatory elements (eg, promoters or enhancers). Other suitable promoters are known to those of skill in the art.

As indicated, the expression vector preferably contains at least one selectable marker. Such markers include dihydrofolate reductase, G418, or neomycin resistance for eukaryotic cell culture, and E. coli. coli
For culturing in and other bacteria, a tetracycline resistance gene, a kanamycin resistance gene, or an ampicillin resistance gene can be mentioned. Representative examples of suitable hosts include bacterial cells (eg, E. coli cells, Streptomy).
ces cells, and Salmonella typhimurium cells); fungal cells (eg, yeast cells); insect cells (eg, Drosophila S2 cells and Spodoptera Sf9 cells); animal cells (eg, CHO cells, COS cells, 293 cells, and Bowes melanoma cells) ); As well as plant cells, but is not limited thereto. Appropriate culture mediums and conditions for the above-described host cells are known in the art.

The host cell can be a higher eukaryotic cell (eg, a mammalian cell (eg, a cell of human origin)) or a lower eukaryotic cell (eg, a yeast cell), or
The host cell can be a prokaryotic cell (eg, a bacterial cell). A host strain may be chosen which modulates the expression of the inserted gene sequences, or modifies and processes the gene product in the specific fashion desired. Expression from a particular promoter can be increased in the presence of a particular inducer. Thus, expression of the genetically engineered polypeptide can be regulated. Moreover, different host cells have unique and specific mechanisms for translational and translational modification of proteins and post-translational processing and modification (eg, phosphorylation, cleavage). Appropriate cell lines can be chosen to ensure the desired modification and processing of the foreign protein expressed. Selection of the appropriate vector and promoter for expression in a host cell is a well known procedure, and the necessary techniques for constructing an expression vector, introduction of the vector into the host, and expression in the host are known to those of skill in the art. Idiomatic.

Useful expression vectors for use in bacteria contain a structural DNA sequence encoding the desired protein together with appropriate translation initiation and termination signals in a reading phase operable with a functional promoter. Constructed by inserting. The vector contains one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and, if desired, to effect amplification in the host. Suitable prokaryotic hosts for transformation include E. coli. coli, Bacillus
subtilis, Salmonella typhimurium, and Pseudomonas, Streptomyces, and Staphyl.
Various species within the genus Ococcus are mentioned, but other hosts may also be used as a matter of choice. By way of example, but not limitation, expression vectors useful for bacterial use include the well known cloning vector pBR322 (ATCC370).
A selection marker and an origin of replication, which are derived from a commercially available plasmid containing the genetic element of 17), may be included. Examples of such a commercial vector include pKK22
3-3 (Pharmacia Fine Chemicals, Uppsala
, Sweden) and GEM1 (Promega Biotec, Madis)
on, WI, USA). These pBR322 "backbone" compartments are combined with a suitable promoter and the structural sequence to be expressed. Among the preferred vectors for use in bacteria, pHE4-5 (ATCC Accession No. 209311; and variants thereof), pQE70, pQE60 and pQE-.
9 (available from QIAGEN, Inc., supra); pBS vector, Phase.
script vector, Bluescript vector, pNH8A, pNH1
6a, PNH18A, pNH46A (available from Stratagene); and ptrc99a, pKK223-3, pKK233-3, pDR540, p.
RIT5 (available from Pharmacia). Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG (available from Stratagene); and pSVK3, pB.
There are PV, pMSG and pSVL (available from Pharmacia). Other suitable vectors will be readily apparent to those of skill in the art.

After transformation of the appropriate host strain and growth of the host strain to the appropriate cell density, the selected promoter is induced by appropriate means (eg temperature shift or chemical induction) and the cells Incubate for a further period. Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells used for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, and such methods. Are well known to those skilled in the art.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancer is D
A cis-acting element of NA (usually about 10-300 bp that acts on a promoter to increase its transcription). Examples include the SV40 enhancer on the late side of the replication origin of bp 100-270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer.

Various mammalian cell culture systems can also be used to express recombinant protein. Examples of mammalian expression systems include monkey kidney fibroblast COS-7 strain (G
luzman, Cell 23: 175 (1981)), and other cell lines capable of expressing compatible vectors (eg, C127, 3T3, CHO).
, HeLa and BHK cell lines). Mammalian expression vectors include origins of replication, suitable promoters and enhancers, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5'flanking nontranscribed sequences. DNA sequences from the SV40 splice and polyadenylation sites can be used to provide the required nontranscribed genetic elements.

Introduction of vector constructs into host cells can be effected by techniques known in the art including methods of calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid mediated transfection, electroporation. , But not limited to, transduction, infection, or other methods. Such methods can be found in many standard laboratory manuals (eg,
Davis et al., Basic Methods In Molecular Bi
LOGY (1986)).

In addition to including host cells containing the vector constructs discussed herein, the present invention also includes primary host cells of vertebrate origin, particularly mammalian origin, second host cells, and immortalized. Includes modified host cells. These host cells have been engineered to delete or replace endogenous genetic material (eg, TNFR coding sequences) and / or genetic material operably linked to a TNFR polynucleotide of the invention ( (Eg, a heterologous polynucleotide sequence) and activates, modifies, and / or amplifies the endogenous TNFR polynucleotide. For example, techniques known in the art have known that, through homologous recombination, heterologous regulatory regions (eg,
Promoters and / or enhancers) and endogenous TNFR polynucleotide sequences may be used to operably link the same (eg, June 2, 1997).
U.S. Pat. No. 5,641,670, issued 4th; International Publication No. WO 96/29411, published 26th September 1996; International Publication WO 94 /, published 4th August 1994 12650; Koller et al., Proc. Natl. A
cad. Sci. USA 86: 8932-8935 (1989); and Zi.
See jlstra et al., Nature 342: 435-438 (1989). Each of these disclosures is incorporated by reference in their entirety).

The host cells described below can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, cell-free translation systems can also be used to produce the polypeptides of the invention with RNA from the DNA constructs of the invention.

Polypeptides of the invention may be in modified form (eg, fusion protein (for heterologous protein sequences (of different proteins) (eg, CK-β8 signal peptide (filed June 23, 1995, published. PCT application PCT / US95
/ 09058, amino acid -21 to -1) of the CK-β8 sequence or a signal peptide of stanniocalcin (1994).
Deposited on Jan. 25, 2010, see ATCC Deposit No. 75652)), which includes a polypeptide bound via a peptide bound to))) and is not only expressed in a secretory signal, Additional heterofunctional regions may be included. Such fusion proteins ligate the polynucleotides of the invention and the desired nucleic acid sequence encoding the desired amino acid sequence, in suitable reading frame, to one another by methods known in the art, and the fusion protein product is obtained in the art. The expression can be made by a method known in. Alternatively, such fusion proteins may be produced by protein synthesis techniques (eg, by using a peptide synthesizer).
Can be made by. Thus, for example, regions of additional amino acids (especially charged amino acids) of the polypeptide to improve stability and durability in the host cell, during purification, or during subsequent handling and storage. It can be added to the N-terminus. Peptide moieties can also be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to produce secretion or excretion, improve stability, and facilitate purification, among others, is well known, and
This is a technique commonly used in this field.

A preferred fusion protein comprises a heterologous region from immunoglobulin that is useful for protein stabilization and protein purification. For example, EP-A-0 4
64 533 (Canadian counterpart 2045869) is another human protein,
Disclosed are fusion proteins comprising various portions of the constant regions of immunoglobulin molecules, or portions thereof. In many cases, the Fc part in the fusion protein is sufficiently advantageous for use in therapy and diagnosis, thus resulting, for example, in improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for some uses it is desirable that the Fc portion can be deleted after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when the Fc part proves to be an obstacle to its use in therapy and diagnosis (eg when the fusion protein should be used as an antigen for immunization). In drug discovery, human proteins such as hIL-5 have been fused to the Fc portion for the purpose of high throughput screening assays to identify antagonists of hIL-5. D. Bennett et al. Molecular Rec
ignition 8: 52-58 (1995), and K.S. Johnson
Et al., J. Biol. Chem. 270: 9459-9471 (1995
)checking. In another example, a preferred fusion protein of the invention comprises a portion of an immunoglobulin light chain (ie, a portion of a kappa or lambda light chain). In a particular embodiment, the fusion protein of the invention comprises a portion of the constant region of a kappa or lambda light chain.

Polypeptides of the invention include: purified products from natural sources, including body fluids, tissues, and cells, whether directly isolated or cultured; products of chemical synthetic procedures; And products produced by recombinant techniques from prokaryotic or eukaryotic hosts, including, for example, bacterial cells, yeast cells, higher plant cells, insect cells, and mammalian cells. Depending on the host used in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or non-glycosylated. In addition, the polypeptides of the present invention may also include modified initiating methionine residues, in some cases as a result of host-mediated processes.

The proteins of the invention can be chemically synthesized using techniques known in the art (eg, Creighton, 1983, Proteins: Structure).
s and Molecular Principles, W.S. H. Freem
an & Co. , N .; Y. And Hunkapiller et al., Nature,
310: 105-111 (1984)). For example, the complete T of the present invention
Polypeptides corresponding to fragments of NFR (ie, TNFR-6α and / or TNFR-6β) polypeptides can be synthesized by using a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptide sequence. Non-classical amino acids include, but are not limited to, the D isomers of common amino acids, 2,4-diaminobutyric acid, a-aminoisobutyric acid, 4-aminobutyric acid, Ab.
u, 2-aminobutyric acid, g-Abu, e-Ahx, 6-aminohexanoic acid, Aib
, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine,
Norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline,
Cysteinic acid, t-butylglycine, t-butylalanine, phenylglycine,
Cyclohexylalanine, b-alanine, fluoroamino acids, designer amino acids (eg, b-methyl amino acids), Ca-methyl amino acids, Na-methyl amino acids, and common amino acid analogs. In addition, the amino acids can be D (dextrorotatory) or L (levorotatory).

The TNFR-6α and / or TNFR6-β proteins can be modified either by natural processes such as post-translational processing, or by chemical modification techniques well known in the art. Such modifications are well documented in the base text and more detailed research papers, as well as in many research literature. It is understood that the same type of modification may be present in the same or varying degrees at several sites in a given TNFR-6α and / or TNFR6-β protein. Also, a given TNFR-6α and / or TNFR6-β protein may contain many types of modifications. The TNFR-6α and / or TNFR6-β protein is
For example, the ubiquitination may be branched, and the polypeptide may be cyclic, with or without branching. Cyclic, branched and branched cyclic TNFR-6α and / or TNFR6-β proteins can result from natural post-translational processes or can be made by synthetic methods. As a modification,
Acetylation, acylation, ADP-ribosylation, amidation, covalent binding of flavins,
Covalent bond of heme moiety, covalent bond of nucleotide or nucleotide derivative, covalent bond of lipid or lipid derivative, phosphatidylinositol
covalent bond, cross-linking, cyclization, disulfide bond formation,
Demethylation, covalent crosslink formation, cysteine formation, pyroglutamic acid formation, formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation (Pegylatio
n), proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer RNA-mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (For example, PROTEI
NS-STRUCTURE AND MOLECULAR PROPERTIE
S. Second Edition, T.S. E. Creighton, W.C. H. Freeman and
Company, New York (1993); POSTTRANSLATI
ONAL COVALENT MODIFICATION OF PROTEI
NS, B. C. Edited by Johnson, Academic Press, New Y
ork, pp. 1-12 (1983); Seifter et al., Meth Enzymo.
l 182: 626-646 (1990); Rattan et al., Ann NY A.
cad Sci 663: 48-62 (1992)).

The present invention can be used during or after translation, for example, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, antibody molecules or other cellular agents. It includes TNFR-6α and / or TNFR6-β proteins that are differentially modified, such as by binding to a ligand. Any of numerous chemical modifications, including the following may be carried out by known, but not limited to techniques: cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH _4; acetylation, Formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin;

Further post-translational modifications encompassed by the invention include, for example: N-linked or O-linked carbohydrate chains (N-terminal or C-terminal processing), attachment of chemical moieties to the amino acid backbone. Attachment, chemical modification of N-linked or O-linked carbohydrate chains, and addition or deletion of N-terminal methionine residues as a result of prokaryotic host cell expression. The polypeptide may also be modified with a detectable label such as an enzymatic label, a fluorescent label, an isotope label or an affinity label to allow detection and isolation of the protein.

The present invention may also provide additional advantages such as increased solubility, stability and circulation time of the polypeptide, or reduced immunogenicity of the T of the invention.
Chemically modified derivatives of NFR-6α and / or TNFR6-β proteins are provided (see US Pat. No. 4,179,337). The chemical moieties for derivatization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, and the like. This polypeptide is
Can be modified at random positions within the molecule, or at predetermined positions within the molecule,
And may include one, two, three or more attached chemical moieties.

The polymer can be of any molecular weight and can be branched or unbranched. For polyethylene glycol, a preferred molecular weight is between about 1 kDa and about 100 kDa for ease of handling and manufacturing (the term "about" refers to some molecules in the preparation of polyethylene glycol Heavy, and some indicate lighter than the indicated molecular weight). The desired therapeutic profile (eg, desired duration of sustained release, effect on biological activity in some cases, ease of handling, degree of antigenicity or lack of antigenicity, and therapeutic protein or analog). Other sizes may be used, depending on other known effects of polyethylene glycol). For example, this polyethylene glycol is about 200,500,1000,1500,200.
0, 2500, 3000, 3500, 4000, 4500, 5000, 5500
, 6000, 6500, 7000, 7500, 8000, 8500, 9000,
9500, 10,000, 10,500, 11,000, 11,500, 12,0
00, 12,500, 13,000, 13,500, 14,000, 14,50
0, 15,000, 15,500, 16,000, 16,500, 17,000
, 17,500, 18,000, 18,500, 19,000, 19,500,
20,000, 25,000, 30,000, 35,000, 40,000, 5
50,000, 55,000, 60,000, 65,000, 70,000, 75
8,000, 80,000, 85,000, 90,000, 95,000 or 10
It may have an average molecular weight of 1,000 kDa.

As mentioned above, the polyethylene glycol may have a branched structure. Branched polyethylene glycols are described, for example, in US Pat. No. 5,643,575; Morp.
Urgo et al., Appl. Biochem. Biotechnol. 56: 59-
72 (1996); Vorovjev et al., Nucleosides Nucle.
tides 18: 2745-2750 (1990); and Calicet
i et al., Bioconjug. Chem. 10: 638-646 (1999), the disclosure of each of which is incorporated herein by reference.

The polyethylene glycol molecule (or other chemical moiety) should be attached to the protein in view of its effect on the functional or antigenic domains of this protein. There are numerous coupling methods available to those of skill in the art (eg, EP 0 401 384 (G-CSF to P, incorporated herein by reference).
EG)), Malik et al., Exp. Hematol. 20: 1028-
1035 (1992) (pegylation of GM-CSF with tresyl chloride).
See also report)))). For example, polyethylene glycol can be covalently attached via a amino acid residue by a reactive group such as a free amino or carboxyl group. Reactive groups are groups to which activated polyethylene glycol molecules can be attached. The amino acid residue having a free amino group may include a lysine residue and an N-terminal amino acid residue; the amino acid residue having a free carboxyl group may include an aspartic acid residue, a glutamic acid residue and a C-terminal amino acid residue. Residues may be mentioned. Sulfhydryl residues can also be used as a reactive group to attach the polyethylene glycol molecule. Preferred for therapeutic purposes is a bond at the amino group, eg at the N-terminus or at the lysine group.

As alluded to above, polyethylene glycol can be attached to proteins via attachment to any of a number of amino acid residues. For example, polyethylene glycol can be attached to proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid or cysteine residues. One or more reaction chemistries are used to determine a particular amino acid residue of a protein (eg, lysine, histidine, aspartic acid, glutamic acid, or cysteine) or an amino acid residue of a protein (eg, lysine, histidine, aspartic acid, glutamic acid, cysteine and its Combinations) can be used to attach polyethylene glycol to more than one mold.

In particular, proteins that are chemically modified at the N-terminus may be desirable. Using polyethylene glycol as an example of this composition, various polyethylene glycol molecules (
Molecular weight, branching, etc.), ratio of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mixture, type of pegylation reaction to be performed,
And a method of obtaining a selected N-terminal pegylated protein. A method of obtaining an N-terminal PEGylated preparation (ie, separating this moiety from other mono-PEGylated moieties, if necessary) is by purification of the N-terminal PEGylated material from a population of PEGylated protein molecules. Selective proteins chemically modified at the N-terminal modification can be achieved by reductive alkylation, which involves the use of a primary amino group (lysine pair Utilizes different reactivity of different types (N-terminal). Under suitable reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.

As mentioned above, PEGylation of the proteins of the invention can be accomplished by any number of means. For example, polyethylene glycol can be linked to proteins either directly or by intervening linkers. A linkerless system for attaching polyethylene glycol to proteins has been described by Delgado et al., Cr.
it. Rev. Thera. Drug Carrier Sys. 9: 249-
304 (1992); Francis et al., Intern. J. of Hemat
ol. 68: 1-18 (1998); U.S. Pat. No. 4,002,531; U.S. Pat. No. 5,349,052; WO95 / 06058; and WO98 / 3246.
6 (the disclosure of each of which is incorporated herein by reference).

One system for attaching polyethylene glycol directly to amino acid residues of proteins without an intervening linker uses tresylated MPEG, which uses tresyl chloride (ClSO ₂ CH ₂ CF ₃ ). Monomethoxy used (m
produced by modification of polyethylene glycol (MPEG). Upon reaction of the protein with tresylated MPEG, polyethylene glycol is attached directly to the amino groups of the protein. Therefore, the present invention relates to the protein of the present invention and 2,2,2-trifluoroethane.
ane) includes a protein-polyethylene glycol conjugate produced by reaction with a polyethylene glycol molecule having a sulfonyl group.

Polyethylene glycol can also be attached to proteins using a number of different intervening linkers. For example, US Pat. No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses urethane linkers for attaching polyethylene glycol to proteins. Protein-polyethylene glycol conjugates, in which polyethylene glycol is attached to the protein by a linker, can also be produced by reaction of the protein with a compound such as: MPEG-succinimidyl succinate, 1,1′- Carbonyldiimidazole activated MPEG, MPEG-2,4,5-trichlorophenyl carbonate, MPEG
-P-nitrophenol carbonate, and various MPEG-succinate derivatives. A number of additional polyethylene glycol derivatives, and reaction chemistries for attaching polyethylene glycol to proteins are described in WO98 / 32466, the entire disclosure of which is incorporated herein by reference. PEGylated protein products produced using the reaction chemistries described herein are included within the scope of the invention.

The number of polyethylene glycol moieties attached to each protein of the invention (ie, the degree of substitution) can also vary. For example, the pegylated protein of the invention is
On average 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20
It may be linked to one or more polyethylene glycol molecules. Similarly, the average degree of substitution is, for example, 1-3, 2-4, 3 per protein molecule.
-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 1
1-13, 12-14, 13-15, 14-16, 15-17, 16-18, 1
Within the range of 7 to 19, or 18 to 20 polyethylene glycol moieties.
Methods for determining the degree of substitution are described, for example, in Delgado et al., Crit. R
ev. Thera. Drug Carrier Sys. 9: 249-304 (
1992).

TNFR proteins can be subjected to ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. It can be recovered and purified by known methods, including but not limited to. Most preferably, high performance liquid chromatography (“HPLC”)
) Is used for purification.

(TNFR Protein) The present invention further provides a protein comprising a polypeptide sequence encoded by the polynucleotide of the present invention.

The TNFR proteins of the invention can be monomers or multimers (ie dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomeric and multimeric TNFR proteins of the invention, their preparation and compositions (preferably pharmaceutical compositions) containing them. In certain embodiments, the polypeptides of the invention are monomers, dimers, trimers or tetramers. In a further embodiment, the multimers of the invention are at least dimers, at least trimers, or at least tetramers.

Multimers encompassed by the present invention can be homomers or heteromers. As used herein, the term homomer refers to a multimer that comprises only the TNFRs of the present invention, including fragments, variants, and fusion proteins of the TNFRs described herein. These homomers can include TNFR proteins with identical or different polypeptide sequences. In certain embodiments, homomers of the invention are multimers that include only TNFR proteins that have identical polypeptide sequences. In another particular embodiment, the homomers of the invention are multimers containing TNFR proteins with different polypeptide sequences. In certain embodiments, the multimers of the invention are homodimers (eg, containing TNFR proteins with identical or different polypeptide sequences) or homotrimers (eg, containing TNFR proteins with identical or different polypeptide sequences). Is. In a further embodiment, the homomeric multimers of the invention are at least homodimers, at least homotrimers or at least homotetramers.

As used herein, the term heteromer, in addition to the TNFR protein of the present invention, is a heterologous protein (ie, a protein containing only a polypeptide sequence that does not correspond to a peptide sequence encoded by the TNFR gene). Is a multimer containing. In a particular embodiment, the multimers of the invention are heterodimers, heterotrimers or heterotetramers. In a further embodiment, the heteromeric multimers of the invention are at least heterodimers, at least heterotrimers or at least heterotetramers.

The multimers of the invention can be the result of hydrophobic, hydrophilic, ionic and / or covalent attachment and / or can be indirectly linked, for example by liposome formation. Thus, in one embodiment, multimers of the invention (eg, homodimers or homotrimers) are formed when the proteins of the invention contact each other in solution. In another embodiment, a heteromultimer of the invention (eg, a heterotrimer or heterotetramer) is a protein of the invention in solution that is an antibody to a polypeptide of the invention (heterologous polypeptide in a fusion protein of the invention. (Including antibodies against the sequences). In other embodiments, the multimers of the invention are formed by covalent attachment to and / or between TNFR proteins of the invention.
Such a covalent bond may be included in the polypeptide sequence of the protein (eg, in the polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 97810, or by the cDNA clone contained in ATCC Deposit No. 97809). It may include one or more amino acid residues contained in the polypeptide sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4 included in the encoded polypeptide. In one example, the covalent bond is a bridge between cysteine residues that are within the polypeptide sequence of a protein that interacts in the native (ie, naturally occurring) polypeptide. In another example, this covalent bond is the result of chemical or recombinant manipulation. Alternatively, such a covalent bond may comprise one or more amino acid residues contained in the heterologous polypeptide sequence in the TNFR fusion protein. In one example, the covalent bond is between the heterologous sequences contained in the fusion protein of the invention (see, eg, US Pat. No. 5,478,925). In a particular example, the covalent bond is a TNFR-Fc of the invention (as described herein).
Between the heterologous sequences contained in the fusion protein. In another particular example, the covalent attachment of a fusion protein of the invention may involve the formation of another TNF family ligand / receptor member (eg, osteoprotegerin (ose) that is capable of forming covalently linked multimers.
(e.g., teprotegerin)) (see, eg, International Publication No. WO 98/49305, the contents of which are hereby incorporated by reference in its entirety). In another embodiment, two or more TR6-α and / or TR6-β polypeptides of the invention are linked through a peptide linker. Examples include the peptide linkers described in US Pat. No. 5,073,627, which is incorporated herein by reference. Proteins comprising multiple TR6-α and / or TR6-β polypeptides of the invention separated by a peptide linker can be produced using conventional recombinant DNA techniques.

Another method for preparing the multimeric TR6-α and / or TR6-β polypeptides of the invention is TR6-α and / or fused to a leucine zipper polypeptide sequence or an isoleucine zipper polypeptide sequence. Or the use of TR6-β polypeptides. Leucine zipper domains and isoleucine zipper domains are polypeptides that promote multimerization of the proteins in which they are found. The leucine zipper originally had some DN
Identified in A-binding proteins (Landschulz et al., Science)
240: 1759, (1988)), and since then in a variety of different proteins. Particularly known leucine zippers are naturally occurring peptides and their derivatives that form dimers or trimers. T
Examples of suitable leucine zipper domains for producing R6-α and / or TR6-β soluble multimeric proteins are the leucine zipper domains described in PCT application WO 94/10308, which is hereby incorporated by reference. is there. A recombinant fusion protein comprising a soluble TR6-α and / or TR6-β polypeptide fused to a dimerizing or trimerizing peptide in solution is expressed in a suitable host cell and the resulting soluble multimeric TR6. −
α and / or TR6-β are recovered from the culture supernatant using techniques known in the art.

Certain members of the TNF family of proteins are believed to exist in trimer form (Beutler and Huffel, Science 264:
667, 1994; Banner et al., Cell 73: 431, 1993). Thus, the trimer TR6-α and / or TR6-β may offer the advantage of enhanced biological activity. Preferred leucine zipper moieties are those that preferentially form trimers. One example is Hopp, which is incorporated herein by reference.
Leucine zipper derived from pulmonary surfactant protein D (SPD) as described in e. et al. (FEBS Letters 344: 191, (1994)) and US patent application Ser. No. 08 / 446,922. Other peptides derived from naturally occurring trimer proteins are trimer TR6-α and / or TR6.
It can be used in the preparation of -β.

In a further preferred embodiment, the TR6-α or TR6-β polynucleotide of the present invention is fused to a polynucleotide encoding a “FLAG” polypeptide. Accordingly, TR6-α-FLAG or TR6-β-FLAG fusion proteins are included in the present invention. The FLAG antigenic polypeptide is the TR6-α of the present invention.
Alternatively, it can be fused to the TR6-β polypeptide at either or both the amino or carboxy termini. In a preferred embodiment, TR6-α-
FLAG or TR6-β-FLAG fusion protein is pFLAG-CMV-.
5a expression vector or pFLAG-CMV-1 expression vector (Sigma, S
t. (Available from Louis, MO, USA). Anderss
on, S.S. Et al., J. Biol. Chem. 264: 8222-29 (1989).
Thomsen, D .; R. Et al., Proc. Natl. Acad. Sci. US
A, 81: 659-63 (1984); and Kozak, M .; , Nature
308: 241 (1984), each of which is incorporated herein by reference in its entirety. In a more preferred embodiment, TR6-α-
FLAG or TR6-β-FLAG fusion protein is detectable by anti-FLAG monoclonal antibody (also available from Sigma).

The multimers of the present invention can be produced using chemical techniques known in the art.
For example, proteins desired to be included in the multimers of the invention can be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (eg, US Pat. No. 478,925, which is incorporated herein by reference.) Further, the multimers of the invention are produced using techniques known in the art and included in the multimers. It is possible to form one or more intermolecular bridges between cysteine residues located within the polypeptide sequence of the desired protein (eg, US Pat. No. 5,478,925).
(Incorporated herein by reference in its entirety)). In addition, the proteins of the present invention may be routinely modified by the addition of cysteine or biotin to the C-terminus or N-terminus of the polypeptide sequence of the protein, the techniques known in the art being one of those It can be applied to generate multimers containing modified proteins (see, eg, US Pat. No. 5,478,925, which is incorporated herein by reference in its entirety). Further, techniques known in the art can be applied to generate liposomes containing protein components that are desired to be included in the multimers of the invention (eg, US Pat. No. 5,47).
8,925, which is incorporated herein by reference in its entirety).

Alternatively, the multimers of the invention can be produced using genetic engineering techniques known in the art. In one embodiment, the proteins included in the multimers of the invention are recombinantly produced using fusion protein technology described herein or otherwise known in the art (eg, herein. See US Pat. No. 5,478,925, which is incorporated by reference in its entirety). In particular embodiments,
The polynucleotide encoding the homodimer of the present invention comprises a polynucleotide sequence encoding the polypeptide of the present invention linked to a sequence encoding a linker polypeptide, and then further in the opposite direction from the original C-terminal to N-terminal direction. Produced by ligating to a synthetic polynucleotide (lacking a leader sequence) encoding the translation product of the polypeptide at, eg, US Pat. No. 5,478, which is hereby incorporated by reference in its entirety. 925). In another embodiment,
Applying recombinant techniques known in the art or otherwise described herein,
Recombinant polypeptides of the invention are produced which contain a transmembrane domain and can be incorporated into liposomes by membrane reconstitution techniques (see, eg, US Pat. 478,925).

In one embodiment, the invention provides an isolated TNFR protein comprising:
Alternatively, there is provided an isolated TNFR protein consisting of: ATC
Complete (full length) TN encoded by the cDNA contained in C Accession No. 78810
Amino acid sequence of FR polypeptide, cD contained in ATCC Accession No. 97809
The amino acid sequence of the complete (full length) TNFR polypeptide encoded by NA, the amino acid sequence of the complete TNFR-6α polypeptide disclosed in Figure 1 (SEQ ID NO: 2), disclosed in Figure 2 (SEQ ID NO: 4). Amino acid sequence of complete TNFR-6β polypeptide, or part of the above polypeptide.

In another embodiment, the invention provides an isolated TNFR protein comprising or alternatively consisting of: the mature TNFR polypeptide encoded by the cDNA contained in ATCC Accession No. 78810. Amino acid sequence of ATC
Amino acid sequence of the mature TNFR polypeptide encoded by the cDNA contained in C Accession No. 97809, amino acid residues 31-300 of the TNFR-6α sequence disclosed in FIG. 1 (SEQ ID NO: 2), FIG. TNFR-6 disclosed in 4)
31 to 170 of the amino acid residues of the β sequence, or a part (ie, fragment) of the above polypeptide.

A polypeptide fragment of the invention comprises a polypeptide which comprises, or alternatively consists of: the amino acid sequence contained in SEQ ID NO: 2, the amino acid sequence contained in SEQ ID NO: 4, ATCC Deposit No. 97810. Amino acid sequence encoded by the cDNA plasmid deposited as ATCC Accession No. 97809, or the amino acid sequence encoded by the cDNA plasmid deposited as ATCC Deposit No. 97809, or AT
An amino acid sequence encoded by a nucleic acid that hybridizes (eg, under stringent hybridization conditions) to the nucleotide sequence of the cDNA contained in CC Accession Nos. 97810 and / or 97809, or as shown in Figures 1 and / or 2. Amino acid sequences (SEQ ID NO: 1 and SEQ ID NO: 3, respectively) or their complementary strands. Polynucleotides that hybridize to these polynucleotide fragments are also included in the invention. A protein fragment may be "free-standing," or comprised within a larger polypeptide, which fragment forms parts or regions, most preferably as a single continuous region. Can be Representative examples of polypeptide fragments of the invention include, for example, fragments comprising or consisting of: amino acids SEQ ID NO: 2, 1-31, 32-5.
0, 51-100, 101-150, 151-200, 201-250, and / or 251-300. Further representative examples of polypeptide fragments of the invention include polypeptide fragments comprising or consisting of the following amino acids: SEQ ID NO: 4, 1-31, 32-70, 70
-100, 100-125, 126-150, and / or 151-170.
Further, the polypeptide fragment is at least 10, 20, 30, 40, 5
0, 60, 70, 80, 90, 100, 110, 120, 130, 140, 15
It can be 0, 175 or 200 amino acids long. Polynucleotides encoding these polypeptides are also included in the invention.

In a particular embodiment, a polypeptide fragment of the invention comprises or alternatively consists of: the amino acid residue shown in Figure 1 (SEQ ID NO: 2),
100-150, 150-200, 200-300, 210-300, 220-
300, 230-300, 240-300, 250-300, 260-300,
270-300, 280-300, and / or 290-300. Polynucleotides encoding these polypeptides are also included in the invention.

TNFR contains two domains with different structural and functional properties. The amino-terminal domain spanning residues 30-196 of SEQ ID NO: 2 is due to the conservation of the four cysteine rich domains characteristic of the TNFR family.
Shows homology to other members of the family. The amino acid sequences contained in each of the four domains include amino acid residues 34 to 70 of SEQ ID NO: 2,
73-113, 115-150, and 153-193. The carboxy-terminal domain spanning amino acid residues 197-300 of SEQ ID NO: 2 has no significant homology to any known sequence. Unlike many other TNF receptor family members, TNFR appears to be exclusively a secreted protein and is not synthesized as a membrane bound form. The amino-terminal domain of TNFR does not appear to be required for TNFR biological activity, whereas the carboxy-terminal domain appears to be important for TNFR multimerization.

In one embodiment, the polypeptides of the invention have amino acid residue 3 of SEQ ID NO: 2.
4-70, 73-113, 115-150 and 153-193 and / or 30-196, or alternatively consist of amino acid residues thereof. Polynucleotides encoding these polypeptides are also included in the invention.

In another embodiment, the polypeptide of the invention has amino acid residue 19 of SEQ ID NO: 2.
7-240, 241-270, 271-300, and / or 197-300
Or alternatively consisting of these amino acid residues. Polynucleotides encoding these polypeptides are also included in the invention. Since these polypeptide sequences are thought to be involved in TNFR multimerization, proteins with one or more of these polypeptide sequences are thought to form dimers, trimers and higher multimers. May have advantageous properties such as increased binding affinity, higher stability, and longer circulating half-life compared to the monomeric form. In a particular embodiment, the invention provides a cell signaling molecule (eg, receptor, extracellular domain thereof, as well as an active fragment, derivative, or derivative of one or more of the above polypeptides, or a receptor or extracellular domain thereof. Fusion proteins, including fusions of analogs) to heterologous sequences. In a preferred embodiment, the heterologous sequence is selected from the family of TNR-like receptors. Such sequences preferably include a functional extracellular ligand binding domain and lack a functional transmembrane and / or cytoplasmic domain. Such fusion proteins are useful for detecting molecules that interact with the fused heterologous sequences, thereby identifying potential new receptors and ligands. The fusion protein is also useful for treating various disorders, such as those involving receptor binding.
In one embodiment, TNF / TNFR sequences and TNF receptor / TNFR
Fusion proteins of the invention that include sequences are used to treat TNF-mediated disorders and TNF receptor-mediated disorders (eg, disorders associated with inflammation, autoimmune disease, cancer, and excessive or diminished apoptosis). .

In a further embodiment, the TNFR polypeptide fragment comprises or alternatively consists of a functional region of a polypeptide of the invention as follows:
The Garnier-Robson α region, β region, turn region of the high antigenicity index described in FIG. 4 (Table 1) and FIG. 5 (Table 2), and described herein.
And Coil region; Chou-Fasman α region, β region, and coil region; Kyte-Doolittle hydrophilic region; Eisenberg α amphiphilic region and β amphiphilic region; Karplus-Schulz flexible region; Em
ini surface formation area as well as Jameson-Wolf area. In a preferred embodiment, the polypeptide fragments of the invention are antigenic. The data shown in columns VIII, IX, XIII and XIV of Tables I and II can be used to routinely determine regions of the TNFR that exhibit a high potential for antigenicity. By selecting a value that represents the region of the polypeptide that is exposed to the surface of the polypeptide in an environment where antigen recognition may occur in the process of initiating the immune response, the highly antigenic region is identified in row VIII, Determined from the data presented in IX, XIII and / or XIV. Particularly highly preferred fragments of the invention are those that comprise a region of TNFR that combine several structural features (eg, several (eg 1, 2, 3 or 4) of the above features). Polynucleotides encoding these polypeptides are also included in the invention.

The present invention includes a polypeptide comprising an epitope as described below and / or consisting of an epitope as follows: An epitope of a polypeptide having an amino acid sequence of SEQ ID NO: 2 and 4, respectively, or respectively ATCC deposit number 97
Epitopes of the polypeptide sequences encoded by the polynucleotide sequences contained in the deposited clones of 810 and 97809, or SEQ ID NO: 1 respectively.
And 3 or the complement of the sequences contained in the deposited clones of ATCC Accession Nos. 97810 and 97809, respectively, under stringent hybridization conditions as defined above, or at lower stringency. An epitope of a polypeptide sequence encoded by a polynucleotide that hybridizes under hybridization conditions. The present invention further provides a polynucleotide sequence encoding an epitope of the polypeptide sequence of the present invention (eg, the sequences disclosed in SEQ ID NOS: 1 and / or 3), the complementary strand of the polynucleotide sequence encoding the epitope of the present invention. Polynucleotide sequences that hybridize to their complementary strands under stringent or lower stringency hybridization conditions as defined above.

As used herein, the term “epitope” refers to that portion of a polypeptide that has antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. In a preferred embodiment, the present invention comprises a polypeptide comprising an epitope as well as a polynucleotide encoding this polypeptide. As used herein, an "immunogenic epitope" is defined as the portion of a protein that elicits an antibody response in an animal and can be any method known in the art (e.g., antibody production as described below). Method). (
For example, Geysen et al., Proc. Natl. Acad. Sci. USA 8
1: 3998-4002 (1983)). As used herein, the term "antigenic epitope" refers to any method known in the art (eg,
Antibody is defined as the part of the protein that is capable of immunospecifically binding to its antigen, as measured by the immunoassays described herein). Immunospecific binding excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes do not necessarily require immunogenicity.

Non-limiting examples of antigenic polypeptides or peptides that can be used to generate TNFR-specific antibodies include polypeptides that include or consist of: SEQ ID NO: 2. About Ala-31 to about Thr-46, about Phe-57 to about Thr-117, about Cys-132 to about Thr.
-175, about Gly-185 to about Thr-194, about Val-20.
5 to approximately Asp-217, approximately Pro-239 to approximately Leu-264, and approximately Ala-283 to approximately Pro-298 amino acid residues; and SEQ ID NO: 4 amino acid residues approximately Ala-31 to approximately Thr-46, About Ph
e-57 to about Gln-80, about Glu-86 to about His-106,
Approximately Thr-108 to approximately Phe-119, approximately His-129 to approximately Val-138, and approximately Gly-142 to approximately Pro-166. These polypeptide fragments can be prepared as described in Jam, as shown in Figures 4 and 5 above.
Analysis of the eson-Wolf antigenic index determined that it carried the antigenic epitopes of the TNFR6-α and TNFR6-β polypeptides, respectively.

Fragments that function as epitopes can be generated by any conventional means. (For example, Houghten, Proc. Natl. Acad. Sci.
USA 82: 5131-5135 (1985) (U.S. Pat. No. 4,631,21).
1)).

In the present invention, the antigenic epitopes are preferably at least 4, at least 5, at least 6, at least 7, more preferably at least 8,
It comprises a sequence of at least 9, at least 10, at least 15, at least 20, at least 25, and most preferably between about 15 and about 30 amino acids. Preferred polypeptides containing immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50,
It is 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues long. Antigenic epitopes are useful, for example, to raise antibodies (including monoclonal antibodies) that specifically bind to this epitope. Antigenic epitopes can be used as target molecules in immunoassays. (For example, Wil
Son et al., Cell 37: 767-778 (1984); Sutcliffe.
Et al., Science 219: 660-666 (1983)).

Similarly, immunogenic epitopes can be used to induce antibodies, eg, according to methods well known in the art. (For example, Sutcliffe et al. (Supra); Wils
on et al. (supra); Chow et al., Proc. Natl. Acad. Sci. USA
82: 910-914; and Bittle et al., J. Am. Gen. Virol. 6
6: 2347-2354 (1985)). A polypeptide comprising one or more immunogenic epitopes may be presented to elicit an antibody response against an animal system (eg rabbit or mouse) with a carrier protein (eg albumin), or the polypeptide may be If sufficiently long (at least about 25 amino acids), the polypeptide can be presented without a carrier. But,
It has been shown that immunogenic epitopes containing as few as 8-10 amino acids are sufficient to elicit antibodies that can (at least) bind to linear epitopes of the denatured polypeptide (eg Western. In blotting).

The epitope-bearing polypeptides of the present invention can be used to induce antibodies according to methods well known in the art. This method includes, but is not limited to, in vivo immunization, in vitro immunization, and phage display methods.
For example, Sutcliffe et al., Supra; Wilson et al., Supra; and Bitt.
le et al. Gen. Virol. , 66: 2347-2354 (1985). When in vivo immunization is used, animals can be immunized with free peptides; however, anti-peptide antibody titers are dependent on the macromolecule carrier (eg, keyhole limpet hemacyanin (KLH) or tetanus toxoid) peptide. Can be boosted by combining. For example, peptides containing cysteine residues can be linked to carriers using linkers such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS). On the other hand, other peptides can be bound to the carrier using more common binding agents such as glutaraldehyde. For example, animals such as rabbits, rats, and mice are known to stimulate emulsions (eg, about 100 μg of peptide or carrier protein and Freund's adjuvant or immune response) with either free peptide or carrier-bound peptide. Immunization by intraperitoneal and / or intradermal injection (including any other adjuvant). Several booster injections may be needed to provide a useful titer of anti-peptide antibody, for example, at intervals of about 2 weeks. This titer can be detected, for example, by an ELISA assay using free peptide adsorbed on the solid surface. Titer of anti-peptide antibody in serum from immunized animals is increased by selection of anti-peptide antibody (eg, by adsorption of peptide on solid support and elution of selected antibody according to methods well known in the art). You can

As will be appreciated by those in the art, and as discussed above, the polypeptides of the present invention that include immunogenic or antigenic epitopes can be fused to other polypeptide sequences. For example, the polypeptides of the present invention are immunoglobulin (Ig
A, IgE, IgG, IgM) constant domains or parts thereof (CH1, C)
H2, CH3, or any combination thereof and portions thereof), resulting in a chimeric polypeptide. Such fusion proteins may facilitate purification and increase half-life in vivo. This has been shown for a chimeric protein consisting of the first two domains of the human CD4-polypeptide and various domains of the constant region of the heavy or light chain of mammalian immunoglobulins. For example, EP 394,827; Traunecker et al., Nature,
331: 84-86 (1988). An IgG fusion protein having a disulfide-bonded dimer structure due to the disulfide bond of the IgG moiety also
It has been found to be more effective in binding and neutralizing other molecules than the monomeric polypeptides or their fragments alone. For example, Fountou
lakis et al. Biochem. , 270: 3958-3964 (1995
)checking. Nucleic acids encoding the above epitopes may also include an epitope tag (
For example, it may be recombined with the gene of interest as a hemagglutinin (“HA”) tag or flag tag) to aid in the detection and purification of the expressed polypeptide. For example, the system described by Janknecht et al. Allows easy purification of native fusion proteins expressed in human cell lines (Janknec).
ht et al., 1991, Proc. Natl. Acad. Sci. USA 88:
8972-897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid so that the open reading frame of this gene is translationally fused to an amino-terminal tag consisting of 6 histidine residues.
This tag serves as the matrix binding domain for the fusion protein. Extracts from cells infected with recombinant vaccinia virus are
Loaded onto a Ni2 ⁺ nitriloacetic acid-agarose column, and the histidine-tagged protein can be selectively eluted with a buffer containing imidazole.

Gene shuffling, motif shuffling, exon shuffling,
And / or the technique of codon shuffling (collectively referred to as "DNA shuffling") can be utilized to modulate the activity of TR6-α and / or TR6-β, which results in TR6-α and / or TR6- Agonists and antagonists of β can be efficiently produced. Generally, US Pat. No. 5,605,793.
No. 5,811,238; No. 5,830,721; No. 5,834.
252; and 5,837,458, and Patten, P .; A.
Curr. Opinion Biotechnol. 8: 724-33 (1
997); Haraya, S .; , Trends Biotechnol. 1
6 (2): 76-82 (1998); Hansson, L .; O. Et al., J. Mol
． Biol. 287: 265-76 (1999); and Lorenzo, M.
． M. And Blasco, R .; , Biotechniques 24 (2):
308-13 (1998), each of these patents and publications incorporated herein by reference. In one embodiment, modification of TR6-α and / or TR6-β polynucleotides and corresponding polypeptides can be accomplished by DNA shuffling. DNA shuffling is the process of homologous or site-specific recombination of two or more DNA segments into the desired T
Assembling into R6-α and / or TR6-β molecules. In another embodiment, the TR6-α and / or TR6-β polynucleotide or its corresponding polypeptide is error-prone (error-pro) prior to recombination.
ne) It may be modified by subjecting it to random mutagenesis by PCR, random nucleotide insertion or other methods. In another embodiment, TR6-α
And / or one or more components, motifs, sections, parts, domains, fragments, etc. of TR6-β with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. Can be recombined. In a preferred embodiment, the heterologous molecule is TNF-α, TNF-β, lymphotoxin-α.
, Lymphotoxin-β, FAS ligand, APRIL. In a more preferred embodiment, the heterologous molecule is any member of the TNF family.

In addition, the techniques of gene shuffling, motif shuffling, exon shuffling, and / or codon shuffling (collectively referred to as “DNA shuffling”) can be used to modulate the activity of TNFR. Agonists and antagonists can be efficiently produced. Generally, US Pat. Nos. 5,605,793; 5,811,238; 5,83.
No. 0,721; No. 5,834,252; and No. 5,837,458,
And Patten et al., Curr. Opinion Biotechnol.
8: 724-33 (1997); Harayama, Trends Biote.
chnol. 16 (2): 76-82 (1998); Hansson et al., J. Am. M
ol. Biol. 287: 265-76 (1999); and Lorenzo
And Blasco, Biotechniques 24 (2): 308-13.
(1998), each of these patents and publications incorporated herein by reference. In one embodiment, modification of TNFR polynucleotides and corresponding polypeptides can be accomplished by DNA shuffling. DNA shuffling is performed by homologous recombination or site-specific recombination.
Assembling one or more DNA segments into a desired TNFR molecule. In another embodiment, the TNFR polynucleotide or its corresponding polypeptide may be modified by subjecting it to random mutagenesis by error-prone PCR, random nucleotide insertion, or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, portions of TNFR,
Domains, fragments, etc. can be recombined with one or more components, motifs, sections, portions, domains, fragments, etc. of one or more heterologous molecules. In a preferred embodiment, the heterologous molecule includes, but is not limited to, TNF-α, lymphotoxin-α, (also known as LT-α, TNF-β).
, LT-β (found in the complex heterotrimer LT-α2-β), OPG
L, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3
, OX40L, TNF-γ (International Publication Number WO96 / 14328), TRAIL
, AIM-II (International Publication No. WO97 / 34911), APRIL (J. Ex.
p. Med. 188 (6): 1185-1190), endokine-α (International Publication No. WO98 / 07880), neutrokine-
α (International Publication Number WO98 / 18921), TR6 (International Publication Number WO98 / 3
0694), OPG, OX40, and nerve growth factor (NGF), and soluble forms of Fas, soluble forms of CD30, soluble forms of CD27, soluble forms of CD40 and soluble forms of 4-IBB, TR2 (International Publication No. WO96 / 34
095), DR3 (International Publication Number WO97 / 33904), DR4 (International Publication Number WO98 / 32856), TR5 (International Publication Number WO98 / 30693), T
R7 (International Publication Number WO98 / 41629), TRANS, TR9 (International Publication Number WO98 / 56892), TR10 (International Publication Number WO98 / 54202),
312C2 (International Publication No. WO98 / 06842), and TR12, and soluble forms of CD154, soluble forms of CD70, and soluble forms of CD15.
3. In a more preferred embodiment, the heterologous molecule is any member of the TNF family.

Protein engineering can be used to improve or alter the characteristics of TNFR polypeptides. Recombinant DNA technology known to those of skill in the art can be used to create novel mutant proteins or "muteins," or fusion proteins, containing single or multiple amino acid substitutions, deletions, additions. Such modified polypeptides may exhibit, for example, enhanced activity or increased stability. Furthermore, they can be purified in higher yields and exhibit better solubility than the corresponding native polypeptides, at least under certain purification and storage conditions. For many proteins, including, for example, the extracellular domain of membrane-bound proteins or the mature form of secreted proteins, one or more amino acids are deleted from the N-terminus or C-terminus without substantial loss of biological function. It can be lost is known in the art. For example, Ron et al. Biol. Chem. 268: 29
84-2988 (1993) reported a modified KGF protein with heparin binding activity even when the 3, 8 or 27 amino terminal amino acid residues were deleted.

In the case of the present invention, the proteins of the present invention are members of the TNFR polypeptide family and are therefore SEQ ID NOS: 2 and 4 (TNFR6-α and TNFR6-β).
) Deletion of the N-terminal amino acid up to the cysteine at position 49 results in several biological activities (eg regulation of cell proliferation and apoptosis (eg of lymphoid cells), ability to bind Fas ligand (FasL)). , As well as the ability to bind AIM-II). Polypeptides with additional N-terminal deletions containing Cys-49 residues in SEQ ID NOs: 2 and 4 are not expected to retain such biological activity. It is known that these residues in TNFR-related polypeptides are required to form disulfide bridges that provide the structural stability required for receptor / ligand binding and signal transduction. Is. However, even if the deletion of one or more amino acids from the N-terminus of the protein results in a modification that results in the loss of one or more biological functions of the protein, other functional activities may still be retained. Therefore, complete TNFR, mature TNFR, or T
If less than half of the extracellular domain of NFR is removed from the N-terminus,
The ability of truncated proteins to induce and / or bind to antibodies that recognize the complete or mature TNFR, or the extracellular domain of the TNFR protein, is generally retained. Whether a particular polypeptide lacking the N-terminal residue of the complete protein retains such immunological activity is determined by conventional methods described herein and otherwise in the art. Can be readily determined by conventional methods known in.

Accordingly, the present invention comprises an amino acid sequence in which one or more residues from the amino terminus of the amino acid sequence of TNFR set forth in SEQ ID NOS: 2 and 4 to the cysteine residue in position number 49 has been deleted. Further alternatively provided are polypeptides consisting of them, and polynucleotides encoding such polypeptides. In particular, the present invention relates to residues m-300 of FIG. 1 (SEQ ID NO: 2) and / or FIG.
There is provided a TNFR polypeptide comprising, or alternatively consisting of, the amino acid sequence of residues n-170 of SEQ ID NO: 4), wherein m and n are 1-4.
Is an integer in the range 9 and 49 is a complete TNFR6-α and TNFR6 that is thought to be required for the activity of TNFR6-α and TNFR6-β proteins.
-The position of the first cysteine residue from the N-terminus of the β polypeptide (shown in SEQ ID NOS: 2 and 4, respectively).

[0160]   More specifically, the invention relates to residues of SEQ ID NO: 2:

[0161]

[Equation 1] And the residues of SEQ ID NO: 4:

[0162]

[Equation 2] There is provided a polynucleotide encoding a polypeptide which has (i.e. comprises) the amino acid sequence of a member selected from the group consisting of or alternatively consisting of these amino acid sequences. Polypeptides encoded by these polynucleotide fragments are also included in the invention.

In certain embodiments, the invention provides residues of SEQ ID NO: 2: Val-30 to His-.
Provided is a polynucleotide encoding a polypeptide which comprises or alternatively consists of the amino acid sequence of a member selected from the group consisting of 300. Polypeptides encoded by these polynucleotide fragments are also included in the invention.

In another particular embodiment, the invention features residues of SEQ ID NO: 2: P-23 to H-30.
0 and / or a polynucleotide encoding a polypeptide comprising or alternatively consisting of the amino acid sequence of a member selected from the group consisting of P-34 to H-300. Polypeptides encoded by these polynucleotides are also included in the present invention.

As described above, deletion of one or more amino acids from the N-terminus of a protein results in modification of other functional activity of the protein, even if the modification results in loss of one or more biological functions of the protein. (Eg biological activity) may still be retained. Thus, if less than the majority of the residues of the complete or mature polypeptide is removed from the N-terminus, the truncated TNFR mutein induces an antibody that recognizes the complete or mature form of this polypeptide, and Alternatively, the ability to bind the antibody is generally retained. Whether a particular polypeptide lacking the N-terminal residue of the complete polypeptide retains such immunological activity is determined by conventional methods described herein and otherwise in the art. Can be easily determined by a known method. TNFR muteins with multiple deleted N-terminal amino acid residues appear to be able to retain some biological or immunological activity. In fact, peptides composed of only 6 TNFR amino acid residues can often trigger an immune response.

Accordingly, the present invention has one or more residues deleted from the amino terminus of the TNFR-6α amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) to the arginine residue at position 295. Further provided are polypeptides and polynucleotides encoding such polypeptides. In particular, the present invention consists of one or or their acid comprising residues n ¹ to 300 amino acids of Figure 1 (SEQ ID NO: 2), to provide a polypeptide, wherein n ¹ is 49 to It is an integer of 295 and corresponds to the position of the amino acid residue in FIG. 1 (SEQ ID NO: 2).

More specifically, the invention comprises the amino acid sequence of a member of the sequence of TNFR-6α shown in FIG. 1 (SEQ ID NO: 2) selected from the group consisting of:
Alternatively, a polynucleotide encoding a polypeptide consisting of these amino acid sequences is provided:

[0168]

[Equation 3]

[0169]

[Equation 4]

[0170]

[Equation 5] Polypeptides encoded by these polynucleotide fragments are also encompassed by the present invention.

Similarly, many examples of biologically functional C-terminal deleted muteins are known.
For example, interferon gamma exhibits high activity up to 10-fold by deleting 8-10 amino acid residues from the carboxy terminus of the protein (Doebe).
il et al. Biotechnology 7: 199-216 (1988)).
. In the present case, since the protein of the present invention is a member of the TNFR polypeptide family, deletion of the C-terminal amino acids up to the cysteines at positions 193 and 132 of SEQ ID NOs: 2 and 4, respectively, has several functional consequences. Activity (eg,
Biological activity (eg, regulation of proliferation and apoptosis (eg, regulation of lymphoid cell proliferation and apoptosis) Ability to bind Fas ligand, and AI
Ability to bind M-II, etc.). Polypeptides with additional C-terminal deletions of SEQ ID NOs: 2 and 4 containing cysteines at positions 193 and 132, respectively, are not expected to maintain such biological activity. Because TN
It is known that these residues of the F receptor-related polypeptide are required for the formation of disulfide bridges to provide the structural stability required for receptor binding.

However, even if the deletion of one or more amino acids from the C-terminus of the protein results in modification or loss of one or more biological functions of the protein, other functional activities (eg, Biological activity, ability to multimerize, and ability to bind ligands such as Fas ligand and AIM-II can still be maintained. Thus, the ability of a truncated protein to induce and / or bind to an antibody that recognizes the intact or mature form of the protein remains a non-majority of the intact or mature form of the protein. When the group is removed from the C-terminus, it is generally retained. Whether a particular polypeptide lacking the C-terminal residue of the complete protein retains such immunological activity is determined by conventional methods described herein and otherwise It can be readily determined by conventional methods known in the art.

Therefore, the present invention provides TNFR-6α and TN shown in SEQ ID NOs: 2 and 4.
Polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of FR-6β up to the cysteines at positions 193 and 132 of SEQ ID NOS: 2 and 4, respectively, and such polypeptides Further provided is a polynucleotide encoding In particular, the invention comprises the amino acid sequences of the members of the amino acid sequences in SEQ ID NOs: 2 and 4 selected from the group consisting of residues 1-y and 1-z, respectively, or alternatively from these amino acid sequences. Is provided, where y is any integer in the range 193 to 300 and z is any integer in the range 132 to 170. Polynucleotides encoding these polypeptides are also provided.

In certain preferred embodiments, the present invention comprises an amino acid sequence of a member of the amino acid sequences in SEQ ID NOs: 2 and 4 selected from the group consisting of residues 1-y ′ and 1-z ′, respectively. , Or alternatively, a polypeptide consisting of these amino acid sequences, wherein y ′ is any integer in the range of 193-299 and z ′ is any integer in the range of 132-169. Is. Polynucleotides encoding these polypeptides are also provided.

In a further preferred specific embodiment, the invention provides residues Pr of SEQ ID NO: 2.
o-23 to His-300, Val-30 to His-300, and Pro-3
A polypeptide comprising the amino acid sequence of a member selected from the group consisting of 4 to His-300, or alternatively consisting of these amino acid sequences, as well as residues Pro-23 to Pro-170, Val- of SEQ ID NO: 4. There is provided a polypeptide having an amino acid sequence of a member selected from the group consisting of 30-Pro-170, and Pro-34-His-Pro-170. As described herein, these polypeptides can be fused to heterologous polypeptide sequences. Polynucleotides encoding these polypeptides and these fusion polypeptides are also provided.

The invention is also generally represented by residues m-y of SEQ ID NO: 2 and n-z of SEQ ID NO: 4.
A polypeptide having one or more amino acids deleted from both the amino and carboxy termini, wherein m, n, y, and z are integers as described above. is there.

As also mentioned above, the deletion of one or more amino acids from the C-terminus of the protein is
Other functional activities (eg, biological activity, ability to form homomultimers, and ligands (eg, Fas ligand and AIM), even if they result in modification or loss of one or more biological functions of this protein. -The ability to bind II)) can still be maintained. For example, the ability of a truncated TNFR mutein to induce and / or bind to an antibody that recognizes the complete or mature form of the polypeptide is not the majority of the complete or mature polypeptide. If no residue is removed from the C-terminus, it is generally retained. Whether a particular polypeptide lacking the C-terminal residue of the complete polypeptide retains such immunological activity is determined by conventional methods described herein and, if not so, For example, it can be easily determined by a conventional method known in the art. TNFR muteins lacking multiple C-terminal amino acid residues appear to be able to maintain some biological or immunological activity. In fact, peptides consisting of only 6 TNFR amino acid residues often elicit an immune response.

Therefore, the present invention was deleted from the carboxy terminus of the amino acid sequence of the TNFR polypeptide shown in Figure 1 (SEQ ID NO: 2) to the glycine residue at position 6
Further provided are polypeptides having one or more residues, and polynucleotides encoding such polypeptides. In particular, the present invention, FIG. 1 (i.e., SEQ ID NO: 2) or comprising the amino acid sequence of residues 1-m ^1, or to provide a polypeptide consisting alternatively the amino acid sequence, where m ¹ is FIG. It is an integer of 6 to 299 corresponding to the position of the amino acid residue in 1 (SEQ ID NO: 2).

More specifically, the present invention comprises an amino acid sequence of a member of the sequence of the TFNR sequence shown in Figure 1 (SEQ ID NO: 2) selected from the group consisting of: To polynucleotides encoding polypeptides consisting of these amino acid sequences:

[0180]

[Equation 6]

[0181]

[Equation 7]

[0182]

[Equation 8] Polypeptides encoded by these polynucleotide fragments are also encompassed by the present invention.

In a particular embodiment, the invention provides residues of SEQ ID NO: 2: M-1 to A-271.
, M-1 to Q-254 and / or M-1 to F-221 comprising the amino acid sequence of a member selected from the group consisting of, or alternatively a polypeptide encoding a polypeptide consisting of these amino acid sequences. I will provide a. Polypeptides encoded by these polynucleotide fragments are also encompassed by the present invention.

The present invention may also be described generally as having 1-ie, from the amino- and carboxy-termini of a TNFR polypeptide, which may be described as having residues n ¹ -m ¹ of FIG. 1 (ie, SEQ ID NO: 2). Provide a polypeptide having one or more amino acids deleted, wherein:
n ¹ and m ¹ are integers as described above.

In a further embodiment, the invention provides a polypeptide comprising, or alternatively consisting of, the amino acid sequence of residues 30-m ³ of Figure 1 (ie, SEQ ID NO: 2). Here, m ³ is an integer of 36 to 299 corresponding to the position of the amino acid residue in FIG. 1 (SEQ ID NO: 2). For example, the present invention is shown in FIG.
A polynucleotide which comprises the amino acid sequence of a member of the sequence of the TFNR sequence shown in (SEQ ID NO: 2) selected from the group consisting of the following residues, or which alternatively encodes a polypeptide consisting of these amino acid sequences: I will provide a:

[0186]

[Equation 9]

[0187]

[Equation 10]

[0188]

[Equation 11] Polypeptides encoded by such polynucleotides are also encompassed by the invention. In a particular embodiment, the invention features the residue: V
-30 to A-271, V-30 to Q-254 and / or V-30 to F-22
There is provided a polynucleotide which comprises a amino acid sequence of a member selected from the group consisting of 1, or alternatively encodes a polypeptide consisting of these amino acid sequences. The polypeptides encoded by these polynucleotides are also encompassed by the present invention. The present application also relates to each of the above polynucleotides (p
olepeptide) or polypeptide sequence, at least 80%, 85%
, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to, or alternatively consisting of, a polynucleotide or polypeptide sequence. The invention also includes a polynucleotide or polypeptide sequence as described above fused to a heterologous polynucleotide or polypeptide sequence, respectively.

For fragments of TNFR-6β, where deletion of one or more amino acids from the N-terminus of the protein results in alteration or loss of one or more biological functions of the protein, as described above. Even other functional activities (eg, biological activity, ability to multimerize, ligands (eg, Fas ligand and / or AIM).
-The ability to bind II)) can still be maintained. For example, the ability of a truncated TNFR mutein to induce and / or bind to an antibody that recognizes the complete or mature form of the polypeptide is not the majority of the complete or mature polypeptide. If no residue is removed from the N-terminus,
Generally maintained. Whether a particular polypeptide lacking the N-terminal residue of the complete polypeptide retains such immunological activity is determined by conventional methods described herein, and not For example, it can be easily determined by a conventional method known in the art. A TNFR mutein with a large number of N-terminal amino acid residues deleted is
It seems possible to maintain some biological or immunological activity. In fact, peptides consisting of only 6 TNFR amino acid residues often elicit an immune response.

Accordingly, the present invention provides TNFR-6β as shown in FIG. 2 (ie, SEQ ID NO: 4).
A polypeptide comprising, or alternatively consisting of, one or more residues deleted from the amino terminus of the amino acid sequence to the glycine residue at position 165, and a polynucleotide encoding such a polypeptide. To further provide. In particular, the present invention, FIG. 2 (i.e., SEQ ID NO: 4) or comprising the amino acid sequence of residues n ² -170 of or provides a polypeptide consisting alternatively the amino acid sequence, where n ² is FIG. 2 to 16 corresponding to the positions of amino acid residues in 2 (SEQ ID NO: 4)
It is an integer of 5.

More specifically, the present invention comprises the amino acid sequence of a member of the sequence of TFNR-6β shown in FIG. 2 (SEQ ID NO: 4) selected from the group consisting of:
Alternatively, a polynucleotide encoding a polypeptide consisting of these amino acid sequences is provided:

[0192]

[Equation 12]

[0193]

[Equation 13] Polypeptides encoded by these polynucleotide fragments are also encompassed by the present invention.

As also mentioned above, the deletion of one or more amino acids from the C-terminus of the protein is
Other functional activities, such as biological activity, ability to form homomultimers, and ligands (eg, Fas ligand and / or Or the ability to bind AIM-II)) can still be maintained. For example, the ability of a truncated TNFR-6β mutein to induce and / or bind to an antibody that recognizes the intact or mature form of the polypeptide is never greater than that of the intact or mature polypeptide. When a non-partial residue is removed from the C-terminus, it is generally retained. Whether a particular polypeptide lacking the C-terminal residue of the complete polypeptide retains such immunological activity is determined by conventional methods described herein and, if not so, For example, it can be easily determined by a conventional method known in the art. TNFR-6β muteins lacking multiple C-terminal amino acid residues appear to be able to maintain some biological or immunological activity. In fact, peptides consisting of only 6 TNFR-6β amino acid residues often elicit an immune response.

Accordingly, the invention provides one or more residues deleted from the carboxy terminus of the amino acid sequence of the TNFR-6β polypeptide shown in Figure 2 (SEQ ID NO: 4) to the glycine residue at position NO: 6. Further provided are polypeptides comprising, or alternatively consisting of, these residues, and polynucleotides encoding such polypeptides. In particular, the present invention, FIG. 2 (i.e., SEQ ID NO: 4) or comprising the amino acid sequence of residues 1-m ^2, or to provide a polypeptide consisting alternatively the amino acid sequence, where m ² is FIG. 6 corresponding to the position of the amino acid residue in 2 (SEQ ID NO: 4)
Is an integer from ˜169.

More specifically, the invention comprises the amino acid sequence of a member of the sequence of TFNR-6β shown in FIG. 1 (SEQ ID NO: 2) selected from the group consisting of the following residues:
Alternatively, a polynucleotide encoding a polypeptide consisting of these amino acid sequences is provided:

[0197]

[Equation 14]

[0198]

[Equation 15] Polypeptides encoded by these polynucleotide fragments are also encompassed by the present invention.

The present invention may also be described generally as having residues n ² -m ² of Figure 1 (ie, SEQ ID NO: 2), both the amino- and carboxy-termini of TNFR-6β polypeptides. Provide a polypeptide comprising one or more amino acids deleted from, or alternatively consisting of these amino acid sequences, wherein n ² and m ² are
It is an integer as described above.

[0200] This application also, poly encoding TNFR polypeptides shown herein m-y, n-z, n 1 -m 1, 30-m 3, and / or as n ² -m ² At least 90%, 92%, 95%, 96%, 97%, 98%,
Or a nucleic acid molecule comprising polynucleotide sequences that are 99% identical, or alternatively consisting of these polynucleotide sequences. In a preferred embodiment, the present application provides at least 9 polynucleotide sequences encoding a polypeptide having the specific N-terminal and C-terminal deletion amino acid sequences described herein.
A nucleic acid molecule comprising, or alternatively consisting of, 0%, 92%, 95%, 96%, 97%, 98%, or 99% polynucleotide sequences. The present invention also includes the above polynucleotide sequences fused to a heterologous polynucleotide sequence. Polypeptides encoded by these nucleic acids and / or polynucleotide sequences are also encompassed by the invention.

Also included is a nucleotide sequence that encodes a polypeptide consisting of a portion of the complete TNFR amino acid sequence encoded by the cDNA clone contained in ATCC Deposit Nos. 97810 or 97809, where this portion is, respectively, A
1 to about 49 amino acids have been removed from the amino terminus of the complete amino acid sequence encoded by the cDNA clones contained in TCC Deposit Nos. 97810 and 97809, or encoded by the cDNA clones contained in ATCC Deposit Nos. 97810 and 97809. 1 to about 107 or 58 amino acids have been removed from the carboxy terminus of the complete amino acid sequence described above, or alternatively the complete amino acid sequence encoded by the cDNA clones contained in ATCC Deposit Nos. 97810 and 97809. Excludes any combination of amino and carboxy terminal deletions. Polypeptides encoded by all of the above polynucleotides are also encompassed by the invention.

It will also be appreciated by the parties that in addition to the truncated form of the protein discussed above, some amino acid sequences of the TNFR polypeptide may be altered without significant impact on the structure or function of the protein. To be done. When considering such differences in sequence, it should be noted that there are critical regions in the protein that determine activity.

Accordingly, the present invention provides for variants of TNFR polypeptides that exhibit substantial TMFR polypeptide functional activity (eg, immunogenic activity, biological activity), or protein moieties discussed below. Including a region of a TNFR protein such as
Further included are variants of the polypeptide. Such variants include deletions, insertions, transitions, repeats, and type substitutions selected according to general rules known in the art to have little effect on activity. For example, guidance on how to make phenotypically silent amino acid substitutions can be found in Bowie, J. et al. U. Et al., "Deciphering the Message in Protein"
Sequences: Tolerance to Amino Acid S
Substitutions "Science 247: 1306-1310 (1
990), where we show that there are two main approaches to study the resistance of amino acid sequences to changes. The first method relies on the process of evolution, where the mutation is either accepted or rejected by natural selection. The second approach uses genetic engineering to induce amino acid changes at specific sites in the cloned gene as well as a selection or screen to identify functionally maintaining sequences. To the authors, these studies have revealed that proteins are surprisingly resistant to amino acid substitutions. The authors further indicate which amino acid changes tend to be permissive at particular sites in the protein. For example, most embedded amino acid residues require non-polar side chains, while surface side chain features are generally poorly conserved. Other such phenotypic silent substitutions are described by Bowie, J. et al. U.
Et al. (Supra) and references cited therein. Typically, one-to-one substitutions among the aliphatic amino acids Ala, Val, Leu, and Ile, exchange of hydroxy residues Ser and Thr, exchange of acidic residues Asp and Glu, amide residue Asn. And Gln, exchange of basic residues Lys and Arg,
And the substitution between the aromatic residues Phe, Tyr is considered a conservative substitution. Thus, a fragment, derivative, or analog of the polypeptide encoded by SEQ ID NO: 2, 4, or 6 or the deposited cDNA has (i) one or more amino acid residues conserved or conserved. A non-natural amino acid residue, preferably a conserved amino acid residue, and such a substituted amino acid residue may or may not be encoded by the genetic code. Good, or (ii) one or more amino acid residues containing a substituent, or (iii) a mature extracellular polypeptide or a soluble extracellular polypeptide for increasing the half-life of the polypeptide Fused to another compound, such as a compound (eg, polyethylene glycol), or (iv)
Additional amino acids (eg, IgG Fc peptide fusion and / or immunoglobulin light chain constant region peptides, leader or secretory sequences, or TNF
The sequences used for the purification of the R polypeptide) are the T's described herein.
It may be fused to an NFR polypeptide. Such fragments, derivatives and analogs are considered to be within the purview of the parties concerned by the teachings herein.

Accordingly, the TNFR of the invention may include one or more amino acid substitutions, deletions, or additions, either from natural mutations or artificial manipulations. As shown, small property changes are preferred, such as conservative amino acid substitutions that do not significantly affect protein folding or activity (see Table III).

[0205]

[Table 10] Functionally important amino acids in the TNFR protein of the present invention can be isolated by methods known in the art (eg, site-directed mutagenesis or alanine-s).
canning) mutagenesis (Cunningham and Wells, Scie)
nce 244: 1081-1085 (1989)). The latter procedure introduces a single alanine mutation at every residue in the molecule. The resulting mutant molecule is then functionally active (eg, ligand / receptor (eg, Fas
Ligand and / or AIM-II) receptor binding or proliferative activity in vitro or in vivo).

It is of particular interest to replace charged amino acids with other charged or neutral amino acids that can produce proteins with highly desirable improved properties (eg, less aggregation). Aggregation not only reduces activity, but can be a problem in preparing pharmaceutical formulations. Because aggregates can be immunogenic (Pinckard et al., Clin. Exp. Immunol. 2:
331-340 (1967); Robbins et al., Diabetes 36: 8.
38-845 (1987); Cleland et al., Crit. Rev. Thera
peutic Drug Carrier Systems 10: 307-3
77 (1993)).

Amino acid substitutions may also alter the selectivity of ligand binding for cell surface receptors. For example, Ostade et al., Nature 361: 266-.
268 (1993) describes specific variants that result in the selective binding of TNF-α to only one of the two known forms of the TNF receptor. Sites that are critical for ligand-receptor binding can also be determined by structural analysis (eg, crystallization, nuclear magnetic resonance or photoaffinity labeling) (Smith et al., J. Mol.
Biol. 224: 899-904 (1992) and de Vos et al., Sci.
ence 255: 306-312 (1992)).

Since TNFR-6α and TNFR-6β are members of the TNFR receptor-related protein family, preferably the mutation is of a TNFR in order to modulate rather than completely eliminate the biological activity of TNFR. It is made in a sequence that encodes an amino acid in a conserved extracellular domain, more preferably at a residue within this region that is not conserved among members of the TNF receptor family. An isolated polynucleotide comprising a nucleic acid sequence encoding a TNFR variant described above also forms part of the invention.

The polypeptides of the present invention are preferably provided in isolated form and are preferably substantially purified. Recombinantly produced versions of TNFR polypeptides have been described by Smith and Johnson, Gene 67: 31-40 (1).
988) and can be substantially purified. The polypeptides of the present invention can also be purified from natural or recombinant sources using the anti-TNFR-6α and anti-TNFR-6β antibodies of the invention in methods well known in the field of protein purification.

The present invention provides an isolated TN comprising an amino acid sequence selected from the group consisting of:
Further providing an FR polypeptide: (a) set forth in SEQ ID NO: 2 or 4, or
Or the amino acid sequence of a full-length TNFR polypeptide having the full amino acid sequence as encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 78810 or 97809; (b) positions 31-300 in SEQ ID NO: 2 Amino acid sequence of the mature TNFR polypeptide having the amino acid sequence of SEQ ID NO: 31 or the amino acid sequence of positions 31 to 170 in SEQ ID NO: 4, or the amino acid sequence as encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97810 or 97809. Or (c) the amino acid sequence at positions 31 to 283 in SEQ ID NO: 2 or 3 in SEQ ID NO: 4
The amino acid sequence of positions 1 to 166, or ATCC deposit no.
The amino acid sequence of the soluble extracellular domain of the TNFR polypeptide having the amino acid sequence as encoded by the cDNA clone contained in the plasmid deposited as 809.

Further polypeptides of the invention are at least 90% similar to the above polypeptides, more preferably at least 80%, 85%, 90%, 92% or 95% similar, even more preferably. Is at least 96%, 97%, 98%,
Or a polypeptide having 99% similarity. The polypeptide of the present invention may also be at least 80% identical, more preferably at least 85% identical to the polypeptide encoded by the deposited cDNA (ATCC Deposit No. 78810 or 97809) or the polypeptide of SEQ ID NO: 2 or 4. , 90%, 92%
, Or 95% identical, and even more preferably at least 96%, 97%, 98%,
It includes polypeptides that are 99% identical, and may also include portions of such polypeptides that have at least 30 amino acids and more preferably at least 50 amino acids.

“% Similarity” to two polypeptides is based on the Bestfit program (W
isconsin Sequence Analysis Package, V
version 8 for Unix (registered trademark), Genetics Com
putter Group, University Research Park,
575 Science Drive, Madison, WI 53711) and the default settings for determination of similarity are used to contemplate the similarity score generated by comparing the amino acid sequences of two polypeptides. Bestfit is based on Smith and Waterman (Adv
ances in Applied Mathematics 2: 482-4
89, 1981) to find the best segment of homology between two sequences.

For example, a polypeptide having an amino acid sequence that is at least 95% “identical” to a reference sequence of a TNFR polypeptide has the amino acid sequence of this polypeptide is the polypeptide sequence is the reference amino acid of the TNFR polypeptide. 10 each in an array
It is intended to be identical to the reference sequence, except that it may contain changes of up to 5 amino acids per 0 amino acids. That is, at least 80 relative to the reference amino acid sequence.
Up to 5% of the amino acid residues of the reference sequence may be deleted or replaced by another amino acid in order to obtain a polypeptide having an amino acid sequence which is%, 85%, 90% or 95% identical. Or 5 of all the amino acid residues of the reference sequence.
Many amino acids up to% can be inserted in the reference sequence. These changes in the reference sequence can occur at the amino or carboxy terminal positions of the reference amino acid sequence, or somewhere between these terminal positions, either individually within the residues within the reference sequence or within the reference sequence. Are dispersed in any of one or more consecutive groups of.

As a practical matter, any particular polypeptide may be identified, for example, in SEQ ID NO: 2 or 4.
To the amino acid sequence set forth in, or by the cDNA obtained in the deposit having ATCC Deposit No. 97810 or 97809, or a fragment thereof (eg, as described herein (
For example, a polypeptide having the sequence of amino acids 30 to 300 of SEQ ID NO: 2), T
Sequence of any polypeptide corresponding to the N- or C-terminal deletion of NFR),
At least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%
Or, whether or not they are 99% identical, the Bestfit program (Wiscons
in Sequence Analysis Package, Version
8 for Unix (registered trademark), Genetics Computer
Group, University Research Park, 575 Sc
can be routinely determined using known computer programs, such as Ience Drive, Madison, WI 53711). Bes to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the invention.
When using tfit or any other sequence alignment program, the parameters are, of course, such that the percent identity is calculated over the entire length of the reference amino acid sequence and the homology gap of up to 5% of the total number of amino acids in the reference sequence. Is set to be acceptable.

In a particular embodiment, the identity between the reference (query) sequence (sequence of the invention) and the subject sequence (also referred to as a global sequence alignment) is Brutla.
g., et al. (Comp. App. Biosci. 6: 237-245 (1990)) based on the FASTDB computer program. Preferred parameters used in the FASTDB amino acid sequence alignment are: Matrix = PAM 0, k-tuple = 2, Mismatch Pen.
alty = 1, Joining Penalty = 20, Randomizat
Ion Group Length = 0, Cutoff Score = 1, Wi
window Size = sequence length, Gap Penalt
y = 5, Gap Size Penalty = 0.05, Window Siz
e = 500, or the length of the target amino acid sequence (whichever is shorter). According to this embodiment, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions (not due to internal deletions), a manual correction is made to the results. This is because the FASTDB program does not consider N-terminal and C-terminal truncations of the subject sequence when calculating the overall percent identity. For a subject sequence that is truncated at the N-terminus and the C-terminus, the percent identity to the query sequence does not match / align with the corresponding subject residue as a percentage of the total bases of the query sequence, the N-terminus of the subject sequence. And is corrected by calculating the number of residues in the query sequence that are C-terminal. The determination of whether the residues are matched / aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity and the FASTD above.
Calculated by the B program using specific parameters to arrive at the final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only those residues N- and C-terminal to the subject sequence that are not matched / aligned with the query sequence are considered for the purpose of manually adjusting the percent identity score. That is, only the query residue positions are located outside the furthest N-terminal and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. Deletions occur at the N-terminus of the subject sequence, and therefore FAS
The TDB alignment shows no match / alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the non-matching N- and C-termini /
The total number of residues in the query sequence) is expressed so that 10% is subtracted from the percent identity score calculated by the FASTDB program. 9 remaining
If 0 residues were perfectly matched, the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared to a 100 residue query sequence. In this case, the deletion is an internal deletion, so there are no residues at the N-terminus or C-terminus of the subject sequence that are not matched / aligned with the query sequence. In this case, FASTD
The percent identity calculated by B is not manually corrected. Again, FAS
N of the target sequence which is not matched / aligned with the query sequence shown in the TDB alignment
Only residue positions outside the terminus and C-terminus are manually corrected. Other manual corrections are
Not done for the purposes of this embodiment.

Polypeptides of the invention have uses, including but not limited to, molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns, using methods well known to those of skill in the art. As described in detail below, the polypeptides of the present invention may also be used to raise polyclonal or monoclonal antibodies, which are used to detect TNFR protein expression, as described below. Assay, or as agonists and antagonists that can enhance or inhibit the function of the TNFR protein. Furthermore, such polypeptides can be used in the yeast two-hybrid system to "capture" TNFR protein binding proteins, which are also candidate agonists and antagonists according to the invention. The yeast two-hybrid system is described by Fields and Song, Nature 340: 245-246.
(1989).

Transgenic The proteins of the invention can also be expressed in transgenic animals.
Mouse, rat, rabbit, hamster, guinea pig, pig, mini pig (micr
o-pig), goats, sheep, cows and non-human primates such as, but not limited to, baboons, monkeys and chimpanzees, animals of any species can be used to produce transgenic animals. . In certain embodiments,
Techniques described herein or otherwise known in the art are used for expression of the polypeptides of the invention in humans as part of a gene therapy protocol.

Any technique known in the art may be used to introduce the transgene (ie, the polynucleotide of the invention) into an animal to establish the foo of the transgenic animal.
nder line) can be generated. Such techniques are described in Pronuclear Microinjection (Patterson et al., Appl. Microbiol. Biotec.
hnol. 40: 691-698 (1994); Carver et al., Biotec.
hology (NY) 11: 1263-1270 (1993); Wright
Et al., Biotechnology (NY) 9: 830-834 (1991); and Hoppe et al., U.S. Pat. No. 4,873,191 (1989)); Germline retrovirus-mediated gene transfer (Van der Putten et al., Pr.
oc. Natl. Acad. Sci. USA 82: 6148-6152 (19).
85)), blastocysts or embryos; gene targeting in embryonic stem cells (Thompso)
n et al., Cell 56: 313-321 (1989)); electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3: 180).
3-1814 (1983)); introduction of the polynucleotide of the present invention using a gene gun (see, for example, Ulmer et al., Science 259: 1745 (1993)); to embryonic pluripotent stem cells. Introduction of the nucleic acid construct and re-transfer of this stem cell into the blastocyst; and sperm-mediated gene transfer (L
avitrano et al., Cell 57: 717-723 (1989)); and the like. For a review of such techniques, see Gordon, “Transgenic A,” which is incorporated herein by reference in its entirety.
animals ", Intl. Rev. Cytol. 115: 171-229 (1
989). US Pat. No. 5,464,764 (Capecchi et al., Positive-Negative Selection Methods).
and Vectors); US Pat. No. 5,631,153 (Capecc)
hi et al., Cell and Non-Human Organisms Con.
taining Pretermined Genomic Modif
situations and Positive-Negative Select
Ion Methods and Vectors for Making S
ame); US Pat. No. 4,736,866 (Leder et al., Transgen.
ic Non-Human Animals); and US Pat. No. 4,873.
No. 191 (Wagner et al., Genetic Transformation)
of Zygotes); each of which is hereby incorporated by reference in its entirety. The contents of each document listed in this paragraph is hereby incorporated by reference in its entirety.

Any technique known in the art can be used to generate transgenic clones containing a polynucleotide of the invention (eg, cultured, quiescently induced embryonic cells, fetal cells or adult cells). Nuclear Transfer of Cell-Derived Enucleated Oocytes to the Nucleus (Campell et al., Nature 380: 64-66 (1996); Wil
mut et al., Nature 385: 810-813 (1997), each of which is incorporated herein by reference in its entirety).

The present invention provides transgenic animals having the transgene in all their cells, as well as animals having the transgene in some (but not all) of the cells (ie, mosaic or chimeric animals). provide. The transgene is
It can be incorporated as one transgene or as multiple copies such as concatemers (eg head-to-head tandem or head-to-tail tandem). This transgene is also described, for example, in the teaching of Lasko et al. (Lasko et al., Proc. Natl.
Acad. Sci. USA 89: 6232-6236 (1992)) and can be selectively introduced into and activated by specific cell types. The regulatory sequences required for such cell type-specific activation depend on the particular cell type of interest, and they will be apparent to those of skill in the art. Targeting of the gene is preferred when it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene. Briefly, if such a technique is utilized, a vector containing several nucleotide sequences homologous to the endogenous gene may be used to bind the nucleotide sequence of the endogenous gene via homologous recombination with the chromosomal sequence. And is designed for the purpose of destroying the function of the nucleotide sequence. Transgenes can also be selectively introduced into specific cell types, and thus are described, for example, by Gu et al. (Science 265:
103-106 (1994)), the endogenous gene is inactivated only in the introduced cell type. The regulatory sequences required for such cell type-specific inactivation depend on the particular cell type of interest, and they will be apparent to those of skill in the art. The contents of each type listed in this paragraph are hereby incorporated by reference.

Once a transgenic animal is produced, expression of its recombinant gene can be assayed using standard techniques. Initial screening can be accomplished by Southern blot analysis or PCR techniques to confirm that transgene integration has occurred by analysis of animal tissue. The level of transgene mRNA expression in the tissues of transgenic animals was also determined by Northern blot analysis, in situ hybridization analysis and reverse transcriptase P of tissue samples obtained from the animals.
It can be assessed using techniques including, but not limited to CR (rt-PCR). Samples of transgenic gene expressing tissues can also be evaluated immunocytochemically or immunohistochemically using antibodies specific for the transgene product.

Once founder animals are generated, they can be bred, inbred, outbred or crossed to generate colonies of particular animals. Examples of such mating strategies include, but are not limited to: Founder outcrosses with more than one integration site to establish another lineage; additive expression of each transgene. By effect, inbreeding of separate strains to produce composite transgenics expressing higher levels of the transgene; a given routine for both enhancing expression and eliminating the need for screening animals by DNA analysis. Hybridization of heterozygous transgenic animals that produce animals homozygous for the site of integration; crossing of separate homozygous strains to generate complex heterozygous or homozygous lines; and to the desired experimental model Mating to place the transgene on a suitable different background.

The transgenic and “knockout” animals of the invention are animal model systems useful in generating the biological function of a TNFR polypeptide, an abnormal TN.
It has uses, including but not limited to, the study of conditions and / or disorders associated with FR expression, and the screening of compounds that are effective in ameliorating such conditions and / or disorders.

In a further embodiment of the invention, cells that have been genetically engineered to express a protein of the invention, or cells that have been genetically engineered not to express a protein of the invention (eg, a knockout) are in vivo. Administer to patient. Such cells can be obtained from patients (ie, animals, including humans) or MHC compatible donors, and can be fibroblasts, bone marrow cells, blood cells (eg lymphocytes), adipocytes, muscle cells, endothelial cells, etc. Can be included, but is not limited to. This cell
For example, transduction (using viral vectors and preferably those that integrate the transgene into the cell genome), or transfection procedures (using plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. To introduce a coding sequence of the polypeptide of the present invention into a cell or to disrupt an endogenous regulatory sequence bound to the coding sequence and / or the polypeptide of the present invention. For this, recombinant DNA technology is used to genetically engineer in vitro. The coding sequence of the polypeptide of the invention may be placed under the control of a strong constitutive or inducible promoter or promoter / enhancer to achieve expression and preferably secretion of the polypeptide of the invention. Engineered cells that express and preferably secrete a polypeptide of the invention can be introduced systemically into the patient, eg, in circulation or intraperitoneally. Alternatively, the cells can be incorporated into a matrix and transplanted into the body (eg, genetically engineered fibroblasts can be transplanted as part of a skin graft; genetically engineered endothelial cells can be a lymphoid graft or a vascular graft). Implantable as part of a strip (eg, Anderson et al., US Pat. No. 5,399,349).
And Mulligan and Wilson, US Pat. No. 5,460,95.
See No. 9. Each of these is hereby incorporated by reference in its entirety).

If the cells to be administered are non-self or non-MHC compatible cells, they may be administered using well known techniques that interfere with the development of a host immune response against the introduced cells. For example, the cells may be introduced in an encapsulated form and the introduced cells may not be recognized by the host immune system while the components can be exchanged for the immediate extracellular environment.

Antibodies The present invention further relates to antibodies and polypeptides of the invention, preferably T-cell antigen receptors (TCRs) that immunospecifically bind an epitope (for assaying specific antibody-antigen binding. (As determined by immunoassays well known in the art). The antibodies of the present invention include polyclonal antibodies, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') fragments, Fab expression libraries. The fragments produced include, but are not limited to, anti-idiotype (anti-Id) antibodies, including, for example, anti-Id antibodies to the antibodies of the invention, and any of the above epitope binding fragments. As used herein, the term "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules (ie, molecules that contain an antigen binding site that immunospecifically binds an antigen). Regarding The immunoglobulin molecules of the invention can be of any type (eg,
IgG, IgE, IgM, IgD, IgA, and IgY), class (eg,
IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or a subclass of immunoglobulin molecules.

Most preferably, the antibody is a human antigen-binding antibody fragment of the invention and comprises Fab, Fab ′ and F (ab ′) 2, Fd, single chain Fvs (scFv),
Single chain antibody, disulfide linked Fvs (sdFv) and VL domain or VH
Examples include, but are not limited to, fragments that include any of the domains. Antigen binding antibody fragments, including single chain antibodies, may include variable regions, either alone or in combination with the following: hinge regions, CH1 domains, CH2 domains and CH3 domains, in whole or in part. Hinge region, CH1 domain, C
Also included in the invention are antigen binding fragments that also include any combination of variable regions with the H2 and CH3 domains. The antibodies of the present invention can be of any animal origin including birds and mammals. Preferably, the antibody is human, murine, donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, "human" antibody includes antibodies having the amino acid sequence of human immunoglobulin and is a transgenic animal from a human immunoglobulin library or against one or more human immunoglobulins and Animals that do not express endogenous immunoglobulins (see below and, for example, Kucherlapati et al., US Pat. No. 5,939,59).
Antibody as described in No. 8).

Antibodies of the invention may be monospecific, bispecific, trispecific or more multispecific. Multispecific antibodies can be specific for different epitopes of a polypeptide of the invention, or specific for both a polypeptide of the invention and a heterologous epitope (eg, a heterologous polypeptide or a solid support material). Can be objective. For example, PCT Publication WO 93/17715; WO 92/08802;
WO 91/00360; WO 92/05793; Tutt et al., J. Am. Immu
nol. 147: 60-69 (1991); U.S. Pat. No. 4,474,893;
No. 4,714,681; No. 4,925,648; No. 5,573,92.
No. 0; 5,601, 819; Kostelny et al., J. Am. Immunol. 1
48: 1547-1553 (1992).

Antibodies of the invention may be described or specified by an epitope or portion of a polypeptide of the invention that is recognized or specifically bound by the antibody. Portions of this epitope or polypeptide may be defined as described herein, for example, by N-terminal and C-terminal positions, by size at consecutive amino acid residues, or as listed in the tables and figures, Can be specified. Antibodies that specifically bind any epitope or polypeptide of the invention can also be excluded. Thus, the invention includes antibodies that specifically bind the polypeptide of the invention and allow for the exclusion of this polypeptide.

The antibodies of the invention can also be described or specified by their cross-reactivity. Any other analog of the polypeptides of the invention, ortholog
Antibodies that do not bind log) or homologs are included. At least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55% and at least 50% identity to the polypeptides of the present invention. Also included in the invention is an antibody that binds a polypeptide having (as calculated using methods known in the art and described herein). Less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, 70 relative to the polypeptide of the present invention
To polypeptides having less than%, less than 65%, less than 60%, less than 55% and less than 50% identity (as calculated using methods known in the art and methods described herein). Antibodies that do not bind are also included in the invention. Further included in the invention is an antibody that binds a polypeptide encoded by a polynucleotide that hybridizes to a polynucleotide of the invention under stringent hybridization conditions (as described herein). . Antibodies of the invention may also be described or specified by their binding affinity for the polypeptides of the invention. The preferred binding affinity is 5 × 10 ^-2 M, 10 ^-2 M, 5 × 1
0 ^-3 M, 10 ^-3 M, ^{5x10 -4} M, 10 ^-4 M, ^{5x10 -5} M, 10 ^-5 M, ^5x1
0 ^-6 M, 10 ^-6 M, ^{5x10 -7} M, 10 ^-7 M, ^{5x10 -8} M, 10 ^-8 M, ^5x1
0 ^-9 M, 10 ^-9 M, ^{5x10 -10} M, 10 ^-10 M, ^{5x10 -11} M, 10 ^-11 M, 5
Dissociation less than ^{x10 -12} M, 10 ^-12 M, ^{5x10 -13} M, 10 ^-13 M, ^{5x10 -14} M, 10 ^-14 M, ^{5x10 -15} M, or 10 ^-15 M Included are binding affinities with a constant or K _d .

The present invention also includes any method known in the art for determining competitive binding (
Antibodies that competitively inhibit the binding of antibodies to the epitopes of the invention as determined by, for example, the immunoassays described herein) are provided. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.

The antibodies of the present invention can act as agonists or antagonists of the polypeptides of the present invention. For example, the invention includes antibodies that disrupt the interaction of the receptor / ligand with either or all of the polypeptide moieties of the invention. The invention features both receptor-specific and ligand-specific antibodies. The present invention also features receptor-specific antibodies that do not interfere with ligand binding but prevent receptor activation. Receptor activation (ie, signal transduction) can be determined by the techniques described herein or otherwise known in the art. For example, activation of a receptor may result in phosphorylation of the receptor (eg,
Tyrosine or serine / threonine) or immunoprecipitation (eg, as described above), followed by detection of its substrate by Western blot analysis. In certain embodiments, the antibody is at least 90%, at least 80%, at least 70%, at least 60% of the activity in the absence of antibody.
, Or at least 50% inhibited ligand or receptor activity.

The present invention also recognizes receptor-specific antibodies that interfere with both ligand binding and receptor activation, as well as receptor-ligand complexes, and, preferably, unbound receptor or unbound ligand. Is characterized by an antibody that does not specifically recognize. Similarly, the invention includes neutralizing antibodies that bind to the ligand and prevent it from binding to the receptor, as well as binding to the ligand, thereby preventing receptor activation, but preventing the ligand from binding to the receptor. No antibodies included. Further included in the invention are antibodies that activate the receptor. These antibodies can act like receptor agonists, ie, enhance or activate either all or a subset of the biological activity of ligand-mediated receptor activation. The antibody may be specified as an agonist, antagonist or inverse agonist for a biological activity, including the specific biological activity of the peptides of the invention disclosed herein. The antibody agonists described above can be made using methods known in the art. For example, PCT Publication WO 96/40281; US Patent No. 5,
811,097; Deng et al., Blood 92 (6): 1981-1988.
(1998); Chen et al., Cancer Res. 58 (16): 3668-
3678 (1998); Harrop et al., J. Am. Immunol. 161 (4):
1786-1794 (1998); Zhu et al., Cancer Res: 58 (1).
5): 3209-3214 (1998); Yoon et al., J. Am. Immunol. 1
60 (7): 3170-3179 (1998); Prat et al. Cell. S
ci. 111 (Pt2): 237-247 (1998); Pittard et al., J. Am.
Immunol. Methods 205 (2): 177-190 (1997).
Liautard et al., Cytokine 9 (4): 233-241 (199);
7); Carlson et al. Biol. Chem. 272 (17): 1129
5-11301 (1997); Taryman et al., Neuron 14 (4):
755-762 (1995); Muller et al., Structure 6 (9).
: 1153-1167 (1998); Bartunek et al., Cytokine.
8 (1): 14-20 (1996), which is incorporated herein by reference in its entirety.

The antibodies of the invention can be used to purify, detect and target the polypeptides of the invention, including, but not limited to, diagnostic and therapeutic methods both in vitro and in vivo. . For example, the antibody has use in immunoassays for qualitatively and quantitatively measuring the levels of polypeptides of the invention in biological samples. For example, Harlow et al., An
tibodies: A Laboratory Manual, (Cold S
pring Harbor Laboratory Press, 2nd edition, 19
88), which is incorporated herein by reference in its entirety.

[0235] As discussed in more detail below, the antibodies of the invention can be used either alone or in combination with other compositions. The antibody may further be recombinantly fused at its N-terminus or C-terminus to a heterologous polypeptide, or may be chemically linked (including covalent and non-covalent) to the polypeptide or other composition. . For example, the antibodies of the invention can be recombinantly fused or conjugated to molecules and effector molecules (eg, heterologous polypeptides, drugs, or toxins) useful as labels in detection assays. For example, PCT publication WO92 / 08495;
WO91 / 14438; WO89 / 12624; US Patent No. 5,314,995
And European Patent No. 396,387.

The antibodies of the invention are modified (ie, covalently attached).
attachment) by derivatives of covalent attachment of any type of molecule to the antibody such that the antibody does not prevent it from producing an anti-idiotypic response. For example, without limitation, antibody derivatives include, for example, glycosylations, acetylations, pegylations, phosphorylations.
), Amidation, derivatization with known blocking / blocking groups, proteolytic cleavage, ligation to cellular ligands or other proteins, and the like. Numerous optional chemical modifications
It can be carried out by known techniques including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. In addition, the derivative may contain one or more non-classical amino acids.

The antibodies of the invention may be produced by any suitable method known in the art.
Polyclonal antibodies to the antigen of interest can be produced by various procedures well known in the art. For example, the polypeptides of the invention can be administered to a variety of host animals, including but not limited to rabbits, mice, rats, etc., to induce the production of serum containing polyclonal antibodies specific for the antigen. Various adjuvants can be used to increase the immunological response, depending on the host species, and Freund's (complete and incomplete), mineral gels such as aluminum hydroxide (mi
general gel), surface-active substances such as lysolecithin, pluronic (p
luuronic) polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and BCG (calumet-
Bacillus gellan) and potentially useful human adjuvants such as corynebacterium parvum. Such adjuvants are also well known in the art.

Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display techniques, or a combination thereof. For example, monoclonal antibodies can be produced using the hybridoma technology known in the art, including: Har
Low et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press
, 2nd edition, 1988); Hammerling et al., Monoclonal An.
tibodies and T-Cell Hybridomas 563-6
81 (Elsevier, NY 1981), which is incorporated by reference in its entirety. The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which the monoclonal antibody is produced.

Methods for producing and screening for particular antibodies using hybridoma technology are routine and well known in the art, and are discussed in detail in Example 11. Briefly, mice can be immunized with the polypeptides of the invention or cells expressing such peptides. Once an immune response is detected (eg,
Antigen-specific antibodies are detected in mouse sera), mouse spleens are harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable melanoma cells (eg cells from cell line SP20 available from the ATCC). Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed for cells secreting antibodies capable of binding the polypeptides of the invention by methods known in the art. Ascites fluid, which generally contains high levels of antibodies, can be produced by immunizing mice with positive hybridoma clones.

Accordingly, the invention provides a method of producing an antibody produced by a method comprising culturing a monoclonal antibody and a hybridoma cell secreting the antibody of the invention, wherein, preferably, this antibody The hybridoma is a hybridoma clone which secretes an antibody capable of binding to the polypeptide of the present invention by fusing splenocytes isolated from the immunized mouse with the antigen of the present invention using myeloma cells. Produced by screening the hybridomas resulting from the fusion.

Antibody fragments that recognize particular epitopes can be produced by known techniques. For example, Fab and F (ab) ′ 2 fragments of the invention are (Fa
It can be produced by proteolytic cleavage of immunoglobulin molecules using enzymes such as papain (to produce the b fragment) or pepsin (to produce the F (ab ') 2 fragment). F (ab ′) 2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain.

For example, the antibodies of the present invention can also be produced using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In particular, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (eg human or mouse). Phage expressing an antigen binding domain that binds to an antigen of interest can be selected or identified with the antigen (eg, using labeled antibody or antigen bound or supplemented to a solid surface or bead). Phage used in these methods are typically phage having the antibody domain of Fab, Fv or disulfide-stabilized Fv recombinantly fused to either the phage gene III protein or the phage gene VIII protein. Is a filamentous phage containing the fd and M13 binding domains expressed from E. coli. Examples of phage display methods that can be used to generate the antibodies of the invention include those disclosed below: Brinkman et al. Immunol. Method
s 182: 41-50 (1995); Ames et al., J. Am. Immunol. Me
thods 184: 177-186 (1995); Kettleboroug.
h et al., Eur. J. Immunol. 24: 952-958 (1994); Pe.
rsic et al., Gene 187 9-18 (1997); Burton et al., Ad.
vances in Immunology 57: 191-280 (1994)
); PCT application number PCT / GB91 / 01134; PCT publication WO 90/0
2809; WO 91/10737; WO 92/01047; WO 92/1.
8619; WO 93/11236; WO 95/15982; WO 95/2.
0401; and U.S. Patent Nos. 5,698,426; 5,223,409.
No. 5,403,484; No. 5,580,717; No. 5,427.
No. 908; No. 5,750,753; No. 5,821,047; No. 5,5.
No. 71,698; No. 5,427,908; No. 5,516,637; No. 5,780,225; No. 5,658,727; No. 5,733,743 and No. 5,969,108 (the above references are incorporated herein by reference in their entirety).

As described in the above references, after phage selection, the region encoding the antibody derived from the phage can be used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment. It can be separated and used and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast and bacteria (eg, as described in detail below). For example, techniques for recombinantly producing Fab, Fab 'and F (ab') 2 fragments can also be used using methods known in the art. Such methods are disclosed, for example, in: PCT Publication WO 92/22324; Mullinax et al., BioT.
techniques 12 (6): 864-869 (1992); and Saw.
ai et al., AJRI 34: 26-34 (1995); and Better et al., S.
science 240: 1041-1043 (1998) (these references are incorporated by reference in their entirety).

Examples of techniques that can be used to generate single chain Fvs and antibodies include US Pat. Nos. 4,946,778 and 5,258,498; Huston.
Et al., Methods in Enzymology 203: 46-88 (19.
91); Shu et al., PNAS 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, the use of chimeric, humanized or human antibodies may be preferred. A chimeric antibody is a molecule in which different parts of the antibody are derived from different animal species (for example, an antibody having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region). Methods for making chimeric antibodies are known in the art. For example, Morris
on, Science 229: 1202 (1985); Oi et al., BioTec.
hnies 4: 214 (1986); Gillies et al., (1989) J.
． Immunol. Methods 125: 191-202; US Pat. No. 5,
807,715; 4,816,567; and 4,816,397.
No., which are hereby incorporated by reference in their entireties. A humanized antibody is an antibody molecule from a non-human species antibody that binds to a desired antibody having one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule. .. Often, framework residues in the human framework regions will be replaced with the corresponding residue from the CDR donor antibody to alter (preferably improve) antigen binding. Substitutions of these frameworks are identified by methods well known in the art, for example modeling CDR and framework residue interactions to identify framework residues important for antigen binding, and at specific positions. By sequence comparison to identify unusual framework residues. (For example, Queen et al., US Pat. No. 5,585,089; Riechmann. Et al.
See Nature 332: 323 (1988). These are incorporated herein by reference in their entirety). Antibodies can be humanized using various techniques known in the art including the following: eg, CDR-grafting (European Patent No. 23).
No. 9,400; PCT Publication WO 91/09967; US Pat. No. 5,225,5.
39; 5,530,101 and 5,585,089), veneering or resurfacing.
ng) (European Patent Nos. 592,106; 519,596; Padlan,
Molecular Immunology 28 (4/5): 489-498
(1991); Studnicka et al., Protein Engineeri.
ng 7 (6): 805-814 (1994); Roguska et al., PNAS.
91: 969-973 (1994)), and chain shuffling (cha).
in shuffling (US Pat. No. 5,565,332).

Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. U.S. Pat. Nos. 4,444,887, 4,716,111; and PCT Publication W.
O 98/46645, WO 98/50433, WO 98/24893, W
See also O 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.

Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins but which are capable of expressing human immunoglobulin genes. For example, a complex of human heavy and light chain immunoglobulin genes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, human variable regions, constant regions and diversity regions (diversity)
region) can be introduced into mouse embryonic stem cells in addition to the human heavy chain gene and human light chain gene. The mouse heavy and light chain immunoglobulin genes can be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletions in the JH region interfere with endogenous antibody production. The modified embryonic stem cells are developed and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring that express human antibodies. The transgenic mouse is loaded with the selected antigen (eg, all or part of a polypeptide of the invention).
To immunize in the usual manner. Monoclonal antibodies directed against the antigen are obtained from immunized transgenic mice using conventional hybridoma technology.
Human immunoglobulin transgenes are masked during B cell differentiation by rearrangement of transgenic mice and are followed by class switching and somatic mutations. Thus, the use of such techniques results in therapeutically useful IgG
Antibodies, IgA antibodies, IgM antibodies and IgE antibodies can be produced. For an overview of this technology for producing human antibodies, see Lonberg and Husza.
r (1995, Int. Rev. Immunol. 13: 65-93). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies, as well as protocols for producing such antibodies, see, eg, PCT Publications WO98 / 24893; WO96 / 34096; WO96 / 3.
3735; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,93.
See 9,598, which are hereby incorporated by reference in their entireties. In addition, Abgenix, Inc. Companies such as (Freemont, CA) and Genpharm (San Jose, CA) may be engaged in providing human antibodies directed against selected antigens using techniques similar to those described above.

Human antibodies that fully recognize the selected epitope were "guided (gui).
ed) selection ”. In this approach,
The selected non-human monoclonal antibody (eg, mouse antibody) is used to guide the selection of human antibodies that fully recognize the same epitope. (Jespers
Et al., Bio / technology 12: 899-903 (1988)) Furthermore, antibodies to the polypeptides of the invention produce anti-idiotypic antibodies that "mimic" the polypeptides of the invention using techniques well known to those of skill in the art. Can be used in sequence to do. (Eg Greenspan and Bona, FASEB
J. 7 (5): 437-444; (1989) and Nissinoff, J.
． Immunol. 147 (8): 2429-2438 (1991). ) For example, binding and multimerization of polypeptides
ization) and / or antibodies that competitively inhibit the binding of the polypeptides of the invention to ligands can be used to produce anti-idiotypes that “mimic” the multimerization and / or binding domains of the polypeptides, And consequently binds and neutralizes the polypeptide and / or its ligand.
Neutralization of such anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligands. For example, such anti-idiotypic antibodies can be used to bind a polypeptide of the invention and / or bind its ligand / receptor, and thereby block TNFR-mediated inhibition of apoptosis.

Polynucleotides Encoding Antibodies The present invention further provides polynucleotides comprising nucleotide sequences encoding the antibodies of the present invention and fragments thereof. The invention also provides for stringent or low stringency hybridization conditions (eg,
A polynucleotide encoding an antibody (as defined above), preferably an antibody which specifically binds to a polypeptide of the invention, preferably which binds to a polypeptide having the amino acid sequence of SEQ ID NO: 2 or 4. A polynucleotide that hybridizes to.

The polynucleotide may be obtained by any method known in the art and the nucleotide sequence of the polynucleotide determined. For example, if the nucleotide sequence of the antibody is known, the polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (eg, Kutmeier et al., B.
ioTechniques 17: 242 (1994)),
Briefly, this involves the following steps: synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligation of these oligonucleotides, followed by PCR of the linked oligonucleotides. amplification.

Alternatively, the polynucleotide encoding the antibody may be made from nucleic acid from an appropriate source. No clone containing a nucleic acid encoding a particular antibody is available, but if the sequence of the antibody molecule is known, the nucleic acid encoding the immunoglobulin is
A cDNA library made from a suitable source (eg, an antibody cDNA library, or any tissue or cell expressing an antibody (eg, a hybridoma cell selected for expression of an antibody of the invention), or therefrom. Synthetic primers capable of hybridizing the isolated nucleic acid (preferably poly A + RNA) to the 3'end or 5'end of the sequence, for example to identify a cDNA clone from a cDNA library encoding an antibody. It can be obtained by PCR amplification used or by cloning using oligonucleotide probes specific for particular gene sequences. The amplified nucleic acid produced by PCR is
It can then be cloned into a replicable cloning vector using any method known in the art.

Once the nucleotide sequence of the antibody and the corresponding amino acid sequence are determined,
Nucleotide sequences of antibodies can be prepared by methods well known in the art for manipulation of nucleotide sequences (eg, recombinant DNA technology, site-directed mutagenesis, PCR, etc. (eg,
Sambrook et al., 1990, Molecular Cloning, AL.
Laboratory Manual, 2nd Edition, Cold Spring Har
bor Laboratory, Cold Spring Harbor, NY
And Ausubel et al., 1998, Current Protocols.
in Molecular Biology, John Wiley & Sons
, NY. Both are incorporated herein by reference in their entirety. )) Can be engineered with to produce antibodies with different amino acid sequences to generate, for example, amino acid substitutions, deletions, and / or insertions.

In certain embodiments, the amino acid sequences of the variable domains of the heavy and / or light chains are identified by methods well known in the art for identification of sequences of complementarity determining regions (CDRs) (eg, sequence Other heavy chains to determine hypervariable regions,
And by comparing the variable region of the light chain with a known amino acid sequence). Using conventional recombinant DNA techniques, one or more CDRs may be inserted within the framework regions as described above (eg, into the human framework regions for humanizing non-human antibodies). . This framework region can be a naturally occurring region, or a consensus framework region, and preferably a human framework region (eg C for the listed human framework regions.
hothia et al. Mol. Biol. 278: 457-479 (1998).
checking). Preferably, the polynucleotide produced by the combination of the framework regions and CDRs encodes an antibody that specifically binds to a polypeptide of the invention. Preferably, as discussed above, one or more amino acid substitutions may be made within the framework regions, and preferably the amino acid substitutions improve the binding of the antibody to its antigen. Furthermore, such a method
It can be used to make amino acid substitutions or deletions of cysteine residues in one or more variable regions involved in intrachain disulfide bonds, so as to create antibody molecules lacking one or more intrachain disulfide bonds. . Other changes to the polynucleotide are
Included by the present invention and in the art.

Furthermore, techniques developed to produce “chimeric antibodies” by splicing genes from a mouse antibody molecule of suitable antigen specificity with genes from a human antibody molecule of suitable biological activity. (Morrison et al., Proc. N.
atl. Acad. Sci. 81: 851-855 (1984); Neuber.
ger et al., Nature 312: 604-608 (1984); Takeda.
Et al., Nature 314: 452-454 (1985)). As mentioned above, a chimeric antibody is a molecule in which different portions are derived from different animal species, such molecules having variable regions derived from the constant regions of mouse mAb and human immunoglobulin (eg, human Antibody).

Alternatively, techniques described for the production of single chain antibodies (US Pat. No. 4,694,
778; Bird, Science 242: 423-42 (1988); H.
uston et al., Proc. Natl. Acad. Sci. USA 85: 587.
9-5883 (1988); and Ward et al., Nature 334: 544.
-54 (1989)) can be adapted to the production of single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region through amino acid bridges, yielding single chain polypeptides. E. Techniques for the assembly of functional Fv fragments in E. coli can also be used (Sk
erra et al., Science 242: 1038-1041 (1988)).

Methods of Producing Antibodies The antibodies of the invention may be produced by any method known in the art for synthesizing antibodies, particularly by chemical synthesis or, preferably, by recombinant expression techniques. Can be done.

Antibodies of the invention, or fragments, derivatives or analogs thereof (eg,
Recombinant expression of the heavy or light chain of an antibody of the invention requires construction of an expression vector containing a polynucleotide encoding the antibody. Once the polynucleotide encoding the antibody molecule of the invention or the heavy or light chain of the antibody, or a portion thereof (preferably containing the variable domain of the heavy or light chain) is obtained, production of the antibody molecule Vectors for can be produced by recombinant DNA technology using techniques well known in the art. Accordingly, methods for preparing a protein by expression of a polynucleotide containing an antibody encoding a nucleotide sequence are described herein. Methods well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DN.
A technology, synthetic technology, and in vivo gene recombination. Accordingly, the invention provides a replicable vector comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter. To do. Such vectors include constant regions of antibody molecules (eg, PCT Publication WO86 / 05807; PCT Publication WO89).
/ 01036; and US Pat. No. 5,122,464) and a variable domain of an antibody that can be cloned into such a vector for full expression of the heavy or light chain. obtain.

The expression vector is transferred into a host cell by conventional techniques, and the transfected cells are then cultured by conventional techniques to produce the antibody of the invention. Accordingly, the invention includes a host cell containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, operably linked to a heterologous promoter. In a preferred embodiment for expression of double-chain antibodies, the vectors encoding both heavy and light chains are co-expressed in a host cell for total expression of immunoglobulin molecules, as detailed below. Can be done.

A variety of host expression vector systems may be utilized to express the antibody molecule of the present invention. Such host expression systems represent vehicles in which the coding sequence of interest may be produced and subsequently purified, but also in situ when transformed or transfected with sequences encoding the appropriate nucleotides. 2 represents a cell capable of expressing an antibody molecule of the invention. These include bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody-encoding sequences (eg E. coli, B. subtilis (sub).
microorganisms such as yeasts transformed with a recombinant yeast expression vector containing a sequence encoding an antibody (eg, Saccharomyces, Pich).
ia); an insect cell line infected with a recombinant viral expression vector (eg, baculovirus) containing a sequence encoding an antibody; a recombinant viral expression vector (eg, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV)
) Infected plant cell line or a plant cell line transformed with a recombinant plasmid expression vector containing a sequence encoding an antibody (eg Ti plasmid); or a promoter derived from the genome of a mammalian cell (eg metallothionein). Promoter) or a promoter derived from a mammalian virus (eg, adenovirus late promoter; vaccinia virus 7.5K promoter) and a mammalian cell line (eg, COS, CHO) carrying a recombinant expression construct.
, BHK, 293, 3T3 cells). Preferably bacterial cells such as Escherichia coli, and more preferably eukaryotic cells, especially for the expression of whole recombinant antibody molecules, are used for the expression of the recombinant antibody molecules. For example, in combination with a vector such as the major immediate early gene promoter element from human cytomegalovirus,
Mammalian cells such as Chinese hamster ovary cells (CHO) are effective expression systems for antibodies (Föcking et al., Gene 45: 101 (
1986); Cockett et al., Bio / Technology 8: 2 (19).
90)).

In bacterial systems, many expression vectors may be advantageously selected depending upon the use intended for the expression of the antibody molecule. For example, if large quantities of such proteins are to be produced, vectors may be desired that direct high levels of expression of the fusion protein product, which are easily purified for the production of pharmaceutical compositions of antibody molecules. In such a vector, the antibody-encoding sequence may be separately ligated in frame to the vector along with the lacZ-encoding region, such that a fusion protein is produced.
coli expression vector pUR278 (Ruther et al., EMBO J. 2:17).
91 (1983)); pIN vector (Inouye & Inouye, Nucl.
eic Acids Res. 13: 3101-3109 (1985); Van.
Heeke & Schuster, J. Biol. Chem. 24: 5503-
5509 (1989)) and the like, but are not limited thereto. pGEX
Vectors can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general,
Such fusion proteins are soluble and can be easily purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vector is designed to contain a thrombin or factor Xa protease cleavage site so that the cloned target gene product can be released from the GST moiety.

In an insect system, Autographa californica nuclear polyhedrosis virus (Aut
ographa California nuclear polyhedr
osis virus) (AcNPV) is used as a vector to express foreign genes. The virus is Spodoptera frugi
Proliferates in perda cells. The antibody coding sequence may be individually cloned into a nonessential region of the virus (eg, the polyhedrin gene) and placed under control of an AcNPV promoter (eg, the polyhedrin promoter).

Many viral-based expression systems can be utilized in mammalian host cells. When an adenovirus is used as an expression vector, the sequence of interest encoding the antibody can be linked to an adenovirus transcription / translation control complex (eg, a late promoter and a tripartite leader sequence). This chimeric gene can then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion into a nonessential region of the viral genome (eg region E1 or E3) results in a recombinant virus that survives in the infected host and is capable of expressing antibody molecules. (For example, Logan & Shenk, Proc. Natl. Ac
ad. Sci. USA 81: 355-359 (1984)). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, this start codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be increased by including appropriate transcription enhancer elements, transcription terminators, etc. (Bittner et al., Meth).
ods in Enzymol. 153: 51-544 (1987)).

In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (eg, glycosylation) and processing (eg, cleavage) of protein products can be important for protein function. Different host cells have characteristic and unique mechanisms for post-translational processing and modification of protein and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells may be used that have the cellular machinery for proper processing of the primary transcript, glycosylation of the gene product, and phosphorylation. Such mammalian host cells include CHO, VERY, BHK, Hela, COS, M
DCK, 293, 3T3, WI38 and, in particular, breast cancer cell lines (eg BT
483, Hs578T, HTB2, BT20 and T47D) as well as normal mammary gland cell lines such as CRL7030 and Hs578Bst.

Stable expression is preferred for long-term, high-yield production of recombinant proteins.
For example, cell lines that stably express the antibody molecule can be engineered. Rather than the use of expression vectors containing viral origins of replication, the host cell is controlled by appropriate expression control elements (eg, promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.) and selectable markers. It can be transformed with DNA. Following the introduction of exogenous DNA, engineered cells can be grown for 1-2 days in concentrated medium and then switched to selective medium. A selectable marker in the recombinant plasmid confers resistance to selection and allows cells to stably integrate the plasmid into their chromosomes and proliferate, forming a lesion that can then be cloned and propagated into the cell line. . This method can be advantageously used to engineer cell lines expressing antibody molecules. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.

Many selection systems may be used, including herpes simplex virus thymidine kinase (Wigler et al., Cell 11: 223 (1977)), which may be used in tk-, hgprt-, or aprt- cells, respectively. Hypoxanthine-guanine phosphoribosyl transferase (Szybalska and S
zybalski, Proc. Natl. Acad. Sci. USA 48: 2
02 (1992)), and adenine phosphoribosyl transferase (Lo
wy et al., Cell 22: 817 (1980)) gene, but is not limited thereto. Antimetabolite resistance can also be used as the basis for selection of the following genes: dhfr, which confers resistance to methotrexate (Wigler et al.,
Natl. Acad. Sci. USA 77: 357 (1980)); O'Ha.
Re et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1
981); gpt which confers resistance to mycophenolic acid (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78: 2072 (
1981)); conferring resistance to aminoglycoside G-418 neo (Clin
ic Pharmacy 12: 488-505; Wu and Wu, Bio.
therapy 3: 87-95 (1991); Tolstosev, Ann.
． Rev. Pharmacol. Toxicol. 32: 573-596 (19
93); Mulligan, Science 260: 926-932 (199).
3); and Morgan and Anderson, Ann. Rev. Bio
chem. 62: 191-217 (1993); May 1993, TIB TE.
CH 11 (5): 155-215); as well as hygro conferring resistance to hygromycin (Santerre et al., Gene 30: 147 (1984)).
. Recombinant DNA technology methods generally known in the art can be routinely applied to the selection of desired recombinant clones, and such methods are described, for example, in Ausub.
el et al. (ed.), Current Protocols in Molecular
r Biology, John Wiley & Sons, NY (1993); K.
riegler, Gene Transfer and Expression
, A Laboratory Manual, Stockton Press,
NY (1990); and Dracopoli et al. (Eds.), Current P.
rotocols in Human Genetics, John Wile
y & Sons, NY (1994) chapters 12 and 13; Colberre-Ga.
rapin et al. Mol. Biol. 150: 1 (1981), which are incorporated herein by reference in their entirety.

Expression levels of antibody molecules can be increased by vector amplification (for a review, Bebbington and Hentschel, The use of).
vectors based on gene amplification
for the expression of cloned genes i
n mammalian cells in DNA cloning, Volume 3 (Academic Press, New York, 1987)). If the marker can be amplified in the vector system expressing the antibody, increasing the level of inhibitor present in the culture medium of the host cell will increase the number of copies of the marker gene. The production of this antibody is also increased due to the binding of this amplified region to the antibody gene (Crouse et al., Mol. Cell. Biol. 3: 257.
(1983)).

The host cell is co-expressed with two expression vectors of the invention, a first vector encoding a polypeptide derived from the heavy chain and a second vector encoding a polypeptide derived from the light chain. Can be transfected. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes both heavy and light chain polypeptides and allows for expression thereof. In such a situation, this light chain should be placed before the heavy chain to avoid excess toxic free heavy chain (Proudfoot, Nature 322: 52 (1986);
Kohler, Proc. Natl. Acad. Sci. USA 77: 219.
7 (1980)). The coding sequences for the heavy and light chains may be cDNA or genomic DN.
A may be included.

Once the antibody molecule of the present invention is produced by animal, chemical synthesis, or recombinant expression, the antibody molecule may be prepared by any method known in the art for purification of immunoglobulin molecules (eg, , Chromatography (eg, ion exchange chromatography, affinity (particularly by protein A followed by affinity for a specific antigen) chromatography, and sizing column chromatography), centrifugation, by differential solubility, or by protein purification. Can be purified by any other standard technique).

Antibody Conjugates The present invention provides a polypeptide of the invention (or a portion thereof, preferably at least 10, 20 or 50 of the polypeptide) for producing a fusion protein.
Individual amino acids) or chemically bound (including both covalent and non-covalent) antibodies. This fusion need not necessarily be direct, but can occur via a linker sequence. The antibody is a polypeptide of the invention (or a portion thereof, preferably at least 10 of the polypeptide,
Specific for antigens other than 20 or 50 amino acids). For example, an antibody is obtained by fusing or binding a polypeptide of the invention, either in vitro or in vivo, to an antibody specific for a particular cell surface receptor, thereby causing the polypeptide of the invention to bind to a particular cell type. Can be used to target Antibodies fused or conjugated to the polypeptides of the invention can also be used in in vitro immunoassays and purification methods using methods known in the art. See, eg, Harbor et al., Supra and PCT Publication WO 93/212232; E.
P 439,095; Naramura et al., Immunol. Lett. 39:
91-99 (1994); U.S. Pat. No. 5,474,981; Gillies et al., PNAS 89: 1428-1432 (1992); Fell et al., J. Am. Imm
unol. 146: 2446-2452 (1991), which are incorporated by reference in their entirety.

The invention further includes compositions comprising a polypeptide of the invention fused or attached to a domain of an antibody other than the variable region. For example, the polypeptides of the present invention can be fused or conjugated to the Fc region of an antibody, or a portion thereof. The antibody portion fused to the polypeptide of the present invention comprises a constant region, a hinge region, a CH1 domain,
It may comprise the CH2 domain, and the CH3 domain, or any combination of all or part of those domains. The polypeptide can also be fused or conjugated to the antibody moieties described above to form multimers. For example, an Fc portion fused to a polypeptide of the invention may form a dimer via a disulfide bond between the Fc portions. Higher order multimeric forms can be made by fusing the polypeptide to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of the present invention to antibody moieties are known in the art. For example, US Pat. Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,9
46; EP 307,434; EP 367,166; PCT publication WO 96.
/ 04388; WO 91/06570; Ashkenazi et al., Proc. N
atl. Acad. Sci. USA 88: 10535-10539 (1991).
); Zheng et al. Immunol. 154: 5590-5600 (199
5); and Vil et al., Proc. Natl. Acad. Sci. USA 89
11337-11341 (1992) (references cited above are incorporated by reference in their entirety).

As discussed above, the polypeptides of the present invention can be fused or conjugated to the antibody moieties described above to increase the in vivo half-life of the polypeptide, or by methods known in the art. Used in the immunoassay used. Furthermore, the polypeptides of the present invention can be fused or conjugated to the antibody moieties described above to facilitate purification. One reported example is the first two of the human CD4 polypeptides.
A chimeric protein consisting of one domain and various domains of the constant region of the heavy or light chain of a mammalian immunoglobulin is described. (EP 394,827;
Traunecker et al., Nature 331: 84-86 (1988)).
Polypeptides of the invention fused or bound to an antibody having a disulfide-linked dimeric structure (due to IgG) may also bind and neutralize other molecules than monomeric secreted proteins or protein fragments alone. Can be more efficient at. (Funtoulakis et al., J. Biochem. 270: 39.
58-3964 (1995)). In many cases, the Fc portion of the fusion protein will be of therapeutic and diagnostic benefit, and thus may result in, for example, improved pharmacokinetic properties. (EP A 232, 262). Alternatively, deletion of the Fc portion after the fusion protein has been expressed, detected and purified is preferred. For example, if the fusion protein is used as an antigen for immunization, the Fc
Proteins can interfere with treatment and diagnosis. In drug development, for example, human proteins (eg hIL-5) were fused to Fc proteins for the purpose of high throughput screening assays to identify antagonists of hIL-5. (Bennett et al., J. Molecular Recogni.
8: 52-58 (1995); Johnson et al. Bio
l. Chem. 270: 9459-9471 (1995)).

Furthermore, the antibodies of the invention or fragments thereof may be fused to a marker sequence, such as a peptide that facilitates purification. In a preferred embodiment, the marker amino acid sequence is, inter alia, the pQE vector (QIAGEN, Inc.
, 9259 Eton Avenue, Chatsworth, CA, 9131.
Hexa-histidine peptides such as the tags provided in 1), many of which are commercially available. For example, Gentz et al., Proc. Natl. Ac
ad. Sci. Hexa-histidine provides convenient purification of the fusion protein, as described in USA 86: 821-824 (1984). Other peptide tags useful for purification include the "HA" tag corresponding to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (19).
84)) and "flag" tags.

The present invention further includes antibodies or fragments thereof that bind to a diagnostic or therapeutic agent. The antibody can be used diagnostically, for example, to monitor tumor development or progression as part of a clinical trial procedure (eg, to determine the efficacy of a given therapeutic regimen). Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances, radioactive substances, positron emitting metals using various positron emission tomography, and non-radioactive paramagnetic metals. Ions are mentioned. See, eg, US Pat. No. 4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent substances include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent substances include luminol; bioluminescent substances Examples include luciferase, luciferin, and aequorin; examples of suitable radioactive substances include ¹²⁵ I, ¹³¹ I, ¹¹¹ In or ⁹⁹ Tc.

In addition, the antibody or fragment thereof can be conjugated to a cytotoxin (eg, cytostatic or cytocidal agent), therapeutic agent or therapeutic moiety such as a radioactive metal ion. Cytotoxic or cytotoxic agents include any agent that is harmful to cells. Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposid.
e), vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoid,
Included are procaine, tetracaine, lidocaine, propranolol, and puromycin and their analogs or homologs. The therapeutic agents include antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (eg, mechlorethamine, thioepa chlorambucil, melphalan, carmustine ( BSNU) and lomustine (CCNU), cyclotosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C
, And cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracycline (eg, daunorubicin (formerly daunomycin), and doxorubicin), antibiotics (eg, dactinomycin (formerly actinomycin)). , Bleomycin, mithramycin, and anthramycin (AMC), and anti-mitotic agents such as vincristine and vinblastine.

The conjugates of the invention can be used for the modification of a given biological response and the therapeutic agent or drug moiety should not be construed as limited to classical chemotherapeutic agents. . For example, the drug moiety can be a protein or polypeptide that possesses the desired biological activity. Such proteins include, for example, toxins such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; tumor necrosis factor, α-interferon, β-interferon, nerve growth factor, platelet-derived growth factor, tissue plasminose. Gen-activators, thrombotic agents or anti-angiogenic agents (eg angiostatin or endostatin (en
dostatin)); or biological response modifiers (eg, lymphokines, interleukin-1 (“IL-1”), interleukin-2 (“IL-2”), interleukin-6 ( "IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor (
"G-CSF"), or other growth (proliferation) factors and the like.

Antibodies can also be attached to a solid support that is particularly useful for immunoassay or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Techniques for coupling such therapeutic moieties to antibodies are well known, eg Arnon.
Et al., "Monoclonal Antibodies For Immuno.
targeting Of Drugs In Cancer Therapy "
Monoclonal Antibodies And Cancer The
rapid, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Lis.
s, Inc. 1985); Hellstrom et al., "Antibodies F."
or Drug Delivery "Controlled Drug Del
Ivery (2nd edition), Robinson et al. (eds.), pp. 623-53 (Marc.
el Dekker, Inc. 1987); Thorpe, "Antibody
Carriers Of Cytotoxic Agents In Can
cer Therapy: A Review ”Monoclonal Anti
bodies'84: Biological And Clinical Ap
applications, Pinchera et al. (eds.), pp. 475-506 (198).
5); "Analysis, Results, And Future Pros
selective Of The Therapeutic Use Of Ra
diolabeled Antibody In Cnacer Therap
y ”Monoclonal Antibodies For Cancer D
inspection And Therapy, Baldwin et al. (eds.), 303
-16 (Academic Press 1985) and Thorpe et al.,
"The Preparation And Cytotoxic Prop
"Arties Of Antibody-Toxin Conjugates",
Immunol. Rev. 62: 119-58 (1982).

Alternatively, the antibody is conjugated to a secondary antibody and the antibody heteroconjugate as described by Segal in US Pat. No. 4,676,980, which is incorporated herein by reference in its entirety. A body (heteroconjugate) may be formed.

Antibodies, with or without a therapeutic moiety attached to the antibody, administered alone or in combination with cytotoxic factors and / or cytokines, can be used as therapeutic agents.

Assays for Antibody Binding The antibodies of the invention can be assayed for immunospecific binding by any method known in the art. Immunoassays that may be used include (Western blot, radioimmunoassay, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassay, to name just a few).
Competitive and non-competitive assays using such techniques as immunoprecipitation assay, precipitation reaction, gel diffusion precipitation reaction, immunodiffusion assay, agglutination assay, complement fixation assay, immunoradiometric assay, fluorescent immunoassay, protein A immunoassay. Systems, but are not limited to. Such assays are routine,
And are well known in the art (eg, Ausubel et al., Ed., 1994, Current Protocol, which is incorporated herein by reference in its entirety).
ols in Molecular Biology, Volume 1, John Wi
ley & Sons, Inc. , New York). Exemplary immunoassays are briefly described below (although these are not intended to be limiting).

Immunoprecipitation protocols generally involve RIPA buffer (1% NP-40 or Trito) supplemented with protein phosphatase and / or protease inhibitors (eg, EDTA, PMSF, aprotinin, sodium vanadate).
nX-100, 1% sodium deoxycholate, 0.1% SDS, 0.
0.01 M sodium phosphate, 15% NaCl, pH 7.2, 1% Tr
lysing a population of cells in a lysis buffer such as asylol), adding the antibody of interest to the cell lysate, incubating at 4 ° C. for a period of time (eg 1-4 hours), protein A and / Or adding Protein G Sepharose beads to the cell lysate, incubating at 4 ° C for about 1 hour or more, washing the beads in lysis buffer, and resuspending the beads in SDS / sample buffer Including the step of The ability of the antibody of interest to immunoprecipitate a particular antigen can be assayed, for example, by Western blot analysis. One of skill in the art will be able to discern parameters that can be modified to increase binding of antibody to antigen and to reduce background (eg, preclearing cell lysates with Sepharose beads). . For further discussion on immunoprecipitation protocols, see, eg, Ausubel et al., Eds., 1994, Current P.
rotocols in Molecular Biology, Volume 1, Jo
hn Wiley & Sons, Inc. , New York, 10.16.
See 1.

Western blot analysis generally involves the steps of preparing a protein sample, a polyacrylamide gel of the protein sample (eg 8 depending on the molecular weight of the antigen).
% -20% SDS-PAGE), transferring the protein sample from its polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking solution (eg 3% BSA or skim milk powder) Blocking the membrane in PBS), washing the membrane with a wash buffer (eg,
Washing in PBS-Tween 20), blocking the membrane with primary antibody (antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking buffer Using a secondary antibody (eg recognizing the primary antibody, eg an anti-human antibody) conjugated to an enzyme substrate (eg horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (eg 32P or 125I) diluted in Blocking the membrane, washing the membrane in wash buffer, and detecting the presence of the antigen. One of ordinary skill in the art will be aware of parameters that can be modified to increase the signal detected and to reduce background noise. For further discussion on Western blot protocols, see, eg, Ausubel et al., Eds., 1994, Current Protocols in Molecular.
Biology, Volume 1, John Wiley & Sons, Inc. ，
See New York, 10.8.1.

ELISA involves preparing an antigen, coating the wells of a 96-well microtiter plate with the antigen, binding a detectable compound such as an enzyme substrate (eg horseradish peroxidase or alkaline phosphatase). The antibody of interest is added to the well and incubated for a period of time, and the presence of antigen is detected. In the ELISA, the antibody of interest need not be bound to the detectable compound; instead, a second antibody (which recognizes the antibody of interest) bound to the detectable compound can be added to the wells. Further, instead of coating the well with the antigen, the antibody can be coated to the well. In this case, a second antibody conjugated to a detectable compound can be added subsequent to the addition of the antigen of interest to the coated wells. One of ordinary skill in the art will be aware of parameters that can be modified to increase the signal detected, and other variations of the ELISA known in the art. For further discussion on ELISA, see, eg, Ausubel et al., Ed., 1994, Cur.
rent Protocols in Molecular Biology,
Volume 1, John Wiley & Sons, Inc. , New York,
See 11.2.1.

Antibody binding affinity for antigen and off-rate of antibody-antigen interaction (of
f-rate) can be determined by competitive binding assay. One example of a competitive binding assay is a radioimmunoassay, which involves incubating a labeled antigen (eg, 3H or 125I) with an antibody of interest in the presence of increasing amounts of unlabeled antigen, and labeling. Detection of antibody bound to the antigen. The affinity of the antibody of interest for a particular antigen, and the binding off-rate can be determined from the data by Scatchard plot analysis. Competition with the second antibody can also be determined using a radioimmunoassay. In this case, the antigen is the labeled compound (eg 3H or 125I) in the presence of increasing amounts of unlabeled secondary antibody.
A) antibody of interest conjugated to

Therapeutic Uses The present invention further relates to antibody-based therapies, which comprise the antibodies of the invention for treating one or more of the disclosed diseases in animals, preferably mammals. , And most preferably the step of administering to a human patient. The therapeutic compounds of the invention include the antibodies of the invention (including fragments, analogs and derivatives thereof, as described herein) and nucleic acids encoding the antibodies of the invention (described herein). Including fragments, analogs and derivatives thereof and anti-idiotypic antibodies). Antibodies of the invention include diseases and disorders associated with aberrant expression and / or activity of the polypeptides of the invention (including diseases and / or disorders such as autoimmune diseases and / or deficiencies described herein). Can be used to treat). Treatment and / or prevention of diseases and disorders associated with aberrant expression and / or activity of the polypeptides of the invention includes, but is not limited to, ameliorating the symptoms associated with those diseases and disorders. The antibodies of the present invention are known in the art or can be provided in a pharmaceutically acceptable composition as described herein.

One summary of how the antibodies of the invention may be used therapeutically is locally or systemically in the body, or (eg, by complement (CDC), or by effector cells (ADCC)). The direct cytotoxicity of the antibody (as mediated)
Conjugating a polynucleotide or polypeptide of the invention. Some of these approaches are described in more detail below. Given the teachings provided herein, one of ordinary skill in the art would be able to determine, without undue experimentation, how to use the antibodies of the invention for diagnostic, monitoring or therapeutic purposes. Recognize.

The antibodies of the invention may be other monoclonal or chimeric antibodies, or lymphokines or hematopoietic growth factors (eg IL-2, IL-2, IL-2, IL-2, IL-2, IL-2, IL-2, IL-2 IL-3 and IL
-7) and the like) can be advantageously used.

The antibodies of the invention can be administered alone or in combination with other types of treatments such as radiation therapy, chemotherapy, hormone therapy, immunotherapy and antitumor agents.
Generally, it is preferred to administer a species-sourced or species-reactive product that is the same species as the patient's species (in the case of antibodies). Thus, in a preferred embodiment, human antibodies,
The fragment derivative, analog, or nucleic acid is administered to a human patient for treatment or prevention.

A high affinity and / or for a polypeptide or polynucleotide of the invention, both for immunoassays relating to the polynucleotides or polypeptides of the invention, including fragments thereof, and in the treatment of disorders associated therewith. It is preferred to use potent in vivo inhibitory and / or neutralizing antibodies, fragments thereof, or regions thereof. Such antibodies, fragments or regions preferably have an affinity for the polynucleotides or polypeptides of the present invention, including fragments thereof. The preferred binding affinity is 5
^{X10 -6} M, 10 ^-6 M, 5 x 10 ^-7 M, 10 ^-7 M, 5 x 10 ^-8 M, 10 ^-8 M, 5
^{X10 -9} M, 10 ^-9 M, 5 x 10 ^-10 M, 10 ^-10 M, 5 x 10 ^-11 M, 10 ^-11 M
5 × 10 ^-12 M, 10 ^-12 M, 5 × 10 ^-13 M, 10 ^-13 M, 5 × 10 ^-14 M, 1
Binding affinities with dissociation constants or Kd less than 0 ^-14 M, ^{5x10 -15} M, and 10 ^-15 M are included.

Gene Therapy In certain embodiments, a nucleic acid comprising a sequence encoding an antibody or functional derivative thereof treats a disease or disorder associated with aberrant expression and / or activity of a polypeptide of the invention, Administered for the purpose of gene therapy to inhibit or prevent. Gene therapy refers to a therapy that is performed by administering an expressed or expressible nucleic acid to a subject. In this embodiment of the invention, the nucleic acids produce their encoded protein, which mediates a therapeutic effect.

Any method available in the art for gene therapy can be used in accordance with the present invention. An exemplary method is described below.

For a general review of methods of gene therapy, see Goldspiel et al., Cli.
Nal Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstos.
hev, Ann. Rev. Pharmacol. Toxicol. 32: 573
-596 (1993); Mulligan, Science 260: 926-.
932 (1993); and Morgan and Anderson, Ann.
Rev. Biochem. 62: 191-217 (1993); May, TIB.
See TECH 11 (5): 155-215 (1993). Methods generally known in the recombinant DNA art that can be used are described in Ausubel.
Et al., Current Protocols in Molecular
Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Express.
Ion, A Laboratory Manual, Stockton Pre
ss, NY (1990).

In a preferred aspect, the compound contains a nucleic acid sequence encoding an antibody, said nucleic acid sequence being an expression vector expressing the antibody, or fragment or chimeric protein thereof, or heavy or light chain thereof, in a suitable host. Is part of. In particular, such nucleic acid sequences have a promoter operably linked to the antibody coding region, said promoter being inducible or constitutive, and optionally tissue-specific. In another particular embodiment, nucleic acid molecules are used that flank the region encoding the antibody and any other desired sequences that facilitate homologous recombination at the desired site in the genome, thus rendering the antibody Provides intrachromosomal expression of the encoding nucleic acid (Koller and Smithies, Proc. N.
atl. Acad. Sci. USA 86: 8932-8935 (1989);
Zijlstra et al., Nature 342: 435-438 (1989)).
In a particular embodiment, the expressed antibody molecule is a single chain antibody; or the nucleic acid sequence comprises sequences encoding both the heavy and light chains of the antibody or fragments thereof.

Delivery of the nucleic acid to the patient can be direct (where the patient is directly exposed to the nucleic acid or nucleic acid-bearing vector) or indirect (where the cell is first transfected with the nucleic acid in vitro). Converted and then transplanted to the patient). These two approaches are known as in vivo gene therapy or as ex vivo gene therapy, respectively.

In certain embodiments, the nucleic acid sequences are directly administered in vivo, where they are expressed to produce the encoded product. This is accomplished by a number of methods known in the art, such as by constructing them as part of a suitable nucleic acid expression vector and administering it intracellularly (eg, defective or attenuated retroviral vectors). Viruses or other viral vectors (US Pat. No. 4,980)
, 286)), or by direct injection of naked DNA, or microparticle bombardment (eg, gene gun; Biol).
istic, Dupont), or by coating with lipids or cell surface receptors, or by transfecting agents, or by encapsulating them in liposomes, microparticles, or microcapsules, or By administering to a peptide that is known to enter, by administering to a ligand that undergoes receptor-mediated endocytosis (eg, Wu and Wu, J. Biol. Chem.
． 262: 4429-4432 (1987)), which can be used to target cell types that specifically express the receptor. In another embodiment, nucleic acid-ligand complexes can be formed where the ligand disrupts endosomes fusogenic.
) Contains viral peptides to ensure that the nucleic acid avoids lysosomal degradation. In yet another embodiment, the nucleic acids can be targeted in vivo for cell-specific uptake and expression by targeting specific receptors (eg, PCT Publication No. WO 92/06180 (April 1992). 16th (Wu et al.))
No. WO92 / 22635 (December 23, 1992 (Wilson et al.))
No. WO92 / 20316 (November 26, 1992 (Findeis et al.))
); WO 93/14188 (July 22, 1993 (Clarke et al.))
, WO 93/20221 (October 14, 1993 (Young)). Alternatively, the nucleic acid can be introduced inside the cell and incorporated into the host cell DNA for expression by homologous recombination (Koller and Sm.
ithies, Proc. Natl. Acad. Sci. USA 86: 893
2-8935 (1989); Zijlstra et al., Nature 342: 43.
5-438 (1989)).

In a specific embodiment, viral vectors that contain nucleic acid sequences that encode the antibodies of the invention are used. For example, a retroviral vector can be used (M
iller et al., Meth. Enzymol. 217: 581-599 (1993)
)checking). These retroviral vectors contain the necessary components for correct packaging of the viral genome and correct integration into host cell DNA. The nucleic acid sequence encoding the antibody used in gene therapy is cloned into one or more vectors, which facilitates delivery of the gene into patients. For more details on retroviral vectors, see Boesen et al., Bi.
others, 6: 291-302 (1994), which describes the use of retroviral vectors to deliver the mdrI gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Can be issued. Other references describing the use of retroviral vectors in gene therapy are: : Clowes et al. Clin. Invest. 93: 644-651 (1
994); Kiem et al., Blood 83: 1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therap
y 4: 129-141 (1993); and Grossman and Wil.
son, Curr. Opin. in Genetics and Devel.
3: 110-114 (1993).

Adenovirus is another viral vector that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to respiratory epithelia. Adenovirus naturally infects respiratory epithelia where it causes mild disease. Other targets of adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenovirus has the advantage that it can infect non-dividing cells. Kozarsky and Wilson, Curr
ent Opinion in Genetics and Developopm
ent 3: 499-503 (1993) provides an overview of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3.
-10 (1994) demonstrated the use of adenoviral vectors to transfer genes to the rhesus monkey respiratory epithelium. Other examples of the use of adenovirus in gene therapy are described by Rosenfeld et al., Science 252: 431-434 (19).
91); Rosenfeld et al., Cell 68: 143-155 (1992).
Mastrangeli et al., J .; Clin. Invest. 91: 225-2
34 (1993); PCT Publication No. WO 94/12649; and Wang et al.,
Gene Therapy 2: 775-783 (1995).
In a preferred embodiment, adenovirus vectors are used.

Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:
289-300 (1993); US Pat. No. 5,436,146).

Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer involves transfer of the selectable marker to the cells. The cells are then subjected to selection to isolate those cells that take up and express the transferred gene.
The cells are then delivered to the patient.

In this embodiment, the nucleic acid is introduced into the cell prior to in vivo administration of the resulting recombinant cell. Such introduction can be performed by any method known in the art, including but not limited to: transfection, electroporation, microinjection, viruses including nucleic acid sequences. Infection with vector or bacteriophage vector, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Many techniques are known in the art for introducing foreign genes into cells (eg, Loeffler and Behr, Met.
h. Enzymol. 217: 599-618 (1993); Cohen et al., M.
eth. Enzymol. 217: 618-644 (1993); Cline,
Pharmac. Ther. 29: 69-92m (1985)),
And if the necessary developmental and physiological functions of the recipient cells are not disrupted, they can be used according to the invention. This technique should provide for stable transfer of the nucleic acid to the cell so that the nucleic acid is expressible by the cell, preferably heritable and expressible by the progeny of the cell.

The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (eg, hematopoietic stem cells or hematopoietic progenitor cells) are preferably administered intravenously. The amount of cells contemplated for use depends on the desired effect, patient condition, etc. and can be determined by one of skill in the art.

Cells into which nucleic acids can be introduced for purposes of gene therapy include any desired available cell type, including but not limited to: epithelial cells, endothelial cells,
Keratinocytes, fibroblasts, muscle cells, hepatocytes; T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, blood cells such as granulocytes; various stem cells or progenitor cells, In particular, hematopoietic stem cells or hematopoietic progenitor cells (eg cells such as those obtained from bone marrow, cord blood, peripheral blood, fetal liver, etc.).

In a preferred embodiment, the cells used for gene therapy are autologous to the patient.

In embodiments where recombinant cells are used in gene therapy, the nucleic acid sequences encoding the antibody are introduced into the cells such that the nucleic acid sequences are expressible by the cells or their progeny, and then the recombinant cells are , Administered in vivo for therapeutic effects. In a specific embodiment, stem cells or progenitor cells are used. Any stem and / or progenitor cells that can be isolated in vitro and maintained in vitro can potentially be used according to this embodiment of the invention (
For example, PCT Publication No. WO 94/08598: Temple and Ande.
rson, Cell 71: 973-985 (1992); Rheinwald.
, Meth. Cell Bio. 21A: 229 (1980); and Pit
telkow and Scott, Mayo Clinic Proc. 61: 7
71 (1986)).

In a specific embodiment, the nucleic acid to be introduced for the purpose of gene therapy contains an inducible promoter operably linked to the coding region, such that expression of the nucleic acid results in proper transcription induction. It can be controlled by controlling the presence or absence of the factor.

Demonstration of Therapeutic or Prophylactic Activity The compounds or pharmaceutical compositions of the invention are preferably tested in vitro prior to use in humans and then in vivo for the desired therapeutic or prophylactic activity. To be done. For example, in vitro assays to demonstrate therapeutic or prophylactic utility of a compound or pharmaceutical composition include the effect of the compound on cell lines or patient tissue samples. The effect of a compound or composition on cell lines and / or tissue samples can be determined utilizing techniques known to those of skill in the art, including but not limited to rosette formation assays and cytolytic assays. In vitro assays that can be used in accordance with the present invention to determine if administration of a particular compound is indicated include in vitro cell culture assays, in which a patient tissue sample is grown in culture, The compound is then exposed or otherwise administered and the effect of such compound on the tissue sample is observed.

Therapeutic / Prophylactic Administration and Compositions The present invention provides for treatment, inhibition and prophylaxis by administration to a subject of an effective amount of a compound or pharmaceutical composition of the invention, preferably an antibody of the invention. To provide a method. In a preferred aspect, the compound is substantially purified (eg, substantially free of substances that limit its effect or produce undesired side effects). The subject is preferably
Animals such as but not limited to cows, pigs, horses, chickens, cats, dogs, and the like, and preferably mammals, and most preferably humans.

Formulations and methods of administration that can be used when the compound comprises nucleic acids or immunoglobulins are described above; additional suitable formulations and routes of administration are selected from among those described herein below. Can be done.

Various delivery systems are known and can be used to administer the compounds of the invention (eg, liposomes, microparticles, microcapsules, encapsulation in recombinant cells capable of expressing the compound). , Receptor-mediated endocytosis (
For example, Wu and Wu, J .; Biol. Chem. 262: 4429-443
2 (1987)), the construction of nucleic acids as part of retroviruses or other vectors). Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compound or composition may be administered by any convenient route, such as by infusion or bolus injection, by absorption through the epithelial or mucosal lining, such as the oral, rectal and intestinal mucosa, and other It can be administered with a biologically active agent. Administration can be systemic or local. Further, the pharmaceutical compounds or compositions of the invention may be administered by any suitable route, including intraventricular and intrathecal injections; intraventricular injection may be for example, intraventricular injection attached to a reservoir, such as the Ommaya reservoir. Introduction to the central nervous system by means of a catheter). Pulmonary administration may also be employed, eg, by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In a specific embodiment, it may be desirable to administer the pharmaceutical compound or composition of the invention locally to the area in need of treatment; this is for example, but not limited to, Local injection during surgery, topical application (eg, in combination with post-surgical wound dressing), injection, catheter, suppository, or implant (the implant being a membrane such as a sialastic membrane). Or a porous, non-porous, or glue-like material, including fibers). Preferably, in administering a protein of the invention, including antibodies, care must be taken to use materials that do not absorb the protein.

In another embodiment, the compound or composition can be delivered into vesicles, particularly liposomes (Langer, Science 249: 1527-1533 (
1990); Treat et al., Liposomes in the Therap.
y of Infectious Disease and Cancer, L
opez-Berestein and Fidler (ed.), Liss, New
York, pp. 353-365 (1989); Lopez-Berestein,
Ibid, pages 317-327; see ibid.).

In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump may be used (Lang.
er, (supra); Sefton, CRC Crit. Ref. Biomed. E
ng. 14: 201 (1987); Buchwald et al., Surgery 88.
: 507 (1980); Saudek et al., N .; Engl. J. Med. 321
574 (1989)). In another embodiment, polymeric materials may be used (Medical Applications of Control).
led Release, Langer and Wise (ed.), CRC Pre
s. , Boca Raton, Florida (1974); Control
ed Drug Bioavailability, Drug Product
Design and Performance, Smolen and Bal
1 (eds.), Wiley, New York (1984); Ranger and P.
eppas, J .; Macromol. Sci. Rev. Macromol. Ch
em. 23:61 (1983); Levy et al., Science 2
28: 190 (1985); During et al., Ann. Neurol. 25: 3
51 (1989); Howard et al., J. Am. Neurosurg. 71: 105 (
1989) also). In yet another embodiment, the controlled release system can be placed near the therapeutic target, ie, the brain, thus requiring only a portion of the systemic dose (eg, Goodson, Medical Applicat).
ions of Controlled Release, (supra), Volume 2,
115-138 (1984)).

Other controlled release systems are discussed in the review by Langer (Science 249: 1527-1533 (1990)).

In a specific embodiment, wherein the compound of the invention is a protein-encoding nucleic acid, the nucleic acid constitutes it as part of a suitable nucleic acid expression vector and is such that it is intracellular. By administration (eg, by use of retroviral vectors (see US Pat. No. 4,980,286), or by direct injection, or microparticle bombardment (eg, gene gun; Biolis).
Tic, Dupont) or by coating with a lipid or cell surface receptor or transfecting agent, or in combination with a homeobox-like peptide known to enter the nucleus (eg,
Joliot et al., Proc. Natl. Acad. Sci. USA 88:18
64-1868 (see 1991)) and the like, so as to enhance the expression of the encoded protein in vivo. Alternatively, the nucleic acid can be introduced intracellularly and incorporated into host cell DNA for homologous recombination for expression.

The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" has been approved by the Federal Regulatory Authority or the U.S. Government for use in animals, and more particularly in humans, or in the United States Pharmacopeia or other Means that it is listed in the generally accepted pharmacopoeia.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers include sterile liquids such as water and oils, including oils of petroleum, animal, vegetable or synthetic origin (eg, peanut oil, soybean oil, mineral oil, sesame oil, etc.). Can be. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions, and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene. , Glycol, water, ethanol and the like. The composition can, if desired, also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. Examples of suitable pharmaceutical carriers are E.I. W. "Reming" by Martin
ton's Pharmaceutical Sciences ". Such a composition comprises a therapeutically effective amount of the compound, preferably in purified form,
It is included with a suitable amount of carrier to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

In a preferred embodiment, the composition is formulated according to conventional procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. If desired, the composition can also include a solubilizer and a local anesthesia such as lignocaine to relieve pain at the site of injection. Generally, the components are either separately or mixed together in a single dosage form, eg, in ampoules or sachets (s) showing a fixed amount of active agent.
supplied as a lyophilized powder or water-free concentrate in a sealed container such as an achette). Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, the ingredients may be mixed prior to administration,
Ampoules of sterile water for injection or saline can be provided.

The compounds of the present invention may be formulated as neutral or salt forms. Pharmaceutically acceptable salts include salts formed with anions such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid and the like, and sodium, potassium, ammonium, calcium, ferric hydroxide, Isopropylamine, triethylamine,
Mention may be made of salts formed with cations such as those derived from 2-ethylaminoethanol, histidine, procaine and the like.

The amount of a compound of the invention that is effective in this treatment (suppression and prevention of diseases or disorders associated with aberrant expression and / or activity of the polypeptides of the invention) will be determined by standard clinical techniques. Can be done. In addition, in vitro assays may optionally be used to help identify optimal dosage ranges. Precise dosages to be used in the formulation will also depend on the route of administration, and the severity of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

For antibodies, the dosage administered to a patient is typically 0.1 mg to 100 mg per kg patient body weight. Preferably, the dosage administered to a patient is between 0.1 mg and 20 mg / kg of the patient's body weight, more preferably 1 mg to 10 mg / kg of the patient's body weight. In general, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, low dosages and infrequent administrations of human antibodies are often possible. Further, the dosage and frequency of administration of the antibodies of the invention may be altered (eg,
It can be reduced by enhancing antibody uptake by lipidation and the like and tissue penetration (eg into the brain).

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Notifications in the form prescribed by governmental agencies regulating the manufacture, use or sale of pharmaceutical or biological products may optionally be accompanied by such containers. This notice
It reflects the agency's approval of manufacture, use or sale for human administration.

Diagnostic and Imaging Labeled antibodies that specifically bind to the polypeptide of interest, and their derivatives and analogs thereof, have been used for diagnostic purposes to detect abnormal expression and expression of the polypeptides of the invention. Diseases and / or disorders associated with activity can be detected, diagnosed or monitored. The present invention provides for the detection of aberrant expression of a polypeptide of interest, which comprises (a) using one or more antibodies specific for the polypeptide of interest to target in a cell or body fluid of an individual. Assaying the expression of the polypeptide of
And (b) comparing the level of gene expression to the level of standard gene expression, whereby increasing or decreasing the level of assayed polypeptide gene expression compared to the standard level of expression. Shows abnormal expression.

The present invention provides a diagnostic assay for diagnosing a disorder, which assay comprises (
a) assaying the expression of the polypeptide of interest in cells or fluids of an individual using one or more antibodies specific for the polypeptide of interest, and (b) this gene expression level and standard Comparing the level of gene expression, whereby an increase or decrease in the assayed polypeptide gene expression level compared to its standard expression level is indicative of a particular disorder. With respect to cancer, the presence of relatively high amounts of transcripts in biopsied tissue from an individual may indicate a predisposition for the development of the disease or may provide a means for detecting the disease prior to the onset of actual clinical symptoms. Can be provided. A more definitive diagnosis of this type may allow health professionals to use preventative measures or early aggressive treatment, thereby preventing the development or further progression of cancer.

Assaying TR6-α and / or TR6-β polypeptide levels in a biological sample can occur using antibody-based techniques. The antibodies of the invention can be used to assay protein levels in biological samples using classical immunohistological methods known to those of skill in the art (eg, Jalkanen, M. et al., J. Chem.
Cell. Biol. 101: 976-985 (1985); Jalkanen.
, M .; Et al., J. Cell. Biol. 105: 3087-3096 (1987).
checking). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzymatic labels (eg,
Glucose oxidase); and radioisotopes (eg iodine ( ¹³¹ I, ¹²⁵ I, ¹²³ I, ¹²¹ I), carbon ( ¹⁴ C), sulfur ( ³⁵ S), tritium ( ³ H), indium ( ^{115 m} In, ^{113 m)} In, ¹¹² In, ¹¹¹ In), and technetium ( ⁹⁹ T
c, ^99m Tc), thallium ( ²⁰¹ Ti), gallium ( ⁶⁸ Ga, ⁶⁷ Ga), palladium ( ¹⁰³ Pd), molybdenum ( ⁹⁹ Mo), xenon ( ¹³³ Xe), fluorine ( ¹⁸ F)
^{, 153 Sm, 177 Lu, 159} Gd, 149 Pm, 140 La, 175 Yb, 166 Ho, 90 Y, 4 7 Sc, 186 Re, 188 Re, 142 Pr, 105 Rh, 97 Ru); luminescent labels (e.g.,
Luminol); and fluorescent labels (eg fluorescein and rhodamine)
, As well as biotin.

Techniques known in the art can be applied to label the antibodies of the invention. Such techniques include, but are not limited to, the use of bifunctional binders (eg,
U.S. Pat. Nos. 5,756,065; 5,714,631; 5,696,2.
No. 39; No. 5,652,361; No. 5,505,931; No. 5,489,4.
25; 5,435,990; 5,428,139; 5,342,60.
4, No. 5,274,119; No. 4,994,560; and No. 5,808.
, 003 (the contents of each of which is hereby incorporated by reference in its entirety).

One aspect of the invention is the detection and diagnosis of diseases or disorders associated with aberrant expression of the polypeptide of interest in animals, preferably mammals, and most preferably humans. In one embodiment, diagnosis is a) administering to a subject (eg, parenterally, subcutaneously, or intraperitoneally) an effective amount of a labeled molecule that specifically binds to a polypeptide of interest. B) to allow the labeled molecule to preferentially concentrate at the site in the subject where the polypeptide is expressed (and to remove unbound labeled molecule to background levels) A) waiting for a time interval after administration; c) determining the background level; and d) detecting the labeled molecule in the subject, so that the label is above this background level. Detection of the activating molecule indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest. Background level can be determined by a variety of methods, including comparing the amount of labeled molecule detected to standard values previously determined for a particular system.

It is understood in the art that the size of the subject and the imaging system used will determine the amount of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally be 99mTc, in the range of about 5-20m Curie. The labeled antibody or labeled antibody fragment will then preferentially accumulate at the location of cells which contain the particular protein. In vivo tumor imaging is described by S. et al. W. Burchiel et al.
Immunopharmacokinetics of Radiolabel
ed Antibodies and Their Fragments "(T
Umor Imaging, Chapter 13: The Radiochemical
Detection of Cancer, S.M. W. Burchiel and B
． A. Rhodes, Masson Publishing Inc. (19
82).

Depending on a number of variations, including the type of label used and the mode of administration, the labeled molecule is allowed to preferentially concentrate at a site in the subject and is bound. The time interval after administration for removal of unlabeled molecules to background levels is 6-48 hours or 6-24 hours or 6-12 hours. In another embodiment, the time interval after administration is 5-20 days or 5-10 days.

In one embodiment, monitoring diseases and disorders is performed by repeating the method for diagnosing a disease or disorder (eg, one month after initial diagnosis, first 6 months after diagnosis, 1 year after initial diagnosis, etc.).

The presence of labeled molecule can be detected in a patient using methods known in the art for in vivo scanning. These methods depend on the type of label used. One of ordinary skill in the art can determine the appropriate method for determining a particular label. Methods and devices that may be used in the diagnostic methods of the present invention include computer tomography (CT), whole body scans (eg, protons).
n) emission tomography (PET)), magnetic resonance imaging (MRI), and ultrasound diagnostics, but not limited to these.

In a particular embodiment, the molecule is labeled with a radioisotope and a radiation responsive surgical instrument.
(Thurston et al., US Pat. No. 5,441,050)
To detect in patients using. In another embodiment, the molecule is labeled with a fluorescent compound and detected in a patient using a fluorescence response scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and detected in the patient using positron emission tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and detected in the patient using magnetic resonance imaging (MRI). (Kit) The present invention provides a kit that can be used in the above method. In one embodiment, the kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In a particular embodiment, the kit of the invention comprises a substantially isolated polypeptide comprising an epitope. This epitope specifically immunoreacts with the antibody contained in the kit. Preferably, the kit of the present invention further comprises a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kit of the invention comprises means for detecting binding of the antibody to a polypeptide of interest (eg, the antibody is a detectable substrate (eg, a fluorescent compound, an enzyme substrate). , Radioactive compounds or luminescent compounds), or a secondary antibody that recognizes the primary antibody can be conjugated with a detectable substrate).

In another particular embodiment of the invention, the kit is a diagnostic kit for use in screening sera containing antibodies specific for proliferative and / or cancerous polynucleotides and polypeptides. is there. Such a kit may include a control antibody that does not react with the polypeptide of interest. Such a kit may comprise a substantially isolated polypeptide antigen containing the epitope. This epitope specifically immunoreacts with at least one anti-polypeptide antigen antibody. Further, such a kit comprises means for detecting the binding of the above antibody to an antigen (eg, the antibody is a fluorescent compound (eg, fluorescein or rhodamine that can be detected by flow cytometry) and a conjugate). Can be). In certain embodiments, the kit may comprise a recombinantly produced polypeptide antigen or a chemically synthesized polypeptide antigen. The polypeptide antigens of the kit can also be attached to a solid support.

In a more particular embodiment, the detection means of the above kit comprises a solid support to which the above polypeptide antigen is attached. Such a kit may also include a non-attached reporter labeled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the reporter-labeled antibody described above.

In a further embodiment, the invention comprises a diagnostic kit for use in screening serum containing antigens of the polypeptides of the invention. The diagnostic kit comprises a substantially isolated antibody that specifically immunoreacts with a polypeptide or polynucleotide antigen, and a means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody. Prepare In one embodiment, the antibody is attached to a solid support. In a particular embodiment, the antibody may be a monoclonal antibody. This detection means of the kit may include a secondary labeled monoclonal antibody. Alternatively, or additionally, the detection means can include a labeled competing antigen.

In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface bound antigen obtained by the method of the invention. After binding of the specific antigen antibody to this reagent and removal of unbound serum components by washing, this reagent is reacted with a reporter-labeled anti-human antibody to bind the bound anti-human antibody to the solid support. A reporter is bound to this reagent in proportion to the amount of antigen antibody. The reagent is washed again to remove unbound labeled antibody and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme, which is detected by incubating the solid phase in the presence of a suitable fluorescent, luminescent or colorimetric substrate (Sigma, St. Louis, MO). To be done.

In the above assay, solid surface reagents are prepared by known techniques for attaching protein materials to solid support materials such as polymer beads, dipsticks, 96 well plates or filtration materials. These attachment methods generally involve non-specific adsorption of proteins to the support or covalent attachment of proteins to the support (typically amine groups that are free relative to chemically reactive groups on the solid support).
For example, activated carboxyl groups, hydroxyl groups, or aldehyde groups)). Alternatively, streptavidin coated plates can be used in combination with biotinylated antigen.

The invention thus provides an assay system or kit for carrying out this diagnostic method. The kit generally comprises a support having surface-bound recombinant antigens,
And a reporter-labeled anti-human antibody for detecting surface-bound anti-antigen antibody.

Immune System Related Disorders Diagnostic Methods The inventors have discovered that TNFR-6α and TNFR-6β are expressed in hematopoietic and transformed tissues. TNFR for many immune system-related disorders
Substantially altered (increased or decreased) levels of gene expression are "normal" in immune system tissues or other cells or body fluids (eg, serum and plasma) obtained from individuals with such disorders. TNFR gene expression level, ie TNF in immune system tissues or other cells or body fluids from individuals without immune system disorders
It can be detected relative to the expression level. Accordingly, the present invention provides a diagnostic method useful during the diagnosis of immune system disorders, which method determines the expression level of a gene encoding a TNFR protein in immune system tissues or other cells or body fluids from an individual. And comparing the measured gene expression level with a standard TNFR gene expression level, whereby an increase or decrease in gene expression level compared to the standard is indicative of an immune system disorder. .

In particular, certain tissues of mammals with cancers (eg colon cancer, breast cancer and lung cancer) have an increased copy number of the TNFR gene when compared to the corresponding “normal” level, and / or Or RNFR protein and mRN encoding TNFR
It is believed to be expressed at significantly elevated levels of A. Furthermore, elevated levels of TNFR protein, when compared to serum from a homologous mammal without cancer,
It is believed that it can be detected in certain cells or body fluids (eg, serum and plasma) from mammals with such cancers.

Accordingly, the present invention provides a diagnostic method useful during the diagnosis of immune system disorders, including cancer, which method comprises TNF in immune system tissues or other cells or body fluids from an individual.
Measuring the expression level of the gene encoding the R protein, and comparing the measured gene expression level to a standard TNFR gene expression level, thereby increasing the gene expression level compared to the standard. Or a decrease is indicative of an immune system disorder.

The present invention is useful as a prognostic indicator when the diagnosis of disorders in the immune system, including the diagnosis of tumors, has already been performed according to conventional methods. By prognostic indicators, patients with reduced gene expression experience worse clinical outcomes compared to patients expressing the gene at levels closer to normal levels.

By “assaying the expression level of a gene encoding a TNFR protein”, the level of TNFR-6α and / or TNFR-6β protein, or the level of mRNA encoding TNFR-6α and / or TNFR-6β protein. In a first biological sample, either directly (eg, by determining or assessing absolute protein levels or mRNA levels) or relative (eg, to TNFR protein levels or mRNA levels in a second biological sample). It is intended to be determined or evaluated qualitatively or quantitatively. Preferably, the TNFR protein level or mRNA level in the first biological sample is measured or evaluated and compared to a standard TNFR protein level or mRNA level, the standard being obtained from an individual without the disorder. It is determined from two biological samples or is determined by averaging the levels from a population of individuals who do not have a compromised immune system. As appreciated in the field,
Once the standard TNFR protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.

By “biological sample” is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source that contains TNFR protein or mRNA. . As shown, the biological sample is T
Body fluids (such as serum, plasma, urine, synovial fluid, and spinal fluid) containing the free extracellular domain (or soluble form) of the NFR protein, immune system tissues, and complete TNFR
, Mature TNFR, or other tissue sources recognized to express the extracellular domain of TNFR. Methods of obtaining tissue biopsies and body fluids from mammals are well known in the art. If the biological sample contains mRNA, tissue biopsy is the preferred source.

The present invention also contemplates the use of the genes of the present invention to diagnose mutations in the TNFR gene. For example, if a mutation is present in one of the genes of the invention, the condition results from a lack of production of the receptor polypeptide of the invention. Furthermore, mutations that enhance receptor polypeptide activity lead to diseases associated with overexpression of receptor polypeptide, such as cancer. Mutations in a gene can be detected by comparing the sequence of the defective gene with the sequence of the normal gene. It can then be established that the mutated gene is associated with disease symptoms or susceptibility to disease symptoms. That is, the mutated gene that leads to insufficient expression of the receptor polypeptide of the present invention is TNFR
It is associated with the inability to inhibit ligand and / or AIM-II mediated apoptosis, resulting in irregular cell growth (eg, tumor growth).

Other immune system disorders that can be diagnosed by the above assay include hypersensitivity, allergies, infectious diseases, and graft-host disease.
), Immunodeficiency disorders, autoimmune diseases, and the like, but are not limited thereto.

Individuals carrying mutations in the gene of the present invention can be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosis can be obtained from the cells of a patient, such as from tissue biopsies from blood, urine, saliva, and other tissues. Genomic DNA
Can be used directly for detection or PCR (Saik
i, Nature, 324: 163-166 (1986)). RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acids of this invention can be used to identify and analyze mutations in the human genes of this invention. For example, deletions and insertions are detected by changes in the size of the amplification product relative to the normal genotype. The point mutation is
Amplified DNA is labeled with radiolabeled RNA or radiolabeled antisense DN of the present invention
It can be identified by hybridizing to the A sequence. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or melting temperature difference. Such diagnoses are particularly useful for prenatal or neonatal testing.

Sequence differences between the reference gene and “variants” can be revealed by direct DNA sequencing methods. In addition, cloned DNA segments can be used as probes to detect specific DNA segments. The sensitivity of this method is PC
Greatly enhanced when combined with R. For example, the sequencing primer is
Used with single-stranded template molecules generated by double-stranded PCR products or modified PCR products. Sequencing is performed by conventional procedures with radiolabeled nucleotides or automated sequencing procedures with fluorescent tags.

Sequence changes at specific positions may result in nuclease protection assays (eg, RNas
e and S1 protection or chemical cleavage methods (eg, Cotton et al., PNAS, 8
5: 4397-4401 (1985))).

Assaying TNFR protein levels in biological samples can be performed using antibody-based methods. For example, TNFR protein expression in tissues can be studied by classical immunohistological methods (Jalkanen, M. et al., J. et al.
Cell. Biol. 101: 976-985 (1985); Jalkane.
n, M. Et al., J. Cell. Biol. 105: 3087-3096 (1987)
)). Other antibody-based methods useful for detecting TNFR gene expression include immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, and iodine, such as glucose oxidase ^{(12 5 I, 121 I)} , carbon ⁽¹⁴ C), sulfur ⁽³⁵ S), tritium ⁽³ H) Radioisotopes such as, Indium ( ¹¹² In), and Technitium ( ^99m Tc),
And fluorescent labels such as fluorescein and rhodamine, and biotin.

In addition to assaying TNFR protein levels in biological samples obtained from an individual, TNFR protein can also be detected in vivo by diagnostic imaging.
Antibody labels or markers for in vivo imaging of TNFR proteins are X
Includes those detectable by radiography, NMR, or ESR. For radiography, suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation, but are clearly not harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, and can be incorporated into antibodies by labeling the nutrients for the relevant hybridoma.

[0349]   Radioisotopes (eg,¹³¹I,¹¹²In,^99mTc, (¹³¹I,¹²⁵I,^{one two Three}I, ¹²¹ I), carbon (¹⁴C), sulfur (³⁵S), tritium (³H), indium (^115m In,^113mIn,¹¹²In,¹¹¹In), and technetium (⁹⁹Tc,^99mTc
),thallium(²⁰¹Ti), gallium (⁶⁸Ga,⁶⁷Ga), palladium (¹⁰³Pd
),molybdenum(⁹⁹Mo), xenon (¹³³Xe), fluorine (¹⁸F),¹⁵³Sm, ¹⁷⁷ Lu,¹⁵⁹Gd,¹⁴⁹Pm,¹⁴⁰La,¹⁷⁵Yb,¹⁶⁶Ho,⁹⁰Y,⁴⁷Sc,¹⁸⁶
Re,¹⁸⁸Re,¹⁴²Pr,¹⁰⁵Rh,⁹⁷Ru), radiopaque material, or nucleus
Labeled with a suitable detectable imaging moiety, such as a material detectable by magnetic resonance
In addition, TNFR-specific antibodies or antibody fragments can be used in mammals (eg, non-human mammals).
Oral, subcutaneous, or intraperitoneal) and tested for disorders of the immune system. Cover
The size of the specimen and the imaging system used are necessary for producing diagnostic images.
It is understood in the art to determine the amount of imaging moiety required. Radioisotope part
In the case of, for human subjects, the amount of radioactivity injected is usually^99mTc
It is in the range of about 5 to 20 millicuries. Then the labeled antibody or antibody fragment
The pigment is preferably Neutrokine-α protein.
Accumulates preferentially at the location of cells including quality. In vivo tumor imaging is described by S. W. B
Urchiel et al., “Immunopharmacokinetics of
Radiolabeled Antibodies and Their Fr
“Agments” (Tumor Imaging: The Radiochem
I.Cal. Detection of Cancer, Chapter 13, S.M. W. Bu
rchiel and B. A. Edited by Rhodes, Masson Publishing
ng Inc. (1982)).

Treatment Tumor necrosis factor (TNF) family ligands induce the most pleiotropic cellular responses, including cytotoxicity, antiviral activity, immunomodulatory activity, and transcriptional regulation of several genes. Is known to belong to various cytokines (Goeddel
, D. V. Et al., "Tumor Necrosis Factors: Gene.
Structure and Biological Activites "
Symp. Quant. Biol. 51: 597-609 (1986), Co.
ld Spring Harbor; Beutler, B .; , And Ceram
i, A. , Annu. Rev. Biochem. 57: 505-518 (198
8); Old, L .; J. , Sci. Am. 258: 59-75 (1988); F.
iers, W.I. , FEBS Lett. 285: 199-224 (1991)).
. TNF-family ligands induce such various cellular responses by binding to TNF-family receptors.

TNRF-6α polynucleotides and polypeptides and / or TNFR-6β polynucleotides and polypeptides of the present invention can be expressed by deficient or insufficient amounts of TNRF-6α and / or TNRF-6β (directly Or indirectly) can be used in developing treatments for any disorder mediated. TN
The FR-6α polypeptide and / or the TNFR-6β polypeptide can be administered to a patient suffering from such a disorder (eg, a mammal, preferably a human).
Alternatively, gene therapy approaches may be applied to treat such disorders. T
Disclosure herein of FNR-6α and / or TNFR-6β nucleotide sequences includes detection of TNRF-6α and / or TNRF-6β defective genes, as well as detection of the defective genes in normal TNRF-6α and / or TNRF. Allows replacement with the -6β coding gene. The defective gene is the nucleotide sequence of the TNRF-6α and / or TNRF-6β gene derived from a patient suspected of having a defect in this gene in an in vitro diagnostic assay, and the TNRF-disclosed herein. 6α and / or TNRF-
It can be detected by comparison with the 6β nucleotide sequence.

[0352] In another embodiment, the polypeptides of the invention are Fa in different cell types.
It is used as a research tool to study biological effects resulting from inhibition of s ligand / TNFR-6α and / or Fas ligand / TNFR-6β and / or Fas ligand / AIM-II interactions. The TNFR-6α and / or TNFR-6β polypeptides may also be Fas ligand, AI.
It can be used in an in vitro assay to detect M-II or TNFR-6α and / or TNFR-β or their interactions.

In another embodiment, the purified TNFR-6α and / or TNFR of the invention.
The -6β polypeptide is used to inhibit the binding of Fas ligand and / or AIM-II to the endogenous cell surface Fas ligand and / or AIM-II receptor. Certain ligands of the TNF family (of which Fas ligand and AIM-II are members) have been reported to bind to more than one different cell surface receptor protein. AIM-II is also believed to bind to multiple cell surface proteins. Fas ligand and / or A
By binding IM-II, the soluble TNFR-6α and / or TNFR-6β polypeptides of the invention become Fas ligand and / or AIM-I.
Used to inhibit binding of I to endogenous TNFR-6α and / or TNFR-6β as well as to Fas ligands and AIM-II receptor proteins that differ from TNFR-6α and / or TNFR-6β Can be done. Therefore, in another embodiment, TNFR-6α and / or TNFR-6.
β is used to inhibit Fas ligand and / or AIM-II biological activity in in vitro or in vivo procedures. By inhibiting the binding of Fas ligand and / or AIM-II to cell surface receptors, the TNFR-6α and / or TNFR-6β polypeptides of the present invention also include Fas ligand and / or AIM-II endogenous receptors. Inhibits biological effects that result from binding to. TNFR-6α and / or TNFR-6
Various forms of β may be used (eg, TNFR-6α and / or TNFR-6β fragments, TNFR-6α and / or TNFR-6β derivatives, as well as modifications that may bind Fas ligand and / or AIM-II. Including the body). In a preferred embodiment, the soluble TNFR-6α of the invention and / or
Or the TNFR-6β polypeptide is Fas ligand and / or AIM-
II to inhibit the biological activity of II (eg, Fas ligand-mediated apoptosis of cells susceptible to such apoptosis and / or AIM-II).
Administered to inhibit mediated apoptosis).

In a further embodiment, the TNFR-6α and / or TNFR of the invention.
-6β polypeptide causes Fas ligand-mediated disorders and / or AIM-II
Administered to mammals to treat mediated disorders. Such Fas ligand-mediated disorders and / or AIM-II-mediated (eg, human) disorders include:
Conditions that are caused (directly or indirectly) or exacerbated by Fas ligand and / or AIM-II are included.

TNFR polypeptide is expressed and TNFR-6α and TNFR-6β
Cells that have a strong cellular response to the ligand include lymphocytes, endothelial cells, keratinocytes and prostate tissue. "Cellular response to TNF family ligands" refers to cells induced by TNF family ligands,
Any genotypic, phenotypic and / or morphological changes to a cell line, tissue, tissue culture or patient are contemplated. As shown, such cellular responses include not only normal physiological responses to TNF family ligands, but also diseases associated with increased apoptosis or inhibition of apoptosis. Further, as described herein, the TNFR polypeptides of the present invention bind Fas ligand and AIM-II and, as a result, Fas
Block ligand and AIM-II mediated apoptosis. Apoptosis programmed cell death is a physiological mechanism involved in the loss of B and / or T lymphocytes of the immune system and its dysregulation.
can lead to many different pathogenic processes (JC Ame).
isen AIDS 8: 1197-1213 (1994); H. Kram
ner et al., Curr. Opin. Immunol. 6: 279-289 (199
4)).

Diseases associated with increased cell survival or inhibition of apoptosis include cancer (eg, follicular lymphoma, carcinoma with p53 mutations, and hormone-dependent tumors (these are: colon cancer, heart tumor, pancreatic cancer). , Melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, gastric cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelial tumor, osteoblastoma, giant cell tumor of bone , But not limited to, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); , Autoimmune diabetes, biliary cirrhosis, Behcet's disease
e), Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis (
For example, proliferative glomerulonephritis) autoimmune gastritis, autoimmune idiopathic thrombocytopenic purpura and rheumatoid arthritis) and viral infections (eg herpes virus,
Poxviruses and adenoviruses), inflammation, graft-versus-host disease (acute and / or chronic), acute graft rejection, and chronic graft rejection.
In a preferred embodiment, the TNFR polynucleotides, polypeptides and / or antagonists of the invention are used to inhibit the growth, progression and / or metastasis of cancer, in particular the cancers listed above.

Additional diseases or conditions associated with increased cell survival include, but are not limited to, malignant disease progression and / or metastasis and associated disorders such as: leukemia (acute leukemia (eg, leukemia). Acute lymphocytic leukemia, acute myelogenous leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia) and chronic leukemia (eg chronic myelogenous (granulocytic)) ) Leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphoma (eg Hodgkin's and non-Hodgkin's disease), multiple myeloma, Waldenstrom macroglobulinemia, heavy chain disease, and solid Tumors (sarcomas and carcinomas (eg fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelium sarcoma (end
otheliosarcoma), lymphangiosarcoma, lymphatic endothelium, periosteal tumor, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal Cell carcinoma, adenocarcinoma, sweat adenocarcinoma, sebaceous adenocarcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryo Stage cancer, Wilms tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma of the ventricles , Pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma). .

Diseases associated with increased apoptosis include: AIDS; neurodegenerative disorders (eg Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis,
Retinitis pigmentosa, cerebellar degeneration and brain tumors or previously related disorders; autoimmune disorders (eg, multiple sclerosis, Sjogren's syndrome, Graves' disease, Hashimoto thyroiditis, autoimmune diabetes, biliary cirrhosis, Behcet's disease (Behcet). 's dis
ease), Crohn's disease, polymyositis, systemic lupus erythematosus, immune-related glomerulonephritis (eg, proliferative glomerulonephritis), autoimmune gastritis, idiopathic thrombocytopenic purpura and rheumatoid arthritis), spinal cord formation Abnormal syndromes (eg, aplastic anemia), graft-versus-host disease (acute and / or chronic), ischemic injury (eg, as caused by ischemic heart injury and myocardial infarction, stroke and reperfusion injury) , Liver injury or disease (eg, hepatitis-related liver injury, cirrhosis, ischemia / reperfusion injury, cholestosis (bile duct injury) and liver cancer); toxic-induced liver disease (such as that caused by alcohol) ), Septic shock, ulcerative colitis, cachexia and anorexia. In a preferred embodiment, TNF
R polynucleotides, polypeptides and / or agonists are used to treat or prevent the diseases and disorders listed above.

In a particular embodiment, the TNFR polynucleotides, polypeptides or agonists of the invention are used for the treatment and / or prevention of glomerulonephritis. In a further embodiment, the TNFR polynucleotides, polypeptides or agonists of the invention cause chronic glomerulonephritis and / or cell / tissue damage (eg, glomerular cell death) and / or medical conditions associated with this disease. Used to treat and / or prevent. In a further non-limiting embodiment, the TNFR polynucleotides, polypeptides or agonists of the invention are associated with proliferative glomerulonephritis and / or cell / tissue damage (eg, glomerular cell death) and / or this disease. It is used to treat and / or prevent a medical condition.

In certain embodiments, TNFR polynucleotides, polypeptides or agonists of the invention are used to treat or prevent biliary cirrhosis and / or medical conditions associated with this disease.

In certain embodiments, the TNFR polynucleotides, polypeptides or agonists of the invention treat a disease, such as alcoholic liver disease and / or a medical condition associated with this disease, such as cirrhosis. Or used to prevent.

In a particular embodiment, the TNFR polynucleotides, polypeptides or agonists of the invention are used for the treatment and / or prevention of graft versus host disease. In certain embodiments, the TNFR polynucleotides, polypeptides or agonists of the invention are associated with tissue damage or destruction or cell damage or destruction (eg depletion of lymphoid cells associated with graft versus host disease) and / or Alternatively, it is used for the treatment (eg, attenuation) or prevention of other medical conditions associated with this disease. In another specific, non-limiting embodiment, the TNFR polynucleotides, polypeptides or agonists of the invention are used for the treatment (eg, attenuation) and / or prevention of diarrhea during graft versus host disease. To be done.

In certain embodiments, TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are for the treatment and / or prevention of Sjogren's disease and / or for tissue / cell damage or destruction (eg, (Damage or destruction of salivary and / or tear tissue), and / or attenuation of other medical conditions associated with this disease.

In certain embodiments, the TNFR polynucleotides, polypeptides or agonists of the invention are used for the treatment and / or prevention of multiple sclerosis and / or tissue damage or destruction (eg, neurological tissue). It is used for (injury or destruction of, for example, CNS tissue) and / or trauma or attenuation of other medical conditions associated with this disease.

In certain embodiments, TNFR polynucleotides, polypeptides or agonists of the invention, including antibodies and antibody fragments of the invention, are used for the treatment and / or prevention of Alzheimer's disease and / or tissue. Used for damage or destruction (eg, damage or destruction of neurological tissue or cells) and / or attenuation of the medical condition associated with this disease.

In certain embodiments, TNFR polynucleotides, polypeptides or agonists of the invention are for the treatment, prevention of Parkinson's disease and / or tissue damage or destruction (eg, neurological tissue or cells ( (Eg, damage or destruction of nerve cells, etc.), and / or attenuation of the medical condition associated with this disease.

In certain embodiments, the TNFR polynucleotides, polypeptides or agonists of the invention are used to damage and / or damage cells or tissues (eg, neurological tissue) before, during, immediately after, and / or after a stroke. Alternatively, it is used for the treatment, prevention or attenuation of medical conditions associated with stroke.

In certain embodiments, the TNFR polynucleotides, polypeptides or agonists of the invention are for the treatment, prevention of ischemic injury (eg, ischemic heart injury, etc.) and / or medical conditions associated with ischemic injury. Or used for attenuation. In certain embodiments, TNFR polynucleotides, polypeptides or agonists of the invention are used for the treatment, prevention or attenuation of ischemic heart injury before, during, immediately after and / or after a heart attack.

In another particular embodiment, the TNFR polynucleotides, polypeptides and / or agonists of the invention are myelodysplastic syndromes.
It is used for the treatment or prophylaxis of inflammatory disorders (MDS) and / or medical conditions associated with MDS.

In another specific embodiment, a TNFR polynucleotide, polypeptide or agonist of the invention increases the number of circulating blood cells in a patient suffering from cytopenia, lymphopenia and / or anemia. Used for.

In certain embodiments, TNFR polynucleotides, polypeptides or agonists of the invention are for the treatment and / or prevention of Hashimoto's thyroiditis and / or the destruction or damage of tissues or cells (eg thyroid). For the attenuation of, and / or for the treatment or prevention of medical conditions associated with this disease.

In certain embodiments, the TNFR polynucleotides, polypeptides or agonists of the invention are for the treatment (eg, attenuation) and / or prevention of autoimmune gastritis and / or medical conditions associated with this disease. used.

In certain embodiments, a TNFR polynucleotide, polypeptide or agonist of the invention is associated with ulcerative colitis and / or cell / tissue damage (eg, ulcers in the colon) and / or this disease. Used for the treatment and / or prevention of medical conditions.

In a particular embodiment, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are used for the treatment and / or prevention of rheumatoid arthritis and / or medical conditions associated with this disease. To be done.

In addition, many cancers F that bind Fas-positive T cells and kill them.
Secretes asL. Thus, any cancer that expresses FasL will be associated with the TNFR of the invention.
And can be a target for treatment with TNFR agonists. Such cancers include, but are not limited to, malignant myeloma, leukemia and lymphoma.

Many of the pathologies associated with HIV are mediated by apoptosis, including HIV-induced nephropathy and HIV encephalitis. Therefore, in a further preferred embodiment, the TNFR polynucleotides, polypeptides and / or TNFR agonists of the invention are used for the treatment or prevention of AIDS and AIDS-related pathologies. Another embodiment of the invention relates to the use of TNFR-6α and / or TNFR-6β to attenuate Fas ligand and / or AIM-II mediated T cell death in HIV infected patients.

The immunodeficiency condition that defines AIDS is secondary to a decrease in the number and function of CD4 ⁺ T lymphocytes. A recent report showed that daily CD4 ⁺ T cell loss was 3%.
． Presumed to be between 5 × 10 ⁷ and 2 × 10 ⁹ cells (Wei X et al., Nat
ure 373: 117-122 (1995)). One cause of CD4 ⁺ T cell depletion in the setting of HIV infection is believed to be HIV-induced apoptosis (eg, Meyaard et al., Science 257: 217-2).
19, (1992); Groux et al., J Exp. Med. 175: 331,
(1992); and Oyaizu et al., Cell Activation an.
d Apoptosis in HIV Infection Andrieu
And Lu, edited by Plenum Press, New York, 1995, 1.
See pages 01-114). In fact, HIV-induced apoptotic cell death
Not only demonstrated in vitro but, more importantly, in infected individuals (Ameisen, JC, AIDS 8: 1197-1213).
(1994); Finkel, T .; H. And Banda, N .; K. , Curr
． Opin. Immunol. 6: 605-615 (1995); Muro-C.
acho, C.I. A. Et al., J. Immunol. 154: 5555-5566 (1
995)). Furthermore, apoptosis and depletion of CD4 ⁺ T lymphocytes is associated with AID
Closely correlated with different animal models of S (Brunner, T., et al., Nature).
373: 441-444 (1995); Gougeon, M .; L. Et al AID
S Res. Hum. Retroviruses 9: 553-563 (199
3)), and apoptosis is not observed in these animal models where viral replication does not result in AIDS (Gougeon, ML et al. AIDS R).
es. Hum. Retroviruses 9: 553-563 (1993)).
. Further data indicate that uninfected T lymphocytes from HIV infected individuals, but primed or activated T lymphocytes undergo apoptosis after encountering Fas ligand. It was demonstrated that infection of U937 cells with HIV results in de novo expression of Fas ligand and that Fas ligand mediates HIV-induced apoptosis, using a monocyte cell line that results in death following HIV infection. (Badley, AD et al., J. Virol. 70: 199-206.
(1996)). Moreover, the TNF family of ligands is detectable in uninfected macrophages, and its expression is upregulated, after which HIV infection results in selective killing of uninfected CD4 T lymphocytes (
Badley, A .; D. Et al., J. Virol. 70: 199-206 (1996
)). Furthermore, further studies suggest that Fas-mediated apoptosis impairs T cell loss in HIV individuals (Katsikis et al., J. Exp. Med. 18).
1: 2029-2036, 1995).

Accordingly, the present invention provides a method for treating an HIV ⁺ individual, which method comprises the step of administering a TNFR and / TNFR agonist of the present invention, the method comprising selectively killing CD4 T lymphocytes. To reduce. Mode of administration and dosing
The details are discussed below.

It is also possible that T cell apoptosis occurs through multiple mechanisms. In addition, at least some of the T cell deaths found in HIV patients are associated with AIM-.
It can be mediated by II. Without wishing to be bound by theory, it is believed that such Fas ligand and / or AIM-II mediated T cell death occurs through a mechanism known as activation-induced cell death (AICD).

Activated human T cells are induced to undergo programmed cell death (apoptosis) upon induction through the CD3 / T cell receptor complex, a process called activation-induced cell death (AICD). It AICD of CD4 T cells isolated from asymptomatic individuals infected with HIV was reported (Groux et al., Supra). Therefore, AICD is associated with depletion of CD4 + T cells and A in individuals infected with HIV.
It may play a role in the progression of IDS. Therefore, the present invention provides Fa in HIV patients.
A method of inhibiting s-ligand mediated and / or AIM-II mediated T cell death, which method comprises providing a patient with TNFR-6α and / or TNFR of the invention.
A method is provided that includes administering a -6β polypeptide. In one embodiment, the patient is asymptomatic when treatment with TNFR-6α and / or TNFR-6β is initiated. If desired, prior to treatment, peripheral blood T cells can be
It can be extracted from patients and tested for susceptibility to Fas ligand-mediated and / or AIM-II-mediated cell death by conventional procedures. In one embodiment, the patient's blood or plasma is contacted with TNFR-6α and / or TNFR-6β ex vivo. TNFR-6α and / or TNFR-6β
Can be attached to the appropriate chromatographic matrix known in the art by conventional procedures. The patient's blood or plasma flows through a chromatography column containing matrix-bound TNFR-6α and / or TNFR-6β polypeptides before being returned to the patient. Fixed TNFR-6
α and / or TNFR-6β are Fas ligands and / or AIM-I
Binds I and therefore from the blood of the patient Fas ligand and / or AIM-I
Remove I protein.

In a further embodiment, the TNFR-6α and / or TNFR of the invention.
The -6β polypeptide can be administered in combination with other inhibitors of T cell apoptosis. For example, at least some of the T cell death seen in HIV patients is believed to be mediated by TRAIL (International Application Publication Number WO 97/01633, which is hereby incorporated by reference). So, for example,
Patients susceptible to both Fas ligand-mediated and TRAIL-mediated T cell death can be treated with both agents that block TRAIL / TRAIL receptor interactions and agents that block Fas ligand / Fas interactions. . Suitable agents that can be administered with the polynucleotides and / or polypeptides of the invention to block the binding of TRAIL to the TRAIL receptor include soluble TRAIL receptor polypeptides (eg, OPG, DR
Soluble Form of 4 (International Application Publication Number WO 98/32856); TR5 (International Application Publication Number WO 98/30693); DR5 (International Application Publication Number WO 98 /
41629); TR10 (International Application Publication Number WO 98/54220)); a multimeric form of the soluble TRAIL receptor polypeptide; and TRAIL that binds to the TRAIL receptor without transducing a biological signal that causes apoptosis.
Receptor antibodies, anti-TRAIL antibodies that block the binding of TRAIL to one or more TRAIL receptors, and TRAIL muteins that bind TRAIL receptors but do not transduce biological signals that result in apoptosis, including but not limited to: Not done. Preferably, the antibody used according to this method is a monoclonal antibody.

Suitable agents that also block the binding of Fas ligand to Fas that can be administered with the polynucleotides and polypeptides of the present invention include soluble Fas
Polypeptide; a multimeric form of soluble Fas polypeptide (eg, sFas / F
a dimer of c); an anti-Fas antibody that binds Fas without transducing a biological signal that causes apoptosis; an anti-Fas that blocks the binding of Fas ligand to Fas
Ligand antibodies; and Fas ligand muteins that bind Fas but do not transduce biological signals that cause apoptosis, but are not limited thereto. Examples of suitable agents for blocking Fas-L / Fas interactions, including blocking anti-Fas monoclonal antibodies, are described in International Application Publication No. WO 95/10540, which is hereby incorporated by reference.

Suitable agents that can be administered with the polynucleotides and / or polypeptides of the invention to block the binding of AIM-II to the AIM-II receptor include soluble AIM-II receptor polypeptides (eg, , Soluble form of TR2 (International Application Publication No. WO 96/34095); LTβ receptor; and TR8 (International Application Publication No. WO 98/54201)); Soluble AIM-I
A multimeric form of the I receptor polypeptide; as well as an AIM-II receptor antibody that binds the AIM-II receptor without transducing a biological signal that causes apoptosis, binding of AIM-II to one or more AIM-II receptors Include, but are not limited to, anti-AIM-II antibodies that block AIM-II as well as muteins of AIM-II that bind the AIM-II receptor but do not transduce biological signals that result in apoptosis. Preferably, the antibody used according to this method is a monoclonal antibody.

In allograft rejection, the immune system of the recipient animal is pre-primed to respond. This is because the immune system for most is primed only by environmental antigens. Tissues from other members of the same species are not presented in the same manner (eg, viral and bacterial are presented). In the case of allograft rejection, immunosuppressive regimens are designed to prevent the immune system from reaching the effector phase. However, the immune profile of xenograft rejection may be more similar to disease recurrence than allograft rejection. In case of recurrence of the disease,
The immune system is already activated, as evidenced by the destruction of natural islet cells. Therefore, in disease recurrence, the immune system is already in the effector phase. The antagonists of the invention may suppress the immune response to both allografts and xenografts. This is because activated lymphocytes and lymphocytes that have differentiated into effector cells are sensitive to compounds that express the TNFR polypeptide and thereby enhance TNFR activity. Accordingly, the present invention further provides a method for making an immune privileged tissue. The antagonists of the invention may further be used in the treatment of inflammatory bowel disease.

The TNFR polynucleotides, polypeptides and agonists of the invention also include
It can be used to suppress the immune response. In one embodiment, the T of the present invention
NFR polynucleotides, polypeptides and agonists are used to minimize the annoying effects associated with transplantation. In certain embodiments, the TNFR polynucleotides, polypeptides and agonists of the invention are used to suppress a Fas-mediated immune response (eg, in a manner similar to immunosuppressive agents such as rapamycin or cyclosporine). It In another embodiment, the TNFR polynucleotides, polypeptides and agonists of the invention are used to suppress an AIM-II mediated immune response.

Furthermore, both graft rejection and graft-versus-host disease are induced in part by apoptosis. Therefore, in a further preferred embodiment, the T of the invention is
The NFR polynucleotide, polypeptide and / or TNFR agonist is
Used to treat and prevent and / or reduce graft rejection. In a further preferred embodiment, the TNFR polynucleotides, polypeptides and / or TNFR agonists of the invention are used to treat and prevent and / or reduce graft versus host disease.

In addition, TNFR-6α and / or TNFR-6β polypeptides, polynucleotides and / or agonists are useful for graft rejection (eg xenograft and allograft rejection (eg acute allograft rejection)) and. It may be used to treat or prevent medical conditions associated with graft rejection. In certain embodiments, the TNFR-6α and / or TNFR-6β polypeptides, polynucleotides and / or agonists of the invention treat acute allograft rejection and / or medical conditions associated with acute allograft rejection. Or used for prevention. In a further specific embodiment, the TNFR-6α of the invention.
And / or TNFR-6β polypeptides, polynucleotides and / or agonists are used for the treatment or prevention of renal allograft rejection and / or medical conditions associated with renal allograft rejection. .

Fas ligand is a type II membrane protein that induces apoptosis by binding to Fas. Fas ligand is expressed on activated T cells and acts as an effector of cytotoxic lymphocytes. Molecular and genetic analysis of Fas and Fas ligand have shown that the murine lymphoproliferative mutation (lpr) and systemic lymphoproliferative disorder (gld) are mutations of Fas and Fas ligand, respectively. lpr in gld mice develops lymphadenopathy and suffers from autoimmune disease. Based on these phenotypic and other studies, Fas
It is believed that the system is involved in an apoptotic process during T cell development, in particular peripheral clonal deletion of mature T cells or activation-induced suicide of mature T cells. In addition to activated lymphocytes, Fas is expressed in liver, heart and lung. Administration of agonistic anti-Fas antibodies to mice has been shown to induce apoptosis in the liver and cause liver damage resulting in immediate mouse killing. These findings indicate that the Fas system plays a role not only in the physiological process of lymphoid development but also in cytotoxic T lymphocyte-mediated diseases (eg, fulminant hepatitis and / or hepatitis due to viral infections or toxicants). Show that it plays a role. As discussed herein, TNFR-6α and / or TNFR-6β are
It binds to Fas ligand and thus functions as an antagonist of Fas ligand-mediated activity. Accordingly, the TNFR-6α polypeptides and / or polynucleotides of the invention and / or the TNFR-6β polypeptides and / or polynucleotides of the invention and / or agonists thereof are used to inhibit lymphoproliferative disorders (eg, lymphadenopathy and Other disorders mentioned herein), autoimmune disorders (eg autoimmune diabetes, systemic lupus erythematosus, Graves' disease, Hashimoto's thyroiditis, immune-related glomerulonephritis, autoimmune gastritis, autoimmune idiopathic For the treatment or prevention of thrombocytopenic purpura, multiple sclerosis, rheumatoid arthritis and other disorders mentioned herein), and / or liver diseases (eg acute and chronic hepatitis and cirrhosis). Can be used for.

In a specific embodiment, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are for treating or treating hepatitis and / or tissue / cell damage or destruction and / or medical conditions associated with hepatitis. Used for prevention. In certain embodiments, TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are used for the treatment or prevention of fulminant hepatitis and / or medical conditions associated with fulminant hepatitis.

In certain embodiments, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are systemic lupus erythematosus (SL).
E) and / or tissue / cell damage or destruction and / or for the treatment or prevention of medical conditions associated with SLE. In a further specific embodiment, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are used for the treatment or prevention of skin trauma in SLE patients.

In a particular embodiment, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are associated with insulin-dependent diabetes mellitus and / or tissue / cell damage or destruction and / or insulin-dependent diabetes mellitus. Used for the treatment or prevention of medical conditions. In a further specific embodiment, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention reduce or prevent damage to islet cells before, during or shortly after the onset of diabetes, and / or Reduces exogenous insulin demand.

In certain embodiments, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the invention are toxic epidermal necrolysis (TE).
N) and / or tissue / cell damage or destruction and / or for the treatment or prevention of medical conditions associated with TEN. In a further specific embodiment, the TNFR polynucleotides, polypeptides and / or agonists or antagonists of the present invention are used for the treatment or prevention of Lyell syndrome.

Hepatitis viruses (eg, hepatitis B virus and hepatitis C virus) are the major causative agents of chronic liver disease. In hepatitis infection, F in hepatocytes
As expression is upregulated according to the severity of liver inflammation. Hepatitis virus-specific T
When the cells migrate to hepatocytes and recognize viral antigens via the T cell receptor, hepatitis virus-specific T cells are activated and Fas-bearing hepatocytes can transduce apoptotic death signals to Fas. Express the ligand. Therefore,
The Fas system plays an important role in hepatocyte injury by viral hepatitis. Therefore, in a particular embodiment, the TNFR-6α and / or TNF of the invention.
R-6β polypeptides and / or polynucleotides and / or agonists or antagonists thereof may induce hepatitis (eg,
It is used for the treatment or prevention of hepatitis B virus infection or infection caused by hepatitis C virus infection). In one embodiment, the patient's blood or plasma is contacted ex vivo with a TNFR-6α and / or TNFR-6β polypeptide of the invention. TNFR-6α and / or TNFR-6β can be bound to a suitable chromatographic matrix by conventional procedures. According to this embodiment, the patient's blood or plasma flows through a chromatography column containing matrix-bound TNFR-6α and / or TNFR-6β before being returned to the patient. Fixed TNFR-6α and / or TNFR-6
β binds Fas ligand and thus clears Fas ligand protein from the patient's blood.

In a particular embodiment, the TNFR6α and / or TNFR-6 of the invention.
β polypeptides, polynucleotides, and / or agonists or antagonists are associated with renal failure (eg, chronic renal failure) and / or tissue / cell damage or destruction (eg, tubular epithelial cell deletion) and / or renal failure It can be used for the treatment or prophylaxis of medical conditions.

In certain embodiments, the TNFR6α and / or TNFR-6 of the invention.
Beta polypeptides, polynucleotides, and / or agonists or antagonists can be used to control (ie, stimulate or inhibit) bone growth. In certain embodiments, TNFR6α and / or TNFR-6β polypeptides, polynucleotides, and / or agonists or antagonists of the invention are used to stimulate bone growth. Particular diseases or conditions that may be treated or prevented with the compositions of the present invention include fractures and bone defects, as well as disorders resulting in weakened bones (eg, osteoporosis, osteomalacia and age-related loss of bone weight). But is not limited to these.

TNFR Encoding TNFR-6α and / or TNFR-6β of the Invention
-6α and / or TNFR-6β polypeptide or polynucleotide,
And / or the agonist or antagonist thereof is a cardiovascular disorder (
It can be used to treat or prevent peripheral arterial disease such as limb ischemia).

Cardiovascular disorders include arterio-arterial fistula.
stula), arteriovenous fistula, cerebral arteriovenous birth defects, congenital heart defects (congeni)
cardiovascular abnormalities such as tal heart defects, pulmonary valve atresia, and Scimitar syndrome. Congenital heart defects include aortic coarctation, tricentric heart, coronary vessel anomalies
, Cross heart, right thoracic heart, patent ductus arteri
oss), Ebstein's anomaly, Eisenmenger complex, left ventricular underdevelopment syndrome, left thoracic heart, tetralogy of Fallot, transposition of the great arteries, bilateral right ventricle origin, tricuspid valve closure, residual arterial canal , And heart septal deficiency
ts) (e.g., aortopulmonary separation)
eptal defect, endocardial bed deficiency, Luthambache syndrome, trilogy of Fallot, ventricular heart septal defect (ventricular heart sep
tal defects)).

Cardiovascular disorders also include atherosclerosis, arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocardium. Inflammation (including bacterial), cardiac aneurysm, cardiac arrest, congestive heart failure (eg, chronic congestive heart failure), congestive cardiomyopathy, paroxysmal respiratory distress, edema edema, cardiac hypertrophy, congestive cardiomyopathy,
Left ventricular hypertrophy, right ventricular hypertrophy, post-infarction cardiac rupture (post-infarction h)
early rupture), ventricular septal rupture, heart valve disease, myocardial disease, myocardial ischemia, pericardial effusion, pericarditis (including infarct and tuberculosis), pericarditis, postpericardiotomy syndrome, Pulmonary fibrosis, right heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications (cardiova)
circulatory pregnancies, scimitar syndrome, cardiovascular syphilis, and cardiovascular
heart diseases such as berculosis).

In certain embodiments, the TNFR-6α and / or TNFR- of the present invention.
6β polynucleotides, polypeptides or agonists can be used for the treatment and / or prevention of chronic congestive heart failure and / or medical conditions associated with chronic congestive heart failure.

In another particular embodiment, the TNFR-6α and / or TNF of the invention.
The R-6β polynucleotides, polypeptides or agonists are useful for lung injury or disease (eg, lung fibrosis and chronic obstructive pulmonary disease (eg, emphysema and chronic bronchitis)) and / or tissue / cell injury or It can be used for the treatment and / or prophylaxis of medical conditions associated with disruption (eg, alveolar wall disruption and / or bronchial wall disruption) and / or lung injury or disease.

Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, premature contraction, Adams-Stokes syndrome, leg block, sinoatrial block, long QT syndrome (long).
QT syndrome), collateral contraction, Lone-Ganning-Levine syndrome, Maheme-type pre-excita
tion syndrome), Wolff-Parkinson-White syndrome, sinus dysfunction syndrome, tachycardia, and ventricular fibrillation. As tachycardia, paroxysmal tachycardia,
Supraventricular tachycardia, ventricular intrinsic rhythm promotion, atrioventricular nodal reentry tachycardia (atrioventri
circular nodal reentry tachycardia), ectopic atrial tachycardia, ectopic junction tachycardia, sinoatrial nodal reentry tachycardia
dal reentry tachycardia), sinus tachycardia, torsade
De pointe, and ventricular tachycardia.

Heart valve diseases include aortic insufficiency, aortic stenosis, and heart murmur (hea).
r murmurs), aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve dysfunction, mitral valve stenosis, pulmonary valve atresia, pulmonary valve dysfunction, pulmonary valve stenosis, tricuspid Includes atresia, tricuspid dysfunction, and tricuspid stenosis.

Cardiomyopathy includes alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, subvalvular aortic stenosis, subvalvular pulmonary stenosis, restricted cardiomyopathy, Chagas cardiomyopathy, intracardiac Membrane fibroelasticity, endocardial myocardial fibrosis, Keens syndrome, myocardial reperfusion injury, and myocarditis.

Myocardial ischemia includes angina, coronary aneurysm, coronary atherosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction, and myocardial stunnin.
g) such as coronary artery disease.

Cardiovascular diseases also include aneurysms, dysplasias, hemangiomatosis, bacterial hemangiopathies, Hippel-Lindau Diseases.
), Klipel-Tornone-Weber syndrome, Sturgi-Weber syndrome,
Vasomotor edema, aortic disease, Takayasu arteritis, aortitis, Leuriche syndrome,
Arterial occlusive disease, arteritis, arteritis, polyarteritis nodosa, cerebrovascular disease, diabetic vasculopathy, diabetic retinopathy, embolism, thrombosis, erythromelalgia, hemorrhoids, liver Venous obstruction disorder, hypertension, hypotension, ischemia, peripheral vascular disorder, phlebitis, pulmonary vein occlusion disease, Raynaud's disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, telangiectasia Ataxia
a telangiectasia), hereditary hemorrhagic telangiectasia, varicocele, varicose vein, varicose ulcer, vasculitis, and vascular diseases such as venous insufficiency.

Aneurysms include dissecting aneurysms, pseudoaneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, cardio-aneurysms, and iliac aneurysms. Is mentioned.

Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasia, mesenteric vascular occlusion, Moyamoya disease, renal artery occlusion, retinal artery occlusion, and occlusive thrombosis. Sexual vasculitis.

Cerebrovascular disorders include carotid artery disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous birth defects, cerebral artery disease, cerebral occlusion and thrombosis, Carotid artery thrombosis, sinus thrombosis, Wallenberg syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage
), cerebral infarction, cerebral ischemia (including transient), subclavian artery stealing syndrome, periventricular leukomalacia,
Vascular headaches, cluster headaches, migraine headaches, and vertebrobasi
lar) dysfunction.

[0409] Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, toe cyanosis syndrome, fat embolisms, pulmonary embolisms, and thromboembolisms. As thrombosis, coronary artery thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis,
Includes sinus thrombosis, Wallenberg syndrome, and thrombophlebitis.

Ischemia includes cerebral ischemia, ischemic colitis, compartment syndrome, anterior compartment syndrome, myocardial ischemia, reperfusion injury, and peripheral limb ischemia. Examples of vasculitis include aortitis, arteritis, Behcet syndrome, Churg-Strauss syndrome, cutaneous mucosal lymph node syndrome, obstructive thrombotic vasculitis, hypersensitivity vasculitis, and Schoenlein-Henoch purpura. ), Allergic cutaneous vasculitis and Wegener's granulomatosis.

In one embodiment, the TNFR-6α and / or TNFR- of the present invention.
6β polypeptides, polynucleotides and / or agonists or antagonists are used for the treatment or prevention of thrombotic microangiopathy. One such disorder is thrombotic thrombocytopenic purpura (TTP) (Kwaan
, H .; C. , Semin. Hematol. 24:71 (1987); Thom
Pson et al., Blood 80: 1890 (1992)). Increasing TTP-related mortality was reported by U.S.P. S. Reported by Centers for Disease Control (Torok et al., Am. J. Hematol. 50:84 (
1995)). Plasma from patients affected by TTP (including HIV + and HIV− patients) induces apoptosis of human endothelial cells of microvascular origin in the skin,
It does not induce apoptosis of human endothelial cells of macrovascular origin (Laurence et al.,
Blood 87: 3245 (1996)). Therefore, plasma of TTP patients is believed to contain one or more factors that directly or indirectly induce apoptosis. Anti-Fas blocking antibodies have been shown to reduce TTP plasma-mediated apoptosis of microvascular endothelial cells (Lawrence et al. Blood 87:32).
45 (1996); hereby incorporated by reference). Therefore, TT
Fas ligand present in serum of P patients appears to play a role in inducing apoptosis of microvascular endothelial cells. Another thrombotic microangiopathy is the hemolytic uremic syndrome (HUS) (Moake, JL, Lancet, 343: 393, (
1994); Melnyk et al., (Arch. Intern. Med., 155:
2077, (1995); Thompson et al., Supra). Thus, in one embodiment, the present invention often provides TNFR-6α and / or T for treating or preventing a condition referred to as “adult HUS” (though children may be affected as well).
It relates to the use of NFR-6β. The disorder known as HUS associated with childhood / diarrhea differs in etiology from adult HUS. In another embodiment, the condition characterized by coagulation of small blood vessels is TNFR-6α and / or TNF of the invention.
It can be treated using R-6β polypeptides and / or polynucleotides. Such conditions include, but are not limited to, those described herein. For example, cardiac problems seen in about 5-10% of pediatric AIDS patients are thought to involve small vessel coagulation. Microvascular collapse in the heart has been reported in multiple sclerosis patients. As a further example, treatment of systemic lupus erythematosus (SLE) is contemplated. In one embodiment, the patient's blood or plasma is ex vivo and the TNFR-6α and / or TN of the present invention is ex vivo.
Contacted with FR-6β polypeptide. TNFR-6α and / or TNFR
-6β can be attached to a suitable chromatographic matrix using techniques known in the art. According to this embodiment, the patient's blood or plasma is prior to returning to the patient, matrix-bound TNFR-6α and / or TNF.
Flow through a chromatography column containing R-6β. Fixed TNFR
-6α and / or TNFR-6β are Fas ligands and / or AIMs.
-II, thus removing the Fas ligand protein from the patient's blood. Alternatively, TNFR-6α and / or TNFR-6β can be administered in vivo to patients suffering from thrombotic microangiopathy. In one embodiment, the TNFR-6α and / or TNFR-6β polynucleotides or polypeptides of the invention are administered to a patient. Accordingly, the present invention provides an effective amount of the TNFR of the present invention.
Provided are methods for treating thrombotic microangiopathy comprising the use of -6α and / or TNFR-6β polypeptides. TNFR-6α and / or TNFR
-6β polypeptides are used in in vivo or ex vivo procedures to mediate Fas ligand-mediated and / or (eg, apoptotic) microvascular endothelial cells.
Or it may inhibit AIM-II mediated damage.

The TNFR-6α and TNFR-6α and / or TNFR-6β and TNFR-6β polynucleotides of the invention can be used with other agents useful in treating a particular disorder. . For example, in an in vitro study reported by Laurence et al. (Blood 87: 3245, 1996), some reduction of TTP plasma-mediated apoptosis of microvascular endothelial cells resulted in anti-Fas blocking antibodies, aurintricarboxylic acid, or cryoprecipitation. This was achieved by using depleted normal plasma. Thus, the patient may be treated in combination with an additional agent that inhibits Fas ligand-mediated apoptosis of endothelial cells, such as those agents described above. In one embodiment, the TNFR-6α polypeptide and / or TNF of the invention.
R-6β polypeptides as well as anti-FAS blocking antibodies may be TTP or HU
It is administered to patients suffering from a disorder characterized by thrombotic microangiopathy such as S. Examples of blocking monoclonal antibodies directed against the Fas antigen (CD95) are included in International Application Publication No. WO95 / 1, which is hereby incorporated by reference.
0540.

The naturally occurring balance between endogenous stimulators and inhibitors of angiogenesis is such that inhibitory effects predominate. Rastinejad et al., Cell
56: 345-355 (1989). Neovascularization is under normal physiological conditions (
In the rare instances that occur during wound healing, tissue regeneration, embryonic development, and female reproductive processes, for example, angiogenesis is tightly regulated and spatially and temporally limited. Under conditions of pathological angiogenesis that characterize solid tumor growth,
These regulatory controls fail. Unregulated angiogenesis becomes pathological and sustains the progression of many neoplastic and non-neoplastic diseases. Many serious diseases are dominated by abnormal neovascularization, including solid tumor growth and metastasis, arthritis, some types of eye disorders, and psoriasis. For example, Moses et al., Bi
otech. 9: 630-634 (1991); Folkman et al.,
N. Engl. J. Med. 333: 1757-1763 (1995); Aue.
rbach et al. Microvasc. Res. 29: 401-411 (19
85); Folkman, Advances in Cancer Research.
Edited by rch, Klein and Weinhouse, Academic Press
S., New York, pp. 175-203 (1985); Patz, Am. J.
Opthalmol. 94: 715-743 (1982); and Folkma.
n et al., Science 221: 719-725 (1983). In many pathological conditions, the process of angiogenesis contributes to the disease state.
For example, significant data has been accumulated that suggests that solid tumor growth depends on angiogenesis. Folkman and Klagsbrun, Science
e 235: 442-447 (1987).

The invention provides for treatment of a neovascularization-related treatment or disorder by administration of a TNFR-6α and / or TNFR-6β polynucleotide and / or polypeptide of the invention. Malignant and metastatic conditions that can be treated with the polynucleotides and polypeptides of the invention include malignancies, solid tumors, and cancers described herein and otherwise known in the art. But not limited to these (for a review of such disorders, see Fishman et al., Med.
icine, 2nd edition, J. B. Lippincott Co. , Philade
lphia (1985)).

Ocular disorders associated with neovascularization that may be treated with the TNFR-6α and / or TNFR-6β polynucleotides and / or polypeptides of the present invention, including TNFR agonists and / or antagonists, include: Neovascular glaucoma, diabetic retinopathy, retinoblastoma, post lens fibroplasia, uveitis, retinopathy of premature macular degeneration, corneal neovascularization, as well as other inflammatory diseases of the eye, eye tumors , And diseases associated with choroidal or iris neovascularization. For example, Waltman et al., Am. J. Ophthal. 85
: 704-710 (1978) and Gartner et al., Surv. Ophth
al. 22: 291-312 (1978).

In another embodiment, TNFR-6α and / or TNFR-6 of the present invention.
Polynucleotides and polypeptides of β, and / or agonists or antagonists are used to stimulate the differentiation and / or survival of photoreceptor cells and / or reduce the number, differentiation and / or survival of photoreceptor cells. It can be used to treat or prevent a related disease, disorder, or condition.

Further, disorders that can be treated with the TNFR-6α and / or TNFR-6β polynucleotides and polypeptides of the present invention, including TNFR agonists and / or antagonists, include hemangiomas, arthritis, psoriasis, Angiofibromas,
Atherosclerotic plaque, delayed wound healing, granulation, hemophilic joints, hyperplastic scars,
Non-limiting examples include non-union joints, Austler-Weber syndrome, pyogenic granulomas, scleroderma, trachoma, and vascular adhesions.

In a further embodiment, TNFR-6α and / or TNFR-6β polynucleotides, polynucleotides, and / or other compositions of the invention (eg, anti-TNFR-6α and / or anti-TNFR-6β antibodies). Are used to treat or prevent diseases or conditions associated with allergies and / or inflammation.

In certain embodiments, TNFR polynucleotides, polypeptides and / or
Alternatively, the agonist or antagonist can be used to treat or prevent thyroid-related eye disorders and / or tissue / cell damage or destruction, and / or medical conditions associated with thyroid-related eye disorders.

In certain embodiments, TNFR polynucleotides, polypeptides or agonists of the invention are used to prolong protein expression following gene therapy by inhibiting or reducing elimination of transgene expressing cells. .

In a further embodiment, TNFR-6α and / or TNFR-6β polynucleotides and / or polynucleotides, and / or agonists or antagonists thereof are used to promote wound healing.

The polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful in diagnosing and treating or preventing a wide range of diseases and / or conditions. Such diseases and conditions include cancer (eg, immune cell-related cancer, breast cancer, prostate cancer, ovarian cancer, follicular lymphoma,
cancers associated with p53 mutations or changes, brain tumors, bladder cancers, cervical cancers, colon cancers,
Colorectal cancer, non-small cell lung cancer, small cell lung cancer, gastric cancer, etc., lymphoproliferative disorders (
For example, lymphadenopathy), microbial (for example, virus, bacteria, etc.) infection (for example,
HIV-infection, HIV-2 infection, herpes virus infection (HSV-1, HSV-
2, CMV, VZV, HHV-6, HHV-7, EBV), adenovirus infection, poxvirus infection, human papillomavirus infection, hepatitis infection (eg, HAV, HBV, HCV, etc.), Helicoba
cter pylori infection, invasive Staphylococcus, etc.), parasitic infection, nephritis, bone disease (eg, osteoporosis), atherosclerosis, pain, cardiovascular disorders (eg, neovascularization, hypovascularization or circulation). Decrease (
For example, ischemic disease (eg, myocardial infarction, stroke, etc.)), AIDS, allergy, inflammation, neurodegenerative disease (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, pigmented retinopathy, cerebellum) Degeneration), transplant rejection (acute and chronic)
, Graft-versus-host disease, diseases caused by myelodysplasia (eg, aplastic anemia), joint tissue destruction in rheumatism, liver disease (eg, acute and chronic hepatitis, liver injury, and cirrhosis), self Immune diseases (eg, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, immune complex glomerulonephritis, autoimmune diabetes, autoimmune thrombocytopenic purpura, Graves' disease, Hashimoto thyroiditis, etc.), myocardium (Eg dilated cardiomyopathy), diabetes, diabetic complications (eg diabetic nephropathy, diabetic neuropathy, diabetic retinopathy), influenza, asthma, psoriasis, glomerulonephritis, septic shock, and ulcers. Colitis, but is not limited thereto.

Polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful in promoting angiogenesis, regulating hematopoiesis, and wound healing (eg, wounds, burns, and fractures). Is.

The polynucleotides and / or polypeptides of the present invention and / or agonists and / or antagonists thereof are also useful as adjuvants for enhancing the immune responsiveness to specific antigens, antiviral immune response.

More generally, the polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful in modulating (ie, increasing or decreasing) the immune response. For example, the polynucleotides and / or polypeptides of the present invention may be useful in the preparation or recovery from surgery, trauma, radiation therapy, chemotherapy, and transplantation, and also in immune responses in elderly and immunocompromised individuals. And / or used to boost recovery. Alternatively, the polynucleotides and / or polypeptides of the invention and / or agonists and / or antagonists thereof are useful as immunosuppressive agents, eg, in treating or preventing autoimmune disorders. In certain embodiments, the polynucleotides and / or polypeptides of the invention have a chronic inflammatory, allergic or autoimmune condition, such as those described herein or otherwise known in the art. ) Is used to treat or prevent.

In one aspect, the invention relates to a method for enhancing apoptosis induced by a TNF family ligand, which method comprises administering a TNFR antagonist (eg, an anti-TNFR antibody or TNFR polypeptide fragment) to a patient (preferably Includes the step of administering to humans). Preferably, the TNFR antagonist is administered to treat diseases and conditions that have been shown to have increased cell survival. Antagonists of the invention include monoclonal antibodies directed against soluble forms of TNFR and TNFR polypeptides.

By “antagonist” is intended naturally occurring and synthetic compounds that can enhance or enhance apoptosis. By "agonist" is intended naturally occurring and synthetic compounds that can inhibit apoptosis.
Whether any of the candidate "agonists" or "antagonists" of the present invention may inhibit or enhance apoptosis is known in the art as a TNF-family ligand / receptor cell response assay (as described in more detail below). including)
Can be determined using

One such screening procedure involves the use of melanophores which are transfected and express the receptor of the invention. Such a screening technique is disclosed in International Application Publication No. WO92 / 0, which was published on February 6, 1992.
1810. Such assays can be used, for example, to screen for compounds that inhibit (or enhance) the activation of the receptor polypeptides of the invention. This assay relies on contacting melanophores encoding the receptor with both a TNF family ligand and a candidate antagonist (or agonist). Inhibition and enhancement of the signal produced by the ligand indicates that the compound is an antagonist or agonist of the ligand / receptor signaling pathway.

[0429] Other screening techniques include the use of cells expressing the receptor (eg, transfected CHO cells) in a system that measures extracellular pH changes caused by receptor activation (eg, Science 246).
: 181-296 (October 1989)). For example, the compound can be contacted with cells expressing a receptor polypeptide of the invention, and a second messenger response (eg, signal transduction or pH change) can be measured and the potential compound activates the receptor or It is decided whether to inhibit.

Another such screening technique involves introducing RNA encoding the receptor into a Xenopus oocyte to transiently express the receptor. The receptor oocyte can then be contacted with a receptor ligand and the compound screened, followed by inhibition or activation of the calcium signal in the case of a screen for compounds believed to inhibit receptor activation. Can be detected.

Another screening technique involves expressing the construct in cells, where the receptor is linked to phospholipase C or D. Such cells include endothelial cells, smooth muscle cells, embryonic kidney cells and the like. This screen may be accomplished by detection of receptor activation or inhibition of receptor activation from the phospholipase signal, as described herein above.

Another method is to screen for compounds that inhibit activation of the receptor polypeptide of the antagonists of the invention by determining the inhibition of binding of the labeled ligand to cells bearing the receptor on their surface. Includes.
Such a method involves transfecting a eukaryotic cell with a DNA encoding the receptor so that the cell expresses the receptor on its surface and the cell in the presence of a labeled form of a known ligand. Contacting the compound with a compound. The ligand can be labeled, eg, by radioactivity. The amount of labeled ligand bound to the receptor is measured, for example, by measuring the radioactivity of the receptor. If the compound binds to the receptor as determined by the reduction of labeled ligand that binds to the receptor, the binding of labeled ligand to the receptor is inhibited.

Additional screening assays for agonists and antagonists of the present invention are described in Tartaglia, L .; A. And Goeddel, D .; V. ,
J. Biol. Chem. 267 (7): 4304-4307 (1992).

Thus, in a further aspect, the candidate agonist or antagonist is TN
Screening methods are provided to determine whether a cellular response to an F family ligand can be enhanced or inhibited. The method comprises contacting a cell expressing a TNFR polypeptide with a candidate compound and a TNF family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard Is assayed when contacted with the ligand in the absence of the candidate compound, whereby an increase in cellular response over the standard indicates that the candidate compound is an agonist of the ligand / receptor signaling pathway. , And a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand / receptor signaling pathway. By "assaying a cellular response", qualitatively or quantitatively measuring a cellular response to a candidate compound and / or a TNF family ligand (eg, determining an increase or decrease in T cell proliferation or tritiated thymidine label). Or estimating) is intended. According to the present invention, cells expressing a TNFR polypeptide can be contacted with a TNF family ligand provided either endogenously or exogenously.

Agonists according to the present invention include naturally occurring and synthetic compounds (eg TNF family ligand peptide fragments, transforming growth factors, neurotransmitters (eg glutamic acid, dopamine, N-methyl-D-aspartic acid). ), Tumor suppressors (p53), cytolytic T cells, and antimetabolites). Preferred agonists include chemotherapeutic agents such as cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate, and vincristine. Other agonists include ethanol and amyloid peptide (Science)
e 267: 1457-1458 (1995)). Further preferred agonists include polyclonal and monoclonal antibodies raised against TNFR polypeptides or fragments thereof. Such agonistic antibodies elicited against the TNF family of receptors have been described by Tartaglia, L. et al. A
． Et al., Proc. Natl. Acad. Sci. USA 88: 9292-92.
96 (1991); and Tartaglia, L .; A. And Goedde
1, D.I. V. J. Biol. Chem. 267 (7): 4304-4307 (
1992). See also International Application Publication Number WO 94/09137.

Antagonists according to the invention include naturally occurring and synthetic compounds (
For example, CD40 ligand, natural amino acid, zinc, estrogen, androgen, viral gene (eg, adenovirus ElB, baculovirus p35).
And IAP, cowpox virus crmA, Epstein-Barr virus BHRF1
, LMP-1, African swine fever virus LMW5-HL, and herpesvirus yl34.5), calpain inhibitors, cysteine protease inhibitors, and tumor promoters (eg PMA, phenobarbital, and hexachlorocyclohexane)). Other antagonists include TN
Included are polyclonal and monoclonal antibodies raised against FR polypeptides or fragments thereof. Such antagonist antibodies raised against the TNF family of receptors are described in Tartaglia, L .; A. And Goeddel, D .; V. J. Biol. Chem. 267 (7): 43
04-4307 (1992) and Tartaglia, L .; A. Et Cel
73: 213-216 (1993). International Publication Number WO
See also 94/09137.

In a particular embodiment, the antagonist according to the invention is a nucleic acid corresponding to the sequence contained in TNFR or its complementary strand and / or the nucleotide sequence contained in the deposited clones (ATCC Deposit Nos. 97810 and 97809). is there. In one embodiment, the antisense sequence is produced internally by the organism, and in another embodiment, the antisense sequence is administered separately (eg, O'Connor, J., Neurochem. 56: 560 (1991). ) And Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC P
See Less, Boca Raton, FL (1988)). Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple helix formation. Antisense technology is described in, for example, Okano, J. et al. Neurochem. 56: 560 (1991)
; Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC Pr
ess, Boca Raton, FL (1988). Triple helix formation is described, for example, in Lee et al., Nucleic Acids Rease.
rch 6: 3073 (1979); Cooney et al., Science 241.
: 456 (1988); and Dervan et al., Science 251: 13.
00 (1991). This method is based on the binding of polynucleotides to complementary DNA or RNA.

For example, the 5'coding portion of the polynucleotide encoding the mature polypeptide of the invention can be used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription, thereby interfering with transcription and production of the receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into a receptor polypeptide.

In one embodiment, the TNFR antisense nucleic acids of the invention are produced intracellularly by transcription from an exogenous sequence. For example, the vector or part thereof is
It is transcribed to produce the antisense nucleic acid (RNA) of the invention. Such a vector contains a sequence encoding a TNFR antisense nucleic acid. Such a vector, so long as it can be transcribed to produce the desired antisense RNA,
It can remain episomal or become chromosomally integrated. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmids, viruses, or others known in the art used for replication and expression in vertebrate cells. Expression of the sequence encoding TNFR or a fragment thereof may be due to the action in vertebrate (preferably human) cells by any promoter known in the art. Such promoters can be inducible or constitutive.
Such promoters include the SV40 early promoter region (Bernois
t and Chamber, Nature 29: 304-310 (1981)).
, A promoter contained in the 3'-long terminal repeat of Rous sarcoma virus (Yamamo
to et al., Cell 22: 787-797 (1980)), herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. US).
． A. 78: 1441-1445 (1981)), regulatory sequences of the metallothionein gene (Brinster et al., Nature 296: 39-42 (1982).
) And the like, but are not limited to these.

The antisense nucleic acid of the present invention comprises a sequence complementary to at least a part of the RNA transcript of the TNFR gene. However, perfect complementarity, although preferred, is not necessary. A sequence “homologous to at least a portion of RNA”, as referred to herein, is a sequence that has sufficient complementarity to hybridize to RNA and forms a stable duplex. Means In the case of double-stranded TNFR antisense nucleic acids, therefore, single strands of double-stranded DNA can be tested or triplex formation can be assayed. The ability to hybridize depends on both the degree of complementarity and the length of the antisense nucleic acid. In general, the longer the hybridizing nucleic acid, the TN it may contain and still form a stable duplex (or triplex in some cases).
More base mismatches with FR RNA. One of ordinary skill in the art can ascertain the acceptable degree of mismatch by using standard means to determine the melting temperature of the hybridized complex.

Oligonucleotides complementary to the 5'end of the message (eg, 5'untranslated sequences up to and including the AUG start codon) should work most efficiently in inhibiting translation. . However, sequences complementary to the 3'untranslated sequences of mRNAs have also been shown to be effective in inhibiting translation of mRNAs. Generally, Wagner, R .; , Nature 372: 333-335 (
1994). Therefore, the oligonucleotides complementary to either the 5'untranslated, noncoding region or 3'untranslated, noncoding region of TNFR shown in FIGS. 1 and 2 inhibit the translation of endogenous TNFR mRNA. Can be used in the antisense approach. Oligonucleotides complementary to the 5'untranslated region of the mRNA should include the complement of the AUG start codon. mRNA
Antisense oligonucleotides complementary to the coding region, although less efficient inhibitors of translation, can be used in accordance with the present invention. TNFR mRNA
Antisense nucleic acids, whether designed to hybridize to the 5 ', 3', or coding regions of, should be at least 6 nucleotides in length, and preferably 6 to about 50 nucleotides in length. Range of oligonucleotides. In particular aspects, the oligonucleotide is at least about 10 nucleotides, at least about 17 nucleotides, at least about 25 nucleotides, or at least about 50 nucleotides.

The polynucleotides of the present invention may be single or double stranded DNA or RNA or chimeric mixtures or derivatives or modified versions thereof. Oligonucleotides can be modified with base moieties, sugar moieties, or phosphate backbones to improve, for example, molecular stability, hybridization, and the like. Oligonucleotides may be conjugated to other added groups such as peptides (eg, to target host cell receptors in vivo) or agents to facilitate transport across cell membranes (eg, Letsinger et al., Proc. Natl. Acad, Sci.U.S.
A. 86: 6553-6556 (1989); Lemaitre et al., Proc.
Natl. Acad. Sci. U. S. A. 84.648-652 (1987).
PCT Publication No. WO 88/09810 (published December 15, 1988), or the blood-brain barrier (eg, PCT Publication No. WO 89/10134 (see
(Published April 25, 1988)), hybridization-induced cleavage agents (eg, Krol et al., BioTechniques 6: 9).
58-976 (1988)) or insertion (intercalati).
ng) drug (eg, Zon, Pharm. Res. 5: 539-549 (19
88))). To this end, the oligonucleotide
It can be conjugated with another molecule (eg, a peptide, hybridization-induced cross-linking agent, transport agent, hybridization-induced cleavage agent, etc.).

Antisense oligonucleotides may include at least one modified base moiety selected from, but not limited to, the group including: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodo. Uracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylkyuosin , Inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2
-Methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueucin, 5- Methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxosine (w
ybutoxosine), pseudouracil, cuocosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5
-Methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-
Oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N
-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine.

Antisense oligonucleotides also include at least one modified sugar moiety selected from, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense oligonucleotides include phosphorothioates, phosphoramidothioates, phosphoramidates, phosphordiamidates, methylphosphonates, alkylphosphotriesters, and formacetals or analogs thereof. Selected from the group including, but not limited to,
It comprises at least one modified phosphate backbone.

In yet another embodiment, the antisense oligonucleotide is an α-anomeric oligonucleotide. Alpha-anomeric oligonucleotides form specific double-stranded hybrids with complementary RNA, where the strands run parallel to each other as opposed to the normal β-unit (Gautier et al., Nucl. Acids.
Res. 15: 6625-6641 (1987)). The oligonucleotide is

[0447]

[Equation 16] Methyl ribonucleotides (Inoue et al., Nucl. Acids. Res. 15)
: 6131-6148 (1987)) or chimeric RNA-DNA analog (I
noue et al., FEBS Lett. 215: 327-330 (1987)).

Polynucleotides of the invention can be prepared by standard methods known in the art (eg, automated DNA synthesizers (eg, Biosearch, Applied).
(Such as those commercially available from Biosystems))
Can be synthesized. As an example, phosphorothioate oligonucleotides are available from Stei
n, et al. (Nucl. Acids Res. 16: 3209 (1988)), the methylphosphonate oligonucleotides were synthesized by controlled pore glass polymer support (Sarin et al., Proc. Natl. Acad. Sc.
i. U. S. A. 85: 7448-7451 (1988)) and the like.

Although antisense nucleotides complementary to the TNFR coding region sequences can be used, those complementary to the transcribed untranslated region are most preferred.

Potential antagonists in accordance with the present invention also include catalytic RNA, ie ribozymes (eg International Application Publication No. WO published Oct. 4, 1990).
90/11364; Sarver et al., Science 247: 1222-12.
25 (1990)). Ribozymes that cleave mRNAs at site-specific recognition sequences can be used to destroy TNFR mRNA, although the use of hammerhead ribozymes is preferred. Hammerhead ribozyme is a target mR
MR at the position indicated by the adjoining border forming complementary base pairs with NA
Disconnect NA. The only requirement is that the target mRNA has the following two base sequences: 5'-
It is to have UG-3 '. Construction and production of hammerhead ribozymes are well known in the art, and Haseroff and Gerlac
h, Nature 334: 585-591 (1988). TNFR-6α (FIG. 1, SEQ ID NO: 1) and TNFR-5β (FIG. 2,
There are a number of potential hammerhead ribozyme cleavage sites in the nucleotide sequence of SEQ ID NO: 3). Preferably, the ribozyme has a cleavage recognition site of T
Engineered to be located near the 5'end of the NFR mRNA; ie, to increase efficiency and minimize intracellular accumulation of non-functional RNA transcripts.

As in the antisense approach, the ribozymes of the invention can be composed of modified oligonucleotides (eg, for improved stability, targeting, etc.) and express TNFR in vivo. Should be delivered to cells.
The ribozyme-encoding DNA construct may be introduced into cells in a manner similar to that described above for the introduction of DNA-encoding antisense. The preferred method of delivery is
Strong constitutive promoters (eg, pol III promoter or pol I
I) promoter), a DNA construct that "encodes" a ribozyme is used, so that the transfected cells are disrupted by the endogenous TNFR message and in sufficient quantity to interfere with translation. Producing a ribozyme. Such ribozymes, unlike antisense, are catalytic and lower intracellular concentrations are required for efficiency.

Endogenous gene expression can also be reduced by inactivating or “knocking out” the TNFR gene and / or its promoter using targeted homologous recombination (eg Smithies et al. Nature). 317:
230-234 (1985); Thomas and Capecchi, Cell.
51: 503-512 (1987); Thompson et al., Cell 5: 3.
13-321 (1989), each of which is incorporated herein by reference in its entirety). For example, a variant of the invention, a non-functional polynucleotide (or a completely unrelated DNA sequence), flanked by DNA homologous to an endogenous polynucleotide sequence (either the coding or regulatory region of the gene).
Can be used with or without selectable and / or negative selectable markers to transfect cells expressing a polypeptide of the invention in vivo. In another embodiment, techniques known in the art are used to generate a knockout in a cell that contains a gene of interest but does not express that gene. Insertion of the DNA construct via targeted homologous recombination results in inactivation of the target gene. Such an approach is particularly suitable in the field of research and agriculture, where modifications to embryonic stem cells can be used to generate animal progeny having a targeted gene that is inactive (eg, Tho).
mas and Capecchi 1987 and Thompson 1989.
, See above). However, this approach is useful if the recombinant DNA constructs are directly administered or targeted in vivo to the required site using a suitable viral vector that will be apparent to those skilled in the art. It may be routinely adapted for use in humans. The contents of each of the documents cited in this paragraph are hereby incorporated by reference in their entireties.

Antibodies according to the present invention may be prepared by any of a variety of standard methods using the TNFR immunogens of the present invention. Such TNFR immunogens include the TNFR protein (shown in SEQ ID NO: 2 and SEQ ID NO: 4, respectively) (
This may or may not include a leader sequence) as well as TNFR
Polypeptide fragments of TNFR containing the ligand binding domain and / or extracellular domain of

Agonists or antagonists of polyclonal and monoclonal antibodies in accordance with the present invention can be prepared by methods disclosed herein and / or known in the art (eg, Tartaglia and Goeddel, J. Biol).
． Chem. 267 (7): 4304-4307 (1992); Tatagl.
ia et al., Cell 73: 213-216 (1993), as well as International Application Publication No. WO 94/09137, the contents of each of these three applications being incorporated herein by reference in its entirety. Method).
And preferably, it is specific for the polypeptide of the present invention having the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4. Antibodies according to the present invention can be prepared by any of the various methods described herein and known in the art.

Further antagonists according to the invention include soluble forms of TNFR (eg TNFR fragments containing the ligand binding domain from the extracellular region of the full length receptor). Such soluble forms of the receptor, which may be naturally-occurring or synthetic, may bind to cell surface TN for binding to TNF family ligands.
Antagonizing TNFR-mediated signaling by competing with FR and / or antagonizing TNFR-mediated inhibition of apoptosis, for example by destroying the ability of TNFR to multimerize and / or bind, By an apoptosis-inducing ligand (eg, Fas ligand and AIM-II
) Is neutralized. Therefore, the soluble form of the receptor containing the ligand binding domain is T
It is a novel cytokine that can reduce TNFR-mediated inhibition of tumor necrosis induced by NF family ligands. Other such cytokines are known in the art and act physiologically to limit apoptosis induced by Fas ligand, FasB (soluble form of mouse Fas receptor) (Hug.
hes, D.H. P. And Crispe, I .; N. J. Exp. Med. 182
: 1395-1401 (1995)).

Proteins and other compounds that bind to the extracellular domain are also candidate agonists or antagonists according to the present invention. Such binding compounds can be "captured" using the yeast two-hybrid system (Fields and Song.
, Nature 340: 245-246 (1989)). A modified version of the yeast two-hybrid system has been described by Roger Brent and coworkers (Gyuris, J. et al., Cell 75: 791-80.
3 (1993); Zervos, A .; S. Et al., Cell 72: 223-232.
(1993)).

By “TNF family ligand” is intended naturally occurring, recombinant, and synthetic ligands capable of binding to a member of the TNF receptor family and inducing its ligand / receptor signaling pathway. . Members of the TNF ligand family include, but are not limited to: TNFR-6α and TNFR-6β ligands, TNF-α.
, Lymphotoxin-α (also known as LT-α, TNF-β), LT-β
, FasL, CD40, CD27, CD30, 4-lBB, OX40, TRAI
L, AIM-II, and nerve growth factor (NGF).

Formulation and Administration The TNFR polypeptide composition can be used to determine the clinical condition of an individual patient (particularly TNFR-
Side effects of treatment with 6α polypeptide or TNFR-6β polypeptide alone), good considering the site of delivery of the TNFR polypeptide composition, method of administration, schedule of administration, and other factors known to the practitioner. Prescribed and administered in a manner consistent with good medical practice. Thus, an "effective amount" of a TNFR polypeptide for the purposes herein is determined by such considerations.

As a general proposition, an overall pharmaceutically effective amount of TNFR polypeptide administered parenterally per dose is about 1 μg / kg / day to 10 mg / k of patient body weight.
Although in the g / day range, as noted above, this is at therapeutic discretion. More preferably, this dose is at least about 0.01 mg / kg / day, and most preferably between about 0.01 mg / kg / day and 1 mg / kg / day for humans (for hormones). When administered sequentially, the TNFR polypeptide is typically by injection at a rate of about 1 μg / kg / hour to about 50 μg / kg / hour from 1 to 4 injections per day, or For example, either by continuous subcutaneous infusion using a minipump. Intravenous bag solutions may also be used. The length of treatment required to observe the change and the post-treatment interval for the resulting response appears to be highly dependent on the desired effect.

Effective dosages of the compositions of the present invention to be administered can be determined by those of skill in the art through procedures well known in the art, which address parameters such as: biological half-life, bioavailability. , And toxicity. Such determinations are well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

The bioexposure of an organism to TNFR-6α or TNFR-6β polypeptides during therapy also plays an important role in determining a therapeutically and / or pharmaceutically effective dose regimen. It can be achieved. Dosage variations (eg, TNFR-6α polypeptide or T over a relatively long period of time)
Repeated administration of relatively low doses of NFR-6β polypeptide) is therapeutic with respect to the effect achieved by repeated administration of relatively high doses of TNFR-6α or TNFR-6β polypeptides over a relatively short period of time. It may have a pharmaceutically distinct effect.

Freireich, E. J. Et al (Cancer Chemotherapy
Using the equivalent surface area dose conversion factors provided by Reports 50 (4): 219-44 (1966)), one of ordinary skill in the art will appreciate that TNFR-6α or TNFR-6β polypeptides in a given experimental system. The data obtained from the use of the above can be successfully translated into an accurate estimate of the pharmaceutically effective amount of TNFR-6α or TNFR-6β polypeptide administered per dose in another experimental system. Experimental data obtained through administration of TNFR6-Fc in mice was transformed through the transformation coefficient provided by Freireich et al. (See, eg, Example 21), and TNFR-6 in rat, monkey, dog, and human. An accurate estimate of the pharmaceutically effective amount of The following conversion table (Table I
V) is a summary of the data provided by Freireich et al. Table IV
Is the dose expressed in mg / kg from one species in mg in the other species tabulated
An approximation factor is given for conversion to equivalent surface area dose expressed as / kg.

[0463]

[Table 11] Thus, for example, using the conversion factors provided in Table IV, 5 in mice
A dose of 0 mg / kg is converted to an appropriate dose of 12.5 mg / kg in monkeys. This is because (50 mg / kg) × (1/4) = 12.45 mg / kg. As a further example, 0.02, 0.08, 0.8, 2 in mice
, And 8 mg / kg dose was 1.667 μg / kg in humans, respectively.
, 6.67 μg / kg, 66.7 μg / kg, 166.7 μg / kg, and 0
． Equivalent to producing a dose of 667 mg / kg.

A TNFR-6α or TNFR-6β polypeptide of the invention is
It can be administered using any method known in the art. These methods include, but are not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter injection, biolistic injector, particle accelerator, gel foam sponge depot, and other commercially available depots. Substances, osmotic pumps, oral or suppository solid pharmaceutical formulations, intraoperative decanting and topical application, aerosol delivery. Such methods are known in the art. TNFR-6α polypeptide or TN of the present invention
The FR-6β polypeptide can be administered as part of a pharmaceutical composition described in more detail below. TNFR-6α polypeptide or TNFR-6β of the present invention
Methods of delivering polypeptides are known in the art and are described in more detail herein.

The pharmaceutical composition comprising TNFR of the present invention may be administered orally, rectally, parenterally, in a bath,
Vaginal, intraperitoneal, topical (by powder, ointment, drops, or transdermal patch)
, Buccal, or can be administered orally or as a nasal spray. By "pharmaceutically acceptable carrier" is meant a non-toxic solid, semi-solid, or liquid filler, diluent,
By encapsulating material or any type of formulation aid. The composition can, if desired, also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, and intraarticular injection and infusion.

The TNFR polypeptide is also suitably administered by a sustained release system. Suitable examples of sustained-release compositions include suitable polymeric substances (eg, semipermeable polymer matrices in the form of shaped articles (eg, films or microcapsules)), suitable hydrophobic substances (eg, acceptable oils). As an emulsion in), or an ion exchange resin, and a poorly soluble derivative (eg, poorly soluble salt).

Sustained-release matrices include polyactide (US Pat. No. 3,773,919, EP58,481), copolymers of L-glutamic acid and γ-ethyl-L-glutamic acid (Sidman, U. et al., Biopolymers 22). : 547-
556 (1983)), poly (2-hydroxyethyl methacrylate) (R.
Langer et al. Biomed. Mater. Res. 15: 167-27
7 (1981), and R.S. Langer, Chem. Tech. 12: 98-
105 (1982)), ethylene vinyl acetate (R. Langer et al., Ibid.), Or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).

Sustained-release compositions also include liposomally entrapped compositions of the invention (generally Langer, Science 249: 1527-1533 (1990)).
Treat et al., Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-
Berestein and Fidler (ed.), Liss, New York,
317-327 and 353-365 (1989)). Liposomes containing TNFR polypeptides are prepared by methods known per se: DE 3,218.
, 121; Epstein et al., Proc. Natl. Acad. Sci. (US
A) 82: 3688-3692 (1985); Hwang et al., Proc. Nat
l. Acad. Sci. (USA) 77: 4030-4034 (1980); E.
P 52,322; EP 36,676; EP 88,046: EP 143.
949; EP 142, 641; Japanese Patent Application 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,
324. In general, liposomes are small (about 200-800 angstroms) unilamellar with a lipid content greater than about 30 mol% cholesterol, and the selected proportions are adjusted for optimal TNFR polypeptide therapy.

In yet a further embodiment, the composition of the invention is delivered by a pump (Langer, supra; Sefton, CRC Crit. Ref. Biom.
ed. Eng. 14: 201 (1987); Buchwald et al., Surger.
y 88: 507 (1980); Saudek et al., N. et al. Engl. J. Med.
321: 574 (1989)).

Another controlled release system is the Langer
(Science 249: 1527-1533 (1990)).

For parenteral administration, in one embodiment the TNFR polypeptide is
Generally, a unit dose infusion form (solution, suspension, or emulsion) of the desired purity of the TNFR polypeptide is administered to the recipient in a pharmaceutically acceptable carrier (ie, the dosage and concentration used). Which are non-toxic and compatible with the other ingredients of the formulation). For example, the formulation preferably does not contain oxidizing agents, and other compounds known to be deleterious to polypeptides.

In general, the formulations are prepared by contacting the TNFR polypeptide homogeneously and intimately with a liquid carrier or a finely divided solid carrier or both. The product is then shaped, if desired, into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline,
Ringer's solution and dextrose solution are mentioned. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as are liposomes.

The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such agents are non-toxic to recipients at the dosages and concentrations used and are buffering agents such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids or salts thereof; Antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides (eg, polyarginine or tripeptides); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic such as polyvinylpyrrolidone Polymers; amino acids such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides,
And other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and / or polysorbates, poloxamers. , Or PEG
Nonionic surfactants such as

TNFR polypeptides are typically about 0.1 mg / ml to 100 mg / m.
Formulation in such a vehicle at a pH of about 3-8 at a concentration of 1, preferably 1-10 mg / ml. The use of certain of the above excipients, carriers or stabilizers is
It is understood that it results in the formation of FR polypeptide salts.

The TNFR polypeptide used for therapeutic administration must be sterile.
Sterilization is easily completed by filtration through sterile filtration membranes (eg 0.2 micron membranes). Therapeutic TNFR polypeptide compositions are generally placed in a container having a sterile access port, such as an intravenous infusion solution bag or vial having a stopper pierceable by a hypodermic injection needle.

Generally, the TNFR polypeptide is stored in unit or multi-dose containers, such as sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, a 10 ml vial is filled with sterile filtered 1% (w / v) aqueous TNFR polypeptide solution (5 ml) and the resulting mixture is lyophilized. The injection solution was lyophilized TN using bacteriostatic water for injection.
Prepared by reconstituting the FR polypeptide.

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more ingredients of the pharmaceutical compositions of the invention. Such containers may be accompanied by a notice in the form specified by the governmental agency that regulates the manufacture, use or sale of pharmaceutical or biological products, which notice may be of manufacture, use or sale for human administration. Indicates agency approval. Moreover, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

The compositions of this invention may be administered alone or in combination with other therapeutic agents.
These therapeutic agents include chemotherapeutic agents, anti-opportunistic infectious agents, anti-viral agents, antibiotics, steroidal and non-steroidal anti-inflammatory agents, immunosuppressive agents, conventional immunotherapeutic agents and cytokines. Not limited to. Combinations can be concomitant (eg, as a mixture), separately (but simultaneously or immediately).
; Or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously (eg, through separate intravenous lines in the same subject). . "Combination" administration further encompasses the separate administration of one of the compounds or agents to give the first administration, followed by the second administration.

In one embodiment, the compositions of this invention are administered in combination with other members of the TNF family. TNF, T that can be administered with the compositions of the invention
NF-related or TNF-like molecules include, but are not limited to: soluble forms of TNF-α, lymphotoxin-α (LT-α, TNF-.
also known as β), LT-β (found in the complex heterotrimer LT-α2-β), OPGL, CD27L, CD30L, CD40L, 4-1BB.
L, DcR3, OX40L, TNF-γ (international application publication number WO96 / 1432
8), AIM-I (International Application Publication No. WO97 / 33899), AIM-II (
International application publication number WO 97/34911), APRIL (J. Exp. Med.
188 (6): 1185-1190), endokine-α (international application publication number W)
O98 / 07880), OPG, and Neutrokine-α (International Application Publication No. WO98 / 18921), TWEAK, OX40, and nerve growth factor (NG).
F) and soluble forms of Fas, CD30, CD27, CD40 and 4-IB
B, TR2 (International Application Publication Number WO96 / 34095), DR3 (International Application Publication Number WO97 / 33904), DR4 (International Application Publication Number WO98 / 32856)
), TR5 (International Application Publication Number WO98 / 30693), TR7 (International Application Publication Number WO98 / 41629), TRANK, TR9 (International Application Publication Number WO98).
/ 56892), TR10 (International Application Publication Number WO98 / 54202), 312.
C2 (International Application Publication No. WO98 / 06842) and TR12.

Conventional non-specific immunosuppressive agents that may be administered in combination with the compositions of the present invention include, but are not limited to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide, methylprednisone. , Prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells.

In a particular embodiment, the compositions of this invention are administered in combination with an immunosuppressive agent. Immunosuppressant preparations that may be administered with the compositions of the present invention include, but are not limited to, ORTHOCLONE ^™ (OKT3).
, SANDIMMUNE ^™ / NEORAL ^™ / SANGDYA ^™ (cyclosporine), PROGRAM ^™ (tacrolimus), CELLCEPT ^™ (mycophenolate), azathioprine, glucocorticosteroids (glucorticosteroids) ( ^TM ), RAPAMURUSE, and RAPAMUR. In certain embodiments, immunosuppressive agents may be used to prevent rejection of organ or bone marrow transplants.

In certain embodiments, the compositions of the invention are administered in combination with an antiretroviral agent, a nucleoside reverse transcriptase inhibitor, a non-nucleoside reverse transcriptase inhibitor, and / or a protease inhibitor. Nucleoside reverse transcriptase inhibitors that can be administered in combination with the compositions of the present invention include:
Non-limiting examples include: RETROVIR ^™ (Zidovudine / AZT), VIDEOX ^™ (Didanocin / ddI), HIVID ^™ (Zalcitabine / ddC), ZERIT ^™ (Stavudine / d4T), EPIVIR ^™ (lamivudine / 3TC). , And COMBIVIR ^™ (zidovudine / lamivudine). Non-nucleoside reverse transcriptase inhibitors that may be administered in combination with the compositions of the present invention include, but are not limited to: VIRAMUNE ^™ (
Nevirapine), RESCRIPTOR ^™ (Deravirdin), and SUSTIV
A ^TM (Efavirenz). Protease inhibitors that may be administered in combination with the compositions of the present invention include, but are not limited to: CR
IXIVAN ^™ (Indinavir), NORVIR ^™ (Ritnavir), INVI
RASE ^™ (Saquinavir), and VIRACCEPT ^™ (Nelfinavir). In certain embodiments, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and / or protease inhibitors are used in any combination with the compositions of the invention to treat AIDS and / or HIV. The infection may be prevented or treated.

In another embodiment, the compositions of this invention may be administered in combination with anti-opportunistic infection agents. Anti-opportunistic infection agents that may be administered in combination with the compositions of the present invention include, but are not limited to:

[0484]

[Chemical 1] In a particular embodiment, the composition of the invention is treated with TRIMETHOPRIM-SU.
LFAMETHOXAZOLE^TM, DAPSONE^TM, PENTAMIDINE ^TM , And / or ATOVAQONE^TMUsed in any combination with
And treat opportunistic Pneumocystis carinii pneumonia infection prophylactically.
Can be placed or prevented. In another particular embodiment, the composition of the invention is treated with ISO
IAZID^TM, RIFAMPIN^TM, PYRAZINA MIDE^TM, And / or
Or ETHAMBUTOL^TMUsed in any combination with
may be prophylactically treated or prevent co-infection with cobacterium avium
. In another particular embodiment, the composition of the invention comprises a RIFABUTIN^TM, C
LARITHROMYCIN^TM, And / or AZITROMYCIN^TMWhen
Opportunistic Mycobacterium tu
berculosis infection may be treated or prevented prophylactically. Another specific implementation
In one aspect, the composition of the present invention comprises a GANCICLOVIR^TM, FOSCARNE
T^TM, CIDOFOVIR^TMUse in any combination with
Tomegalovirus infections may be treated or prevented prophylactically. In another particular embodiment
Then, the composition of the present invention is treated with FLUCONAZOLE.^TM, ITRACONAZOL
E^TM, And / or KETOCONAZOLE^TMSmell any combination with
Can be used to prophylactically treat or prevent opportunistic fungal infections. Another specific implementation
In a state, the composition of the invention may be added to ACYCLOVIR.^TMAnd / or FAMCI
COLVIR^TMUsed in any combination with, Opportunistic Herpes Simplex
Rus type I and / or type II infections may be treated or prevented prophylactically. Another special
In certain embodiments, the compositions of the present invention are treated with PYRIMETHAMINE.^TMand
/ Or LEUCOVORIN^TMUsed in any combination with
The Toxoplasma gondii infection may be treated or prevented prophylactically. Another
In a particular embodiment of the composition of the present invention is LEUCOVORIN^TM,and
/ Or NEUPOGEN^TMUsed in any combination with
The infection may be treated or prevented prophylactically.

In a further embodiment, the compositions of this invention are administered in combination with an antiviral agent. Antiviral agents that may be administered with the compositions of the present invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantidine.

In a further embodiment, the compositions of this invention may be administered in combination with an antibiotic drug. Antibiotics that may be administered with the compositions of the present invention include, but are not limited to, amoxicillin, aminoglycosides, β-
Lactam (glycopeptide), β-lactamase, clindamycin, chloramphenicol, cephalosporin, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolone, macrolide, metronidazole, penicillin, quinolone, rifampin, streptomycin. , Sulfonamide, tetracycline, trimethoprim, trimethoprim-sulfantoxazole (trim
ethoprim-sulfamthoxazole), and vancomycin.

In a further embodiment, the compositions of this invention may be administered alone or in combination with anti-inflammatory agents. Anti-inflammatory agents that may be administered with the compositions of the present invention include, but are not limited to, glucocorticoids and non-steroidal anti-inflammatory agents, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, Aryl carboxylic acid, aryl propionic acid derivative, pyrazole, pyrazolone, sialic acid derivative, thiazinecarboxamide, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrin, Benzaduck, benzydamine, bucolome, difenpyramide,
Ditazole, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaseprol, paranyline, perisoxal, pifoxime, procazone, proxazole, and tenidap.

In another embodiment, the compositions of this invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that may be administered with the compositions of the present invention include, but are not limited to: antibiotic derivatives (eg, doxorubicin, bleomycin, daunorubicin, and dactinomycin); anti-estrogens (
For example, tamoxifen; antimetabolites (eg, fluorouracil, 5-F
U, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (eg, carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphami). De, estramustine, hydroxyurea,
Procarbazine, mitomycin, busulfan, cisplatin, and vincristine sulfate); hormones (eg, medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate,
Chlorotrianisene, and test lactones); nitrogen mustard derivatives (eg mephalen, chlorambucil, mechlorethamine (nitrogen mustard), and thiotepa); steroids and combinations (eg betamethasone sodium phosphate); and others (eg , Dicarbazine, asparaginase, mitothene, vincristine sulfate, vinblastine sulfate and etoposide).

In certain embodiments, the compositions of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) or in any combination of the components of CHOP. In another embodiment, the compositions of the invention are administered in combination with Rituximab. In a further embodiment, the compositions of the invention are administered with Rituxmab and CHOP, or with any combination of the components of Rituxmab and CHOP.

In a further embodiment, the compositions of this invention may be administered in combination with cytokines. Cytokines that may be administered with the compositions of the invention include, but are not limited to: GM-CSF, G-CSF, IL2.
, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13,
IL15, anti-CD40, CD40L, IFN-α, IFN-β, IFN-γ, T
NF-α, and TNFβ. In another embodiment, the compositions of the invention can be administered with any interleukin. These interleukins include:
These include, but are not limited to: IL-1α, IL-1β, IL-
2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9
, IL-10, IL-11, IL-12, IL13, IL-14, IL-15,
IL-16, IL-17, IL-18, IL-19, IL-20, and IL-
21. In a preferred embodiment, the compositions of the invention are administered in combination with TNF-α. In another preferred embodiment, the composition of the invention comprises IFN-α.
It is administered in combination with.

In a further embodiment, the compositions of the invention are administered in combination with an antigenic protein. Antigenic proteins that can be administered with the compositions of the invention include, but are not limited to: Glioma-derived growth factor (GD).
GF) (disclosed in European Patent No. EP-399816); Platelet-derived storage phase factor A (PDGF-A) (disclosed in European Patent No. EP-682110); Platelet-derived growth factor B (PDGF-B) (European). Placenta growth factor (PlGF) (disclosed in International Application Publication No. WO 92/06194); Placental growth factor-2 (PlGF-2) (Hauser et al., Gorwt).
h Factors, 4: 259-268 (1993)); Vascular Endothelial Growth Factor (VEGF) (disclosed in International Application Publication No. WO 90/13649); Vascular Endothelial Growth Factor-A (VEGF-A) ( European Patent No. EP-506477
Vascular endothelial growth factor-2 (VEGF-2) (International Application Publication No. W).
O96 / 39515); vascular endothelial growth factor-B186 (VEGF-).
B186) (disclosed in International Application Publication No. WO96 / 26736); Vascular Endothelial Growth Factor-D (VEGF-D) (disclosed in International Application Publication No. WO98 / 02543); Vascular Endothelial Growth Factor-D (VEGF-). D) (International Application Publication Number WO98
/ 07832); and vascular endothelial growth factor-E (VEGF-E) (
It is disclosed in German patent number DE19639601). The above references are incorporated herein by reference.

In a further embodiment, the compositions of the invention are administered in combination with fibroblast growth factor. Fibroblast growth factors that may be administered with the compositions of the present invention include, but are not limited to: FGF-1, FGF-2.
, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8
, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, F
GF-14, and FGF-15.

In a further embodiment, the compositions of the invention are administered in combination with other therapeutic or prophylactic regimens, such as radiation therapy.

Chromosome Assays Nucleic acid molecules of the invention are also useful for chromosome identification. This sequence can be specifically targeted to and hybridize with a particular location on an individual human chromosome. Moreover, there is currently a need to identify specific sites on the chromosome. At the moment,
Most of the chromosomal marker reagents based on actual sequence data (repeated polymorphisms) are not available for marker chromosomal location. D to the chromosome according to the invention
Mapping NAs is an important first step in correlating their sequences with disease-related genes.

In certain preferred embodiments in this regard, c as disclosed herein
The DNA is used to clone the genomic DNA of the TNFR protein gene. This can be accomplished using a variety of well known techniques and libraries that are commonly available. Then, using well-known techniques for this purpose,
Genomic DNA is used for in situ chromosome mapping.

In addition, in some cases, the sequence is converted from cDNA to PCR primer (
Preferably, it can be mapped to the chromosome by preparing 15-25 bp). Computer analysis of the 3'untranslated region of the gene is used to rapidly select primers that do not span more than one exon in genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of cDNA clones to metaphase chromosome spreads can be used in one step to provide the correct chromosomal location. This technique has a c as short as 50 or 60 bp.
It can be used with DNA-derived probes. For an overview of this technology, see Ver
ma et al., Human Chromosomes: A Manual Of Ba.
sic Technologies, Pergamon Press, New Yo
See rk (1988).

Once the sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data is
For example, V. McKusick, Mendelian Inheritance
In Man (Johns Hopkins University, Wel
ch Medical Library) (available online from Ch Medical Library). Associations between genes and diseases that map to the same chromosomal region are then identified by linkage analysis (co-inheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is found in some or all of the affected individuals, but not in any normal individual, the mutation appears to be the causative agent of the disease.

The invention will be more readily understood by reference to the following examples, as generally described in the invention, which are provided by way of illustration, Not intended as a limitation.

Examples Example 1: Expression and purification of TNFR-6α and TNFR-6β in E. coli The bacterial expression vector pQE60 is used for bacterial expression in this example (
QIAGEN, Inc. , 9259 Eton Avenue, Chatswo
rth, CA, 91311). pQE60 is resistant to ampicillin antibiotics (“Am
pr ”) and a bacterial origin of replication (“ ori ”), an IPTG inducible promoter, a ribosome binding site (“ RBS ”), QIAGEN Inc. Six codons encoding a histidine residue, and a suitable single Contains restriction enzyme cleavage sites. These elements consist of six His residues (ie, “6 × His”) to which a DNA fragment encoding the polypeptide is covalently linked to the carboxyl terminus of the peptide.
Are arranged so that they can be inserted in such a way as to produce a polypeptide with a "tag"). However, in this example, the sequence encoding the polypeptide is 6
Translation of the His codon is prevented and thus the polypeptide is inserted so that it is produced without the 6xHis tag.

TNFRs Containing Mature Forms of TNFR-6α and TNFR-6β Amino Acid Sequences
The DNA sequences encoding the desired portions of the -6α and TNFR-6β proteins anneal to the amino terminal sequences of the desired portions of the TNFR-6α or TNFR-6β proteins and were deposited 3'to the cDNA coding sequence. Amplified from the deposited cDNA clone using PCR oligonucleotide primers that anneal to the sequences in the construct. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5'and 3'sequences, respectively.

To clone the mature form of the TNFR-6α protein, the 5 ′ primer contains a sequence containing an underlined NcoI restriction site.

[0503]

[Chemical 2] (SEQ ID NO: 19). Of course, one of skill in the art will appreciate that the position of the 5'primer-initiated protein coding sequence can be varied to amplify the desired portion of the complete protein, which is shorter or longer than the mature form. The 3'primer contains a sequence containing an underlined HindIII restriction site

[0504]

[Chemical 3] (SEQ ID NO: 20). To clone the mature form of the TNFR-6β protein, the 5 ′ primer has the sequence SEQ ID NO: 19 above, and 3
'The primer contains a sequence containing an underlined HindIII restriction site

[0505]

[Chemical 4] (SEQ ID NO: 21).

The amplified TNFR-6α and TNFR-6β DNA fragments and the pQE60 vector were then digested with NcoI and HindIII,
The digested DNAs are then ligated together. By inserting the TNFR-6α and TNFR-6β DNAs into the restricted pQE60 vector, IP
Position the TNFR-6α and TNFR-6β protein coding regions, including their associated stop codons, downstream in frame with the TG inducible promoter and the initiation AUG. This relevant stop codon prevents translation of the 6 histidine codons downstream of the insertion site.

The ligation mixture was subjected to Sambrook et al., Molecular Cloning:
a Laboratory Manual, 2nd Edition; Cold Spring
Harbor Laboratory Press, Cold Spring
Harbor, N.M. Y. (1989) using standard procedures as described in Competent E. E. coli cells. Multiple copies of plasmid pREP4 (which expresses the lac repressor and kanamycin resistance (
“Kanr”) is added). E. coli strain M15 / rep4 is used in carrying out the exemplary examples described herein. This strain (this is TN
It is the only strain of the many that is suitable for expressing FR-6α or TNFR-6β proteins), and is available from QIAGEN Inc. , (Supra). Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of cloned DNA is confirmed by restriction analysis, PCR and DNA sequencing.

Clones containing the desired construct were cultured overnight in liquid culture in LB medium supplemented with both ampicillin (100 μg / ml) and kanamycin (25 μg / ml) (
"O / N") grow. The O / N culture is used to inoculate large scale medium at a dilution of approximately 1:25 to 1: 250. Cells are grown to an optical density at 600 nm (“OD600”) of between 0.4 and 0.6. Then, isopropyl-β-D-
Thiogalactopyranoside (“IPTG”) was added at a final concentration of 1 mM to give lac
Inactivating the I repressor induces transcription from the lac repressor sensitive promoter. Cells are subsequently incubated for a further 3-4 hours. The cells are then harvested by centrifugation.

The cells are then agitated for 3-4 hours at 4 ° C. in 6M guanidine-HCl, pH 8 in order to purify the TNFR-6α and TNFR-6β polypeptides. Cell debris was removed by centrifugation and TNFR-6α and TNFR-6.
The supernatant containing β was mixed with 50 mM Na acetate buffer (
Dialyze against pH 6). Alternatively, the protein was added to 500 mM NaCl containing protease inhibitors, 20% glycerol, 25 mM Tri.
The protein can be successfully refolded by dialysis against s / HCl pH 7.4. After renaturation, the protein is subjected to ion exchange chromatography,
It can be purified by hydrophobic interaction chromatography and size exclusion chromatography. Alternatively, affinity chromatography steps such as antibody columns can be used to obtain pure TNFR-6α and TNFR-6β proteins. The purified protein is stored at 4 ° C or frozen at -80 ° C.

[0510] The following alternative methods were used to produce E. coli when present in the form of inclusion bodies. The TNFR-6α or TNFR-6β expressed in E. coli can be purified. Unless otherwise specified, all the following steps are performed at 4-10 ° C.

E. At the end of the production phase of E. coli fermentation, the cell culture is cooled to 4-10 ° C. and the cells are harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech). Based on the predicted protein yield per unit weight of cell paste and the weight of purified protein required, the appropriate amount of cell paste is suspended in a buffer containing 100 mM Tris, 50 mM EDTA, pH 7.4. The cells are mixed with a high shear mixer (high shear mixer).
xer) to disperse into a homogenous suspension.

The cells were then placed in solution with a microfluidizer.
er) (Microfluidics, Corp. or APV Gaulin
Inc. ) Is dissolved by two passes at 4000-6000 psi. The homogenate is then treated with NaC to a final concentration of 0.5M NaCl.
1 solution, followed by centrifugation at 7000 × g for 15 minutes. The resulting pellet was treated with 0.5 M NaCl, 100 mM Tris, 50 mM EDTA, p.
Wash again with H 7.4.

The washed inclusion bodies obtained are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After centrifugation at 7000 xg for 15 minutes, the pellet is discarded, and the supernatant containing the TNFR-6α or TNFR-6β polypeptide is further washed with G
Incubate overnight at 4 ° C. to allow uHCl extraction.

After high speed centrifugation (30,000 × g) to remove insoluble particles, Gu
HCl solubilized protein in 50 mM sodium, pH 4.5, 150 m
20 volumes of buffer containing M NaCl, 2 mM EDTA and GuHCl extract are refolded by rapid mixing with vigorous stirring. The refolded, diluted protein solution is kept at 4 ° C. for 12 hours without further stirring before further purification steps.

To clarify the refolded TNF receptor polypeptide solution, a 0.16 μm membrane filter with appropriate surface area (pre-prepared, equilibrated with 40 mM sodium acetate, pH 6.0). For example, Filtron
) Equipped with a tangential filtration device (tangential filtration u)
nit) is used. The filtered sample is treated with a cation exchange resin (eg Por
os HS-50, Perseptive Biosystems). The column was washed with 40 mM sodium acetate, pH 6.0, and 250 mM, 500 mM, 1000 mM, and 1500 mM NaCl in the same buffer.
Elute in a stepwise fashion with. The eluate is continuously monitored by absorbance at 280 nm. Fractions are collected and further analyzed by SDS-PAGE.

Fractions containing TNF receptor polypeptide are then pooled and mixed with 4 volumes of water. The diluted sample was then prepared in advance with a strong anion exchange resin (Poros HQ-50, Perseptive Biosystem).
s) and a weak ion exchange resin (Poros CM-20, Perseptive)
Biosystems) in series column set. 40 mM column
Equilibrate with sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20 column was then loaded from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1
． Elute with a linear gradient of 10 column volumes ranging from 0 M NaCl, 50 mM sodium acetate, pH 6.5. Fractions are collected at A ₂₈₀ under continuous monitoring of the eluate. Fractions containing TNFR-6α or TNFR-6β polypeptide (eg, as determined by 16% SDS-PAGE) are then pooled.

The resulting TNF receptor polypeptide exhibits greater than 95% purity after the above refolding and purification steps. Minor contaminating bands are Coomassie blue stained 16% SDS-PAGE when loaded with 5 μg of purified protein.
Observed from the gel. Purified protein was also tested for endotoxin / LPS contamination and typically LPS content was 0.1 n according to the LAL assay.
It is less than g / ml.

Example 2 TNFR-6α and TNFR in a Baculovirus Expression System
Cloning and Expression of the 6β Protein) In this illustrative example, plasmid shuttle vector pA2 was used to mature the cloned DNA encoding the complete protein, including its naturally involved secretion signal (leader) sequence. TNFR-6α or TNFR-6
Baculoviruses expressing β-protein have been described by Summer et al., A Manual.
l of Methods for Baculovirus Vectors
and Insect Cell Culture Procedures,
Texas Agricultural Experimental Stat
Insertion using standard methods such as those described in Ion Bulletin 1555 (1987). This expression vector is an Autographa cali
It contains the strong polyhedrin promoter of fornica nuclear polyhedrosis virus (AcMNPV) and contains convenient restriction sites such as BamHI, XbaI, and Asp718. The simian virus 40 (“SV40”) polyadenylation site is used for efficient polyadenylation. For easy selection of recombinant viruses, the plasmids were cloned in E. coli under the control of the weak Drosophila promoter in the same orientation. It contains the β-galactosidase gene from E. coli, followed by the polyadenylation signal of the polyhedrin gene. The inserted gene is wild type virus D
It produces viable virus that flanks the viral sequences on both sides for cell-mediated homologous recombination with NA and expresses the cloned polynucleotide.

As will be readily appreciated by those of skill in the art, if necessary, as long as the construct provides a properly positioned signal for transcription, translation, secretion, etc., including a signal peptide and an in-frame AUG. Other baculovirus vectors of can be used in place of the above vectors (eg, pAc373, pVL941, and pAcIM1). For example, such a vector is described by Luckow et al., Virolog.
y 170: 31-39 (1989).

A cDNA sequence encoding the full-length TNFR-6α or TNFR-6β protein in the deposited clone, including the AUG initiation codon and the naturally associated leader sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4. Is amplified with PCR oligonucleotide primers corresponding to the 5'and 3'sequences of the gene. The 5'primers of TNFR-6α and TNFR-6β are B underlined.
Sequences containing amHI restriction sites

[0521]

[Chemical 5] (SEQ ID NO: 22). All of the above primers were prepared according to Kozak, M .; , J
． Mol. Biol. 196: 947-950 (1987), which encodes an efficient signal for initiating translation in eukaryotic cells. TNFR-
The 6α 3 ′ primer contains a sequence containing an underlined Asp718 restriction site.

[0522]

[Chemical 6] (SEQ ID NO: 23). The 3'primer of TNFR-6β contains a sequence containing an underlined Asp718 restriction site.

[0523]

[Chemical 7] (SEQ ID NO: 24).

The amplified fragment was transferred to a commercial kit (“Geneclean” BIO).
101 Inc. , La Jolla, Ca) for isolation from 1% agarose gels. This fragment is then digested with the appropriate restriction enzymes for each of the primers used as specified above and again purified on a 1% agarose gel.

The plasmid can be digested with the same restriction enzymes and optionally dephosphorylated with calf intestinal phosphatase using conventional techniques known in the art. This DNA was then added to a commercially available kit (“Geneclean” BIO 101 In).
c. , La Jolla, Ca) for isolation from 1% agarose gels.

This fragment and the dephosphorylated plasmid are ligated with T4 DNA ligase. E. coli HB101 or XL-1 Blue (Status
ne Cloning Systems, La Jolla, CA). E. coli host cells are transformed with the ligation mixture and seeded in culture plates. Bacteria are identified immediately by digesting the DNA from individual colonies using the enzymes used above to identify the plasmid-containing bacteria with the human TNF receptor gene. The digestion products are then analyzed by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is referred to herein as pA2-TNFR-6α or pA2TN.
It is referred to as FRTNFR-6β (collectively pA2-TNFR).

5 μg of plasmid pA2-TNFR was isolated from Felgner et al., Proc. Na
tl. Acad. Sci. USA 84: 7413-7417 (1987), using the lipofection method, 1.0 μg of commercially available linearized baculovirus DNA ("BaculoGold ^™ baculovirus DN.
A ", Pharmingen, San Diego, CA. ) And co-transfection with. 1 μg BaculoGold ^™ viral DNA and 5 μg
g of plasmid pA2-TNFR was added to 50 μl of serum-free Grace's medium (Life).
Technologies Inc. , Gaithersburg, MD) in sterile wells of a microtiter plate. Then 10 μl Lipofectin and 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. This transfection mixture is then
S seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum
F9 insect cells (ATCC CRL 1711) are added dropwise. Then plate
Incubate at 27 ° C for 5 hours. The transfection solution is then removed from the plate and 1 ml Grace's insect medium supplemented with 10% fetal bovine serum is added. Then, the culture is continued at 27 ° C. for 4 days.

After 4 days, supernatants are harvested and plaque assayed as described by Summers and Smith (supra). G producing blue-stained plaque
To allow easy identification and isolation of al expressing clones, "Blue G
al ”(Life Technologies Inc., Gaithersb.
urg) is used. (A detailed description of this type of "plaque assay" can also be found in Life Technologies Inc., Ga.
It can also be found in the User Guide for Insect Cell Culture and Baculovirology distributed at Itersburg, pages 9-10). After appropriate incubation, blue stained plaques are picked up with a micropipette (eg Eppendorf) tip. The agar containing the recombinant virus is then resuspended in a microcentrifuge tube containing 200 μl Grace's medium. Then, the suspension containing the recombinant baculovirus is used to infect insect Sf9 cells seeded in a 35 mm dish. After 4 days, the supernatants of these culture dishes were collected and
Store at ℃.

To confirm expression of the TNF receptor gene, Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. Cells are infected with recombinant baculovirus at a multiplicity of infection ("MOI") of about 2. If radiolabeled protein is desired, after 6 hours, the medium was removed and depleted of methionine and cysteine in SF900 II medium (Life Technologies).
Inc. , Rockville, MD). After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi of ³⁵ S-cysteine (Amers
(available from ham). The cells are incubated for a further 16 hours, then the cells are harvested by centrifugation. Proteins and cellular proteins in the supernatant are analyzed by SDS-PAGE followed by (if radiolabeled) autoradiography.

Using amino-terminal microsequencing of the amino acid sequence of the purified protein, TNF was used.
The amino-terminal sequence of the mature form of the receptor protein can be determined.

Example 3 Cloning and Expression of TNFR-6α and TNFR-6β in Mammalian Cells Representative mammalian expression vectors include promoter elements (which mediate the initiation of transcription of mRNA), protein coding sequences, And signals necessary for termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences, and intervening sequences flanking donor and acceptor sites for RNA splicing. Very efficient transcription is achieved using the early and late promoters from SV40, the long terminal repeats (LTR) from retroviruses (eg RSV, HTLVI, HIVI) and the early promoters of cytomegalovirus (CMV). obtain. However, cellular elements can also be used (eg, human actin promoter). Expression vectors suitable for use in the practice of the present invention include, for example, pSVL and pSVL.
MSG (Pharmacia, Uppsala, Sweden), pRSV
cat (ATCC 37152), pSV2dhfr (ATCC 37146)
, And vectors such as pBC12MI (ATCC 67109). Mammalian host cells that can be used include human Hela cells, 293 cells, H9 cells and Jurkat cells, mouse NIH3T3 cells and C127 cells, Cos1 cells, Cos7 cells and CV1 cells, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary (CHO) -cells.

Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome. Co-transfection with selectable markers (eg dhfr, gpt, neomycin, hygromycin) allows the identification and isolation of transfected cells.

The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) marker is useful in developing cell lines that carry hundreds or even thousands of copies of the gene of interest.
Another useful selectable marker is the enzyme glutamine synthase (GS) (Mur
phy et al., Biochem J. et al. 227: 277-279 (1991); Be.
Bbington et al., Bio / Technology 10: 169-175 (
1992)). These markers are used to grow mammalian cells in selective medium and select the cells with the highest resistance. These cell lines contain the amplified gene integrated into the chromosome. Chinese hamster ovary (CH
O) cells and NSO cells are often used for protein production.

The expression vectors pC1 and pC4 represent the Rous sarcoma virus strong promoter (LTR) (Cullen et al., Molecular and Cellula).
r Biology, 438-447 (March 1985)) and a fragment of the CMV-enhancer (Boshart et al., Cell 41: 521-53).
0 (1985)). Multiple cloning sites (eg, having restriction enzyme cleavage sites BamHI, XbaI, and Asp718) facilitate cloning of the gene of interest. The vector further contains the 3'intron of the rat preproinsulin gene, polyadenylation, and termination signals.

Example 3 (a): Cloning and Expression in COS Cells Expression plasmids pTNFR-α-HA and pTNFR-6β-HA were prepared by using a part of cDNA encoding the mature form of TNF receptor protein as an expression vector pcDNAI. / Amp or pcDNAIII (this is Invitrogen
, Inc. Can be obtained from E.C.).

The expression vector pcDNAI / amp contains: (1) E. E. coli effective for growth in E. coli and other prokaryotic cells. E. coli origin of replication; (2) ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) SV40 origin of replication for growth in eukaryotic cells; (4) CMV promoter, polylinker, SV40 intron; ( 5) The hemagglutinin fragment (ie, purified, placed so that the cDNA is conveniently under expression control of the CMV promoter and can be operably linked to the SV40 intron and polyadenylation signal by restriction sites in the polylinker. "HA" to facilitate
Tag), followed by a stop codon, and a polyadenylation signal. HA tags are described by Wilson et al., Cell 37: 767 (1984).
) Corresponds to the epitope derived from the influenza hemagglutinin protein described by Fusion of the HA tag to the target protein allows easy detection and recovery of the recombinant protein using an antibody that recognizes the HA epitope. p
cDNA III further contains a neomycin selectable marker.

A DNA fragment encoding the complete TNF receptor polypeptide is cloned into the polylinker region of the vector so that recombinant protein expression is driven by the CMV promoter. The plasmid construction strategy is as follows. The TNF receptor cDNA of the deposited clone was cloned into E. Much the same as described above for the construction of the vector for expression of the TNF receptor in E. coli, amplification is carried out with primers containing convenient restriction sites. Appropriate primers can be easily designed by those skilled in the art.

The PCR amplified DNA fragment and the vector pcDNAI / Amp were cloned into Xb
Digest with aI and EcoRI, then ligate. The ligation mixture was transformed into E. coli
Stock SURE (Stratagene Cloning Systems, 11
099 North Torrey Pines Road, La Joll
a, available from CA 92037), and the transformed cultures are then plated onto ampicillin medium plates that are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and tested for the presence of fragments encoding TNFR-α and TNFR-6β polypeptides by restriction analysis or other means.

For expression of recombinant TNFR-α and TNFR-6β, COS cells were prepared, for example, in Sambrook et al., Molecular Cloning: a L.
Laboratory Manual, Cold Spring Labora
tory Press, Cold Spring Harbor, New
DEAE-DEXTRAN is used as described in York (1989) and transfected with the expression vector as described above. TNF with cells
Incubate under conditions for R expression.

Expression of pTNFR-α-HA and pTNFR-6β-HA fusion proteins is described, for example, in Harlow et al., Antibodies: A Laborato.
ry Manual, 2nd edition; Cold Spring Harbor La
laboratory Press, Cold Spring Harbor,
Detection by radiolabeling and immunoprecipitation using the method described in New York (1988). For this purpose, 2 days after transfection, the cells are labeled by incubating in medium containing ³⁵ S-cysteine for 8 hours. Cells and media were harvested and cells were washed and detergent-containing RIPA buffer as described by Wilson et al. (Cited above): 15
0 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40,
Dissolve in 0.5% DOC, 50 mM TRIS, pH 7.5. Proteins are precipitated from cell lysates and culture media with HA-specific monoclonal antibodies. The precipitated protein is then analyzed by SDS-PAGE and autoradiography. Expression products of the expected size were observed in cell lysates, which is not seen in the negative control.

Example 3 (b): Cloning and Expression in CHO Cells Vector pC4 is used for expression of TNFR-6α and TNFR-6β polypeptides. The plasmid pC4 is the plasmid pSV2-dhfr (AT
It is a derivative of CC Deposit No. 37146). This plasmid contains the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity transfected with these plasmids were selected by growing the cells in selective media (α-minus, MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate. Can be done. Amplification of the DHFR gene in cells that are resistant to methotrexate (MTX) is well documented (eg, Alt, FW.
Kellems, R .; M. Bertino, J .; R. And Sch
imke, R.M. T. , 1978, J .; Biol. Chem. 253
: 1357-1370, Hamlin, J .; L. And Ma, C.I. 1990
, Biochem. et Biophys. Acta, 1097: 10.
7-143, Page, M .; J. And Sydenham, M .; A. , B
iotechnology 9: 64-68 (1991)). Cell proliferation in increasing concentrations of MTX results in resistance to the drug by overproducing the target enzyme DHFR as a result of amplification of the DHFR gene. When the second gene is linked to the DHFR gene, it is usually co-amplified and overexpressed. It is known in the art that this approach can be used to develop cell lines with more than 1,000 copies of the amplified gene. Subsequently, if methotrexate is removed, a cell line containing the amplified gene integrated into one or more chromosomes of the host cell is obtained.

The plasmid pC4 contains Rous sarcoma virus (C) for expression of the gene of interest.
ullen et al., Molecular and Cellular Biolog.
y, March 1985: 438-447), a strong promoter of the long terminal repeat (LTR), and human cytomegalovirus (CMV) (Boshart et al., C).
41: 521-530 (1985)), which contains a fragment isolated from the enhancer of the immediate early gene. Downstream of the promoter there is a single restriction enzyme cleavage site that allows integration of the gene: BamHI, Xba.
I and Asp718. The plasmid contains the 3'intron and polyadenylation site of the rat preproinsulin gene after these cloning sites. Other high efficiency promoters may also be used for expression (eg, human β-actin promoter, SV40 early or late promoters, or long terminal repeats from other retroviruses (eg, HIV and HTLVI)). Cl
The ontech Tet-Off and Tet-On gene expression systems and similar systems can be used to express TNF receptor polypeptides in a regulated manner in mammalian cells (Gossen, M., and Bujard,
H. 1992, Proc. Natl. Acad. Sci. USA
89: 5547-5551). Other signals, such as those from the human growth hormone or globin gene, can be used as well for polyadenylation of mRNA. Stable cell lines containing the gene of interest integrated into the chromosome can also be selected for upon cotransfection with a selectable marker such as gpt, G418, or hygromycin. Initially, it is advantageous to use more than one selectable marker (eg G418 and methotrexate).

The plasmid pC4 was digested with the appropriate restriction enzymes for the specific primers used to amplify the selected TNF receptor as outlined below, and then digested with calf intestinal phosphatase. Dephosphorylate by procedures known in the art. The vector is then isolated from a 1% agarose gel.

The DNA sequence encoding the TNF receptor polypeptide is amplified using PCR oligonucleotide primers corresponding to the 5'and 3'sequences of the desired portion of the gene. TNFR-6α and TNFR containing an underlined BamHI site
The 5'primer for -6β has the following sequence: 5'CGC GGATCC GCCATCATGAGGGCGTGGAGGGGGCC.
AG3 '(SEQ ID NO: 22). The 3'primer for TNFR-6α has the following sequence, including the underlined Asp718 restriction site: 5'CGC GGTACC CTCTTTCAGTGCAAAGTG3 '(SEQ ID NO: 2
3). The 3'primer for TNFR-6β was Asp718 underlined.
Includes the following sequences including restriction sites: 5'CGC GGTACC CTCCTCAGCTCCTCGCAGTG 3 '(SEQ ID NO: 24).

The amplified fragment is digested with an endonuclease that cuts at the engineered restriction sites and then repurified on a 1% agarose gel. The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. Then E. E. coli HB101 or XL-1 Blue cells are transformed and bacteria containing the fragment inserted into plasmid pC4 are identified using, for example, restriction enzyme analysis.

Chinese hamster ovary cells lacking an active DHFR gene are used for transfection. 5 μg of expression plasmid pC4 was transformed with lipofectin (Felgner et al., Supra) to 0.5 μg of plasmid pSVn.
Co-transfect with eo. The plasmid pSV2-neo contains a dominant selectable marker (the neo gene from Tn5 which encodes an enzyme that confers resistance to a group of antibiotics including G418). Cells are seeded in α-minus MEM supplemented with 1 mg / ml G418. After 2 days, cells were trypsinized and treated with 10, 25, or 50 ng / ml methotrexate and 1 mg / ml.
Seed hybridoma cloning plates (Greiner, Germany) in α-MEM supplemented with G418. After about 10-14 days, single clones were trypsinized and then at different concentrations of methotrexate (50 nM.
, 100 nM, 200 nM, 400 nM, 800 nM) are used to seed 6-well Petri dishes or 10 ml flasks. The clones growing at the highest concentration of methotrexate were then transferred to higher concentrations of methotrexate (1 μM, 2 μM, 5
μM, 10 mM, 20 mM) in a new 6-well plate. The same procedure is repeated until clones are obtained that grow at a concentration of 100-200 μM. Expression of the desired gene product is analyzed, for example, by SDS-PAGE and Western blot, or by reverse phase HPLC analysis.

Example 4 Tissue Distribution of TNF Receptor mRNA Expression Northern blot analysis was performed and TNFR-6α or TNFR in human tissue was used, inter alia, using the method described by Sambrook et al. (Cited above). Examine the expression of the -6β gene. A cDNA probe containing the entire nucleotide sequence of the TNF receptor protein (SEQ ID NO: 1 or 3) was prepared using redipr.
Label with ³² P using the ime ^™ DNA labeling system (Amersham Life Science) according to the manufacturer's instructions. After labeling, probe with CHROM
ASPIN-100 ^™ column (Clontech Laboratories)
, Inc. ) Is used according to the manufacturer's protocol number PT1200-1. The purified labeled probe is then used to probe various human tissues for TNF receptor mRNA.

Multiple containing various human tissues (H) or human immune system tissues (IM)
Tissue Northern (MTN) blots were obtained from Clontech, and ExpressHyb ^™ Hybridization Solution (Clo).
ntech) according to the manufacturer's protocol number PT1190-1 with labeled probe. After hybridization and washing, blots are mounted and exposed to film overnight at -70 ° C and the film developed according to standard procedures.

It will be appreciated that the present invention may be practiced other than as described in detail in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings and are therefore within the scope of the appended claims.

Example 5 Gene Therapy Using Endogenous TNFR-6 Gene Another method of gene therapy according to the present invention is described in, for example, US Pat. No. 5,641, issued June 24, 1997. 670; International Application Publication No. WO 96/29411, published September 26, 1996; International Application Publication No. WO94 / 12650, published August 4, 1994; Koller et al., Proc. Natl. Ac
ad. Sci. USA 86: 8932-8935 (1989); and Zijl.
stra et al., Nature 342: 435-438 (1989), comprising operably linking an endogenous TNFR (ie, TNFR-6) sequence to the promoter by homologous recombination. This method involves activation of a gene that is present in the target cell but is either not expressed in that cell or is expressed at a lower level than desired. A polynucleotide construct is made that contains the promoter sequence and a target sequence that is adjacent to the promoter sequence and that is homologous to the 5'non-coding sequence of endogenous TNFR-6. The target sequence is located sufficiently close to the 5'end of TNFR-6 so that the promoter will be operably linked to the endogenous sequence upon homologous recombination. This promoter sequence and target sequence are
It can be amplified using CR. Preferably, the amplified promoter contains different restriction enzyme sites at the 5'and 3'ends. Preferably, 3 of the first target sequence
The'end contains the same restriction enzyme sites as the 5'end of the amplified promoter, and the 5'end of the second target sequence contains the same restriction enzyme sites as the 3'end of the amplified promoter.

The amplified promoter and amplified target sequence are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter sequence and the digested target sequence are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under suitable conditions for ligation of the two fragments. The construct is size-fractionated on an agarose gel and then purified by phenol extraction and ethanol precipitation.

In this example, the polynucleotide construct is administered as a naked polynucleotide by electroporation. However, the polynucleotide construct is also administered with a transfection facilitating agent (eg, liposomes, viral sequences, viral particles, precipitating agents, etc.). Such communication methods are known in the art.

[0553] Once the cells are transfected, homologous recombination occurs resulting in a promoter operably linked to the endogenous TNFR-6 sequence. This is the intracellular TN
It results in the expression of FR-6. Expression can be detected by immunological staining or any other method known in the art.

Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in DMEM and 10% fetal bovine serum. Logarithmic or early stationary phase fibroblasts are trypsinized and rinsed from the plastic surface with nutrient medium.
An aliquot of cell suspension is removed for counting and the remaining cells are subjected to centrifugation. The supernatant was aspirated and the pellet was mixed with 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl).
, 0.7 mM Na2HPO4, 6 mM dextrose). The cells are recentrifuged, the supernatant is aspirated, and the cells are resuspended in electroporation buffer containing 1 mg / ml acetylated bovine serum albumin. The final microsuspension contains approximately 3 × 10 ⁶ cells / ml. Electroporation should be performed immediately after resuspension.

Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting the TNFR-6 locus, plasmid p
UC18 (MBI Fermentas, Amherst, NY) to HindI
Digest with II. The CMV promoter is amplified by PCR using a 5'end XbaI site and a 3'end BamHI site. Two TNFR-6 non-coding sequences are amplified by PCR: one TNFR-6 non-coding sequence (TNF
R-6 fragment 1) with a HindIII site at the 5'end and Xb at the 3'end
a site is used to amplify; the other non-TNFR-6 non-coding sequence (TNFR-6
Fragment 2) has a BamHI site at the 5'end and a HindIII at the 3'end.
Amplify using the site. The CMV promoter and TNFR-6 fragment were loaded with the appropriate enzymes (CMV promoter-XbaI and BamHI; TNFR-6.
Fragment 1-XbaI; TNFR-6 fragment 2-BamHI) and ligated together. The resulting ligation product is digested with HindIII and ligated with the HindIII digested pUC18 plasmid.

Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-Rad). The final DNA concentration is generally at least 120 μg /
ml. Then 0.5 ml of cell suspension (containing approximately 1.5 × 10 ⁶ cells) is added to the cuvette and the cell suspension and DNA solution are gently mixed. Electroporation was performed using a Gene-Pulser device (Bio-
Rad). The capacitance and voltage are set to 960 μF and 250-300 V, respectively. As the voltage increases, viable cells decrease, but the proportion of viable cells that stably integrate the introduced DNA in their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 ms should be observed.

The electroporated cells are kept at room temperature for approximately 5 minutes, then the contents of the cuvette are gently removed with a sterile transfer pipette. 1 cell
10 ml pre-warmed nutrient medium in 0 cm dish (DM with 15% bovine serum
EM) directly and incubated at 37 ° C. The next day, medium is aspirated and replaced with 10 ml of fresh medium and incubated for an additional 16-24 hours.

The engineered fibroblasts were then either used alone or in cytodex (cyt).
odex) 3 After being grown to confluence on 3 microcarrier beads, injected into the host. Here, the fibroblasts produce the protein product. The fibroblasts can then be introduced into the patient described above.

Example 6 Effect of TNFR in Treating Graft-versus-Host Disease in Mice The present invention also includes methods for the treatment of immune / severe acute GVHD in a patient, The method comprises the step of administering a TNFR polypeptide or TNFR agonist of this invention to a patient, preferably a human.

An analysis of the use of soluble TNFR polypeptides of the invention (eg, TNFR-6) to treat graft versus host disease (GVHD) has C57BL / 6 as a parent (BALB / c × C57BL / 6) Performed by use of the F1 mouse model. The parental F1 mouse model is a well characterized and reproducible animal model of GVHD in bone marrow transplant patients, which is well known to those of skill in the art (eg, Gleichemann et al., Immunol Toda).
y 5: 324, 1984, which is incorporated by reference in its entirety.
checking). Soluble TNFR is expected to bind FasL and inhibit FasL-mediated apoptosis, which is important in liver, skin and lymphoid organ damage observed in this animal model of GVHD. Play a pathogenic role (Baker et al., J. Exp. Med. 183: 26.
45, (1996); Charles et al., J. Am. Immunol. 157: 538
7, (1996); and Hattori et al., Blood 91: 4051, (
1998), each of which is incorporated herein by reference in its entirety).

The onset of GVHD status was initiated in C57BL / 6 mice (BALB / c × C57B
L / 6) F1 mice (both Jackson Lab, Bar Harbo
r, available from Maine) of about 1-3 × 10 ⁸ spleen cells. 6-8 groups of mice have 0.1-5.0 mg / kg
TNFR or human IgG isotype control is received intraperitoneally or intradermally every other day after injection of splenocytes. The effect of TNFR on liver enzyme release in serum (an indicator of liver damage) is analyzed twice per week for at least 3 weeks. When significant amounts of liver enzymes are detected in human IgG treated mice, the animals are treated with the relative extent of tissue damage to the liver, spleen, skin and intestines and T.
Sacrifice for histological evaluation of NFR-induced therapeutic effects on these organs.

[0562] The ability of TNFR to restore immune / severe acute GVHD-related systems is reduced in liver enzyme release in serum, tissue damage and / or when compared to controls.
Or indicated by decreased cachexia, decreased body weight and / or mortality.

Finally, TNFR and human IgG treated animals undergo clinical evaluation every other day to assess cachexia, body weight and mortality.

TNFR in combination therapy with TNF-α inhibitors also showed this G
It can be tested in the VHD mouse model.

Example 7: TNFR-6α (DcR3) Suppresses AIM-II-Mediated Apoptosis (Background) Tumor necrosis factor (TNF) family members are, for example, those that regulate cell proliferation,
Involved in the regulation of various biological activities such as differentiation, cell survival, cell death, cytokine production, lymphocyte co-stimulation, immunoglobulin secretion, and isotype switching (Armitage, R., Curr. Opin. Immunol. 6).
, 407-413 (1994); Tewari, M .; Curr. Opin.
Genet. Dev. 6, 39-44 (1996)). Receptors of this family share a common structural motif in their extracellular domains, which motif consists of multiple cysteine-rich repeats of approximately 30-40 amino acids (Gr.
uss, H.C. J et al., Blood 85, 3378-3404 (1995)). T
NFR1, CD95 / Fas / APO-1, DR3 / TRAMP / APO-3,
DR4 / TRAIL-R1 / APO-2, DR5 / TRAIL-R2 and DR
The 6 receptor contains a conserved intracellular motif of 30-40 amino acids, called the death domain, which is associated with activation of the apoptotic signaling pathway,
Other members containing low sequence identity in their intracellular domain are transcription factor N
Stimulates F-κB and AP-1 (Armitage, R., Curr. Op.
in. Immunol. 6, 407-413 (1994); Tewari, M .;
Curr. Opin. Genet. Dev. 6, 39-44 (1996);
Gruss, H .; J. Et al., Blood 85, 3378-3404 (1995).
).

Most TNF receptors contain a functional cytoplasmic domain and include TNFR1 (Loetscher, H et al., Cell 61,351).
-356 (1990); Schall, T .; J. Et al., Cell 61,361-
370 (1990)), TNFR2 (Smith, CA et al., Science).
248, 1019-1023 (1990)), lymphotoxin β receptor (LTβR) (Baens, M. et al., Genomics 16, 214-).
218 (1993)), 4-1BB (Kwon, BS, et al., Proc. Nat.
l. Acad. Sci. USA 86, 1963-167 (1989)), H
VEM / TR2 / ATAR (Kwon, BS et al., J. Biol. Chem.
272, 14272-14276 (1997); Montgomery, R .; I
． Et al., Cell 87, 427-436 (1996); Hsu, H .; Et al., J. B
iol. Chem. 272, 13471-13474 (1997)), NGFR
(Johnson, D. et al., Cell 47, 545-554 (1986)),
CD27 (Van Lier, RA, et al., J. Immunol. 139, 15).
89-1596 (1987)), CD30 (Durkorp, H. et al., Cell.
68, 421-427 (1992)), CD40 (Banchereau, J.
． Et al., Cell 68, 421-427 (1994)), OX40 (Malle.
tt, S. EMBO J. et al. 9, 1063-1068 (1990)), Fas
(Itoh, N. et al., Cell 66, 233-243 (1991)), DR3.
/ TRAMP (Chinnayan, AM et al., Science 274.
990-992 (1996)), DR4 / TRAIL-R1 (Pan, G. et al.,
Science 276, 111-113 (1996)), DR5 / TRAIL-
R2 (Pan, G. et al., Science 277, 815-818) (1997).
) And RANK (Anderson, D. et al., Nature 390, 175).
-179 (1997)). How Many Members of the TNFR Superfamily Do Not Have an Intracytoplasmic Domain and Are Secreted (eg, osteoprotegerin (OPG) Simone
t., et al., Cell 89, 309-319 (1997)), or membrane bound via the glycophospholipid tail (eg, TRID / DcR1 / TRAIL-R.
3 (Degli-Esposti, MA et al., J. Exp. Med. 186.
1165-1170 (1997); Sheridan, J .; P. Et al, Science
Ce 277, 818-821 (1997)). A viral open reading frame encoding soluble TNFR has also been identified (eg, SFV).
-T2 (Smith, CA et al., Science 248, 1019-102.
3 (1990)), Va53 (Howad, ST et al., Virology 1).
80, 633-647 (1991)), G4RG (Hu, FQ. Et al., Viro.
logy 204, 343-356 (1994)), and crmB (Gru.
ss, H.C. J., et al., Blood 85, 3378-3404 (1995))).

A new TNFR superfamily member was identified by searching the expressed sequence tag (EST) database (designated TNFR-6α).
, And were characterized as soluble cognate ligands for AIM-II and FasL / CD95L. AIM-II and FasL mediate apoptosis, which is the most common physiological form of cell death and occurs during embryogenesis, immune regulation, tissue remodeling and tumor regression.

AIM-II is highly induced in activated T lymphocytes and macrophages. AIM-II was added to HVEM / TR2 and LTβR (Mauri).
, D. N. Et al., Immunity 8, 21-30 (1998)) as a cellular ligand. HVEM / TR2 is a receptor for herpes simplex virus type 1 (HSV-1) that invades human T lymphoblasts. HVEM /
Antibodies to soluble forms of TR2-Fc and HVEM / TR2 have been shown to inhibit mixed lymphocyte responses, suggesting a role for this receptor or its ligand in T lymphocyte proliferation (Kwon, B et al. , J. Bi
ol. Chem. 272, 14272-14276 (1997); Mauri,
D. N. Et al., Immunity, 21-30 (1998); Harrop, J. et al.
A. Et al., J. Immunol. 161, 1786-1794 (1998)). L
Expression levels of TβR are prominent on epithelial cells but absent on T and B lymphocytes. Signaling via LTβR induces cell death in some adenocarcinomas (Brownig, JL et al., J. Exp. Med.
． 183, 867-878 (1996)). AIM-II produced by activated lymphocytes can elicit immune regulation from hematopoietic cells expressing only HVEM / TR2, and apoptosis of tumor cells (expressing both LTβR and HVEM / TR2 receptors). Can be induced (Zhai, Y. et al., J. Clin.
Invest. 102, 1142-1151 (1998); Harrop, J. et al.
A. Et al., J. Biol. Chem. 273, 27548-27556 (1998)
)).

FasL is one of the major effectors of cytotoxic T lymphocytes and natural killer cells. FasL is also involved in establishing peripheral tolerance in activation-induced cell death of lymphocytes. Furthermore, the expression of FasL in non-lymphoid cells and tumor cells is
It contributes to the maintenance of immune tolerance of tissues by preventing the infiltration of s-sensitive lymphocytes (Nagata, S., Cell 88, 355-365 (1997)). F
asL is also treated and scraped from the surface of human cells (Sch
nieder, P.N. Et al., J. Exp. Med. 187, 1205-1213 (1
998)).

Here we demonstrate that TNFR-6α, a new member of the TNFR superfamily, binds AIM-II and FasL. Therefore, TNFR-6α may act as an inhibitor in AIM-II-induced tumor cell death by blocking AIM-II interactions with AIM-II receptors.

Materials and Methods Identification and Cloning of New Members of the TNFR Superfamily The EST cDNA database (obtained from more than 600 different cDNA libraries) was TNFR using the blastn and tblastn algorithms. We screened for sequence homology for superfamily cysteine-rich motifs. Three EST clones containing the same open reading frame of amino acid sequences showing significant homology to TNFR-II were identified from human normal prostate tumor and human pancreatic tumor cDNA libraries. A full length TNFR-6α cDNA clone encoding an intact N-terminal signal peptide was obtained from a human normal prostate library.

RT-PCR Analysis For RT-PCR analysis, total RNA was treated with PMA / ionomycin or LP.
Trizol (GIBCO) was used to isolate from various human cell lines before and after stimulation with S. RNA was converted to cDNA by reverse transcription and amplified by PCR for 35 cycles. The primers used for amplification of the TNFR-6α fragment follow the sequence of TNFR-6α. β-actin was used as an internal control for RNA integrity. PCR products were electrophoresed on a 2% agarose gel, stained with ethidium bromide, and visualized by UV irradiation.

(Production and Purification of Recombinant Protein) A recombinant TNFR-6α protein having hexahistidine at the C-terminus was produced. TNFR-6α- (His), which encodes the entire TNFR-6α protein, was amplified by PCR. In order to clone in the correct orientation, the forward primer (5'-AGACCCAAGCTTCCCTGCTCCAGCAAGGA
CCATG-3 ′: HindIII site at the 5 ′ end of SEQ ID NO: 25) and the reverse primer (5′-AGACGGGATCCTTAGGTGGTGGTGGTGG)
A BamHI site at the 5'end of GTGGGTGCACAGGGAGGAGAAGGCTCC-3 ': SEQ ID NO: 26) was prepared. The amplified fragment was designated as HindI.
II / BamHI, and a mammalian expression vector (pCEP4 (Invitr
gene)). The TNFR-6α- (His) / pCEP4 plasmid was transformed into HEK293E to produce recombinant TNFR-6α- (His).
BNA cells were stably transfected. TNFR-6α (His) / pCE
Serum-free medium from cells transfected with P4 was loaded onto a Ni column (No
vagen) was passed through. The column eluate was fractionated by SDS-PAGE and TNFR-6α- (His) was loaded with anti-poly (His) ₆ antibody (Sigma).
) Was used to detect by Western blot analysis.

HVEM / TR2-Fc, LTβR-Fc and Flag-tagged soluble AIM
The production of the -II (soluble AIM-II) fusion protein was described above (Zhai,
Y. Et al., J. Clin. Invest. 102, 1142-1151 (1998)
)). Supernatant containing Fc fusion protein was filtered and protein G
Captured on Sepharose beads. Flag-tagged soluble AIM-II
The protein was purified using an anti-Flag mAb affinity column.

(Immunoprecipitation) TNFR-6α- (His) was added to the binding buffer (150 mM NaC) at 4 ° C.
1, 0.1% NP-40, 0.25% gelatin, 50 mM HEPES, pH 7
． In 4), various Flag-tagged ligands of the TNF superfamily and anti-Flag agarose were used to incubate overnight followed by precipitation. Bound proteins were separated by 12.5% SDS-PAGE and HR
Detection was by Western blot with P-conjugated anti-poly (His) ₆ or anti-human IgG1 antibody.

Cell Binding Assays For cell binding assays, HEK293EBNA cells were stably transfected with the entire sequence of pCEP4 / AIM-II cDNA or pCEP4 vector alone using the calcium phosphate method. After selection with hygromycin B, cells were harvested with 1 mM EDTA in PBS and 20 on ice.
Min TNFR-6α- (His), HVEM / TR2-Fc, or LTβR-
Incubated with Fc. For detection of the Fc fusion protein, cells were
Stained with FITC-conjugated goat anti-human IgG. To detect TNFR-6α binding, cells were treated with anti-poly (His) ₆ and FITC-conjugated goat anti-mouse Ig.
Stained continuously with G. FACscan (Becton Dic
Kinson).

Cytotoxicity Assay Cytotoxicity assays using HT29 cells were performed as previously described (Browning, JL et al., J. Exp. Med. 183, 867-8).
78 (1996)). Briefly, 5000 HT29 cells were treated with 1% FBS, DM
96 well plates with EM were seeded and soluble AIM-II (10n
g / ml) and 10 units / ml human recombinant interferon gamma (IFN-
γ). Serial dilutions of TNFR-6α- (His) were added to microtiter wells in quadruplicate. Cells treated with IFN-γ and soluble AIM-II were incubated with various amounts of TNFR-6α- (His) for 4 days, then [ ³ H] thymidine was added during the last 6 hours of culture. . Collect the cells,
And thymidine incorporation was detected using a liquid scintillation counter.

Results and Discussion TNFR-6α is a new member of the TNFR superfamily TNFR-6α was identified by searching the EST database. Three clones containing the same open reading frame were identified from human normal prostate and pancreatic tumor cDNA libraries. A full length TNFR-6α cDNA encoding an intact N-terminal signal peptide was obtained from a human normal prostate library. The open reading frame of TNFR-6α is 3
It encodes 00 amino acids. To determine the N-terminal amino acid sequence of mature TNFR-6α, hexa-histidine tagged TNFR-6α was expressed in a mammalian cell expression system and the N-terminal amino acid sequence was determined by peptide sequencing. The N-terminal sequence of processed TNFR-6α- (His) started at amino acid 30. This suggests that the first 29 amino acids constituted the signal sequence. Therefore, the mature protein of TNFR-6α was composed of 271 amino acids with no transmembrane region. One potential N within TNFR-6α
There was a binding glycosylation site (Asn173). OPG (Simnetet
, W. Et al., Cell 89, 309-319 (1997)), the putative protein is soluble and the secreted protein and recombinant TNFR-6α expressed in animal cells are approximately as predicted on polyacrylamide gels. 40kD
Met. TNFR-I, TNFR-II, 4-1BB, TR2 / HVEM, L
Alignment of the amino acid sequences of TβR, TR1 / OPG and TNFR-6α illustrated the presence of a potential cysteine rich motif. TNFR-6α contains two complete cysteine-rich motifs and two incomplete cysteine-rich motifs, and its amino acid sequence was strikingly similar to the TR1 / OPG amino acid sequence. TNFR-6α, OPG and TNFR-II
Share about 30% sequence homology with.

MRNA Expression We analyzed the expression of TNFR-6α mRNA in various human tissues by Northern blot hybridization. Northern blot analysis suggested that TNFR-6α mRNA was approximately 1.3 kb long and was predominantly expressed in lung tissue and colorectal adenocarcinoma cell line SW480. RT-PCR analysis was performed to determine the expression pattern of TNFR-6α in various cell lines. TNFR-6α transcripts were expressed in most hematopoietic cell lines.
Weakly detected. Expression of TNFR-6α was induced upon activation of Jurkat T leukemia cells. Interestingly, TNFR-6α mRNA was expressed in endothelial cell lines (
In HUVEC) is expressed at high levels.

Identification of Ligands for TNFR-6α To identify ligands for TNFR-6α, several Flag-tagged soluble proteins of TNF ligand family members were immunoprecipitated to produce recombinant TNFR-6α- (His. ) Screened for protein binding. TNFR-6α- (His) selectively binds AIM-II-Flag and FasL- among Flag-tagged soluble TNF ligand members.
The Flag was tested. This result suggests that TNFR-6α binds at least two ligands (AIM-II and FasL). AIM-II shows significant sequence homology (31%) with the C-terminal receptor binding domain of FasL, while soluble AIM-II is unable to bind Fas (Mauri, DN et al. Immunity 8, 21-30 (1998); Zhai, Y. et al., J. C.
lin. Invest. 102, 1142-1151 (1998)). These may have similar binding epitopes for TNFR-6α binding.

Previously, Zhai and Harrop (Zhai, Y et al., J. Clin. In
vest. 102, 1142-1151 (1998); Harrop, J. et al. A.
Et al., J. Biol. Chem. 273, 27548-27556 (1998) are biological functions of AIM-II and HVEM / TR2 and / or LTβR.
The possible mechanism of its action as a ligand to sucrose was reported. AIM-II is expressed in activated T cells. A related to serum starvation or addition of IFN-γ
IM-II inhibits cell proliferation of tumor cells (MDA-MB-231 and HT293).

To determine whether TNFR-6α could act as an inhibitor of the interaction of HIM / TR2 or LTβR with AIM-II, TNFR-
6α- (His) was used as a competitive inhibitor in the AIM-II-HVEM / TR2 interaction. HVEM / TR2 when AIM-II was immunoprecipitated with HVEM / TR2-Fc in the presence of TNFR-6α- (His).
-Fc binding to AIM-II is competitively reduced by TNFR-6α- (His), whereas TNFR-6α- (His) binding to AIM-II is H
It does not change depending on VEM / TR-Fc. Furthermore, HVEM / TR2-Fc (
6 nM) or LTβR (6 nM) bound to 20 in the immunoprecipitation assay.
It was completely inhibited by nM TNFR-6α (His) protein. These results indicate that TNFR-6α mediated AI through HVEM / TR2 and LTβR.
We support the notion that it can act as a potent inhibitor of M-II function.

(Binding of TNFR-6α- (His) to AIM-II-transfected cells) To determine whether TNFR-6α binds to AIM-II expressed on the cell surface, We have HIM2 transfected with AIM-II.
Binding assays were performed by flow cytometry using 93EBNA cells. AIM-II-transfected HEK293EBNA cells were transferred to T
NFR-6α- (His) and HVEM / TR2-Fc and LTβR-F
It was markedly stained with c. pCEP4 vector-transfected HEK2
No binding was detected by HVEM / TR2-Fc or LTβR on 93EBNA cells. Furthermore, the control isotopes did not bind to AIM-II transfected HEK293EBNA cells and any of the fusion proteins described above did not bind to vector-transfected cells, confirming the specificity of these bindings. These bindings suggest that TNFR-6α may bind both soluble and membrane bound forms of AIM-II.

(TNFR-6α Inhibits AIM-II-Induced Cytotoxicity in HT29 Cells) Brewing et al. (J. Exp. Med. 183, 867-878 (1996).
)) Shows that Fas activation leads to rapid cell death (12-24 hours), while LT
βR is 2 to induce apoptosis in colorectal adenocarcinoma cell line (HT29)
It was shown to take 3 days. Zhai et al. (J. Clin. Invest. 102).
, 1142-1151 (1998) also showed that AIM-II had LTβR and H.
Results in death of cells expressing both VEM / TR2, but not LTβR or HVE
It was reported that cells expressing only the M / TR2 receptor did not cause death. Both HVEM / TR2 and LTβR are synergistically involved in AIM-II-mediated killing of HT29 cells (Zhai, Y. et al., J. Clin. Inve.
st. 102, 1142-1151 (1998)).

To determine whether TNFR-6α binding inhibits AIM-II-mediated cytotoxicity, HT29 cells were treated with 200 ng / ml LTβR-Fc or T.
Incubated with 10 ng / ml soluble AIM-II and IFN-γ (10 U / ml) in the presence of NFR-6α- (His). TNFR-6α-
(His) significantly blocked AIM-II mediated cell killing. Cells again
Incubated with soluble AIM-II and / or IFN-γ in the presence of various concentrations of TNFR-6α- (His). TNFR-6α- (His)
Blocked soluble AIM-II-induced cell death in a dose-dependent manner. Taken together, TNFR-6α appears to act as a natural inhibitor of AIM-II-induced tumor cell killing. This data also suggests that TNFR-6α contributes to tumor immune evasion.

The interaction of AIM-II with HVEM / TR2 and / or LTβR can trigger different biological events such as T cell proliferation, blocking HVEM-dependent HSV1 infection, and anti-tumor activity ( Mauri, DN et al., Immuni
ty 8, 21-30 (1998); Zhai, Y .; Et al., J. Clin. Inv
est. 102, 1142-1151 (1998); Harrop, J. et al. A. Et al., J. Biol. Chem. 273, 27548-27556 (1998)).
TNFR-6α may act as an inhibitor of AIM-II interactions and may play diverse roles in different cell types. TNFR-6α may act as a decoy receptor and contribute to immune evasion in both slow and rapid tumor cell death mediated by AIM-II and / or FasL-mediated apoptotic pathways.

Another possibility is that TNFR-6α functions as a cytokine to induce membrane-bound Fas
L or AIM-II can be induced and signals can be directly transduced via FasL or AIM-II. Recently, the group of Desbarats and the group of Suzuki showed that FasL could transduce itself, leading to cell cycle arrest and cell death in CD4 ⁺ T cells, but not CD8 ⁺ T cells.
We have reported that cells do not induce cell proliferation (Desbaraats, J. et al.,
Nature medicine 4, 1377-1382 (1998); Su
zuki, I .; Et al., J. Exp. Med. 187, 123-128 (1998)
). Therefore, TNFR-6α may be involved in signaling through FasL and AIM-II.

HUVEC cells constitutively expressed TNFR-6α in RT-PCR analysis. AIM-II and FasL are known to be expressed in activated T cells. Therefore, it is speculated that TNFR-6α and its ligand are important for the interaction between activated T lymphocytes and endothelium. TNFR-6α is
It may be involved in the transport of activated T cells as well as the survival of endothelial cells.

Example 8 Activation-Induced Apoptosis Assay Activation-induced apoptosis is assayed using SupT-13 T leukemia cells and measured by cell cycle analysis. The assay is performed as follows. SupT-13 cells were treated with 10% F in logarithmic growth (approximately 1 × 10 ⁶ ).
Maintain in RPMI with CS. Sup-T13 cells at 0.5 × 10 ⁶ / ml
Seed wells of a 24-well plate at 1 ml / well. TNF of the present invention
AIM II protein and Fas in the presence or absence of R polypeptide
Ligand protein (0.01, 0.1, 1, 10, 100, 1000 ng / m
1) or buffer control is added to the wells and the cells are incubated for 24 hours at 37 ° C. in the presence or absence of TNFR polypeptide of the invention. Wells of another 24-well plate were sterile filtered at 0.5 ml / well in the presence or absence of anti-CD3 antibody at 10 μg / ml in 0.05M bicarbonate buffer, pH 9.5. Concentration of purified BC3 mA
Prepare by incubating b or buffer alone. The plate is incubated overnight at 4 ° C. Wells of antibody-coated plate were sterilized at 4 ℃.
Wash 3 times with BS. Treated Sup-T13 cells are transferred to antibody-coated wells and incubated at 37 ° C for 18 hours. Apoptosis is measured by cell cycle analysis using propidium iodide and flow cytometry. Proliferation of treated cells is measured by taking a total volume of 300 μl in each treated well and adding to triplicate wells (100 μl / well) in 96-well plates. For each well, 20 μl / well ³ H thymidine (0.5 μCi
/ 20 μl, 2 Ci / mM) and incubate at 37 ° C. for 18 hours. Harvest and count uptake of ³ H-thymidine by the cells. This measurement can be used to confirm the effect on apoptosis when observed otherwise. The positive controls for this assay were anti-CD3 cross-linking alone,
Fas ligand alone and / or AIM-II alone. Furthermore, anti-F
as monoclonal antibody (soluble form-500 ng / ml in IgM mAb)
Was used to demonstrate marked and reproducible apoptosis in this strain.
The negative control for this assay is medium alone or buffer alone.
Also, crosslinking with another anti-CD3 mAb (OKT3) shows no effect. TNFR agonists according to the present invention show reduced apoptosis when compared to treatment of Sup-T13 cells with AIM-II or Fas ligand in the absence of TNFR agonist. The TNFR antagonists of the present invention bind a Fas ligand or a TNFR polypeptide having AIM-II binding affinity (eg, mature TNFR) to a TNFR polypeptide to be tested, and an AIM-II or Fas ligand and Sup-. It can be identified by contacting this combination in a solution with T13 cells. The negative control for this assay is a mixture containing mature TNFR, Sup-T13 cells, and AIM-II or Fas ligand (FasL) alone. Samples containing the TNFR antagonists of the present invention show increased apoptosis when compared to the negative control.

If an effect is observed by cell cycle analysis, the cells may be further stained using techniques well known to those skilled in the art, either for the TUNEL assay for flow cytometry or by Annexin V.

(Example 9: Blocking Fas ligand-mediated apoptosis of Jurkat T cells by TNFR6α-Fc) (Method) Jurkat T cells expressing Fas receptor were sFas ligand alone, or Fas-Fc or TNFR6α-Fc (present). Treated with any of the sFas ligands in combination with the full length TNFR6α protein fused to the Fc domain (corresponding to amino acids 1-300 of SEQ ID NO: 2) as described herein. The sFas ligand protein used was Alexis C
Obtained from corporation. The sFas ligand protein used contains a FLAG epitope tag at its N-terminus. Cross-linking of Fas ligand utilizing a monoclonal Flag epitope has been previously demonstrated to significantly enhance the ability of Fas ligand to mediate apoptosis, so Fla
g-antibodies were included in this study. Specifically, 106 Jurkat cells (RPMI +
5% serum) with Fas ligand (Alexis) (20 ng / ml) and anti-F.
Treated with lag Mab (200 ng / ml), then incubated at 37 ° C. for 16 hours. When TNFR6α-Fc was included in this assay, the receptor was preincubated with Fas ligand and anti-Flag Mab for 15 minutes.

Results After incubation, cells were harvested, resuspended in PBS and subjected to flow cytometric analysis (Table V). Approximately 1% of cells appear to undergo apoptosis in the absence of Fas ligand (FasL), as measured by high annexin staining and weak propidium iodide staining (Table IV). Treatment with soluble Fas ligand alone resulted in an approximately 7-fold increase in the number of apoptotic cells, which, as expected, was Fas-.
It can be blocked in the presence of Fc. Similar to Fas-Fc, TNFR6α-F
c was also able to block Fas-mediated apoptosis by blocking with TNFR6α-Fc, which was observed in a dose-dependent manner over a tri-log scale (Table V). T
The ability of NFR6α-Fc to block Fas-mediated killing of Jurkat cells was also determined in a cell death assay (FIGS. 7A-B). In this assay,
Cells were again treated with the combination of Fas ligand and TNFR6α-Fc for 16 hours. To determine the level of viable cells after treatment, cells were treated with 10% ALOM.
Incubate in AR blue for 5 hours and OD 570 nm-630 nm
Was tested spectrophotometrically. Treatment with Fas ligand resulted in a cell viability of 5
There was a 0% reduction (FIGS. 7A-B). The decrease in cell viability is due to Fas-Fc
Alternatively, it can be overcome by either TNFR6α-Fc (but not TR5-Fc) (FIGS. 7A-B), confirming the ability of TNFR6α to inhibit Fas ligand-mediated activity. 100 ng / ml and 10 ng / ml in this assay
In both, the ability of TNFR6α-Fc to block Fas ligand-mediated activity was statistically different from the total absence of TNFR6α-Fc (p <0.
05) (FIGS. 7A-B). Moreover, the ability of TNFR6α-Fc to block Fas ligand-mediated cell death and apoptosis appears to be as efficient as Fas-Fc (Table V and FIGS. 7A-B).

Table V. FACS analysis showing blocking of Fas ligand-mediated apoptosis 1
0 ⁶ Jurkat cells (RPMI + 5% serum) were treated with Fas ligand (All).
exis; 20 ng / ml) and anti-FLAG (200 ng / ml),
Then, it was incubated at 37 ° C. for 16 hours. When the Fc receptor was included in this assay, the receptor was preincubated with Fas ligand and anti-FLAG Mab for 15 minutes. After incubation, cells are harvested and PB
Resuspended in S and subjected to flow cytometric analysis.

[0594]

[Table 12] Conclusions TNFR6α-Fc appears to block Fas ligand-mediated apoptosis of Jurkat cells in a dose-dependent manner as efficiently as Fas ligand.

Example 10: Protein Fusion of TNFR-6α and / or TNFR-6β The TNFR-6α and / or TNFR-6β polypeptide of the present invention is optionally fused to another protein. It These fusion proteins can be used in various applications. For example, fusion of a TNFR-6α and / or TNFR-6β polypeptide to a His tag, HA tag, protein A, IgG domain, and maltose binding protein facilitates purification; EP A 394,8.
27; Traunecker et al., Nature 331: 84-86 (1988).
)checking). Similarly, fusions to IgG-1, IgG-3, and albumin increase half-life in vivo. TNFR-6α and / or TNF
Nuclear localization signals fused to the polypeptide of R-6β can target the protein to specific subcellular localizations. On the other hand, covalent heterodimers or homodimers may increase or decrease the activity of the fusion protein. Fusion proteins can also create chimeric molecules that have more than one function. Finally, fusion proteins may increase the solubility and / or stability of fusion proteins as compared to non-fusion proteins. All forms of the above fusion proteins are made using techniques known in the art or by using or routinely modifying the following protocols outlining fusion of polypeptides to IgG molecules. Can be done.

Briefly, the human Fc portion of an IgG molecule is the 5'and 3'of the sequence set forth below.
It can be PCR amplified using primers spanning the ends. These primers also preferably contain convenient restriction enzyme sites to facilitate cloning into an expression vector, preferably a mammalian expression vector.

For example, if the pC4 (Accession No. 209646) expression vector is used, the human Fc portion can be ligated into the BamHI cloning site. 3'BamH
Note that the I site should be destroyed. The vector containing the human Fc portion was then restricted again by BamHI, linearized the vector, and isolated TNFR-6α and / or TNFR-6β polynucleotides by the PCR protocol described in Example 1. Is ligated to this BamHI site. Note that this polynucleotide is cloned without a stop codon, otherwise no fusion protein is produced.

PC4 does not require a second signal peptide if a naturally occurring signal sequence is used to produce the secreted protein. Alternatively, if a naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence (see, eg, International Application Publication No. WO 96/34891).

[0599]   Human IgG Fc region:

[0600]

[Chemical 8] (Example 11: Production of antibody) (a. Hybridoma technology) The antibody of the present invention can be prepared by various methods. (Current Pr
otocols, Chapter 2). As an example of such a method, T
Cells expressing R6-α and / or TR6-β are administered to the animal to induce the production of serum containing polyclonal antibodies. In a preferred method, TR
Preparations of 6-α and / or TR6-β proteins are prepared and purified to be substantially free of natural contaminants. Such preparations are then introduced into animals to produce greater specific activity of polyclonal antisera.

Monoclonal antibodies specific for the proteins TR6-α and / or TR6-β are prepared using hybridoma technology (Kohler et al., Na.
Nature 256: 495 (1975); Kohler et al., Eur. J. Imm
unol. 6: 511 (1976); Kohler et al., Eur. J. Immun
ol. 6: 292 (1976); Hammerling et al .: Monoclona.
l Antibodies and T-Cell Hybridomas, E
Lsevier, N.M. Y. , Pp. 563-681 (1981)). In general, animals (
Preferably mice) are immunized with TR6-α and / or TR6-β polypeptides, or more preferably with secreted TR6-α and / or TR6-β polypeptide expressing cells. Such polypeptide-expressing cells are preferably supplemented with 10% fetal bovine serum (inactivated at about 56 ° C.) in any suitable tissue culture medium and contain about 10 g / l of non-essential amino acids, about 1. Cultured in Earle's modified Eagle's medium supplemented with 1,000 U / ml penicillin and about 100 μg / ml streptomycin.

The splenocytes of such mice are extracted and fused with the appropriate myeloma cell line. Any suitable myeloma cell line may be used in accordance with the present invention; however, AT
It is preferred to use the parental myeloma cell line (SP2O) available from CC. After fusion, the resulting hybridoma cells were selectively maintained in HAT medium and then Wands et al. (Gastroenterology 80: 225-232 (
Cloning by limiting dilution as described by 1981)). The hybridoma cells obtained by such selection are then assayed to identify clones secreting antibodies capable of binding the TR6-α and / or TR6-β polypeptides.

Alternatively, additional antibodies capable of binding to TR6-α and / or TR6-β polypeptides may be generated in a two step procedure using anti-idiotypic antibodies. Such a method takes advantage of the fact that the antibody itself is the antigen and therefore it is possible to obtain an antibody that binds to the second antibody. According to this method, protein-specific antibodies are used to immunize animals, preferably mice. The splenocytes of such animals are then used to produce hybridoma cells. The hybridoma cells are then screened to identify clones producing antibodies that may be blocked by TR6-α and / or TR6-β for their ability to bind to TR6-α and / or TR6-β protein-specific antibodies. It Such antibodies include anti-idiotypic antibodies to TR6-α and / or TR6-β protein-specific antibodies, and immunize animals to form additional TR6-α and / or TR6-β protein-specific antibodies. Used to guide.

For purposes of in vivo use of the antibody in humans, the antibody is "humanized." Such antibodies can be produced by using genetic constructs derived from hybridoma cells which produce the monoclonal antibodies described above. Methods for producing chimeric and humanized antibodies are known in the art and are discussed below (for a review, Morrison, Science 229: 1202 (1
985); Oi et al., BioTechniques 4: 214 (1986); C.
abilly et al., U.S. Pat. No. 4,816,567; Taniguchi et al., E.
P 171496; Morrison et al., EP 173494; Neuberg.
er et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312: 643 (1984); Neub.
Erger et al., Nature 314: 268 (1985)).

(B) Isolation of antibody fragments directed against TR6-α and / or TR6-β from a library of scFvs) The naturally occurring V gene isolated from human PBL was added to TR6-α. And / or is constructed into a library of antibody fragments containing reactivity to TR6-β polypeptides (the donor may or may not be exposed to them) (eg, US Pat. 885,793 (incorporated herein by reference in its entirety).

(Rescue of Library) PCT Publication WO 92/0
A library of scFv is constructed from human PBL RNA as described in 1047. To rescue the phage displaying the antibody fragment, about 10 ⁹ E. coli carrying the phagemid were rescued. 50 ml of 2 × TY (1%
Containing glucose and 100 μg / ml ampicillin) (2 × TY-A
MP-GLU) and 0.8 with shaking. D. Grow to. 5 ml of this culture was used to inoculate 50 ml of 2xTY-AMP-GLU,
2 × 10 ⁸ TU Δ gene 3 helper (M13 Δ gene III, PCT publication WO
92/01047) and the cultures are incubated for 45 minutes at 37 ° C. without shaking and then for 45 minutes at 37 ° C. with shaking. This culture was incubated for 10 minutes at 4000 rpm. p. m. Centrifuge at 2 ° C. and pellet 2 liters of 2 × TY (100 μg / ml ampicillin and 50 μg / ml).
(containing ml kanamycin) and grown overnight. Phages are prepared as described in PCT Publication WO 92/01047.

M13Δ gene III is prepared as follows: M13Δ gene III helper phage does not encode gene III protein. Therefore, phage displaying antibody fragments (phagemids) have greater binding avidity for antigen. During phage morphogenesis, infectious M13Δ gene III particles are made by growing helper phage in cells carrying the pUC19 derivative that supplies the wild-type gene III protein. The culture is incubated for 1 hour at 37 ° C without shaking and then for another hour at 37 ° C with shaking. Centrifuge the cells (IEC-Centra 8,400r
． p. m. For 10 minutes), 100 μg / ml ampicillin and 25 μg / ml
2xTY broth containing 2 ml of kanamycin (2xTY-AMP-KAN) 3
Resuspended in 00 ml and grown overnight at 37 ° C with shaking. Phage particles were purified and concentrated from the culture medium by two rounds of PEG precipitation (Sambrook et al., 1990), resuspended in 2 ml PBS, and passed through a 0.45 μm filter (Minisart NML; Sartorius), approximately 10 ^13. A final concentration of transducing units / ml (ampicillin resistant clones) is obtained.

[0608]   (Paning the library) Mainly released Immunotubes (Nunc)
4 ml of either 100 μg / ml or 10 μg / ml of light polypeptide
Coat overnight in PBS with. Replace the tube with 2% Marvel-PB
Block with S for 2 hours at 37 ° C., then wash 3 times in PBS. About 10 ¹³ Apply the TU phage to the tube and tumbl it up and down on a turntable.
While incubating for 30 minutes at room temperature, then leave it for another 1.5 hours.
Ku. Tubes 10 times with PBS 0.1% Tween-20 and 1 with PBS.
Wash 0 times. Add 1 ml of 100 mM triethylamine, and on a turntable
Elute the phage by spinning up and down for 15 minutes and then add this solution to 0
． Immediately neutralize with 5 ml of 1.0 M Tris-HCl, pH 7.4. Then
, Incubating the eluted phage with bacteria for 30 minutes at 37 ° C
From the phage, 10 ml of mid-logarithmic growth E. Feeling in coli TG1
To dye. Then E. E. coli with 1% glucose and 100 μg / ml amp
Plate on TYE plates containing picillin. Then obtained
The bacterial library was rescued with the Δ gene 3 helper phage as described above.
, Prepare phage for next round of selection. This process is then
Repeat for all 4 Nity purifications and repeat tube wash 3 and 4 times.
Increase to 20 times with PBS, 0.1% Tween-20, and 20 times with PBS
.

Binder Characterization Using phage eluted from the third and fourth rounds of selection, E. coli was used. E. coli HB 2151 and soluble scFv
Are generated from a single colony for assay (Marks et al., 1991). 5
ELISA is performed using microtiter plates coated with either 10 pg / ml of the polypeptide of the invention in 0 mM bicarbonate, pH 9.6. Positive clones in the ELISA are further characterized by PCR fingerprinting (see, eg, PCT Publication WO92 / 01047) followed by sequencing.

Example 12: Method for Determining Changes in the TNFR-6α and / or TNFR-6β Genes RNs from whole families or individual patients presenting with the phenotype of interest (eg, disease).
Isolate A. CDNA is then generated from these RNA samples using protocols known in the art (see Sambrook). Next, this cDNA was prepared by using a primer that surrounds the region of interest in SEQ ID NO: 1, P
Used as a template for CR. Suggested PCR conditions are Sidras
ky, D. Et al., Science 252: 706 (1991) using 95 ° C for 30 seconds; 52-58 ° C for 60-120 seconds; and 70 ° C.
35 cycles of 60 to 120 seconds.

Next, the PCR product was subjected to SequiTherm Polymerase (Epi
Sequencing is performed using a center technology and a primer labeled with T4 polynucleotide kinase at its 5'end. TN
The intron-exon boundaries of selected exons of FR-6α and / or TNFR-6β are also determined and genomic PCR products are analyzed to confirm the results. PCR products with suspicious mutations in TNFR-6α and / or TNFR-6β are then cloned and sequenced for direct sequencing.
Confirm the result of "sequencing".

PCR products of TNFR-6α and / or TNFR-6β were transferred to Holton.
, T. A. And Graham M .; W. , Nucleic Acids Re
search, 19: 1156 (1991) and cloned into a T-tail vector and labeled with T7 polymerase (United States Bioche).
sequence). Affected individuals, T not present in unaffected individuals
Identify by mutations in NFR-6α and / or TNFR-6β.

Genomic rearrangements are also observed as a way to determine changes in the TNFR-6α and / or TNFR-6β genes. Genomic clones isolated using techniques known in the art were nick translated using digoxigenin deoxy-uridine 5'-triphosphate (Boehringer Manheim), and Johnson et al., Methods Cell Biol. Three
5: Perform FISH as described in 73-99 (1991). TNFR-6α
And / or for specific hybridization of TNFR-6β to the genomic locus, a large excess of human cot-1 DNA is used to perform hybridization with the labeled probe.

Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium iodide, producing a combination of C and R bands. Aligned images for accurate mapping can be generated by triple band filter set (Chroma Tec).
hology, Brattleboro, VT) and cooled charge-coupled device camera (
Photometrics, Tucson, AZ) and tunable excitation wavelength filters (Johnson et al., Genet. Anal. Tech. Appl. 8:75).
(1991)) in combination with. ISee Graphical
Program System (Invision Corporation)
n, Durham, NC) using image collection, analysis and chromosomal fractionation (fr
agmental) Length measurement is performed. TNFR (hybridized probe)
Chromosomal changes in the genomic region of -6α and / or TNFR-6β are identified as insertions, deletions and translocations. These TNFR-6α and / or TNFR-
The 6β change is used as a diagnostic marker for related diseases.

Example 13: TNFR-6α and / or TNFR in Biological Samples
Methods for Detecting Abnormal Levels of -6β) TNFR-6α and / or TNFR-6β polypeptides can be detected in a biological sample, and elevated or decreased TNFR-6α and / or TNFR-6β can be detected. In some cases, the polypeptide is a marker of a particular phenotype. It will be appreciated that there are many detection methods and, therefore, one of skill in the art can modify the following assays to suit their particular needs.

For example, an antibody sandwich ELISA is used to detect TNFR-6α and / or TNFR-6β in a sample (preferably in a biological sample). Wells of a microtiter plate are filled with T at a final concentration of 0.2 to 10 μg / ml.
Coat with an antibody specific for NFR-6α and / or TNFR-6β. The antibody is either monoclonal or polyclonal and is produced by techniques known in the art. TNFR-6α and / or to wells
Alternatively, the wells are blocked to reduce non-specific binding of TNFR-6β.

The coated wells are then treated with TNFR-6α and / or TNFR-.
Incubate with sample containing 6β for more than 2 hours at room temperature. Preferably, serial dilutions of the sample should be used to confirm the results. The plate is then washed three times with deionized or distilled water to remove unbound TNFR-6α and / or
Alternatively, TNFR-6β is removed.

Next, 50 μl of the specific antibody-alkaline phosphatase conjugate was added to 25-400 n.
Add at a concentration of g and incubate at room temperature for 2 hours. The plate is washed again three times with deionized or distilled water to remove unbound conjugate.

75 μl of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate (NPP) substrate solution was added to each well and incubated for 1 hour at room temperature to allow cleavage of substrate and fluorescence. To do. This fluorescence is measured by a microtiter plate reader. A calibration curve is generated using experimental results from serial dilutions of control samples to plot sample concentration on the X-axis (log scale) and fluorescence or absorbance on the Y-axis (uniform scale). A standard curve is used to interpolate the concentration of polypeptide in the sample. Then TNFR-6α and / or in the sample
Alternatively, the concentration of TNFR-6β polypeptide is interpolated using a fluorescence-based calibration curve measured for this sample.

Example 14 Method of Treating Reduced Levels of TNFR-6α and / or TNFR-6β The present invention reduces the level of TNFR-6α and / or TNFR-6β biological activity in the body. A method for treating an individual in need thereof.
The method involves administering to such an individual a composition comprising a therapeutically effective amount of a TNFR-6α and / or TNFR-6β antagonist. Preferred antagonists for use in the present invention are TNFR-6α and / or TNFR
-6β specific antibody.

Furthermore, a condition caused by a reduction in normal or normal expression levels of TNFR-6α and / or TNFR-6β in an individual is TNFR-6α and / or TNFR-6β, preferably in soluble form and / or secreted. It is understood that it can be treated by administration in the form. Therefore, the present invention also includes T
Provided are methods of treating an individual in need of increased levels of NFR-6α and / or TNFR-6β polypeptide. This method is used for TNFR- in such individuals.
An amount of TNFR-6 that increases the activity level of 6α and / or TNFR-6β
Administering to such an individual a pharmaceutical composition comprising α and / or TNFR-6β.

For example, a patient with reduced levels of TNFR-6α and / or TNFR-6β polypeptide receives a daily dose of 0.1-100 μg / kg of polypeptide for 6 consecutive days. Preferably, the polypeptide is in soluble form and / or
Or in secretory form.

Example 15: Method of Treating Elevated Levels of TNFR-6α and / or TNFR-6β The present invention also provides TNFR-6α and / or TNFR-6β in the body.
A method for treating an individual in need of increased levels of biological activity, the method comprising the composition comprising a therapeutically effective amount of TNFR-6α and / or TNFR-6β or an agonist thereof. And the step of administering to.

Antisense technology is used to inhibit the production of TNFR-6α and / or TNFR-6β. This technique is based on TNFR-6α resulting from various etiologies such as cancer.
And / or is one example of a method of reducing the level of TNFR-6β polypeptide (preferably soluble and / or secreted form).

For example, in patients diagnosed with abnormally elevated levels of TNFR-6α and / or TNFR-6β, antisense polynucleotides were administered at 0.5, 1.0,
Doses are administered intravenously at 1.5, 2.0 and 3.0 mg / kg / day for 21 days. If determined to be well tolerated, the treatment is repeated after a 7 day washout period. Formulations of antisense polynucleotides are provided in Example 10.

Example 16 Treatment Methods Using Gene Therapy—Ex Vivo One method of gene therapy is fibroblasts that may express soluble and / or mature TNFR-6α and / or TNFR-6β polypeptides. Transplant cells into the patient. Generally, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue culture medium and divided into small pieces. A blob of tissue is placed on the wet surface of the tissue culture flask and approximately 10 pieces are placed in each flask. The flask is inverted, closed tightly, and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted, the tissue mass remains fixed at the bottom of the flask, and fresh medium (eg,
Ham's F containing 10% FBS, penicillin and streptomycin
12 medium). The flask is then incubated at 37 ° C for approximately 1 week.

At this point, fresh medium is added and then replaced every few days. After culturing for another two weeks, a monolayer of fibroblasts appears. Trypsinize the monolayer and scale up to a larger flask.

Moloney murine sarcoma virus pMV-7 (Kirsc) flanked by long terminal repeats.
hmeier, P.M. T. Et al., DNA, 7: 219-25 (1988)).
After digestion with RI and HindIII, it is treated with calf intestinal phosphatase.
The linear vector is fractionated on an agarose gel and purified using glass beads.

The cDNA encoding TNFR-6α and / or TNFR-6β was converted to 5 ′.
And can be amplified using PCR primers corresponding to the 3'end coding sequence, respectively. Preferably, the 5'primer contains an EcoRI site and the 3'primer contains a HindIII site. Equal amounts of Moloney murine sarcoma virus linear backbone and amplified EcoRI and HindIII fragments were added to T4D.
Add together in the presence of NA ligase. The resulting mixture is maintained under conditions suitable for ligating the two fragments. The ligation mixture is then used to transform E. col
iHB101 is transformed. It is then plated on agar containing kanamycin to ensure that the vector contains the properly inserted TNFR-6α and / or TNFR-6β.

Amphotropic pA317 or GP + am12 packaging cells were
Dulb containing 0% calf serum (CS), penicillin and streptomycin
Grow to confluent density in tissue culture in ecco modified Eagle medium (DMEM). The MSV vector containing the TNFR-6α and / or TNFR-6β gene is then added to the medium and the packaging cells are transduced with the vector. At this time, the packaging cells are TNFR-6α and / or TN.
Produces infectious viral particles containing the FR-6β gene (herein, the packaging cells are referred to as producer cells).

Fresh medium is added to the transduced producer cells and the medium is then harvested from a 10 cm plate of confluent producer cells. The spent medium containing infectious viral particles is filtered through a millipore filter to remove detached producer cells, which is then used to infect fibroblasts. Media is removed from subconfluent plates of fibroblasts and producer cells are quickly replaced with media. This medium is removed and replaced with fresh medium. If the virus titer is high, virtually all fibroblasts will be infected and no selection is required. If the titer is very low, it is necessary to use a retroviral vector with a selectable marker such as neo or his. Once the fibroblasts are efficiently infected, the fibroblasts are analyzed to determine if TNFR-6α and / or TNFR-6β proteins are being produced.

Next, engineered fibroblasts were used alone or in cytodex 3 (cyto).
dex 3) Transfer to a host either after being grown to confluence on microcarrier beads.

Example 17: Method of Treatment Using Gene Therapy-In Vivo Another aspect of the invention is the use of in vivo gene therapy methods to treat disorders, diseases and conditions. This gene therapy method is used to increase or decrease the expression of TNFR-6α and / or TNFR-6β polypeptides by allowing naked nucleic acid (DNA, RNA, and antisense DNA or RNA) T to animals.
It concerns the introduction of NFR-6α and / or TNFR-6β sequences. TNFR-6
The α and / or TNFR-6β polynucleotide may be operably linked to a promoter, or any other genetic element required for expression of the TNFR-6α and / or TNFR-6β polypeptide by the target tissue. Techniques and methods for such gene therapy and delivery are known in the art, eg, International Application Publication No. WO 90/11092, International Application Publication No. WO 98/11779.
U.S. Pat. Nos. 5,693,622, 5,705,151, 5,580,859; Tabata H .; Et al., Cardiovasc. Res. 35: 470-47
9 (1997); Chao J. et al. Et al., Pharmacol. Res. 35:51
7-522 (1997); Wolff J. et al. A. , Neuromuscul. D
isord. 7: 314-318 (1997), Schwartz B. G
ene Ther. 3: 405-411 (1996); Tsurumi Y. et al. See Circulation 94: 3281-3290 (1996), which is incorporated herein by reference.

The TNFR-6α and / or TNFR-6β polynucleotide constructs may be delivered by any method that delivers an injectable substance to cells of an animal, such as tissue (heart, muscle,
Injection into the interstitial space (skin, lungs, liver, intestine, etc.)). TNF
The R-6α and / or TNFR-6β polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

The term "naked" polynucleotide, DNA or RNA refers to any delivery vehicle (viral sequence, viral particle, liposomal formulation, lipofectin, or lipofectin that acts to help, facilitate, or facilitate entry into cells. (Including a precipitating agent) is not included. However, TNFR-6α and / or TNFR-6
Beta polynucleotides can also be prepared in liposomal formulations (eg, Felgner PL, et al. (1995) Ann. NY A) which can be prepared by methods well known to those of skill in the art.
cad. Sci. 772: 126-139 and Abdaleh B .; Et al (1
995) Biol. Cell 85 (1): 1-7)).

TNFR-6α and / or TNF used in this gene therapy method
The R-6β polynucleotide vector construct is preferably one that does not integrate into the host genome and does not contain sequences that allow replication. Any strong promoter known to those of skill in the art can be used to drive the expression of DNA. Unlike other gene therapy techniques, one major advantage of introducing a naked nucleic acid sequence into a target cell is the transient nature of polynucleotide synthesis in that cell. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide for production of the desired polypeptide for periods of up to 6 months.

The TNFR-6α and / or TNFR-6β polynucleotide constructs are used in tissue (muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, in animals). Kidney, gallbladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system,
(Including the eye, gland, and connective tissue). The interstitial spaces of this tissue are intercellular fluid, mucopolysaccharide matrix (reticulo-fibrils of organ tissue, blood vessel or chamber (ch
amber) between the elastic fibers in the wall, between the collagen fibers in the fibrous tissue), or in the connective tissue overlying muscle cells or in the lacunae of the bone. This is likewise the space occupied by circulating plasma and lymphatic fluid of the lymphatic channels. Delivery of muscle tissue to the interstitial space is preferred for the reasons discussed below. They can be conveniently delivered by injection into the tissue containing these cells. They are preferably delivered to and expressed in differentiated, persistent, non-dividing cells, which delivery and expression can be effected on undifferentiated cells or cells that are not fully differentiated (eg, blood stem cells). Or skin fibroblasts). In vivo, muscle cells are particularly qualified for their ability to take up and express polynucleotides.

For naked TNFR-6α and / or TNFR-6β polynucleotide injections, an effective dosage of DNA or RNA is from about 0.05 g / kg body weight to about 50 g / kg.
It is in the range of mg / kg body weight. Preferably, this dosage is about 0.005 mg /
kg to about 20 mg / kg, and more preferably about 0.05 mg / k
g to about 5 mg / kg. Of course, as the skilled artisan will appreciate, this dosage will vary according to the tissue site of injection. Suitable and effective dosages of nucleic acid sequences can be readily determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, including, for example, inhalation of aerosol formulations, especially for delivery to the lungs or bronchial tissues, throat, or mucous membranes of the nose. In addition, naked TNFR-6α and / or TNFR-6β polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in this procedure.

Injected TNFR-6α and / or TNFR in muscle in vivo
The dose response effect of -6β polynucleotide is determined as follows. TNF
Suitable TNFR-6α and / or TNFR-6β template DNA for the production of mRNA encoding R-6α and / or TNFR-6β polypeptide,
Prepared according to standard recombinant DNA methodology. Template DNA, which can be either circular or linear, is either used as naked DNA or complexed with liposomes. Mice are then injected into the quadriceps with various amounts of template DNA.

To 5-6 week old female and male Balb / C mice, 0.3 ml of 2.5%
Anesthetize by intraperitoneal injection of Avertin. A 1.5 cm incision is made in the anterior thigh and the quadriceps are visualized directly. TNFR-6α and / or T
NFR-6β template DNA was added to 0.1 ml of carrier, and 2 cc with 1 cc syringe.
Inject into the knee about 0.5 cm from the distal insertion site of the muscle through a 7 gauge needle into the knee at a depth of about 0.2 cm. A suture is made over the injection site for future localization and the skin is closed with a stainless steel clip.

After a suitable incubation time (eg 7 days), muscle extracts are prepared by cutting out whole quads. Every fifth 15 μm section of an individual quadriceps is histochemically stained for TNFR-6α and / or TNFR-6β protein expression. The time course for TNFR-6α and / or TNFR-6β protein expression can be done in a similar fashion, except that four animals from different mice are harvested at different times. Persistence of TNFR-6α and / or TNFR-6β DNA in muscle after injection may be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. . The results of the above experiments in mice show that TNFR-6α and / or
Alternatively, TNFR-6β naked DNA can be used to extrapolate appropriate dosages and other treatment parameters in humans and other animals.

Example 18: Rescue of ischemia in rabbit lower limb model To study the in vivo effect of TNFR-6α and / or TNFRβ on ischemia, a rabbit hindlimb ischemia model was previously described (Takeshita, S
． Am J. et al. Pathol 147: 1649-1660 (1995)) by surgical removal of one femoral artery. Resection of the femoral artery results in retrograde propagation of thrombus and occlusion of the external iliac artery. Therefore, blood flow to the ischemic limb depends on collateral vessels originating from the internal iliac artery (Takeshita, S. et al., Am J.
． Pathol 147: 1649-1660 (1995)). The 10 day interval allows post-surgical recovery of rabbits and development of endogenous collateral vessels. Surgery (
After baseline angiography on day 10), the internal iliac arteries of the ischemic limb were treated with 500 mg of naked TNFR-6α and / or TNFRβ expression plasmids (Riessen, R .; Et al., Hum Gene Ther. 4: 749.
-758 (1993); Leclerc, G .; Et al., J. Clin. Invest
． 90: 936-944 (1992)) by the arterial gene transfer technique using a hydrogel-coated balloon catheter.
When used for treatment, a single bolus of 500 mg of protein or control is delivered through the infusion catheter into the internal iliac artery of the ischemic limb over a period of 1 minute. On day 30, various parameters are measured in these rabbits: (a
) BP ratio-ratio of ischemic limb systolic blood pressure to normal limb systolic blood pressure; Blood flow during sexual status, which is also an indirect measure of vascular volume, as well as regurgitation are reflected in the ratio of maximal FL: arrest FL; (c) Angiographic score-this is collateral vessel. Measure by contrast. The score is displayed in an overlay grid (overlayin
(g grid) determined by the percentage of circles (using transverse opacified arteries divided by the total number m of rabbit thighs); (d) Capillary density-number of collateral capillaries obtained by light microscopy from hind limbs. Determined in sections.

The studies described in this example test the activity of the TNFR-6 protein. However, one of ordinary skill in the art will readily be able to perform the illustrated studies to test the activity of TNFR-6α and / or TNFRβ (eg, gene therapy), the activity of TNFR-6α and / or TNFRβ agonists, and / or antagonists. Can be modified to

Example 19 Diabetic Mice and Glucocorticoid Impaired Wound Healing Model A. Diabetic db + / db + Mouse Model To demonstrate that TNFR-6 promotes the healing process, A genetically diabetic mouse model is used. Full layer (f in db + / db + mice
The full thickness wound healing model is a well characterized, clinically relevant and reproducible model of impaired wound healing. Healing of diabetic wounds depends on granulation tissue formation and re-epithelialization rather than contraction (
Gartner et al. Surg. Res. 52: 389 (1992); Gre.
enhalgh et al., Am. J. Pathol. 136: 1235 (1990))
.

This diabetic animal has many of the characteristic properties observed in type II diabetes mellitus. Homozygous (db + / db +) mice have their normal heterozygous (
db + / + m) obese compared to littermates. Mutant diabetes (db + / db +)
Mice carry a single autosomal recessive mutation (db +) on chromosome 4 (C
oleman et al., Proc. Natl. Acad. Sci. USA 77:28
3-293 (1982)). Animals exhibit polyphagia, polydipsia, and polyuria. Mutant diabetic mice (db + / db +) have elevated blood glucose, increased or normal insulin levels, and suppressed cell-mediated immunity (Mandel et al.,
J. Immunol. 120: 1375 (1978); Debray-Sach.
s et al., Clin. Exp. Immunol. 51 (1): 1-7 (1983);
Leiter et al., Am. J. of Pathol. 114: 46-55 (198
5)). Peripheral neuropathy, myocardial complications, and microvascular lesions, basement membrane thickening, and glomerular filtration abnormalities have been described in these animals (Norido, F. et al.
Et al., Exp. Neurol. 83 (2): 221-232 (1984); Rob.
ertson et al., Diabetes 29 (1): 60-67 (1980); G.
iacomelli et al., Lab Invest. 40 (4): 460-473 (
1979); Coleman, D .; L. Diabetes 31 (Addendum): 1-
6 (1982)). These homozygous diabetic mice develop hyperglycemia, which is resistant to insulin, similar to human type II diabetes (Mandel).
Et al., J. Immunol. 120: 1375-1377 (1978)).

The characteristics observed in these animals suggest that the healing in this model may be similar to that observed in human diabetes (Greenhalg.
h et al., Am. J. of Pathol. 136: 1235-1246 (1990)
)).

Genetically diabetic female C57BL / KsJ (db + / db +) mice and their non-diabetic (db + / + m) heterozygous littermates (Jackson Lab).
oratories) were used for this study. These animals are purchased at 6 weeks of age. The study will start at 8 weeks of age. Animals are housed individually and given food and water ad libitum. All operations are performed using aseptic technique. This experiment, Human Ge
nome Sciences, Inc. Institutional Ani
mal Care and Use Committee and the G
uidelines for the Care and Use of La
Follow the Animal Health rules and guidelines.

The wound protocol is performed according to previously reported methods (Tsuboi and Rifkin, J. Exp. Med. 172: 245-251 (1990)).
Briefly, on the day of wounding, animals were treated with avertin (Ave) dissolved in deionized water.
anesthetized with an intraperitoneal injection of rtin) (0.01 mg / mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol. The dorsal area of the animal is shaved and the skin is washed with 70% ethanol solution and iodine. The surgical area is dried with sterile gauze before wounding. An 8 mm full thickness wound was then placed on the Keye.
s Fabricated using a tissue punch. Immediately after wounding, the surrounding skin is gently stretched to eliminate wound extension. The left side of this wound is opened during the experiment. The application of treatment is given topically for 5 consecutive days from the day of wounding. Prior to treatment, the wound is gently washed with sterile saline and gauze sponge.

Wounds are visually inspected and photographed at regular distances on the day of surgery and at 2 day intervals thereafter. Wound closure is determined by daily measurements on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a Calibrated Jameson caliper. A wound is considered healed when granulation tissue is no longer visible and the wound is covered by continuous epithelium.

TNFR-6α and / or TNFRβ were dosed in vehicle for 8 days at different dose ranges of TNFR-6 protein (4 mg to 500 mg per wound per day).
) Is used for administration. The vehicle control group received 50 mL of vehicle solution.

Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wound and surrounding skin are then collected for histology and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered formalin in a tissue cassette between biopsy sponges for further processing.

Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls) are evaluated: 1) vehicle placebo control, 2) TNFR-6α and / or TNFRβ.

Wound closure is analyzed by measuring the area on the horizontal and vertical axes and obtaining the total area of the wound squares. Contraction is then assessed by establishing the difference between the area of the initial wound (day 0) and the area after treatment (day 8). This wound area on day 1 is 64 mm ² (size corresponding to the skin punch). Calculations are performed using the following formula: [Open area on day 8]-[Open area on day 1] / [Open area on day 1] Specimens are fixed in 10% buffered formalin and paraffin. The embedded mass is cut perpendicular to the wound surface (5 mm) and cut using a Reichert-Jung microtome. Routine hematoxylin-eosin (H & E) staining is performed on bisected wound sections. Histological examination of wounds is used to assess whether the healing process and morphological appearance of repaired skin was altered by treatment with TNFR-6. This evaluation includes verification of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, re-epithelialization, and epidermal maturation (Greenhalg.
h, D. G. Et al., Am. J. Pathol. 136: 1235 (1990)).
A blinded observer using a graduated lens micrometer.
ver) used.

Tissue sections are also immunohistochemically stained with a polyclonal rabbit anti-human keratin antibody using the ABC Elite detection system. Human skin is used as a positive tissue control, while non-immune IgG is used as a negative control. Keratinocyte proliferation is determined by assessing the extent of wound re-epithelialization using a calibrated lens micrometer.

Proliferating Cell Nuclear Antigen / Cyclin (PCNA) in Skin Specimens was Modified with ABC El
Demonstrate by using anti-PCNA antibody (1:50) with the ite detection system. Human colon cancer can serve as a positive tissue control, and human brain tissue can be used as a negative tissue control. Each specimen contains a section with elimination of primary antibody and replacement with non-immune mouse IgG. The rank of these sections is based on the extent of proliferation on a scale of 0-8 (lower scale reflecting slight proliferation to higher side reflecting vigorous proliferation).

Experimental data are analyzed using a one-tailed t-test. A p-value of <0.05 is considered significant.

B. Steroid-Injurious Rat Model Inhibition of wound healing by steroids has been well documented in various in vitro and in vivo systems (Wahl, SM, Glucocorticoi).
ds and Wound healing: Anti-Inflammato
ry Steroid Action: Basic and Clinical
Aspects. 280-302 (1989); Wahl, S .; M. Et al., J.
Immunol. 115: 476-481 (1975); Werb, Z .; Et al, J
． Exp. Med. 147: 1684-1694 (1978)). Glucocorticoids inhibit angiogenesis, vascular permeability (Ebert, RH et al., A.
n. Intern. Med. 37: 701-705 (1952)), fibroblast proliferation, and collagen synthesis (Beck, LS et al., Grows Facto.
rs. 5: 295-304 (1991); Haynes, B .; F. Et al., J. Cl
in. Invest. 61: 703-797 (1978)),
And causing a transient decrease in circulating monocytes (Haynes, BF, et al., J. Clin. Invest. 61: 703-797 (1978); Wahl.
, S. M. "Glucocorticoids and wound heal
ing ": Antiflammery Steroid Action
: Basic and Clinical Aspects, Academic
Wound healing is delayed by Press, New York, 280-302 (1989)). Systemic administration of steroids for impaired wound healing is a well-established phenomenon in rats (Beck, LS et al., Growth).
Factors. 5: 295-304 (1991); Haynes, B .; F.
Et al., J. Clin. Invest. 61: 703-797 (1978); Wah.
l, S. M. , "Glucocorticoids and wound he
"aling": Antiflammery Steroid Acti
on: Basic and Clinical Aspects, Academ
ic Press, New York, 280-302 (1989); Pie.
rce et al., Proc. Natl. Acad. Sci. USA 86: 2229-.
2233 (1989)).

To demonstrate whether TNFR-6α and / or TNFRβ could promote the healing process, TNFR-for full-thickness cutaneous wounds in rats, where healing was impaired by systemic administration of methylprednisolone. Evaluate the effects of multiple topical applications of 6.

Young adult male Sprague Dawley rats (weight 250-300 g)
) (Charles River Laboratories) is used for this experiment. The animals are purchased at 8 weeks of age. The start of the study is 9 weeks of age. The healing response of the rat was determined by systemic administration of methylprednisolone (17 mg / k
g / rat, intramuscular). Animals are housed individually and given food and water ad libitum. All operations are performed using aseptic technique. This research, Huma
n Genome Sciences, Inc. Institutional
Animal Care and Use Committee and t
he Guidelines for the Care and Use o
f Follow the rules and guidelines of Laboratory Animals.

The wound protocol follows Section A above. On the day of wounding, animals are treated with ketamine (50
(mg / kg) and xylazine (5 mg / kg) intramuscularly. The dorsal area of the animal is shaved and the skin is washed with 70% ethanol and iodine solution. The surgical area is dried with sterile gauze before wounding. 8 mm full thickness wounds are created using a Keyes tissue punch. The left side of the wound is opened during the experiment. Starting from the day of wounding and subsequent administration of methylmethylprednisolone, the test substance application is given topically once a day for 7 consecutive days. Prior to treatment, the wound is gently washed with sterile saline and gauze sponge.

Wounds are visually inspected and photographed at a fixed distance on the day of wounding and at the end of treatment. Wound closure is determined by daily measurements on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a Calibrated Jameson caliper. A wound is considered healed when granulation tissue is no longer visible and the wound is covered by continuous epithelium.

TNFR-6α and / or TNFRβ are administered in the vehicle for 8 days with different dose ranges (4 mg to 500 mg per wound per day) of TNFR-6 protein. The vehicle control group received 50 mL of vehicle solution.

Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wound and surrounding skin are then collected for histology. Tissue specimens are placed in 10% neutral buffered formalin in a tissue cassette between biopsy sponges for further processing.

Four groups of 10 animals each (5 with methylmethylprednisolone and 5 without glucocorticoid) are evaluated: 1) untreated group, 2) vehicle placebo control, and 3) TNFR. -6 treatment groups.

Wound closure is analyzed by measuring the area on the vertical and horizontal axes and obtaining the total area of the wound. Closure is then assessed by establishing the difference between the area of the initial wound (day 0) and the area after treatment (day 8). This wound area on day 1 is 64 mm ² (size corresponding to the skin punch). Calculations are performed using the following formula: [Open Area on Day 8]-[Open Area on Day 1] / [Open Area on Day 1] Specimens are fixed in 10% buffered formalin and paraffin. The embedded mass is cut perpendicular to the wound surface (5 mm) and cut using an Olympus microtome. Routine hematoxylin-eosin (H & E) staining is performed on bisected wound sections. Histological examination of wounds makes it possible to evaluate whether the healing process and the morphological appearance of the repaired skin have been improved by treatment with TNFR-6α and / or TNFRβ. A graduated lens observer is used by a blinded observer to determine the gap distance of the wound.

Experimental data are analyzed using a one-tailed t-test. A p-value of <0.05 is considered significant.

The studies described in this example test the activity of the TNFR-6 protein. However, one of ordinary skill in the art could easily modify the illustrated studies to include TNFR-6α and
/ Or TNFRβ polynucleotide (eg, gene therapy), TNFR-6
The activity of α and / or TNFRβ agonists and / or antagonists may be tested.

Example 20: Lymphedema Animal Model The purpose of this experimental approach was to identify lymphangiogenesis (lymph) in the rat hind limb.
to develop a suitable and consistent model of lymphedema for testing therapeutic efficacy in re-establishing the circulatory system of the lymphoid system. Efficacy is measured by swelling volume of the affected limb, lymphatic vasculature, quantification of the amount of total plasma proteins, and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more importantly, the chronic progression of edema lasts up to 3-4 weeks.

Prior to beginning surgery, blood samples are drawn for protein concentration analysis.
Male rats (weighing approximately 350 g) are dosed with pentobarbital. Then, the right limb is shaved from the knee to the hip joint. Wipe the shaved area with gauze soaked in 70% EtOH. Blood is drawn for serum total protein testing. After measuring the circumference and volume, mark two measurement levels (0.5 cm above the heel, midpoint of the back of the foot) and then inject the dye into the foot. The endothelium of both right and left dorsal foot is injected with 0.05 ml of 1% Evan's Blue. Then, after the dye is injected into the paw, circumference measurement and volume measurement are performed.

Using the knee joint as a landmark, an incision in the groin of the middle limb is made in a ring so that the position of the femoral vessel can be confirmed. The flaps are dissected and separated using forceps and hemostats. After locating the femoral vessel, the lymphatic vessels that run alongside and below the vessel are located. The major lymphatic vessels in this area are then attached to the electrocoagulated suture ligature (el
electrical suture ligation).

Using a microscope, the muscles of the back of the limb (semitendinosis)
And around the adductor muscle). The location of the popliteal lymph nodes is then confirmed. The two proximal lymphatic vessels and two distal lymphatic vessels as well as the distal blood supply of the popliteal node are ligated with sutures. The popliteal lymph nodes and any associated adipose tissue are then removed by cutting connective tissue.

Take care to manage any mild bleeding that occurs with this procedure. After occlusion of lymphatic vessels, flaps are placed on the liquid skin (Vetbond) (AJ Buck).
Seal by using. Separate skin edges are sealed to the underlying muscle tissue leaving a gap of about 0.5 cm around the leg. The skin may also be anchored by suturing to the underlying muscle when needed.

Animals are housed individually with mesh (no bedding) to avoid infection. Recovered animals are checked daily through the optimal edema peak. This peak typically occurs up to 5-7 days. The plateau edema peak is then observed. To assess the intensity of lymphedema, the circumference and volume of two designated locations on each limb are measured before the procedure and daily for 7 days. The effect of plasma proteins on lymphedema is determined, and it is also investigated whether protein analysis is a useful test perimeter. The weights of both control and edematous limbs are evaluated at two points. Analysis is performed in a blind manner.

Circumference measurement: Under short-term gas anesthesia to prevent limb movement, measure the limb circumference using a cloth tape measure. Measurements are made on the talar and dorsal paw by two different persons and then these two readings are averaged. Readings are taken from both control and edematous limbs.

Volumetric: On the day of surgery, animals are anesthetized with pentobarbital and tested prior to surgery. For daily volume measurements, animals are placed under short-term halothane anesthesia (rapid immobilization and quick recovery), both legs shaved, and the legs marked equally with water-resistant markers. The legs are first soaked in water, then soaked in the device to each significant level, then Buxco hydrops software (Chen / Victo
r). The data is recorded by one person, while the other is soaked in the marked area of the leg.

Blood-Plasma Protein Measurements: Blood is drawn prior to surgery, centrifuged, and serum separated, then the total protein and Ca 2+ comparisons are concluded.

Limb Weight Comparison: After blood is drawn, the animals are prepared for tissue collection.
The limb is cut with a quillitine, then both the experimental and control legs are ligated and cut and weighed. A second weighing is performed by removing the tibio-cakaneal joint and weighing the foot.

Histological preparation: The transverse muscle located behind the knee (popliteal) area was excised and placed in a metal mold, filled with freezeGel, soaked in cold methylbutane and -80 ° C until cut into labeled sample bags. Place at. Upon cutting, the muscle is observed under the fluorescent microscope for lymphatic vessels. Other immunological / histological methods are currently under evaluation.

The studies described in this example test the activity of the TNFR-6 protein. However, one of ordinary skill in the art could easily modify the illustrated studies to include TNFR-6α and
/ Or TNFRβ polynucleotide (eg, gene therapy), TNFR-6
The activity of α and / or TNFRβ agonists and / or antagonists may be tested.

It will be appreciated that the present invention may be practiced other than as described in detail in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings, and are therefore within the scope of the appended claims.

Example 21: TNFR-6α-Fc Inhibits FasL-Mediated Toxicity in a ConA Mouse Model of Liver Injury Intravenous Administration of Concanavalin A to Mice Activates T Lymphocytes and Liver Induces both apoptotic and necrotic cell death of cells. This mimics the pathophysiology of active chronic hepatitis (Tiegs et al., J.
． Clin. Invest. 90: 196. (1992)). The Fas-Fc protein, a dimeric form of Fas predicted to inhibit Fas ligand activity, reduces liver damage in this model via inhibitors of Fas ligand demonstrating involvement in the Fas pathway in pathology. (Ksontini et al., J. Immunol .; 60 (8): 4082-408).
9 (1998)).

(Confirmation of model :) To confirm the ConA mouse model, ConA was added to Balb / c mice,
ConA at doses of 15, 15 and 20 mg / kg were administered iv with 97.5 μg / mouse placebo or Fas-Fc. 10 Balb / C
Mice were used per treatment group. Mice were sacrificed 22 hours after treatment, serum was collected, and biochemical analysis was performed on the Clinical Chemistry Anal.
yzer ILAB900 (Instrumentation Laboratory)
ory) to determine the levels of liver-specific transaminase, alanine aminotransferase (ALT) and aspartate aminotransferase (AST), which are released into serum during liver injury. (Tiegs et al., J. Clin. Invest. 90: 196. (1992).
)). Administration of FasFc at a dose of 97.5 μg / mouse (approximately 5 mg / kg) significantly inhibited elevated liver enzymes at ConA doses of 10 and 15 mg / kg, but not at 20 mg / kg ConA. (Data not shown) was found. Thus, the model was confirmed.

Balb / C mice were treated with three log doses of TNFR6-Fc (0.6, 6, 60).
ConA (15 mg / kg) was injected iv with or without μg / mouse). The TNFR6-Fc fusion protein used in this example was a full-length TNFR6-α polypeptide sequence (amino acids 1 to 1 of SEQ ID NO: 2 fused to an Fc domain.
300). Ten Balb / c mice were used per treatment group. The mice were sacrificed 22 hours after treatment and serum levels of ALT and AST were adjusted to Clinical Chemistry Analyzer ILAB9.
00 (Instrumentation Laboratory). Administration of TNFR6-Fc resulted in both ALT and AST levels
The highest dose tested (60 μg / mouse, 3 mg / kg) significantly inhibited by 50% (data not shown). Thus, TNFR6-Fc significantly reduced serum ConA-induced AST and ALT in a dose response manner.

Effect of TNFR6-Fc on ConA-induced Apoptotic Events in Liver Elevation in serum liver enzyme levels reflects both apoptotic and non-apoptotic pathways of hepatocyte destruction, and thus is more critical in the extent of liver injury. The decision is
It can be guided through direct measurement of apoptotic events. Therefore, apoptosis
Analysis was performed using whole hepatocyte suspensions isolated from mice treated with NFR6-Fc and ConA. Three independent markers of apoptosis were evaluated in the same sample. These include changes in surface expression of phosphatidylserine, measurement of DNA damage, and caspase activation.

Balb / C mice received three log doses of TNFR6-Fc (0.6,6,6).
ConA (15 mg / kg) was injected intravenously with or without 0 μg / mouse). Cell suspensions were isolated from 3 mice / group and hepatocytes 70 μm
Separated by placing intact liver tissue on a cell strainer and using a 5 cc syringe stopper with RPMI 1640/10% FBS.
). The filtered cell suspension was overlaid on lymphocyte separation medium (density 1.0770 g / ml) to remove red blood cells and large debris of tissue debris. The interface layer was collected, washed, and cells were counted. Prior to FACS analysis, the cell suspension was
It was re-filtered with a μm filter.

For measurement of Annexin V binding (an indicator of apoptosis), cells were treated with fluorochrome-conjugated monoclonal antibodies CD45CyChrome and B220 or anti-TCRβPE (Pharmingen, San Die).
go, CA). Bind the cells to a binding buffer (bindin
g buffer) (Pharmingen), then Annexin V
Incubated with FITC (Pharmingen). The stained cells were treated with Becton Dickinson FACScan (Becton Di
Ckinson, San Jose, CA) was used for capture and analysis. CD
Only 45 positive events were collected. Cells that stain brightly for B220 and Annexin V are considered apoptotic B cells; anti-TCRβ and anti-annexin V.
Cells that stained brightly for were considered apoptotic T cells.

The level of DNA degradation (another characteristic of apoptosis) was measured using the TdT enzyme according to the manufacturer's instructions, Apo-DIRECT kit (Pharmingen).
This degradation is measured by adding FITC-labeled dUTP to the 3'end of nicked DNA using a terminal UTP nick-end label (Terminal UTP
Nick-end labeling) (TUNEL). Briefly, cells were fixed in 1% paraformaldehyde, washed with PBS, then fixed in ice cold 70% ethanol. Cells are washed twice with wash buffer, then TdT
Incubated with enzyme-containing staining solution and dUTP-FITC for 1 hour at 37 ° C. Cells were washed twice with a rinsing buffer, resuspended in propidium iodide solution and captured on a FACScan. For analysis, an electronic gate was set to a singlet event and cells that stained bright for dUTP-FITC were considered apoptotic cells.

To determine the presence of the active form of caspase 3 (an early indicator of apoptosis), cells were treated with IC FIX (BioSource International,
(Camarillo, CA), washed twice with PBS, then permeabilized using IC PERM (BioSource). Cell, IC
Incubated with 5 μg rabbit anti-caspase-3PE (Pharmingen) in PERM, washed with IC PERM and then twice with PBS. Cells were captured with FACScan and analyzed for mean fluorescence of PE.

For all three indicators of apoptosis, TNFR6-Fc inhibited mouse liver apoptosis when compared to mice treated with ConA alone (
Table VI). Using DNA damage as a marker and TUNEL analysis, TR6
A dose-dependent trend of inhibition with Fc was observed. These data support a role for TNFR6-Fc in inhibiting ConA-induced hepatitis apoptosis.

[0690]

[Table 13] ^One hepatocyte suspension was analyzed for apoptosis using one of three independent measurements. DNA degradation was measured using TUNEL staining; caspase activation by analysis of the active form of caspase-3; and annexin V staining of surface membrane alterations. Cell suspensions were isolated from livers of 3 mice / group and pooled. Each analysis was performed using the pooled suspension obtained. For Annexin-V staining, liver CD45 + cells only, costaining for B220 or TcRβ (costai).
n) The cells were subjected to capture and Annexin-V staining evaluation.

Conclusion: The finding that TNFR6-FC reduced both ConA-induced serum AST and ALT levels as well as ConA-induced hepatocyte apoptosis was found in the TNFR6-α polypeptides and TNFR- of the present invention. It supports the therapeutic application of β polypeptides for the treatment and / or prevention of hepatitis and other forms of liver damage.

The entire disclosure of all publications (including patents, patent applications, scholarly literature, laboratory manuals, books or other documents) is hereby incorporated by reference.

[0693]

[Table 14] (Canada) The applicant must be the Commissioner of the Patent Office until a Canadian patent is issued based on the application or the application is refused or abandoned and cannot be recovered or withdrawn. Requesting that only an independent expert nominated by the grant of a sample of the deposited biological material referred to in the application be filed by the applicant under the rules for publication of an international application. Prior to the completion of the preparations of 1), this must be notified in writing to the International Bureau.

(Norway) Applicants hereby agree that the application of samples shall be deemed to be until the application has been published (by the Norwegian Patent Office) or determined by the Norwegian Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be made by the applicant to the Norwegian Patent Office before the time when the application is made publicly available under section 22 and section 33 (3) of the Norwegian Patent Act. If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts prepared by the Norwegian Patent Office (list of
any of those listed in "recognized experts", or
It can be any person approved by the applicant in the individual case.

(Australia) Applicant hereby states that donation of a sample of microorganisms is
Alternatively, before the abandonment, rejection or withdrawal of the application, a person who is a person skilled in the art who has no interest in the invention (skilled addre)
It is to be announced that it will only be performed for Ssee) (Australian Patent Law No. 3.25 (3)).

(Finland) The applicant hereby states that the application is (Patent and Control Committee (National
That samples will only be provided to experts in the art until published (by Board of Patents and Regulations) or until a decision by the National Patent and Legal Commission is made without publication. ,Claim.

(UK) Applicant hereby claims that the provision of a sample of microorganisms is made available only to professionals. A request to this effect must be made by the applicant to the International Bureau before the regulatory preparations for the international publication of the application are complete.

(Denmark) Applicants hereby agree that the application of samples shall be deemed to be until the application has been published (by the Danish Patent Office) or has been decided by the Danish Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be filed by the applicant with the Danish Patent Office before the time when the application is made publicly available under Articles 22 and 33 (3) of the Danish Patent Act. If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts prepared by the Danish Patent Office (list of).
any of those listed in "recognized experts", or
It can be any person approved by the applicant in the individual case.

(Sweden) Applicants hereby advise that the application of samples shall be prioritized in the art until the application has been published (by the Swedish Patent Office) or has been decided by the Swedish Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be filed by the applicant with the International Bureau not later than 16 months from the priority date (preferably PCT Applicant's Gui).
Form PCT / RO / 13 described in Annex Z of Volume I of de
4). If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts (lis) prepared by the Swedish Patent Office.
any of the persons listed in to of recognized experts),
Alternatively, it may be any person approved by the applicant in the individual case.

(Netherlands) Applicants hereby agree that until the date of issue of the Dutch patent, or until the date when the application is rejected, withdrawn or abandoned (lapped), microorganisms are specialized under the provisions of Patent Act 31F (1). Claim that it will only be done in the form of sample delivery to the house. A request for this shall be made by the applicant before the Dutch industrial property right before the date on which the application is made publicly available under Article 22C or Article 25 of the Dutch Patent Act, whichever is earlier. It shall be submitted to the Bureau.

[0701]

[Table 15] (Canada) The applicant must be the Commissioner of the Patent Office until a Canadian patent is issued based on the application or the application is refused or abandoned and cannot be recovered or withdrawn. Requesting that only an independent expert nominated by the grant of a sample of the deposited biological material referred to in the application be filed by the applicant under the rules for publication of an international application. Prior to the completion of the preparations of 1), this must be notified in writing to the International Bureau.

(Norway) Applicants hereby agree that the application of samples shall be deemed to be until the application has been published (by the Norwegian Patent Office) or has not been published and has been decided by the Norwegian Patent Office. Claim that it will only be done to the house. A request to this effect shall be made by the applicant to the Norwegian Patent Office before the time when the application is made publicly available under section 22 and section 33 (3) of the Norwegian Patent Act. If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts prepared by the Norwegian Patent Office (list of
any of those listed in "recognized experts", or
It can be any person approved by the applicant in the individual case.

(Australia) Applicant hereby states that donation of a sample of microorganisms is
Alternatively, before the abandonment, rejection or withdrawal of the application, a person who is a person skilled in the art who has no interest in the invention (skilled addre)
It is to be announced that it will only be performed for Ssee) (Australian Patent Law No. 3.25 (3)).

(Finland) The applicant hereby states that the application (Patent and Control Committee (National
That samples will only be provided to experts in the art until published (by Board of Patents and Regulations) or until a decision by the National Patent and Legal Commission is made without publication. ,Claim.

(UK) Applicant hereby claims that the provision of a sample of microorganisms is made available only to professionals. A request to this effect must be made by the applicant to the International Bureau before the regulatory preparations for the international publication of the application are complete.

(Denmark) Applicants hereby agree that the application of samples shall be deemed to be until the application has been published (by the Danish Patent Office) or has been decided by the Danish Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be filed by the applicant with the Danish Patent Office before the time when the application is made publicly available under Articles 22 and 33 (3) of the Danish Patent Act. If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts prepared by the Danish Patent Office (list of).
any of those listed in "recognized experts", or
It can be any person approved by the applicant in the individual case.

(Sweden) Applicants hereby agree that the application of samples shall be deemed to be technical expertise until the application has been published (by the Swedish Patent Office) or determined by the Swedish Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be filed by the applicant with the International Bureau not later than 16 months from the priority date (preferably PCT Applicant's Gui).
Form PCT / RO / 13 described in Annex Z of Volume I of de
4). If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts (lis) prepared by the Swedish Patent Office.
any of the persons listed in to of recognized experts),
Alternatively, it may be any person approved by the applicant in the individual case.

(Netherlands) Applicants hereby agree that until the issue date of the Dutch patent, or until the date when the application is rejected, withdrawn or lapped, the microorganism is specialized under the provisions of Patent Act 31F (1). Claim that it will only be done in the form of sample delivery to the house. A request for this shall be made by the applicant before the Dutch industrial property right before the date on which the application is made publicly available under Article 22C or Article 25 of the Dutch Patent Act, whichever is earlier. It shall be submitted to the Bureau.

[Sequence list]

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of TNFR-6α. The first 30 amino acids (underlined) is a putative leader sequence.

FIG. 2 shows the nucleotide sequence (SEQ ID NO: 3) and deduced amino acid sequence (SEQ ID NO: 4) of TNFR-6β. The first 30 amino acids (underlined) is a putative leader sequence.

FIG. 3. Cl using the Megaline program in DNAstar Soot.
Figure 3 shows an alignment made by the custom method, which shows TNFR-6.
α (“TNFR-6α” (SEQ ID NO: 2)) and TNFR-6β (“TNFR-
6β ”(SEQ ID NO: 4)) and other TNF receptors (for example: TNFR1
(SEQ ID NO: 5); TNFR2 (SEQ ID NO: 6); NGFR (SEQ ID NO: 7); LTb
R (SEQ ID NO: 8); FAS (SEQ ID NO: 9); CD27 (SEQ ID NO: 10); CD3
0 (SEQ ID NO: 11); CD40 (SEQ ID NO: 12); 4-lBB (SEQ ID NO: 13)
OX40 (SEQ ID NO: 14); VC22 (SEQ ID NO: 15); and CRMB (SEQ ID NO: 16)).

FIG. 4 and FIG. 5 show separate analyzes of TNFR-6α and TNFR-6β amino acid sequences, respectively. α and β turn and coil regions; hydrophilic; amphipathic region; flexible region; antigenic index
ex) and surface probabilities are shown as expected from the amino acid sequences of SEQ ID NO: 2 and SEQ ID NO: 4, respectively, using the default parameters of the computer programs cited. In the "antigenicity index-Jameson-Wolf" graph, TNFR-6
The locations of the highly antigenic regions of α and TNFR-6β are indicated, ie from which the regions of the epitope-bearing peptides of the invention can be derived. TNFR-6α antigenic regions include those of SEQ ID NO: 2: approximately Ala-31 to approximately T.
hr-46, approximately Phe-57 to approximately Thr-117, approximately Cys
-132 to about Thr-175, about Gly-185 to about Thr
-194, approximately Val-205 to approximately Asp-217, approximately Pro
-239 to approximately Leu-264, and approximately Ala-283 to approximately Pro-298. The antigenic region of TNFR-6β includes the following of SEQ ID NO: 4: approximately Ala-31 to approximately Thr-46, approximately Phe-57 to.
About Gln-80, about Glu-86 to about His-106, about Thr-108 to about Phe-119, about His-129 to about Val-138, and about Gly-142 to about Pro-16.
6. These polypeptide fragments were determined to carry the antigenic epitopes of the TNFR-6α and TNFR-6β polypeptides by analysis of the Jameson-Wolf antigenic index. The data shown in Figures 4 and 5 are also presented in tabular form in Tables I and II, respectively. This column has the headings "Res" and "Position"
And Roman numerals I-XIV. The heading for this column refers to the following features of the amino acid sequence shown in Figure 4 (Table I) and Figure 5 (Table II): "Res".
: Amino acid residue of SEQ ID NO: 2 (FIG. 1) or SEQ ID NO: 4 (FIG. 2); “position”: position of the corresponding residue in SEQ ID NO: 2 (FIG. 1) or SEQ ID NO: 4 (FIG. 2); I: α
Region (Alpha, Regions) -Garnier-Robson; II:
α region (Alpha, Regions) -Chou-Fasman; III: β
Region (Beta, Regions) -Garnier-Robson; IV: β
Region (Beta, Regions) -Chou-Fasman; V: Turn region (Turn, Regions) -Gannier-Robson; VI: Turn region (Turn, Regions) -Chou-Fasman; VII: Coil region (Coil, Regions) -Garn. -Robson; VIII
: Hydrophilicity Plot-Kyte-D
ool; IX: Hydrophobicity P (Hydrophobicity P)
lot) -Hopp-Woods; X: α amphipathic region (Alpha, Amph)
IPS: Eisenberg; XI: β amphipathic region (Beta, Amphipathic Regions) -Eisenberg
g; XII: Flexible Regions-Kar
plus-Schulz; XIII: Antigenicity index (Antigenic)
Index) -Jameson-Wolf; and XIV: Surface Probability Plot-Emini.

FIG. 4 and FIG. 5 show separate analyzes of TNFR-6α and TNFR-6β amino acid sequences, respectively. α and β turn and coil regions; hydrophilic; amphipathic region; flexible region; antigenic index
ex) and surface probabilities are shown as expected from the amino acid sequences of SEQ ID NO: 2 and SEQ ID NO: 4, respectively, using the default parameters of the computer programs cited. In the "antigenicity index-Jameson-Wolf" graph, TNFR-6
The locations of the highly antigenic regions of α and TNFR-6β are indicated, ie from which the regions of the epitope-bearing peptides of the invention can be derived. TNFR-6α antigenic regions include those of SEQ ID NO: 2: approximately Ala-31 to approximately T.
hr-46, approximately Phe-57 to approximately Thr-117, approximately Cys
-132 to about Thr-175, about Gly-185 to about Thr
-194, approximately Val-205 to approximately Asp-217, approximately Pro
-239 to approximately Leu-264, and approximately Ala-283 to approximately Pro-298. The antigenic region of TNFR-6β includes the following of SEQ ID NO: 4: approximately Ala-31 to approximately Thr-46, approximately Phe-57 to.
About Gln-80, about Glu-86 to about His-106, about Thr-108 to about Phe-119, about His-129 to about Val-138, and about Gly-142 to about Pro-16.
6. These polypeptide fragments were determined to carry the antigenic epitopes of the TNFR-6α and TNFR-6β polypeptides by analysis of the Jameson-Wolf antigenic index. The data shown in Figures 4 and 5 are also presented in tabular form in Tables I and II, respectively. This column has the headings "Res" and "Position"
And Roman numerals I-XIV. The heading for this column refers to the following features of the amino acid sequence shown in Figure 4 (Table I) and Figure 5 (Table II): "Res".
: Amino acid residue of SEQ ID NO: 2 (FIG. 1) or SEQ ID NO: 4 (FIG. 2); “position”: position of the corresponding residue in SEQ ID NO: 2 (FIG. 1) or SEQ ID NO: 4 (FIG. 2); I: α
Region (Alpha, Regions) -Garnier-Robson; II:
α region (Alpha, Regions) -Chou-Fasman; III: β
Region (Beta, Regions) -Garnier-Robson; IV: β
Region (Beta, Regions) -Chou-Fasman; V: Turn region (Turn, Regions) -Gannier-Robson; VI: Turn region (Turn, Regions) -Chou-Fasman; VII: Coil region (Coil, Regions) -Garn. -Robson; VIII
: Hydrophilicity Plot-Kyte-D
ool; IX: Hydrophobicity P (Hydrophobicity P)
lot) -Hopp-Woods; X: α amphipathic region (Alpha, Amph)
IPS: Eisenberg; XI: β amphipathic region (Beta, Amphipathic Regions) -Eisenberg
g; XII: Flexible Regions-Kar
plus-Schulz; XIII: Antigenicity index (Antigenic)
Index) -Jameson-Wolf; and XIV: Surface Probability Plot-Emini.

FIG. 6 shows the nucleotide sequences of HELDI06R (SEQ ID NO: 17) and HCEOW38R (SEQ ID NO: 18) related to SEQ ID NOS: 1 and 3.

7A-B show inhibition of Fas ligand-mediated cell death of TNFR-6α. J
Urkat T cells were treated with a combination of Fas ligand and TNFR-6αFc receptor for 16 hours. To measure the level of viable cells after treatment, cells were incubated with 10% ALOMER blue for 5 hours and OD 57.
It was examined spectrophotometrically from 0 nm to 630 nm. All samples were tested in triplicate.
TNFR6α-Fc appears to inhibit Fas ligand-mediated apoptosis of Jurkar cells as effectively as Fas ligand in a dose-dependent manner.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 39/395 A61P 1/00 4C087 48/00 1/04 4H045 A61P 1/00 1/16 1/04 3 / 10 1/16 5/14 3/10 7/06 5/14 9/00 7/06 9/02 9/00 9/04 9/02 9/06 9/04 9/08 9/06 9/10 9/08 103 9/10 9/12 103 9/14 9/12 13/12 9/14 19/08 13/12 19/10 19/08 25/00 19/10 25/16 25/00 25/28 25/16 27/02 25/28 29/00 101 27/02 31/04 29/00 101 31/12 31/04 31/18 31/12 35/00 31/18 35/02 35/00 37/02 35/02 37/06 37/02 43/00 107 37/06 C07K 14/715 43/00 107 16/28 C07K 14/715 C12N 1/15 16/28 1/19 C12N 1/15 1/21 1 / 19 C12P 21/02 C 1/21 A61K 35/76 5/10 C12R 1:91 C12P 21/02 C12N 15/00 ZNAA // A61K 35/76 A61K 37/02 ( 12P 21/02 C12N 5/00 A C12R 1:91) (31) Priority claim number 60 / 131,279 (32) Priority date April 27, 1999 (April 27, 1999) (33) Priority right Claiming country United States (US) (31) Priority claim number 60 / 131,964 (32) Priority date April 30, 1999 (April 30, 1999) (33) Priority claiming country United States (US) (31 ) Priority claim number 60 / 146,371 (32) Priority date August 2, 1999 (August 2, 1999) (33) Priority claim country United States (US) (31) Priority claim number 60/168 , 235 (32) Priority date December 1, 1999 (December 1, 1999) (33) Priority claiming country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK) , ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR , NE, SN, TD, TG), A (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH , GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN , YU, ZA, ZW (72) Inventor Genz, Rainer El. United States Maryland 20850, Rockville, Mount Prospect Drive 13608 (72) Inventor Ni, Gian United States Maryland 20853, Rockville, Manorfield Road 5502 (72) Inventor Ebner, Rainhard United States Maryland 20878, Gaithersburg , No. 16, Sherburn Terrace 9906 (72) Inventor Yu, Guo Lian United States California 94705, Berkeley, Gravatt Drive 242 (72) Inventor Reuben, Stephen M. United States Maryland 20832, Ornay, Heritage Hills Drive 18528 (72) Inventor Fen, Pin United States Maryland 01876, Gaithersburg, Lerda Court 4 F Term (reference) 4B024 AA01 BA63 CA04 DA02 DA03 DA06 EA04 GA11 GA13 HA17 4B064 AG20 CA02 CA10 CC24 DA01 4B065 AA26X AA90X AA90Y AA91X AB01 AC14 BA02 BA05 CA14 CA24 4C084 AA02 AA06 AA07 AA13 BA01 BA02 BA08 BA22 BA23 CA53 CA56 DA53 NA14 ZA51 ZA45 ZA45 ZA45 ZA45 ZA45 ZA45 ZA38 ZA38 ZA38 ZA38 ZA41 ZA38 ZA38 ZA41 ZB07 ZB08 ZB15 ZB21 ZB26 ZB27 ZB33 ZB35 ZC06 ZC35 ZC55 4C085 AA13 AA14 BB01 BB11 DD61 DD62 DD63 EE01 4C AZA01 AA02 AA03 BC83 NA45 ZA ZA ZA ZA ZA ZA ZA ZA ZA ZA ZA ZB26 ZB27 ZB33 ZB35 ZC35 ZC55 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA50 DA75 EA20 EA28 EA29 FA72 FA73 FA74

Claims (23)

[Claims] 1. An isolated nucleic acid molecule having the following: (a) having the complete amino acid sequence of SEQ ID NO: 2 or 4, or ATCC.
A nucleotide sequence encoding a TNFR polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in Deposit No. 78810 or 97809; (b) the amino acid sequence at positions 31-300 or 31-170 of SEQ ID NO: 2 or 4; Have respectively or ATCC Deposit No. 97810 or 9780
Mature T having the amino acid sequence encoded by the cDNA clone contained in 9
A nucleotide sequence encoding an NFR polypeptide; (c) a nucleotide sequence encoding a soluble extracellular domain of a TNFR polypeptide having the amino acid sequence at positions 31-283 or 31-166 of SEQ ID NOs: 2 and 4, respectively; and (d) 80%, 85%, 90%, or 95% of a sequence selected from the group consisting of a nucleotide sequence complementary to any of the nucleotide sequences of (a), (b), or (c) above. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is identical. 2. The nucleic acid molecule of claim 1, wherein the polynucleotide has a complete nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 3. 3. The nucleic acid molecule of claim 1, wherein the polynucleotide has a nucleotide sequence that encodes a TNFR polypeptide having a complete amino acid sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 4. 4. The T having the amino acid sequence of about 31 to about 300 of SEQ ID NO: 2 or the amino acid sequence of about 31 to about 170 of SEQ ID NO: 4.
The nucleic acid molecule of claim 1, having a nucleotide sequence encoding the mature form of the NFR polypeptide. 5. The T having the amino acid sequence of about 31 to about 283 of SEQ ID NO: 2 or the amino acid sequence of about 31 to about 166 of SEQ ID NO: 4.
The nucleic acid molecule according to claim 1, having a nucleotide sequence encoding the soluble extracellular domain of an NFR polypeptide. 6. An isolated nucleic acid molecule, which comprises: (a) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of residues m to 300 of SEQ ID NO: 2, where n is Is an integer in the range of 1 to 49,
A nucleotide sequence; (b) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of residues n to 170 of SEQ ID NO: 4, where n is an integer in the range 1 to 49,
(C) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of residues 1 to y of SEQ ID NO: 2, where y is an integer in the range 193 to 300; d) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of residues 1 to z of SEQ ID NO: 4, where z is an integer in the range 132 to 170; and (e) m , N, y, and z are (a), (b), (c), and (d) above.
), Residues m to y of SEQ ID NO: 2 or residues n of SEQ ID NO: 4.
A nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of z, comprising a polynucleotide having a nucleotide sequence that is at least 80%, 85%, 90%, or 95% identical to a sequence selected from the group consisting of , An isolated nucleic acid molecule. 7. An isolated nucleic acid molecule, wherein: (a) a nucleotide encoding a polypeptide consisting of a portion of the complete TNFR amino acid sequence encoded by the cDNA clone contained in ATCC Deposit Nos. 97810 and 97809. The sequence, wherein said portion is ATCC Deposit No. 9781.
0 and 97809, the nucleotide sequence excluding amino acids 1 to about 48 from the amino terminus of the complete amino acid sequence encoded by the cDNA clone; (b) encoded by the cDNA clone contained in ATCC Deposit Nos. 78810 or 97809. A nucleotide sequence encoding a polypeptide consisting of a portion of the complete TNFR amino acid sequence, said portion comprising ATCC Deposit No. 9781.
0 and 97809 from the carboxy terminus of the complete amino acid sequence encoded by the cDNA clone contained in 0 and 97809, respectively.
A nucleotide sequence excluding about 38 amino acids; and (c) a nucleotide sequence encoding a polypeptide consisting of a portion of the complete TNFR amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 78810 or 97809. , The portion is the same as the above (a) and (b)
A nucleotide sequence comprising any combination of amino-terminal deletions and carboxy-terminal deletions for each clone of, at least 80%, 85%, 90%, or 95% identical to a sequence selected from the group consisting of An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is 8. The nucleic acid molecule of claim 1, wherein said polynucleotide has the complete nucleotide sequence of a cDNA clone contained in ATCC Deposit No. 97810 or 97809. 9. The nucleic acid molecule of claim 1, wherein the polynucleotide has a nucleotide sequence that encodes a TNFR polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97810 or 97809. 10. The nucleic acid molecule of claim 1, wherein the polynucleotide has a nucleotide sequence that encodes a mature TNFR polypeptide having an amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97810 or 97809. 11. An isolated nucleic acid molecule, the nucleotide sequence being identical to the nucleotide sequence of (a), (b), (c), or (d) of claim 1. To a polynucleotide having a nucleotide sequence consisting of only A residues or only T residues, which is stringent to the polynucleotide having a nucleotide sequence consisting of only A residues. A nucleic acid molecule that does not hybridize under hybridization conditions. 12. An isolated nucleic acid molecule (a) according to claim 1,
A nucleic acid molecule comprising a polynucleotide encoding the amino acid sequence of the epitope-bearing portion of a TNFR polypeptide having the amino acid sequence of (b), (c), or (d). 13. The isolated nucleic acid molecule of claim 12, wherein the nucleic acid molecule is: about Ala-31 to about Thr-46 of SEQ ID NO: 2, about Phe-57 of SEQ ID NO: 2. ~
About Thr-117, about Cys-132 to about Thr-175 of SEQ ID NO: 2, about Gly-185 to about Thr-194 of SEQ ID NO: 2, about Val-205 of SEQ ID NO: 2.
About Asp-217, about Pro-239 to Leu-264 of SEQ ID NO: 2, and about Ala-283 to about Pro-298 of SEQ ID NO: 2, about Ala-31 of SEQ ID NO: 4.
To about Thr-46, Phe-57 to about Gln-80 of SEQ ID NO: 4, about Glu-86 to about His-106 of SEQ ID NO: 4, about Thr-108 to about Phe of SEQ ID NO: 4.
-119, about His-129 to about Val-138 of SEQ ID NO: 4, about Gly-142 to about Pro-166 of SEQ ID NO: 4, an epitope-bearing portion of a TNFR polypeptide comprising an amino acid residue selected from the group consisting of: A nucleic acid molecule that encodes. 14. A method for producing a recombinant vector comprising the step of inserting the isolated nucleic acid molecule of claim 1 into a vector. 15. A recombinant vector produced by the method of claim 14. 16. A method for producing a recombinant host cell, which comprises the step of introducing the recombinant vector according to claim 15 into a host cell. 17. A recombinant host cell produced by the method of claim 16. 18. A recombinant method for producing a TNFR polypeptide, wherein the recombinant host cell of claim 17 is cultured under conditions such that the polypeptide is expressed, and the polypeptide A method comprising the step of recovering a peptide. 19. An isolated TNFR polypeptide, which has the following: (a) having the complete amino acid sequence set forth in SEQ ID NO: 2 or 4, or encoded by a cDNA clone contained in ATCC Deposit No. 97810 or 97809. (B) having the amino acid sequence of positions 31-300 of SEQ ID NO: 2 or 31-170 of SEQ ID NO: 4, or ATCC deposit no.97810 or 97809.
Mature TN having an amino acid sequence encoded by the cDNA clone contained in
Or (c) having the amino acid sequence of positions 31-283 of SEQ ID NO: 2, or 31-166 of SEQ ID NO: 4, or ATCC Deposit No. 97810 or 97809.
Having an amino acid sequence encoded by the cDNA clone contained in
Amino acid sequence of the soluble extracellular domain of the polypeptide, wherein the polypeptide comprises an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to a sequence selected from the group consisting of: 20. An isolated polypeptide, wherein the polypeptide is T
A polypeptide comprising an epitope-bearing portion of an NFR protein, which portion comprises the following amino acid residues: about Ala-31 to about Thr-46 of SEQ ID NO: 2, about Phe-57 of SEQ ID NO: 2.
About Thr-117, about Cys-132 to about Thr-175 of SEQ ID NO: 2, about Gly-185 to about Thr-194 of SEQ ID NO: 2, about Val-205 of SEQ ID NO: 2.
About Asp-217, about Pro-239 to Leu-264 of SEQ ID NO: 2, and about Ala-283 to about Pro-298 of SEQ ID NO: 2, about Ala-31 of SEQ ID NO: 4.
~ About Thr-46, about Phe-57 to about Gln-80 of SEQ ID NO: 4, SEQ ID NO: 4
About Glu-86 to about His-106, about Thr-108 to about Ph of SEQ ID NO: 4.
e-119, about His-129 to about Val-138 of SEQ ID NO: 4, about Gly-142 to about Pro-166 of SEQ ID NO: 4, a polypeptide selected from the group consisting of: 21. An isolated antibody that specifically binds to the TNFR polypeptide of claim 19. 22. A method of treating a patient in need of TNFR polypeptide activity comprising the step of administering to the patient the TNFR polypeptide of claim 19. 23. A step of administering the nucleic acid according to claim 1 to a patient.
A method of treating a patient in need of TNFR polypeptide activity.